Microorganism having increased activity of lipoate protein ligase, and use thereof

By genetically modifying a microorganism with a Bacillus subtilis-derived lipoate protein ligase, the production of pantothenic acid and/or pantoic acid is enhanced, addressing the inefficiencies of chemical synthesis and ensuring the desired stereoisomeric form is produced.

WO2025244453A1PCT designated stage Publication Date: 2025-11-27CJ CHEILJEDANG CORP
View PDF 11 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2025/007006
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-05-24
Filing Date
2025-05-23
Publication Date
2025-11-27

AI Technical Summary

Technical Problem

There is a need for a microorganism with enhanced lipoate protein ligase activity to efficiently produce pantothenic acid and/or pantoic acid biotechnologically, as chemical synthesis methods may not yield the desired stereoisomeric D-form effectively.

Method used

A microorganism is engineered with an introduced lipoate protein ligase, derived from Bacillus subtilis, to enhance its activity, which is then cultured to produce pantothenic acid and/or pantoic acid, utilizing recombinant vectors and genetic modification techniques.

Benefits of technology

The enhanced lipoate protein ligase activity in the microorganism leads to improved production efficiency of pantothenic acid and/or pantoic acid, overcoming limitations of chemical synthesis and ensuring the formation of the desired stereoisomeric form.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The present disclosure provides a microorganism with increased activity of lipoate protein ligase, a composition for producing pantothenic acid and / or pantoic acid comprising the microorganism, and a method for producing pantothenic acid and / or pantoic acid comprising a step of culturing the microorganism, wherein the microorganism has excellent pantothenic acid and / or pantoic acid producing ability.
Need to check novelty before this filing date? Find Prior Art

Description

Microorganisms with enhanced lipoate protein ligase activity and uses thereof

[0001] Provided are a microorganism having enhanced lipoate protein ligase activity, a composition for producing pantothenic acid and / or pantoic acid comprising the microorganism, and a method for producing pantothenic acid and / or pantoic acid comprising a step of culturing the microorganism.

[0002] Cross-citation with related application(s)

[0003] This disclosure claims the benefit of priority to Republic of Korea Patent Application No. 10-2024-0067864, filed May 24, 2024, the entire contents of which are incorporated herein by reference.

[0004]

[0005] Pantothenic acid, also known as vitamin B5, is a member of the vitamin B complex and is a commercially important substance with diverse applications in cosmetics, medicine, human nutrition, and animal nutrition. Pantothenic acid is composed of pantoic acid and beta-alanine linked by an amide bond.

[0006] Pantothenic acid or pantoic acid can be produced chemically, synthetically, or biotechnologically by fermenting suitable microorganisms in a suitable medium. The advantage of biotechnological production methods using microorganisms is that the desired stereoisomeric D-form of pantothenic acid or pantoic acid is formed.

[0007] Accordingly, there is a need for the development of a microorganism having a beneficial effect in biotechnologically producing pantothenic acid and / or pantoic acid and a technology for producing pantothenic acid and / or pantoic acid with high efficiency using the same.

[0008]

[0009] [Patent Document]

[0010] (Patent Document 1) U.S. Patent No. 7718205

[0011]

[0012] An example of the present disclosure provides a microorganism producing pantothenic acid or pantoic acid, having enhanced activity of lipoate protein ligase.

[0013] Another example of the present disclosure provides a composition for producing pantothenic acid or pantoic acid comprising the microorganism.

[0014] Another example of the present disclosure provides a use of the microorganism for producing pantothenic acid or pantoic acid.

[0015] Another example of the present disclosure provides the use of the microorganism for the preparation of a composition for producing pantothenic acid or pantoic acid.

[0016] Another example of the present disclosure provides a method for producing pantothenic acid or pantoic acid, comprising the step of culturing the microorganism in a medium.

[0017]

[0018] One aspect provides a microorganism producing pantothenic acid or pantoic acid having enhanced activity of lipoate protein ligase.

[0019]

[0020] The above lipoate protein ligase (or Lipoate protein ligase A) may be an enzyme that catalyzes a process of converting and activating ATP and lipoic acid into lipoyl-AMP and transferring lipoyl to the lipoyl domain of a lipoate-dependent enzyme. The lipoate protein ligase may refer to a lipoate protein ligase protein, a lipoate protein ligase polypeptide, or a protein having lipoate protein ligase activity. The lipoate protein ligase is known in the art, and may be, but is not limited to, the LplA protein encoded by the lplA gene.

[0021] The microorganism producing pantothenic acid or pantoic acid with enhanced activity of the above lipoate protein ligase may be a microorganism into which a lipoate protein ligase or a polynucleotide encoding the same has been introduced. The lipoate protein ligase may be an endogenous protein of the microorganism to be introduced or an exogenous protein.

[0022] In one example, the lipoate protein ligase may comprise or consist of an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% homology or identity to the amino acid sequence of SEQ ID NO: 1. In addition, a variant of the lipoate protein ligase having an amino acid sequence in which a portion of the sequence is deleted, modified, substituted, conservatively substituted, or added may also be included in the lipoate protein ligase, as long as the protein has such homology or identity and exhibits lipoate protein ligase activity. For example, if the amino acid sequence has sequence additions or deletions that do not alter lipoate protein ligase activity, naturally occurring mutations, silent mutations or conservative substitutions at the N-terminus, C-terminus and / or within the amino acid sequence.

[0023] The term "conservative substitution" refers to the replacement of one amino acid with another amino acid having similar structural and / or chemical properties. Such amino acid substitutions may generally be based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues. Typically, conservative substitutions may have little or no effect on the activity of a protein or polypeptide.

[0024]

[0025] In the present specification, introduction of a foreign protein or a polynucleotide encoding the same into a host cell (microorganism) may mean introduction of a protein or a polynucleotide encoding the same derived from a cell belonging to a different genus from the host cell, a cell belonging to a different species, or another cell of the same species into the host cell.

[0026] In one example, the lipoate protein ligase and / or the polynucleotide encoding it may be derived from, but is not limited to, a microorganism of the genus Bacillus.

[0027] The lipoate protein ligase derived from a microorganism of the genus Bacillus and / or a polynucleotide encoding the same may be derived from a microorganism selected from the group consisting of Bacillus subtilis, Bacillus amyloliquefaciens, Bacillus methylotrophicus, Bacillus licheniformis, Bacillus velezensis, Bacillus sonorensis and Bacillus valismortis, but is not limited thereto. In one example, the foreign lipoate protein ligase and / or a polynucleotide encoding the same may be derived from Bacillus subtilis. The sequence of the lipoate protein ligase derived from Bacillus subtilis can be obtained from the NCBI, a publicly known database.

[0028]

[0029] In one example, the lipoate protein ligase derived from Bacillus subtilis may have, comprise, consist of, or consist essentially of the amino acid sequence of SEQ ID NO: 1.

[0030] The polynucleotide encoding the above lipoate protein ligase may refer to a gene encoding the above lipoate protein ligase.

[0031] The polynucleotide encoding the lipoate protein ligase derived from the above Bacillus subtilis may be derived from Bacillus subtilis, but is not limited thereto, and may be prepared based on the amino acid sequence of the lipoate protein ligase derived from the above Bacillus subtilis, with reference to a known codon table.

[0032] In one example, the polynucleotide encoding the lipoate protein ligase from Bacillus subtilis can have, comprise, consist of, or consist essentially of the nucleic acid sequence of SEQ ID NO: 5.

[0033] In one example, the polynucleotide encoding the lipoate protein ligase may comprise or consist of a nucleic acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% homology or identity to the nucleic acid sequence of SEQ ID NO: 5.

[0034]

[0035] In one example, a microorganism producing pantothenic acid or pantoic acid with enhanced activity of lipoate protein ligase may be a microorganism into which a lipoate protein ligase derived from Bacillus subtilis or a polynucleotide encoding the same has been introduced.

[0036] The above lipoate protein ligase can be introduced into a microorganism using a recombinant vector. The recombinant vector can be used as an insertion vector or an expression vector. Expression of the lipoate protein ligase in a microorganism can be performed by culturing a recombinant cell (e.g., a microorganism) containing a lipoate protein ligase gene, a polynucleotide encoding the lipoate protein ligase, or a recombinant vector containing the same.

