Polish-free hydrogel patterning
The polish-free hydrogel patterning technique addresses the issue of residual polymeric material in flow cells by confining hydrogel and primers to depressions, enhancing accuracy and reducing waste, thus improving sequencing efficiency.
Patent Information
- Application Number
- PCT/US2025/029510
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-05-20
- Filing Date
- 2025-05-15
- Publication Date
- 2025-11-27
AI Technical Summary
Existing methods for preparing flow cells in biological sequencing operations often result in residual polymeric material on interstitial regions, leading to library template contamination and reduced accuracy, and require polishing processes that increase material waste and complicate substrate preparation.
A polish-free hydrogel patterning technique is employed to form flow cells, involving the application of a protective coating and polymeric hydrogel layer within depressions while preserving primers, followed by selective etching to maintain the hydrogel and primers only in the depressions, thereby reducing contamination and simplifying the preparation process.
This method reduces pad hopping and material waste, enhances accuracy, and facilitates the use of non-circular substrates by ensuring the hydrogel and primers are confined to depressions, improving the overall efficiency and throughput of sequencing operations.
Smart Images

Figure US2025029510_27112025_PF_FP_ABST
Abstract
Description
POLISH-FREE HYDROGEL PATTERNING CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. Provisional Application S.N. 63 / 649,914, filed May 20, 2024, the content of each of which is incorporated by reference herein in its entirety. REFERENCE TO SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing, which has been submitted electronically in XML file format and is hereby incorporated by reference in its entirety. Said XML copy, created on April 10, 2024 is named IP-2757- PCT_Sequence_Listing.xml and is 17,763 bytes in size. BACKGROUND
[0003] Various protocols in biological or chemical research involve performing a large number of controlled reactions on local support surfaces or within predefined reaction chambers of a flow cell. The reactions may then be observed or detected, and subsequent analysis may help identify or reveal properties of molecules involved in the controlled reactions. In some examples, the reactions generate fluorescence, and thus an optical system that is configured for fluorescence detection may be used to analyze the controlled reactions. In other examples, the controlled reactions alter charge, conductivity, or some other electrical property of the molecule(s) being analyzed, and thus an electronic system may be used for detection. SUMMARY
[0004] Some biotechnological applications utilize a flow cell that includes a substrate having depressions (separated by interstitial regions) or a lane defined therein. The substrate may have a polymer layer within the depressions or within the lane and may be used for the preparation and / or analysis of biological molecules. For example, molecular analyses, such as certain nucleic acid sequencing methods, may operate using biological reactants (such as primers of aprimer set) that are attached to the polymer layer. In such nucleic acid sequencing methods, the primers may be capable of seeding DNA library templates thereto.
[0005] In some flow cells, a protective coating is formed over the polymer- coated substrate surface, such that the protective coating covers and passivates the polymer layer (and the primers attached thereto) within the depressions or the lane. When the polymer-coated substrate is ready to be used, the protective coating may be removed, e.g., using an etching or dissolving process, to expose the underlying polymer layer and the primers.
[0006] It may be desirable for the polymer layer to be positioned within the depressions / lane and absent from other substrate regions, such as the interstitial regions, e.g., to promote accuracy during sequencing operations. In some instances, it is desirable for the protective coating to be positioned over the polymer layer in order to preserve primers grafted thereto. Further, it may be desirable for the positioning of the protective coating and the polymer layer (within the depressions or the lane) to be performed using a polish-free process, so as to reduce the presence of residual polymeric material on the interstitial regions and to simplify flow cell preparation. Still further, positioning the protective coating and the polymer layer (within the depressions or the lane) via a polish-free process may reduce material waste, increase throughput, and aid in the preparation of substrates having a non-circular shape (e.g., panel-based substrates).
[0007] The methods disclosed herein may be very effective in generating interstitial regions that are free of surface chemistry. However, in some instances, the etching process can be continued to remove surface chemistry from the upper sidewalls of the depressions. This results in library templates that seed deeper into the depressions, and thus cannot readily jump to a nearby depression. In turn, this can reduce or prevent pad hopping, which refers to the process of several adjacent depressions being amplified from the same template sequence (i.e., library template contamination of nearby depressions which may lead to mixed clusters or identical sequence clusters in physically close depressions).