[0037] The introduction of a polynucleotide or recombinant vector encoding the lipoate protein ligase into a microorganism can be performed by a person skilled in the art by appropriately selecting a known transformation method. As used herein, the term "transformation" refers to changing the genetic characteristics of a host cell by introducing a vector containing a target polynucleotide into the host cell. The transformed polynucleotide may be inserted and located within the chromosome of the host cell or may be located extrachromosomally. As long as the polynucleotide can be introduced into the host cell and expressed, there is no limitation on the form in which it is introduced. For example, the polynucleotide may be introduced into the host cell in the form of an expression cassette, which is a genetic construct containing all elements necessary for autonomous expression. The expression cassette may typically include expression control elements such as a promoter, a transcription termination signal, a ribosome binding site, and / or a translation termination signal that are operably linked to the polynucleotide. The expression cassette may be in the form of an expression vector capable of autonomous replication. Additionally, the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence necessary for expression in the host cell. The term "operably linked" as used herein may mean that the polynucleotide is functionally linked to an expression control element (e.g., a promoter) so that transcriptional regulation (e.g., transcription initiation) of the polynucleotide can be performed. Operable linkage can be performed using genetic recombination techniques known in the art.

[0038] The method of transforming the above polynucleotide into a host cell can be performed by any method of introducing a nucleic acid into a cell (microorganism), and can be performed by appropriately selecting a transformation technique known in the art depending on the host cell. Examples of the known transformation methods include, but are not limited to, electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) precipitation, DEAE-dextran, cationic liposome, lipofection, and lithium acetate-DMSO.

[0039] As used herein, the term "vector" refers to a DNA construct for delivering a target polynucleotide into a suitable host or host cell. For example, the vector may comprise a base sequence of a polynucleotide operably linked to a suitable regulatory sequence so as to enable expression of the target polynucleotide in a suitable host. The regulatory sequence may include a promoter capable of initiating transcription, an optional operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and / or a sequence for regulating the termination of transcription and / or translation. After being transformed into a suitable host cell, the vector may replicate or function independently of the genome of the host cell, or may be replicated or function by integrating into the genome itself.

[0040] The vector usable in this specification is not particularly limited as long as it is replicable in a host cell, and may be selected from all commonly used vectors. Examples of commonly used vectors include plasmids, cosmids, viruses, bacteriophages, etc. in a natural or recombinant state. For example, as the vector, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A, etc. can be used as a phage vector or a cosmid vector, and pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series, etc. can be used as a plasmid vector. Specifically, examples include, but are not limited to, pDZ, pDC, pDCM2, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, and pCC1BAC vectors.

[0041] The above vector may further include a selection marker to determine whether the vector has been transformed into a host cell or further, whether the vector has been integrated into the host cell chromosome. The selection marker is used to select cells transformed with the vector or to determine whether the target polynucleotide has been integrated into the chromosome. Markers that confer selectable phenotypes such as drug resistance, nutritional requirements, cytotoxic agent resistance, or expression of surface proteins may be used. In an environment treated with a selective agent, only cells expressing the selection marker will survive or exhibit other phenotypic characteristics, thereby enabling selection of transformed cells.

[0042]

[0043] In the present disclosure, the phrase “a polynucleotide or polypeptide has, includes, consists of, or consists essentially of a specific nucleic acid sequence (base sequence) or amino acid sequence” may mean that the polynucleotide or polypeptide essentially includes the specific nucleic acid sequence (base sequence) or amino acid sequence, and may be interpreted as including (or not excluding) a “substantially equivalent sequence” in which a mutation (deletion, substitution, modification, and / or addition) is added to the specific nucleic acid sequence (base sequence) or amino acid sequence to the extent that the original function and / or desired function of the polynucleotide or polypeptide is maintained. In one example, a polynucleotide or polypeptide “has, includes, consists of, or consists essentially of a particular nucleic acid sequence (base sequence) or amino acid sequence” may mean that the polynucleotide or polypeptide (i) essentially includes the particular nucleic acid sequence (base sequence) or amino acid sequence, or (ii) consists of or essentially includes a nucleic acid sequence or amino acid sequence that has at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98%, at least 99%, at least 99.5%, or at least 99.9% homology or identity with the particular nucleic acid sequence (base sequence) or amino acid sequence, and maintains its original function and / or desired function. In one example, the desired function may mean a function of increasing (improving) or imparting pantothenic acid and / or pantoic acid production ability of a microorganism.

[0044] In this disclosure, 'homology' or 'identity' refers to the degree of similarity between two given amino acid sequences or base sequences, which may be expressed as a percentage. The terms homology and identity are often used interchangeably.

[0045] Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard alignment algorithms, and may be combined with default gap penalties established by the program being used. In practice, homologous or identical sequences can generally hybridize with all or part of the sequence under moderate or high stringency conditions. It should be appreciated that hybridization also includes hybridization with polynucleotides containing common codons or codons that take codon degeneracy into account.

[0046] Whether any two polynucleotide or polypeptide sequences are homologous, similar or identical can be determined using known computer algorithms such as the "FASTA" program using default parameters, for example as in Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) can be determined using the GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO ETA / .](1988) SIAM J Applied Math 48: 1073). For example, homology, similarity, or identity can be determined using BLAST or ClustalW of the National Center for Biotechnology Information Database.

[0047] Homology, similarity, or identity of polynucleotides or polypeptides can be determined by comparing sequence information, for example, using a GAP computer program such as that of Needleman et al. (1970), J Mol Biol. 48:443, as disclosed, for example, in Smith and Waterman, Adv. Appl. Math (1981) 2:482. In brief, the GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids). Default parameters for the GAP program include (1) a binary comparison matrix (containing values ​​of 1 for identity and 0 for non-identity) and (2) a comparison matrix as disclosed by Gribskov et al. (1986) Nucl. Acids Res. 48:443, as disclosed by Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979). 14: A weighted comparison matrix of 6745 (or a permutation matrix of EDNAFULL (EMBOSS version of NCBI NUC4.4)); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10 and a gap extension penalty of 0.5); and (3) no penalty for terminal gaps.

[0048]

[0049] As used herein, the term "microorganism (or strain)" may encompass both wild-type microorganisms and microorganisms that have undergone natural or artificial genetic modification. The microorganism may be a microorganism whose specific mechanism has been strengthened or weakened due to reasons such as the insertion of an external gene or the enhancement or weakening of the activity of an endogenous gene, and may be a microorganism that includes genetic modification for the production of a desired polypeptide, protein, or product (e.g., pantothenic acid and / or pantoic acid).

[0050] In the present disclosure, the term “enhancement” of polypeptide (protein) activity means that the activity of the polypeptide is increased compared to the intrinsic activity. The enhancement may be used interchangeably with terms such as activation, up-regulation, overexpression, and increase. Here, activation, enhancement, up-regulation, overexpression, and increase may all include exhibiting an activity that was not originally present, or exhibiting an activity that is enhanced compared to the intrinsic activity or activity before modification. The “intrinsic activity” refers to the activity of a specific polypeptide that a parent strain or unmodified microorganism originally possessed before the trait change, when the trait change is caused by genetic mutation due to natural or artificial factors. This may be used interchangeably with “activity before modification.” “Enhanced,” “upregulated,” “overexpressed,” or “increased” the activity of a polypeptide relative to its intrinsic activity means that the activity and / or concentration (expression amount) of the specific polypeptide is improved compared to the activity and / or concentration (expression amount) that the parent strain or unmodified microorganism originally had prior to the transformation.

[0051] The above enhancement can be achieved by introducing an exogenous polypeptide, or by enhancing the activity and / or increasing the concentration (expression level) of an endogenous polypeptide. Whether the activity of the polypeptide is enhanced can be determined by an increase in the degree of activity of the polypeptide, the expression level, or the amount of a product resulting from the activity of the polypeptide.

[0052] Enhancement of the activity of the above polypeptide can be achieved by applying various methods well known in the art, and is not limited as long as the activity of the target polypeptide can be enhanced compared to that of the microorganism before modification. Specifically, it may be achieved by using genetic engineering and / or protein engineering, which are routine methods of molecular biology and are well known to those skilled in the art, but is not limited thereto (e.g., Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).

[0053] Specifically, the activity enhancement of the polypeptide (protein) of the present disclosure is

[0054] 1) Increase in the intracellular copy number of a polynucleotide encoding a polypeptide;

[0055] 2) Replacing the gene expression control region on the chromosome encoding the polypeptide with a highly active sequence;

[0056] 3) Modification of the base sequence encoding the initiation codon or 5'-UTR region of a gene transcript encoding a polypeptide;

[0057] 4) Modification of the amino acid sequence of the polypeptide so as to enhance polypeptide activity;

[0058] 5) Modification of the polynucleotide sequence encoding the polypeptide so as to enhance the activity of the polypeptide (e.g., modification of the polynucleotide sequence of the polypeptide gene so as to encode a polypeptide modified so as to enhance the activity of the polypeptide);

[0059] 6) Introduction of a foreign polypeptide exhibiting the activity of the polypeptide or a foreign polynucleotide encoding the same;

[0060] 7) Codon optimization of polynucleotides encoding polypeptides;

[0061] 8) Analyze the tertiary structure of the polypeptide to select the exposed portion and modify or chemically modify it;

[0062] 9) Controlling the cellular localization of polypeptides; or

[0063] 10) It may be a combination of two or more selected from 1) to 9), but is not particularly limited thereto.

[0064] More specifically,

[0065] The increase in the intracellular copy number of the polynucleotide encoding the polypeptide described above may be achieved by introducing into the host cell a vector capable of replicating and functioning independently of the host, to which the polynucleotide encoding the polypeptide is operably linked. Alternatively, the polynucleotide encoding the polypeptide may be achieved by introducing one copy or two or more copies into the chromosome of the host cell. The introduction into the chromosome may be performed by introducing into the host cell a vector capable of inserting the polynucleotide into the chromosome of the host cell, but is not limited thereto. The vector is as described above.

[0066] 2) Replacing the gene expression control region (or expression control sequence) on the chromosome encoding the polypeptide with a sequence having strong activity may be, for example, a mutation in the sequence such as deletion, insertion, non-conservative or conservative substitution, or a combination thereof to further enhance the activity of the expression control region, or replacement with a sequence having stronger activity. The expression control region may include, but is not particularly limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation. As an example, it may be, but is not limited to, replacing the original promoter with a strong promoter.

[0067] Examples of known strong promoters include, but are not limited to, the CJ1 to CJ7 promoters (US Patent No. US 7662943 B2), the lac promoter, the trp promoter, the trc promoter, the tac promoter, the lambda phage PR promoter, the PL promoter, the tet promoter, the gapA promoter, the SPL7 promoter, the SPL13 (sm3) promoter (US Patent No. US 10584338 B2), the O2 promoter (US Patent No. US 10273491 B2), the tkt promoter, and the yccA promoter.

[0068] The above 3) modification of the base sequence encoding the initiation codon or 5'-UTR region of the gene transcript encoding the polypeptide may be, for example, a substitution with a base sequence encoding another initiation codon having a higher polypeptide expression rate than the endogenous initiation codon, but is not limited thereto.

[0069] The modification of the amino acid sequence or polynucleotide sequence of the above 4) and 5) may be, but is not limited to, a mutation in the sequence by deletion, insertion, non-conservative or conservative substitution or a combination thereof in the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide to enhance the activity of the polypeptide, or replacement with an amino acid sequence or polynucleotide sequence improved to have stronger activity or an amino acid sequence or polynucleotide sequence improved to have increased activity. The replacement may be specifically performed by inserting the polynucleotide into a chromosome by homologous recombination, but is not limited thereto. The vector used at this time may additionally include a selection marker to confirm whether or not chromosomal insertion has occurred.

[0070] The introduction of the foreign polynucleotide exhibiting the activity of the polypeptide as described above 6) may be the introduction into the host cell of a foreign polynucleotide encoding a polypeptide exhibiting the same / similar activity as the polypeptide. The foreign polynucleotide is not limited in its origin or sequence as long as it exhibits the same / similar activity as the polypeptide. The method used for the introduction may be performed by a person skilled in the art by appropriately selecting a known transformation method, and the polypeptide may be produced by expressing the introduced polynucleotide in the host cell, thereby increasing its activity.

[0071] The above 7) codon optimization of a polynucleotide encoding a polypeptide may be codon optimization of an endogenous polynucleotide to increase transcription or translation within a host cell, or codon optimization of a foreign polynucleotide to achieve optimized transcription or translation within a host cell.

[0072] The above 8) analyzing the tertiary structure of a polypeptide and selecting an exposed portion to modify or chemically modify may be done by, for example, comparing the sequence information of the polypeptide to be analyzed with a database storing the sequence information of known proteins, determining a template protein candidate based on the degree of sequence similarity, confirming the structure based on this, and selecting an exposed portion to modify or chemically modify, and modifying or modifying it.

[0073] The above 9) regulation of the intracellular location of the polypeptide may target the polypeptide to a specific organelle or specific intracellular space within the cell. For example, targeting to the periplasm or cytoplasm may be achieved by adding or removing a leader sequence that functions in targeting the polypeptide, but is not limited thereto.

[0074] Such enhancement of polypeptide activity may be, but is not limited to, an increase in the activity or concentration or expression level of the corresponding polypeptide relative to the activity or concentration of the polypeptide expressed in the wild type or pre-transformed microbial strain, or an increase in the amount of a product produced from the polypeptide.

[0075]

[0076] In this disclosure, the term "attenuation" of the activity of a polypeptide (protein) encompasses both a decrease in activity or absence of activity compared to the intrinsic activity. The term "attenuation" may be used interchangeably with terms such as inactivation, deficiency, down-regulation, decrease, reduce, and attenuation.

[0077] The above weakening may also include cases where the activity of the polypeptide itself is reduced or eliminated compared to the activity of the polypeptide originally possessed by the microorganism due to mutation of the polynucleotide encoding the polypeptide, etc., cases where the overall polypeptide activity level and / or concentration (expression amount) within the cell is lower than that of the natural strain due to inhibition of expression of the gene of the polynucleotide encoding the polypeptide or inhibition of translation into a polypeptide, cases where the polynucleotide is not expressed at all, and / or cases where the polypeptide has no activity even if the polynucleotide is expressed. The above “intrinsic activity” refers to the activity of a specific polypeptide originally possessed by the parent strain, wild type, or unmodified microorganism before the change in trait when the trait is changed due to genetic mutation caused by natural or artificial factors. This may be used interchangeably with “activity before modification.” The term “inactivation, deficiency, reduction, downregulation, deterioration, attenuation” of the activity of a polypeptide relative to its intrinsic activity means that the activity of a particular polypeptide is lowered compared to the activity that the parent strain or unmodified microorganism originally had before the transformation.

[0078] Attenuation of the activity of such polypeptides can be accomplished by any method known in the art, including but not limited to, and can be achieved by application of various methods well known in the art (e.g., Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014;15(2):2773-2793, Sambrook et al. Molecular Cloning 2012, etc.).

[0079] Specifically, the weakening of the activity of the polypeptide (protein)

[0080] 1) Deletion of all or part of a gene encoding a polypeptide;

[0081] 2) Modification of the expression control region (or expression control sequence) so as to reduce the expression of the gene encoding the polypeptide;

[0082] 3) Modification of the amino acid sequence constituting the polypeptide (e.g., deletion / substitution / addition of one or more amino acids in the amino acid sequence) so as to eliminate or weaken the activity of the polypeptide;

[0083] 4) Modification of the gene sequence encoding the polypeptide such that the activity of the polypeptide is eliminated or weakened (e.g., deletion / substitution / addition of one or more nucleic acid bases in the nucleic acid base sequence of the polypeptide gene such that the polypeptide is modified such that the activity of the polypeptide is eliminated or weakened);

[0084] 5) Modification of the base sequence encoding the initiation codon or 5'-UTR region of a gene transcript encoding a polypeptide;

[0085] 6) Introduction of an antisense oligonucleotide (e.g., antisense RNA) that complementarily binds to a transcript of the gene encoding the polypeptide;

[0086] 7) Addition of a sequence complementary to the Shine-Dalgarno sequence in front of the Shine-Dalgarno sequence of a gene encoding a polypeptide to form a secondary structure to which ribosome attachment is impossible;

[0087] 8) Addition of a promoter that is transcribed in the opposite direction to the 3' end of the ORF (open reading frame) of the gene sequence encoding the polypeptide (Reverse transcription engineering, RTE);

[0088] 9) Controlling the cellular localization of polypeptides; or

[0089] 10) It may be a combination of two or more selected from 1) to 9), but is not particularly limited thereto.