[0008] Disclosed herein are methods involving protective coatings and polish-free hydrogel patterning techniques, which can be used to form or prepare flow cells that are configured for use in a variety of biological sequencing operations.BRIEF DESCRIPTION OF THE DRAWINGS
[0009] Features of examples of the present disclosure will become apparent by reference to the following detailed description and drawings, in which like reference numerals correspond to similar, though perhaps not identical, components. For the sake of brevity, reference numerals or features having a previously described function may or may not be described in connection with other drawings in which they appear.
[0010] Fig.1A is a top view of an example flow cell;
[0011] Fig.1B is an enlarged, and partially cutaway cross-sectional, perspective view of an example of a lane formed in / on a substrate of the flow cell;
[0012] Fig.1C is an enlarged, and partially cutaway cross-sectional, perspective view of an example of an architecture (i.e., depressions) defined in a substrate of the flow cell;
[0013] Fig.2 is a schematic illustration of a flow cell including a complementary metal-oxide semiconductor (CMOS) imaging device that is coupled to a substrate of the flow cell;
[0014] Fig.3A through Fig.3E together depict a schematic illustration of an example of a polish-free method of patterning a substrate, where Fig.3A depicts depressions that are defined in a substrate, the depressions being separated from one another by interstitial regions, Fig.3B depicts a polymeric hydrogel layer applied over the structure of Fig.3A, Fig.3C depicts the formation of a protective coating including a plurality of primers over the structure of Fig.3B and the attachment of the primers to the polymeric hydrogel layer, Fig.3D depicts etching of the protective coating, the polymeric hydrogel layer, and the primers from the interstitial regions of Fig.3C, whereby a portion of each of the protective coating, the polymeric hydrogel layer, and the primers remain over the depressions, and Fig.3E depicts removing the (remaining) protective coating overlying the depressions and the exposure of the (remaining) polymeric hydrogel layer and the primers within the depressions;
[0015] Fig.4A through Fig.4F together depict a schematic illustration of another example of a polish-free method of patterning a substrate, where Fig.4A depicts depressions that are defined in a substrate, the depressions beingseparated by interstitial regions, Fig.4B depicts a polymeric hydrogel layer applied over the structure of Fig.4A, Fig.4C depicts a protective coating applied over the structure of Fig.4B, Fig.4D depicts etching of the protective coating and the polymeric hydrogel layer from the interstitial regions of Fig.4C, whereby portions of each of the protective coating and the polymeric hydrogel layer remain over the depressions, Fig.4E depicts removing the (remaining) protective coating overlying the depressions and the exposure of the (remaining) polymeric hydrogel layer within the depressions, and Fig.4F depicts primers that are grafted to the polymeric hydrogel layer within the depressions;
[0016] Fig.5A through Fig.5C together depict a schematic illustration of still another example of polish-free method of patterning a substrate, where Fig.5A depicts the structure of Fig.3D, Fig.5B depicts continued etching of the protective coating and the polymeric hydrogel layer from an upper portion of the depressions, whereby at least some of the protective coating and the polymeric hydrogel layer remain intact in a bottom portion of the depressions, and Fig.5C depicts removing the remaining protective coating;
[0017] Fig.6A through Fig.6D together depict a schematic illustration of yet another example of a polish-free method of patterning a substrate, where Fig.6A depicts the structure of Fig.4D, Fig.6B depicts continued etching of the protective coating and the polymeric hydrogel from an upper portion of the depressions, whereby at least some of the protective coating the polymeric hydrogel layer remain intact in a bottom portion of the depressions, Fig.6C depicts removing the remaining protective coating to expose the polymeric hydrogel layer remaining in the bottom portion of the depressions, and Fig.6D depicts primers that are grafted to the polymeric hydrogel layer in the bottom portion of the depressions; and
[0018] Fig.7A through Fig.7D depict the graphical results of etching processes that were performed on six example flow cells, with protective coating thickness being shown on the y axis (in nm), and etching time being shown on the x axis (in seconds). DETAILED DESCRIPTION
[0019] Disclosed herein are flow cells including protective coatings, and polish-free patterning techniques for flow cell materials, including the protectivecoatings and hydrogels. The structure of the flow cells (and methods of forming some aspects thereof) will be described in reference to Fig.1A through Fig.1C and in reference to Fig.2. Examples of methods that utilize the protective coating are described in reference to Fig.3A through Fig.3E, Fig.4A through Fig.4F, Fig.5A through Fig.5C, and Fig.6A through Fig.6D.