[0090] for example,

[0091] The above 1) deletion of part or all of the gene encoding the polypeptide may be the removal of the entire polynucleotide encoding the endogenous target polypeptide in the chromosome, replacement with a polynucleotide having some nucleotides deleted, or replacement with a marker gene.

[0092] In addition, the above 2) modification of the expression control region (or expression control sequence) may be a mutation in the expression control region (or expression control sequence) by deletion, insertion, non-conservative or conservative substitution, or a combination thereof, or replacement with a sequence having weaker activity. The expression control region includes, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation.

[0093] In addition, the above 3) modification of the base sequence encoding the initiation codon or 5'-UTR region of the gene transcript encoding the polypeptide may be, for example, a substitution with a base sequence encoding another initiation codon having a lower polypeptide expression rate than the endogenous initiation codon, but is not limited thereto.

[0094] In addition, the modification of the amino acid sequence or polynucleotide sequence of the above 4) and 5) may be, but is not limited to, a mutation in the sequence by deletion, insertion, non-conservative or conservative substitution, or a combination thereof in the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide to weaken the activity of the polypeptide, or replacement with an amino acid sequence or polynucleotide sequence improved to have weaker activity, or an amino acid sequence or polynucleotide sequence improved to have no activity. For example, by introducing a mutation in a polynucleotide sequence to form a stop codon, the expression of a gene may be inhibited or weakened, but is not limited thereto. The "stop codon" is a codon that does not specify an amino acid among the codons on mRNA and serves as a signal to indicate the end of the protein synthesis process, and generally, three of UAA, UAG, and UGA can be used as stop codons.

[0095] The introduction of an antisense oligonucleotide (e.g., antisense RNA) that complementarily binds to the transcript of the gene encoding the polypeptide 6) above can be described, for example, with reference to the literature [Weintraub, H. et al., Antisense-RNA as a molecular tool for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1) 1986].

[0096] 7) Addition of a sequence complementary to the Shine-Dalgarno sequence in front of the Shine-Dalgarno sequence of a gene encoding a polypeptide to form a secondary structure to which ribosome attachment is impossible may render mRNA translation impossible or slow it down.

[0097] 8) Addition of a promoter transcribed in the opposite direction to the 3' end of the ORF (open reading frame) of the gene sequence encoding the polypeptide (Reverse transcription engineering, RTE) may weaken the activity by creating an antisense nucleotide complementary to the transcript of the gene encoding the polypeptide.

[0098] The above 9) regulation of the intracellular location of the polypeptide may target the polypeptide to a specific organelle or specific intracellular space within the cell. For example, targeting to the periplasm or cytoplasm may be achieved by adding or removing a leader sequence that functions in targeting the polypeptide, but is not limited thereto.

[0099] Such attenuation of polypeptide activity may be, but is not limited to, attenuation of the activity or concentration of the corresponding polypeptide relative to the activity or concentration of the polypeptide expressed in the wild type or pre-transformed microbial strain, or an increase in the amount of the product produced from the polypeptide.

[0100]

[0101] Another aspect provides a microorganism of the genus Corynebacterium producing pantothenic acid or pantoic acid, wherein the activity of the lipoate protein ligase is enhanced.

[0102] The microorganism (or strain, recombinant cell) of the present disclosure may be a microorganism having the ability to produce (or produce) pantothenic acid and / or pantoic acid, or having the ability to produce (or increase) pantothenic acid and / or pantoic acid.

[0103] The microorganism producing pantothenic acid or pantoic acid with enhanced activity of the lipoate protein ligase of the present disclosure may be, but is not limited to, a microorganism that naturally lacks the ability to produce pantothenic acid and / or pantoic acid, or a microorganism having the ability to produce pantothenic acid and / or pantoic acid into which the lipoate protein ligase or a polynucleotide encoding the same has been introduced. In one example, the polynucleotide encoding the lipoate protein ligase in the microorganism may be operably linked to a strong promoter. In one example, the lipoate protein ligase may be derived from Bacillus subtilis. The microorganism having enhanced activity of the lipoate protein ligase derived from Bacillus subtilis may have improved ability to produce pantothenic acid and / or pantoic acid.

[0104]

[0105] The fact that the microorganism having enhanced activity of the lipoate protein ligase has improved pantothenic acid and / or pantoic acid production ability or has pantothenic acid and / or pantoic acid production ability may mean that the microorganism has improved pantothenic acid and / or pantoic acid production ability compared to a non-modified microorganism, a cell before recombination, a parent strain, or a wild-type microorganism, or that the microorganism is endowed with pantothenic acid and / or pantoic acid production ability, unlike a non-modified microorganism, a cell before recombination, a parent strain, or a wild-type microorganism that does not have pantothenic acid and / or pantoic acid production ability.

[0106] According to an example, a microorganism having enhanced lipoate protein ligase activity may have enhanced pantothenic acid and / or pantoic acid production capacity compared to a microorganism before enhancement, i.e., an unmodified microorganism of the same species. In the present disclosure, the term "unmodified microorganism" does not exclude a strain containing a mutation that may occur naturally in a microorganism, and may refer to a wild-type strain or a natural strain itself, or a strain before its characteristics are changed by genetic mutation due to natural or artificial factors. For example, the unmodified microorganism may refer to a strain before the activity of lipoate protein ligase is enhanced, according to an example. The term "unmodified microorganism" may be used interchangeably with "pre-modified strain," "pre-modified microorganism," "unmutated strain," "unmodified microorganism," or "reference microorganism." The enhanced activity of the lipoate protein ligase is as described above.

[0107]

[0108] In one example, a microorganism producing pantothenic acid or pantoic acid with enhanced activity of the lipoate protein ligase may be a microorganism with additional enhanced activity of the glycine cleavage system.

[0109] The microorganism with enhanced activity of the above glycine cleavage system may be a microorganism into which an exogenous glycine cleavage system or a polynucleotide encoding the same has been introduced.

[0110] The above glycine cleavage system may comprise a complex of glycine cleavage enzymes, or one or more glycine cleavage enzymes.

[0111] The above glycine decomposition enzyme may be any one enzyme selected from the group consisting of glycine dehydrogenase, aminomethyltransferase, glycine decarboxylase, dihydrolipoyl dehydrogenase, etc.

[0112] The above glycine cleavage system may comprise one or more subunits selected from the group consisting of a GcvP polypeptide, a GcvT polypeptide, and a GcvH polypeptide. In one example, the glycine cleavage system may comprise a GcvP polypeptide, a GcvT polypeptide, and a GcvH polypeptide.

[0113] The above foreign glycine cleavage system may comprise at least one subunit selected from the group consisting of GcvP, GcvT and GcvH polypeptides, each of which may be derived from a different foreign microorganism, or may be derived from the same foreign microorganism.

[0114] The above-mentioned foreign glycine cleavage system and / or polynucleotide encoding the same may be derived from a microorganism of the genus Mycobacterium, but is not limited thereto.

[0115] The above foreign glycine cleavage system and / or polynucleotide encoding the same is selected from the group consisting of Mycobacterium abscessus, Mycobacterium africanum, Mycobacterium asiaticum, Mycobacterium bovis, Mycobacterium chelonae, Mycobacterium fortuitum, Mycobacterium gordonae, Mycobacterium haemophilum, Mycobacterium intracellulare, Mycobacterium kansasii, Mycobacterium lentiflavum, Mycobacterium malmoens It may be derived from one or more Mycobacterium microorganisms selected from the group consisting of, but not limited to, Mycobacterium malmoense, Mycobacterium marinum, Mycobacterium microti, Mycobacterium phlei, Mycobacterium scrofulaceum, Mycobacterium smegmatis, Mycobacterium triplex, Mycobacterium uvium, and Mycobacterium xenopi.In one example, the exogenous glycine cleavage system and / or the polynucleotide encoding the same may be derived from Mycobacterium smegmatis. The sequences of the GcvP, GcvT, or GcvH polypeptides derived from Mycobacterium smegmatis can be obtained, for example, from the NCBI, a known database.

[0116]

[0117] In one example, the GcvP polypeptide derived from Mycobacterium smegmatis can have, comprise, consist of, or consist essentially of the amino acid sequence of SEQ ID NO: 25.

[0118] In one example, the GcvP polypeptide may comprise or consist of an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% homology or identity to the amino acid sequence of SEQ ID NO: 25. In addition, a variant of the GcvP polypeptide having an amino acid sequence in which a portion of the sequence is deleted, modified, substituted, conservatively substituted, or added may also be included in the GcvP polypeptide, as long as the protein has such homology or identity and exhibits glycine dehydrogenase activity. For example, if the amino acid sequence has sequence additions or deletions that do not alter glycine dehydrogenase activity, naturally occurring mutations, silent mutations, or conservative substitutions at the N-terminus, C-terminus, and / or within the amino acid sequence.

[0119] The polynucleotide encoding the GcvP polypeptide derived from Mycobacterium smegmatis may be derived from Mycobacterium smegmatis, but is not limited thereto, and may be prepared based on the amino acid sequence of the GcvP polypeptide with reference to a known codon table. In one example, the polynucleotide encoding the GcvP polypeptide derived from Mycobacterium smegmatis may have, include, consist of, or consist essentially of the nucleic acid sequence of SEQ ID NO: 4 or SEQ ID NO: 28.

[0120] In one example, the polynucleotide encoding the GcvP polypeptide may comprise or consist of a nucleic acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% homology or identity to the nucleic acid sequence of SEQ ID NO: 4 or SEQ ID NO: 28.

[0121] In one example, the GcvT polypeptide derived from Mycobacterium smegmatis can have, comprise, consist of, or consist essentially of the amino acid sequence of SEQ ID NO: 26.

[0122] In one example, the GcvT polypeptide may comprise or consist of an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% homology or identity to the amino acid sequence of SEQ ID NO: 26. In addition, a variant of the GcvP polypeptide having an amino acid sequence in which a portion of the sequence is deleted, modified, substituted, conservatively substituted, or added may also be included in the GcvP polypeptide, as long as the protein has such homology or identity and exhibits glycine dehydrogenase activity. For example, if the amino acid sequence has sequence additions or deletions that do not alter glycine dehydrogenase activity, naturally occurring mutations, silent mutations, or conservative substitutions at the N-terminus, C-terminus, and / or within the amino acid sequence.

[0123] The polynucleotide encoding the GcvT polypeptide derived from Mycobacterium smegmatis may be derived from Mycobacterium smegmatis, but is not limited thereto, and may be prepared based on the amino acid sequence of the GcvT polypeptide with reference to a known codon table. In one example, the polynucleotide encoding the GcvT polypeptide derived from Mycobacterium smegmatis may have, include, consist of, or consist essentially of the nucleic acid sequence of SEQ ID NO: 5 or SEQ ID NO: 29.

[0124] In one example, the polynucleotide encoding the GcvT polypeptide may comprise or consist of a nucleic acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% homology or identity to the nucleic acid sequence of SEQ ID NO: 5 or SEQ ID NO: 29.

[0125] In one example, the GcvH polypeptide derived from Mycobacterium smegmatis can have, comprise, consist of, or consist essentially of the amino acid sequence of SEQ ID NO: 27.

[0126] In one example, the GcvH polypeptide may comprise or consist of an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% homology or identity to the amino acid sequence of SEQ ID NO: 27. In addition, a variant of the GcvP polypeptide having an amino acid sequence in which a portion of the sequence is deleted, modified, substituted, conservatively substituted, or added may also be included in the GcvP polypeptide, as long as the protein has such homology or identity and exhibits glycine dehydrogenase activity. For example, if the amino acid sequence has sequence additions or deletions that do not alter glycine dehydrogenase activity, naturally occurring mutations, silent mutations, or conservative substitutions at the N-terminus, C-terminus, and / or within the amino acid sequence.

[0127] The polynucleotide encoding the GcvH polypeptide derived from Mycobacterium smegmatis may be derived from Mycobacterium smegmatis, but is not limited thereto, and may be prepared based on the amino acid sequence of the GcvH polypeptide with reference to a known codon table. In one example, the polynucleotide encoding the GcvH polypeptide derived from Mycobacterium smegmatis may have, include, consist of, or consist essentially of the nucleic acid sequence of SEQ ID NO: 6 or SEQ ID NO: 30.

[0128] In one example, the polynucleotide encoding the GcvH polypeptide may comprise or consist of a nucleic acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% homology or identity to the nucleic acid sequence of SEQ ID NO: 6 or SEQ ID NO: 30.

[0129] The above microorganism may additionally include a mutation that increases pantothenic acid and / or pantoic acid production, and the location of the mutation and / or the type of gene and / or protein that is the target of the mutation may be included without limitation as long as it increases pantothenic acid and / or pantoic acid production. The above recombinant cell may be used without limitation as long as it is a cell capable of transformation.

[0130] The above microorganism may be a microorganism of the genus Corynebacterium (Corynebacterium sp.). The above-mentioned Corynebacterium genus microorganisms are Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium efficiens, Corynebacterium callunae, Corynebacterium stationis, Corynebacterium singulare, Corynebacterium halotolerans, Corynebacterium striatum, Corynebacterium ammoniagenes, and Corynebacterium pollutisoli. The microorganism may be selected from the group consisting of, but is not limited to, Corynebacterium pollutisoli, Corynebacterium imitans, Corynebacterium testudinoris, and Corynebacterium flavescens.

[0131] The above microorganism may be a microorganism of the genus Bacillus. The above Bacillus microorganism may be a microorganism selected from the group consisting of Bacillus subtilis, Bacillus amyloliquefaciens, Bacillus methylotrophicus, Bacillus licheniformis, Bacillus velezensis, Bacillus sonorensis, and Bacillus valismortis, but is not limited thereto.

[0132] The above microorganism may be a microorganism of the genus Escherichia. The above Escherichia microorganism may be, but is not limited to, Escherichia coli.

[0133] For example, the microorganism having improved pantothenic acid and / or pantoic acid production ability is newly granted, or about 10% or more, about 20% or more, about 24% increase, about 25% increase, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, about 100% or more, about 150% or more, about 200% or more, about 250% or more, about 300% or more, about 400% or more, about 500% or more, about 600% or more, about 700% or more, about 800% or more, about 900% or more, or about An increase of, but not limited to, 1,000% or more, about 1,500% or more, about 2,000% or more, about 2,500% or more, or about 3,000% or more.

[0134] In another example, the microorganism having improved pantothenic acid and / or pantoic acid production ability has a pantothenic acid and / or pantoic acid production ability of about 1.1 times or more, about 1.2 times or more, about 1.24 times or more, about 1.3 times or more, about 1.4 times or more, about 1.5 times or more, about 1.6 times or more, about 1.7 times or more, about 1.8 times or more, about 1.9 times or more, about 2 times or more, about 2.5 times or more, about 3 times or more, about 4 times or more, about 5 times or more, about 6 times or more, about 7 times or more, about 8 times or more, about 9 times or more, about 10 times or more, about 15 times or more, about 20 times or more, about 25 times or more, or about It can be 30 times or more (the upper limit is not particularly limited, for example, it can be about 1,000 times or less), but is not limited thereto.