[0020] Definitions
[0021] It is to be understood that terms used herein will take on their ordinary meaning in the relevant art unless specified otherwise. Several terms used herein and their meanings are set forth below.
[0022] An “acrylamide monomer” refers to a monomer with the structure or a monomer including an acrylamide group. Examples of thean acrylamide group include azido acetamido pentyl may be used.reactive groups at the surface of a single layer substrate or at an outermost layer of a multi- layer substrate. Activation may be accomplished, for example, using silanization or plasma ashing. Though not explicitly shown in the figures, when activation of a surface is performed, it is to be understood that silane groups or –OH functional groups become introduced to the surface. These functional groups can then beused to covalently attach a material, such as a polymeric hydrogel, to the surface that includes the functional groups.
[0024] An “aldehyde” refers to an organic compound containing a functional group with the structure –CHO, which includes a carbonyl center (i.e., a carbon double-bonded to oxygen), with the carbon atom also being bonded to hydrogen and an R group (such as an alkyl or other side chain). The general structure of an aldehyde .
[0025] refers to a straight or branched hydrocarbon chain that isfully saturated (i.e., contains no double or triple bonds). The alkyl group may have 1 to 20 carbon atoms. Example alkyl groups include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tertiary butyl, pentyl, hexyl, and the like. As an example, the designation “C1-4 alkyl” indicates that there are one to four carbon atoms in the alkyl chain, i.e., the alkyl chain is selected from the group consisting of methyl, ethyl, propyl, isopropyl, n-butyl, isobutyl, sec-butyl, and tert-butyl.
[0026] “Alkenyl,” as used herein, refers to a straight or branched hydrocarbon chain containing one or more double bonds. The alkenyl group may have 2 to 20 carbon atoms. Example alkenyl groups include ethenyl, propenyl, butenyl, pentenyl, hexenyl, and the like.
[0027] “Alkyne” or “alkynyl,” as used herein, refers to a straight or branched hydrocarbon chain containing one or more triple bonds. The alkynyl group may have 2 to 20 carbon atoms.
[0028] “Aryl,” as used herein, refers to an aromatic ring or ring system (i.e., two or more fused rings that share two adjacent carbon atoms) containing carbon in the ring backbone. When the aryl is a ring system, every ring in the system may be aromatic. The aryl group may have 6 to 18 carbon atoms. Examples of aryl groups include phenyl, naphthyl, azulenyl, and anthracenyl.
[0029] An “amino” functional group refers to an -NRaRb group, where Ra andRb are each independently selected from hydrogen (e.g., ), C1-6 alkyl, C2-6alkenyl, C2-6 alkynyl, C3-7 carbocycle, C6-10 aryl, 5-10 membered heteroaryl, and 5-10 membered heterocyclyl, as defined herein.
[0030] The terms “attach,” “attached,” and “attachment,” as used herein, refer to the state of two things being joined, fastened, adhered, connected or bound to each other, either directly or indirectly. The terms may refer to chemical attachment or physical attachment. As examples of chemical attachment, a primer (e.g., of a primer set) can be attached to a polymeric hydrogel layer by a covalent or non-covalent bond. Enclosed versions of the flow cell disclosed herein may include a physical attachment where a lid is physically coupled to an unpatterned structure or to a patterned structure at a bonding region (e.g., using an adhesive) (see the lid 116 in Fig.2, which is physically attached to the substrate 14 via an intervening spacer layer 62).
[0031] An “azide” or “azido” functional group refers to -N3.