[0135] As another example, the microorganism having improved pantothenic acid and / or pantoic acid production ability has a pantothenic acid and / or pantoic acid production ability of about 0.1 g / L or more, about 0.2 g / L or more, about 0.3 g / L or more, about 0.4 g / L or more, about 0.5 g / L or more, about 0.6 g / L or more, about 0.7 g / L or more, about 0.8 g / L or more, about 0.9 g / L or more, about 1 g / L or more, about 1.1 g / L or more, about 1.2 g / L or more, about 1.3 g / L or more, about 1.4 g / L or more, about 1.5 g / L or more, about 1.6 g / L or more, about 1.7 g / L or more, or about It may be 1.8 g / L or more, about 1.9 g / L or more, about 2.0 g / L or more, about 2.5 g / L or more, about 3 g / L or more, about 3.5 g / L or more, about 4 g / L or more, about 4.5 g / L or more, about 5 g / L or more, about 5.5 g / L or more, about 6 g / L or more, about 7 g / L or more, about 8 g / L or more, about 9 g / L or more, about 10 g / L or more, about 15 g / L or more, about 20 g / L or more, about 25 g / L or more, about 30 g / L or more (the upper limit is not particularly limited, and may be, for example, about 100 g / L or less), but is not limited thereto.

[0136] The term “about” above includes all ranges including ±0.5, ±0.4, ±0.3, ±0.2, ±0.1, etc., and includes all ranges of values ​​equal to or similar to the value following the term “about,” but is not limited thereto.

[0137]

[0138] Another aspect provides a composition for producing pantothenic acid and / or pantoic acid comprising the microorganism, a medium in which the microorganism is cultured, or a combination thereof.

[0139] The composition may further comprise any suitable excipient commonly used in compositions for producing pantothenic acid and / or pantoic acid, including but not limited to preservatives, wetting agents, dispersing agents, suspending agents, buffering agents, stabilizers, or isotonic agents.

[0140] Another aspect provides the use of the microorganism for producing pantothenic acid and / or pantoic acid.

[0141] Another aspect provides the use of the microorganism for the preparation of a composition for producing pantothenic acid and / or pantoic acid.

[0142] Another aspect provides a method for producing (or preparing) pantothenic acid and / or pantoic acid, comprising the step of culturing a microorganism producing pantothenic acid or pantoic acid, wherein the activity of the lipoate protein ligase of the present disclosure is enhanced, in a medium. The microorganism is as described above.

[0143] The method for producing the above pantothenic acid and / or pantoic acid may include a step of culturing the above microorganism in a medium.

[0144] In this disclosure, "cultivation" refers to growing the microorganism under appropriately controlled environmental conditions. The culturing process of this disclosure can be performed using appropriate media and culture conditions known in the art. This culturing process can be easily adjusted and used by those skilled in the art depending on the selected strain. Specifically, the culturing process may be batch, continuous, and / or fed-batch, but is not limited thereto.

[0145] In the present disclosure, "medium" refers to a material containing nutrients necessary for culturing the microorganism as a main component, and supplies nutrients and growth factors, including water essential for survival and growth. Specifically, the medium and other culture conditions used for culturing the microorganism of the present disclosure may be any medium used for culturing general microorganisms without particular limitation, but the microorganism of the present disclosure may be cultured under aerobic conditions while controlling temperature, pH, etc. in a general medium containing an appropriate carbon source, nitrogen source, phosphorus, inorganic compounds, amino acids, and / or vitamins.

[0146] Specifically, culture media for microorganisms of the present disclosure, such as strains of the genus Corynebacterium, can be found in the literature ["Manual of Methods for General Bacteriology" by the American Society for Bacteriology (Washington D.Corynebacterium, USA, 1981)].

[0147] In the present disclosure, the carbon source may include carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, etc.; sugar alcohols such as mannitol, sorbitol, etc.; organic acids such as pyruvic acid, lactic acid, citric acid, etc.; amino acids such as glutamic acid, methionine, lysine, etc. In addition, natural organic nutrients such as starch hydrolysate, molasses (e.g., blackstrap molasses), rice bran, cassava, sugarcane bagasse, and corn steep liquor may be used, and specifically, carbohydrates such as glucose and sterilized pretreated molasses (i.e., molasses converted to reducing sugar) may be used, and other appropriate amounts of carbon sources may be used in various ways without limitation. These carbon sources may be used alone or in combination of two or more, but are not limited thereto.

[0148] The nitrogen source may include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc.; amino acids such as glutamic acid, methionine, glutamine, etc.; organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolysate, fish or its decomposition product, defatted soybean cake or its decomposition product, etc. These nitrogen sources may be used alone or in combination of two or more, but are not limited thereto.

[0149] The above-mentioned components may include potassium phosphate monobasic, potassium phosphate dibasic, or their corresponding sodium-containing salts. Inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. In addition, amino acids, vitamins, and / or suitable precursors may be included. These components or precursors may be added to the medium in batch or continuous manner, but are not limited thereto.

[0150] Additionally, during the cultivation of the microorganism of the present disclosure, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. may be added to the medium in an appropriate manner to adjust the pH of the medium. Furthermore, during the cultivation, foaming may be suppressed by using an antifoaming agent such as fatty acid polyglycol ester. Furthermore, to maintain the aerobic state of the medium, oxygen or an oxygen-containing gas may be injected into the medium, or to maintain anaerobic and microaerobic states, nitrogen, hydrogen, or carbon dioxide gas may be injected without gas injection, but is not limited thereto.

[0151] In the culture of the present disclosure, the culture temperature can be maintained at 20 to 45°C, specifically 25 to 40°C, and the culture can be performed for about 10 to 160 hours, but is not limited thereto.

[0152] Pantothenic acid and / or pantoic acid produced by the culture of the present disclosure may be secreted into the medium or remain within the cells.

[0153] The method for producing pantothenic acid and / or pantoic acid of the present disclosure may additionally include a step of preparing a microorganism of the present disclosure, a step of preparing a medium for culturing the microorganism, or a combination thereof (in any order), for example, prior to the culturing step.

[0154] The method for producing pantothenic acid and / or pantoic acid of the present disclosure may further include a step of recovering pantothenic acid and / or pantoic acid from a culture medium (a culture medium in which culture is performed) or a microorganism (e.g., a strain of the genus Corynebacterium). The recovering step may be additionally included after the culturing step.

[0155] The above recovery may be performed by collecting the desired pantothenic acid and / or pantoic acid using a suitable method known in the art according to the culture method of the microorganism of the present disclosure, such as a batch, continuous or fed-batch culture method. For example, various chromatographies such as centrifugation, filtration, treatment with a crystallizing protein precipitant (salting out method), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, HPLC or a combination thereof may be used, and the desired pantothenic acid and / or pantoic acid may be recovered from the medium or microorganism using a suitable method known in the art.

[0156] In addition, the method for producing pantothenic acid and / or pantoic acid of the present disclosure may additionally include a purification step. The purification may be performed using any suitable method known in the art. In one example, when the method for producing pantothenic acid and / or pantoic acid of the present disclosure includes both a recovery step and a purification step, the recovery step and the purification step may be performed sequentially or discontinuously, regardless of the order, or may be performed simultaneously or integrated into a single step, but is not limited thereto.

[0157]

[0158] When culturing microorganisms with enhanced lipoate protein ligase activity of the present disclosure, high-yield production of pantothenic acid and / or pantoic acid is possible. Therefore, industrial benefits are expected, including increased production convenience and reduced manufacturing costs.

[0159]

[0160] The present disclosure is described in more detail below with examples. However, these examples are intended to exemplify the present disclosure, and the scope of the present disclosure is not limited by these examples, as will be apparent to those skilled in the art to which the present disclosure pertains.

[0161]

[0162] Example 1. Production of a pantothenic acid-producing Corynebacterium microorganism.

[0163] (1) Manufacturing of pantothenic acid-producing microorganisms

[0164] A Corynebacterium glutamicum strain with increased pantothenic acid production was created by introducing a 3-methyl-2-oxobutanoate hydroxymethyltransferase G116A mutant (PanB(G116A), U.S. Publication No. US 2024-0167065 A1) derived from Escherichia coli.

[0165] First, a vector was constructed to delete panB present in the parent strain. PCR was performed using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template and primers of SEQ ID NOs: 30 and 31 and 32 and 33. PCR was performed under the following conditions: denaturation at 95°C for 30 s; annealing at 55°C for 30 s; and polymerization at 72°C for 1 min, repeated 25 times. As a result, 1,000 bp of gene fragments upstream of the panB gene and 1,000 bp of gene fragments downstream of the panB gene were obtained, and each amplification product was purified using a QIAGEN PCR Purification kit and used as an insert DNA fragment for vector construction. The vector pDC24_ΔpanB for deleting the panB gene on the chromosome was constructed by cloning the pDC24 (SEQ ID NO: 34) vector and DNA fragments (1000 bp gene fragment upstream of the panB gene and 1000 bp gene fragment downstream of the panB gene) treated with restriction enzyme SmaI and heat-treated at 65°C for 20 minutes at a molar concentration (M) of 2:1:1 using TaKaRa's Infusion Cloning Kit according to the provided manual.

[0166] Next, PCR was performed using the genomic DNA of E. coli ATCC47076 strain as a template and primers of SEQ ID NOs: 35 and 36 and 37 and 38. PCR was performed under the following conditions: denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and polymerization at 72°C for 1 minute, repeated 25 times. As a result, 388 bp of gene fragments upstream of the panB gene and 490 bp of gene fragments downstream of the panB gene were obtained, and each amplification product was purified using a QIAGEN PCR Purification kit and used as an insert DNA fragment for vector construction. After treating with the restriction enzyme SmaI and heat-treating at 65℃ for 20 minutes, the pDC24_ΔpanB vector and the obtained DNA fragment were cloned at a molar concentration (M) of 1:1:1 using the Infusion Cloning Kit from TaKaRa according to the provided manual, thereby constructing the vector pDC24_ΔpanB ::panB(EC, G116A) for introducing the panB (G116A) gene from Escherichia coli into the chromosome. The constructed vector pDC24_ΔpanB ::panB(EC, G116A) was transformed into Corynebacterium glutamicum ATCC 13032 via electroporation, and through a secondary crossing-over process, strain ATCC13032 ΔpanB ::panB(EC, G116A) in which the endogenous panB on the chromosome was replaced with the panB(G116A) from E. coli was obtained. The appropriate substitution of panB (G116A) from E. coli was confirmed using the MASA (Mutant Allele Specific Amplification) PCR technique (Takeda et al., Hum. Mutation, 2, 112-117 (1993)) using the following primer combination.That is, the strains that were amplified were first determined by selecting the primer combinations (SEQ ID NOs: 39 and 40 and 41 and 42) that match E. coli panB, and the panB sequences of the selected strains were secondarily confirmed by analyzing them using the primer combinations of SEQ ID NOs: 39 and 43.

[0167] The primer sequences used in the above examples are as shown in Table 1 below.

[0168] SEQ ID NO: 30TGAATTCGAGCTCGGTACCCGAAATAGCGCTTGATGAATC31GGTTGCTACCTGCACCCGGGGGGCATGAGTATAGATGTGA32CTATACTCATGCCCCCCGGGTGCAGGTAGCAACCACAAAG33GTCGACTCTAGAGGATCCCCTATGTGGCGTTGGGTGCAGC35CATCTATACTCATGCCCCCCATGAAACCGACCACCATCTC36ACGGTTTCTACC AGCCACTCggcGCCTTCAATTTTGACCATGT37ACATGGTCAAAATTGAAGGCgccGAGTGGCTGGTAGAAACCGT38TGTGGTTGCTACCTGCACCCTTAATGGAAACTGTGTT CTT39ACTCAACTCGTCGGGATATT40TTCATCAGCAAAGAGTTTGG41TCCGCGCGGCTGTGCGGCAG42TGTGGTTCCAGAACCCGCTGAA43TTAATGGAAACTGTGTTCTT

[0169] (2) Production of microorganisms with a glycine cleavage system

[0170] A vector was constructed to overexpress the gcvPTH gene derived from Mycobacterium smegmatis in the ATCC13032 ΔpanB::panB (EC, G116A) strain constructed in Example 1 (1). Specifically, the genomic DNA of Corynebacterium glutamicum ATCC13032 was used as a template, the promoter fragment (PlysC) of the lysC gene, and the genomic DNA of Mycobacterium smegmatis ATCC 19420 (KCTC 9108) were used as a template, and the gene fragments of gcvP, gcvT, and gcvH were obtained through PCR using primer combinations of SEQ ID NOS: 9, 10, 11, 12, 13, 14, 15, and 16, respectively. The PCR was performed at denaturation 95°C for 30 seconds; Annealing 55°C, 30 seconds; and polymerization 72°C, 3 minutes were repeated 25 times, and as a result, DNA fragments of PlysC (242 bp), gcvP gene, gcvT gene, and gcvH gene were obtained. After treating with restriction enzyme BamHI and heat treating at 65°C for 20 minutes, pECCG117 (Korean Patent Nos. 10-0057684, 10-1992-0008383) vector and the DNA fragments obtained above (PlysC, gcvP, gcvT, gcvH) were cloned at a molar concentration (M) of 2:1:1:1:1 using TaKaRa's Infusion Cloning Kit according to the provided manual, thereby obtaining pECCG117_PlysC-gcvPTH(M. sm) vector. The above vector was transformed into ATCC13032_ΔpanB::panB(EC, G116A) strain by electroporation to obtain a strain overexpressing GcvP, GcvT and GcvH derived from Mycobacterium smegmatis, which was named ATCC13032_ΔpanB::panB(EC, G116A)_ pECCG117_PlysC-gcvPTH (M.sm).

[0171] The primer sequences used in the above examples are as shown in Table 2 below.

[0172] Primer Nucleic Acid Sequences SEQ ID NO: 9ACGGTATCGATAAGCTTGATTTCAGGGTAGTTGACTAAAGSEQ ID NO: 10GCTTTTGGCTGGTCGGACAtCTTTGTGCACCTTTCGATCTSEQ ID NO: 11AGATCGAAAGGTGCACAAAGaTGTCCGACCAGCCAAAAGCSEQ ID NO: 12TGCAGCAGCTCGTCACTCAtTCAGGCGAACGCCTCCACCGSEQ ID NO: 13CGGTGGAGGCGTTCGCCTGAaTGAGTGACGAGCTGCTGCASEQ ID NO: 14TCGGCTGGGATCTCGCTCAtCTATCGCGTGCTCGGTGTGASEQ ID NO: 15TCACACCGAGCACGCGATAGaTGAGCGAGATCCCAGCCGASEQ ID NO: 16CCGGGCTGCAGGAATTCGATTCACTCGGTGACGACCGCGC

[0173] (3) Evaluation of pantothenic acid production capacity

[0174] To confirm the pantothenic acid productivity of the mutant strain obtained in the above example, it was measured by the following method. After inoculating the parent strain and the mutant strain into a 250 ml corner-buffered flask containing 25 ml of production medium, the culture was cultured with shaking at 200 rpm for 48 hours at 32°C, and the culture solution was centrifuged at 20,000 rcf for 10 minutes. The collected supernatant was diluted 1 / 10 with TDW (triple distilled water) and analyzed by HPLC to measure the pantothenic acid concentration.

[0175] <Production medium>

[0176] Glucose 10%, beta-alanine 0.5%, yeast extract 0.4%, ammonium sulfate 1.5%, monobasic potassium phosphate 0.1%, magnesium sulfate heptahydrate 0.05%, iron sulfate heptahydrate 10 mg / l, manganese sulfate monohydrate 6.7 mg / l, biotin 50 μg / l, thiamine HCl 100 μg / l, pH 7.2

[0177] Strain Pantothenic acid concentration (g / L) L-gly concentration (g / L) Increase in pantothenic acid concentration compared to the control group Parent strain (ATCC13032_ΔpanB::panB(EC, G116A)) 1.6 0.5-ATCC13032_ΔpanB::panB(EC, G116A)_ pECCG117_PlysC-gcvPTH (M.sm) 2.8 0.175%

[0178] As a result, as shown in Table 3 above, the parent strain, Corynebacterium glutamicum ATCC13032_ΔpanB::panB(EC, G116A), produced about 1.6 g / L of pantothenic acid, but the ATCC13032_ΔpanB::panB(EC, G116A)_pECCG117_PlysC-gcvPTH (M.sm) strain with a strengthened glycine cleavage system produced pantothenic acid at a concentration of about 2.8 g / L, showing an excellent effect of improving pantothenic acid production.