[0032] A “bonding region” refers to an area of a structure that can be bonded to another material, which may be, as examples, a spacer layer, a lid, another structure, etc., or combinations thereof (e.g., a spacer layer and a lid, or a spacer layer and another structure). The bond that can be formed at the bonding region may be a chemical bond (as described above), or a mechanical bond (e.g., using a fastener, etc.). The bonding region may be free of surface chemistry (e.g., may be free of polymeric hydrogel materials and / or primers). For example, the flow cell 10’ shown in Fig.2 includes a bonding region 21 where the substrate 14 can be sealed to the lid 116, e.g., via an intervening spacer layer 62. In examples of the open- wafer flow cell that include a “bonding region,” it is to be understood that the region is not used for bonding, but rather may be similar to interstitial regions that are free of surface chemistry.
[0033] A “carbocycle” refers to a non-aromatic cyclic ring or ring system containing only carbon atoms in the ring system backbone. When the carbocycle is a ring system, two or more rings may be joined together in a fused, bridged or spiro-connected fashion. Carbocycles may have any degree of saturation, provided that at least one ring in a ring system is not aromatic. Thus, carbocycles include cycloalkyls, cycloalkenyls, and cycloalkynyls. The carbocycle group may have 3 to 20 carbon atoms. Examples of carbocycle rings include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cyclohexenyl, 2,3-dihydro-indene, bicyclo[2.2.2]octanyl, adamantyl, and spiro[4.4]nonanyl.
[0034] The term “carboxylic acid” or “carboxyl” refers to -COOH.
[0035] The term “cycloalkyl” refers to a completely saturated (no double or triple bonds) mono- or multi- cyclic hydrocarbon ring system. When composed of two or more rings, the rings may be joined together in a fused fashion. Cycloalkyl groups can contain 3 to 10 atoms in the ring(s). In some examples, cycloalkyl groups can contain 3 to 8 atoms in the ring(s). A cycloalkyl group may be unsubstituted or substituted. Example cycloalkyl groups include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl.
[0036] As used herein, “cycloalkenyl” or “cycloalkene” refers to a carbocycle ring or ring system having at least one double bond, wherein no ring in the ring system is aromatic. Examples include cyclohexenyl or cyclohexene and norbornenyl or norbornene. One specific example of a cycloalkene is trans- cyclooctene (TCO). Also as used herein, “heterocycloalkenyl” or “heterocycloalkene” means a carbocycle ring or ring system with at least one heteroatom in ring backbone, having at least one double bond, wherein no ring in the ring system is aromatic.
[0037] As used herein, “cycloalkynyl” or “cycloalkyne” refers to a carbocycle ring or ring system having at least one triple bond, wherein no ring in the ring system is aromatic. An example is cyclooctyne. Another example is bicyclononyne. Also as used herein, “heterocycloalkynyl” or “heterocycloalkyne” means a carbocycle ring or ring system with at least one heteroatom in ring backbone, having at least one triple bond, wherein no ring in the ring system is aromatic.
[0038] The term “depositing,” as used herein, refers to any suitable application technique, which may be manual or automated, and, in some instances, results in modification of the surface properties or attachment of one substance to another. Generally, depositing may be performed using vapor deposition techniques, coating techniques, grafting techniques, or the like. Some specific examples include chemical vapor deposition (CVD), spray coating (e.g., ultrasonic spray coating), spin coating, dunk or dip coating, doctor blade coating, puddle dispensing, flow through coating / deposition, aerosol printing, screen printing, microcontact printing, inkjet printing, or the like.
[0039] The term “depression” refers to a discrete concave feature defined in a substrate and having a surface opening. In some instances, the surface openingis at least partially surrounded by interstitial region(s) of the substrate. Depressions can have any of a variety of shapes at their opening in a surface including, as examples, round, elliptical, square, polygonal, star shaped (with any number of vertices), etc. The cross-section of a depression taken orthogonally with the surface can be curved, square, polygonal, hyperbolic, conical, angular, etc. As examples, the depression can be a well or two interconnected wells.