[0179]

[0180] Example 2. Exploration and screening of lipoate protein ligase genes

[0181] In order to produce a Corynebacterium spp. microorganism with enhanced activity of lipoate protein ligase A (LplA), candidate lipoate protein ligase genes from various microorganisms were selected, and the results are shown in Table 4 below.

[0182] Strain Primer Sequence Number Vector 1 Escherichia coli MG1655 (ATCC 700926) PlysC - SEQ ID NO: 17, 18 LplA (EC) - SEQ ID NO: 19, 20 pECCG117-PlysC-gcvPTH (M.sm)_ PlysC-lplA (EC) 2 Bacillus subtilis ATCC 6051) PlysC - SEQ ID NO: 17, 21 LplA (BS) - SEQ ID NO: 22, 23 pECCG117-PlysC- gcvPTH (M.sm)_ PlysC-lplA (BS) 3 Corynebacterium glutamicum ATCC 13032) PlysC - SEQ ID NO: 17, 24LplA(CG)-SEQ ID NO: 25, 26pECCG117-PlysC-gcvPTH(M.sm)_ PlysC-lplA(CG)4Serratia marcescensATCC13880 (KCTC42171)PlysC-SEQ ID NO: 17, 27lplA(SM)-SEQ ID NO: 28, 29pECCG117- PlysC-gcvPTH(M.sm)_ PlysC-lplA(SM)

[0183] Primer name Nucleic acid sequence

[0184] Example 3. Production of a Corynebacterium spp. microorganism with enhanced lipoate protein ligase activity.

[0185] To amplify a DNA fragment encoding lipoate protein ligase using the genomes of each of the obtained microorganisms as templates, PCR was performed using the primer sequences in Tables 4 and 5. PCR was performed using PfuUltraTM high-fidelity DNA polymerase (Stratagene), and the PCR conditions were denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and polymerization at 72°C for 2 minutes, repeated 30 times. As a result, a polynucleotide fragment encoding a microbial-derived lipoate protein ligase was obtained. In addition, using Corynebacterium glutamicum 13032 genomic DNA as a template and a combination of primers SEQ ID NOs: 17 and 18, SEQ ID NOs: 17 and 21, SEQ ID NOs: 17 and 24, and SEQ ID NOs: 17 and 27, PCR was performed in the same manner as above using the combination of primers SEQ ID NOs: 17 and 21, SEQ ID NOs: 17 and 24, and SEQ ID NOs: 17 and 27 to obtain a lysC promoter DNA fragment (PlysC) derived from Corynebacterium glutamicum for the expression of each lipoate protein ligase (E. coli, Bacillus subtilis, Corynebacterium glutamicum, and Serritia marcescens). After treating with restriction enzyme XbaI and heat-treating at 65°C for 20 minutes, pECCG117_PlysC-gcvPTH (M.sm) vector and the above DNA fragments (each lplA gene, each PlysC promoter) were cloned at a molar concentration (M) of 2:1:1 using TaKaRa's Infusion Cloning Kit according to the provided manual, thereby obtaining a total of four vectors (Table 4).

[0186] The four types of vectors produced were transformed into the ATCC13032 ΔpanB::panB (EC, G116A) strain produced in Example 1 (1) by electroporation to produce strains expressing each microorganism-derived lipoate protein ligase.

[0187]

[0188] Example 4. Investigation of pantothenic acid production by a Corynebacterium spp. microorganism with enhanced lipoate protein ligase activity.

[0189] To confirm the pantothenic acid productivity of the strains produced in Example 3, measurements were made using the following method. Specifically, the parent strain and the strains were inoculated into 250 ml corner-buffered flasks containing 25 ml of production medium, and then cultured with shaking at 200 rpm at 32°C for 48 hours. The culture solution was centrifuged at 20,000 rcf for 10 minutes, and the collected supernatant was diluted 1 / 10 with TDW (triple distilled water) and analyzed for pantothenic acid productivity using HPLC. The results are shown in Table 6 below.

[0190] <Production medium>

[0191] Glucose 10%, beta-alanine 0.5%, yeast extract 0.4%, ammonium sulfate 1.5%, monobasic potassium phosphate 0.1%, magnesium sulfate heptahydrate 0.05%, iron sulfate heptahydrate 10 mg / l, manganese sulfate monohydrate 6.7 mg / l, biotin 50 μg / l, thiamine HCl 100 μg / l, pH 7.2

[0192] StrainPantothenic acid concentration (g / L)L-Gly concentration (g / L)Increase in pantothenic acid concentration compared to the control Parent strain (ATCC13032_ΔpanB::panB(EC, G116A)_pECCG117_PlysC-gcvPTH(M. sm))2.50.2ATCC13032_ΔpanB::panB(EC, G116A)_pECCG117_PlysC-gcvPTH(M. sm)-PlysC-lplA(EC)2.20.2-12.00%ATCC13032_ΔpanB::panB(EC, G116A)_pECCG117_PlysC-gcvPTH(M. sm)-PlysC-lplA(BS)3.10.024.00%ATCC13032_ΔpanB::panB(EC, G116A)_pECCG117_PlysC-gcvPTH(M. sm)-PlysC-lplA(CG)2.50.20.00%ATCC13032_ΔpanB::panB(EC, G116A)_pECCG117_PlysC-gcvPTH(M.sm)-PlysC-lplA(SM)1.80.3-28.00%

[0193] As a result, as shown in Table 6 above, the parent strain, Corynebacterium glutamicum ATCC13032_ΔpanB::panB(EC, G116A)_pECCG117_PlysC-gcvPTH (M.sm), produced about 2.5 g / L of pantothenic acid, but ATCC13032_ΔpanB::panB(EC, G116A)_pECCG117_PlysC-gcvPTH(M.sm)-PlysC-lplA(BS), a strain expressing LlplA derived from Bacillus subtilis, showed the highest pantothenic acid productivity of 3.1 g / L.

[0194]

[0195] From the above description, those skilled in the art will understand that the present invention can be implemented in other specific forms without altering its technical spirit or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present invention should be interpreted as encompassing all changes or modifications derived from the meaning and scope of the following claims and their equivalent concepts, rather than the detailed description above.

Claims

1. A microorganism of the genus Corynebacterium that produces pantothenic acid or pantoic acid and has enhanced lipoate protein ligase activity.

2. A microorganism of the genus Corynebacterium, wherein the lipoate protein ligase comprises an amino acid sequence having sequence number 1 or at least 90% sequence identity therewith.

3. A microorganism of the genus Corynebacterium, wherein the lipoate protein ligase in the first paragraph is LplA protein.

4. In the first paragraph, the microorganism is a microorganism of the genus Corynebacterium into which a lipoate protein ligase derived from Bacillus subtilis or a polynucleotide encoding the same has been introduced.

5. In the first paragraph, the microorganism of the genus Corynebacterium has enhanced activity of a glycine cleavage system.

6. A microorganism of the genus Corynebacterium, wherein the glycine cleavage system comprises at least one subunit selected from the group consisting of GcvP, GcvT, and GcvH polypeptides.

7. A microorganism of the genus Corynebacterium, wherein the glycine cleavage system in paragraph 5 is derived from Mycobacterium smegmatis.

8. In the first paragraph, the microorganism of the genus Corynebacterium is Corynebacterium glutamicum.

9. A method for producing pantothenic acid or pantoic acid, comprising a step of culturing a microorganism of the genus Corynebacterium according to any one of claims 1 to 8 in a medium.

10. A production method according to claim 9, further comprising a step of recovering pantothenic acid or pantoic acid from a medium or microorganism according to the culture.

11. A composition for producing pantothenic acid or pantoic acid, comprising a microorganism of the genus Corynebacterium according to any one of claims 1 to 8.

12. Use of a microorganism of the genus Corynebacterium according to any one of claims 1 to 8 for the production of pantothenic acid or pantoic acid.

Citation Information

Patent Citations

  • Roller Tightener for Powertrain

    KR1019920008383A

  • Promoter and uses thereof

    US10273491B2

  • Promoter and use thereof

    US10584338B2

  • Microorganism having increased activity of 3-methyl-2-oxobutanoate hydroxymethyltransferase, and use thereof

    US20240167065A1

  • Promoter sequences from Corynebacterium ammoniagenes

    US7662943B2