[0040] The term “each,” when used in reference to a collection of items, is intended to identify an individual item in the collection, but does not necessarily refer to every item in the collection. Exceptions can occur if explicit disclosure or context clearly dictates otherwise.
[0041] The term “epoxy” as used herein refers .
[0042] The term “etch” as used herein refersremove a protective coating and a polymeric hydrogel from a substrate, such a reactive ion etching process (e.g., utilizing oxygen plasma or some other reactive plasma).
[0043] The term “flow cell” is intended to refer to a vessel having an enclosed or an open flow channel where a reaction can be carried out. A flow cell with an enclosed channel may also include an inlet for delivering reagent(s) to the channel and an outlet for removing reagent(s) from the channel. In some examples, the flow cell enables the detection of the reaction that occurs therein. For example, the flow cell can include one or more transparent surfaces allowing for the optical detection of arrays, optically labeled molecules, or the like. As another example, the flow cell can include a complementary metal oxide semiconductor (CMOS) chip coupled thereto, allowing for the electrical detection of arrays, optically labeled molecules, or the like.
[0044] A “flow channel” or “channel,” as used herein, may refer to (i) an area defined between two bonded components or may be (ii) a concave area, or lane, defined in a single substrate. In either case, the “flow channel” or “channel” can selectively receive a liquid sample, reagents, etc. In some examples, the flow channel may be defined between two substrates, and thus the flow channel may be in fluid communication with surface chemistry disposed on either of the two substrates. In other examples, the flow channel may be defined between one substrate and a lid, and thus the flow channel may be in fluid communication withsurface chemistry disposed on the one substrate. In still other examples, the flow channel may be defined by a concave area that is formed in a surface of a single substrate (e.g., without a lid), and thus the flow channel may be in fluid communication with surface chemistry within the concave area.
[0045] The term “heteroaryl” refers to an aromatic ring or ring system (i.e., two or more fused rings that share two adjacent atoms) that contain(s) one or more heteroatoms, that is, an element other than carbon, including but not limited to, nitrogen, oxygen and sulfur, in the ring backbone. When the heteroaryl is a ring system, every ring in the system is aromatic. The heteroaryl group may have 5-18 ring members.
[0046] The term “heterocycle” means a non-aromatic cyclic ring or ring system containing at least one heteroatom in the ring backbone. Heterocycles may be joined together in a fused, bridged or spiro-connected fashion. Heterocycles may have any degree of saturation provided that at least one ring in the ring system is not aromatic. In the ring system, the heteroatom(s) may be present in either a non-aromatic or aromatic ring. The heterocycle group may have 3 to 20 ring members (i.e., the number of atoms making up the ring backbone, including carbon atoms and heteroatoms). In some examples, the heteroatom(s) are O, N, or S.
[0047] The term “hydrazine” or “hydrazinyl,” as used herein, refers to a - NHNH2 group.
[0048] The term “hydrazone” or “hydrazonyl,” as used herein, refers to a group, in which Ra and Rb are each independently selected fromC1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C3-7 carbocycle, C6-10 aryl, 5-10 membered heteroaryl, and 5-10 membered heterocycle, as defined herein.
[0049] As used herein, “hydroxy” or “hydroxyl” refers to an –OH group.
[0050] The term “hydrogel” or “polymeric hydrogel” refers to a semi-rigid polymer that is permeable to liquids and / or gases. The hydrogel can swell when liquid (e.g., water) is taken up and that can contract when liquid is removed, e.g., by drying. While a hydrogel may absorb water, the examples described herein may not be water-soluble.
[0051] The term “interstitial region” refers to an area, e.g., of a substrate, that separates individual depressions from one another (see interstitial regions 24 separating depressions 34 in Fig.1C). The separation provided by an interstitial region can be partial or full separation.
[0052] “Nitrile oxide,” as used herein, refers to a “RaC≡N+O-” group in which Ra is defined herein. Examples of preparing nitrile oxide include in situ generation from aldoximes by treatment with chloramide-T or through action of base on imidoyl chlorides [RC(Cl)=NOH] or from the reaction between hydroxylamine and an aldehyde.
[0053] “Nitrone,” as used herein, group in which R1, R2, and R3may be any of the Ra and Rb3except that R is not hydrogen (H).
[0054] “Norbornene” or “oxynorbornene,” as used herein, refers to a strained, bridged, cyclic hydrocarbon including a cyclohexene ring and a methylene bridge between C1 and C4.
[0055] A “nucleotide” refers to a nitrogen-containing heterocyclic base (i.e., nitrogenous base), a sugar, and one or more phosphate groups. Each individual nucleotide is a monomeric unit of a nucleic acid sequence. In RNA (ribonucleic acid), the sugar is a ribose, and in DNA (deoxyribonucleic acid), the sugar is a deoxyribose, i.e., a sugar lacking a hydroxyl group that is present at the 2' position in ribose. The nitrogen containing heterocyclic base can be a purine base or a pyrimidine base. Purine bases include adenine (A) and guanine (G), and modified derivatives or analogs thereof. Pyrimidine bases include cytosine (C), thymine (T), and uracil (U), and modified derivatives or analogs thereof. The C-1 atom of deoxyribose is bonded to N-1 of a pyrimidine or N-9 of a purine. A nucleic acid analog may have any of the phosphate backbone, the sugar, or the nitrogen- containing heterocyclic base altered. Examples of nucleic acid analogs include, for example, universal bases or phosphate-sugar backbone analogs, such as peptide nucleic acid (PNA).
[0056] In some examples, the term “over” may mean that one component or material is positioned directly on another component or material. When one is directly on another, the two are in physical contact with each other. In Fig.1B, for example, when a multi-layer substrate 16 (including a base support 18 having an additional layer 20 positioned thereon) is used, the layer 20 is positioned directly “over” the base support 18, such that there is no intervening component or material therebetween.
[0057] In other examples, the term “over” may mean that one component or material is positioned indirectly on another component or material. By indirectly on, it is meant that a gap or an additional component or material may be positioned between the two components or materials. In Fig.1B, for example, when a multi- layer substrate 16 is utilized, the polymeric hydrogel 26 is indirectly over the base support 18. The layer 20 is positioned therebetween.
[0058] A “patterned structure” refers to a substrate that has been patterned with depressions (see the patterned structure 17 including depressions 34 separated by interstitial regions 24 in Fig.1C). In some examples, the substrate is exposed to patterning techniques (e.g., etching, nanoimprint lithography, photolithography, etc.) in order to generate the desired pattern(s). However, the term “patterned structure” is not intended to imply that such patterning techniques have to be used to generate the pattern. An “unpatterned structure” refers to a substrate having a concave feature or a lane defined therein (in which surface chemistry is included), but that does not include depressions defined within the lane (see the unpatterned structure 15 including the lane 22 in Fig.1B).
[0059] The term “polyhedral oligomeric silsesquioxane” (an example of which is commercially available under the tradename “POSS®” from Hybrid Plastics) refers to a chemical composition that is a hybrid intermediate (e.g., RSiO1.5) between that of silica (SiO2) and silicone (R2SiO). An example of polyhedral oligomeric silsesquioxane may be that described in Kehagias et al., Microelectronic Engineering 86 (2009), pp.776-778, which is incorporated by reference in its entirety. In an example, the composition is an organosilicon compound with the chemical formula [RSiO3 / 2]n, where the R groups can be the same or different. Example R groups for POSS® include epoxy, azide / azido, a thiol, a poly(ethyleneglycol), a norbornene, a tetrazine, acrylates, and / or methacrylates, or further, for example, alkyl, aryl, alkoxy, and / or haloalkyl groups.
[0060] As used herein, a “primer” refers to one or more linked nucleotides having a 3’ end and a 5’ end. The primers disclosed herein are single stranded nucleic acid sequences (e.g., single stranded DNA). Some primers, referred to herein as amplification primers, serve as a starting point for template amplification and cluster generation. Other primers, such as those referred to herein as sequencing primers, serve as a starting point for DNA synthesis. The primer may include a number of nucleotides ranging from 2 nucleotides to 200 nucleotides. It is to be understood, however, that the primer can be any number of bases long and can include a variety of non-natural nucleotides. In an example, the primer ranges from 10 to 150 bases, or from 10 to 60 bases, or from 20 to 40 bases, etc.
[0061] A “protective coating” refers to a material in the form of a solid (e.g., a thin film) or a gel that is applied over surface chemistry, for example, in a depression of a patterned substrate (see Fig.1C) or over a lane of an unpatterned substrate (sees Fig.1B). The protective coating may be water soluble (e.g., may include a water-soluble material, examples of which are described herein). The protective coating may be any water-soluble material that does not deleteriously affect the underlying surface chemistry or substrate and that serves to protect and / or preserve the functionality of the surface chemistry. The protective coating may at least substantially prevent the hydrogel layer (and in some instances, primers attached thereto) from undergoing deleterious changes during processing and / or shipping and / or storage. Further, the protective coating may preserve the accessibility of the primer attached to the hydrogel layer and at least substantially prevent degradation of the hydrogel layer.
[0062] A “spacer layer,” as used herein refers to a material that bonds two components together. In some examples, the spacer layer can be a radiation- absorbing material that aids in bonding, or can be put into contact with a radiation- absorbing material that aids in bonding.
[0063] The term “substrate” may be used herein in conjunction with the term “single layer substrate” or “multi-layer substrate.” A single layer substrate is one layer of a support material that can be imprinted to form a lane (see lane 22 in Fig. 1B) and / or that can be patterned with depressions (see depressions 34 in Fig.1C).The multi-layer substrate includes at least two layers, e.g., a base support with an additional layer thereon, where the additional layer can be imprinted to form the lane (see the substrate 16 including the base support 18 and the layer 20 shown in Fig.1B) and / or that can be patterned with depressions (see Fig.1C).
[0064] “Surface chemistry,” as defined herein, refers to a polymeric hydrogel layer and / or one or more (oligonucleotide) primers attached thereto. Surface chemistry may be disposed within a lane defined in a substrate surface (see the lane 22 in Fig.1B), or may be disposed within depressions defined in a substrate surface (see the depressions 34 in Fig.1C).
[0065] A “thiol” functional group refers to -SH.
[0066] The terms “tetrazine” and “tetrazinyl” refer to six-membered heteroaryl group comprising four nitrogen atoms. Tetrazine can be optionally substituted.
[0067] “Tetrazole,” as used herein, refers to five-membered heterocyclic group including four nitrogen atoms. Tetrazole can be optionally substituted.
[0068] The term “transparent” when describing a material (e.g., substrate, layer, etc.) means that that the material allows light of a particular wavelength or range of wavelengths to pass through. Transparency may be quantified using transmittance, i.e., the ratio of light energy falling on a body to that transmitted through the body. The transmittance of a transparent material will depend upon the thickness of the material and the wavelength of light. In the examples disclosed herein, the transmittance of the transparent material may range from 0.25 (25%) to 1 (100%). The material may be a pure material, a material with some impurities, or a mixture of materials, as long as the resulting material is capable of the desired transmittance. As an example, tantalum pentoxide (i.e., the inorganic compound with the formula Ta2O5) is transparent, having a transmittance ranging from about 0.25 (25%) to 1 (100%), to wavelengths ranging from about 0.35 µm (350 nm) to at least 1.8 µm (1800 nm). Additionally, depending upon the transmittance of the material, the time for light exposure and / or the output power of the light source may be increased or decreased to deliver a suitable dose of light energy through the transparent material to achieve the desired effect.
[0069] The singular forms “a”, “an”, and “the” include plural referents unless the context clearly dictates otherwise.
[0070] The terms comprising, including, containing and various forms of these terms are synonymous with each other and are meant to be equally broad.
[0071] The terms top, bottom, lower, upper, on, adjacent, etc. are used herein to describe the flow cell and / or the various components of the flow cell. It is to be understood that these directional terms are not meant to imply a specific orientation, but are used to designate relative orientation between components. The use of directional terms should not be interpreted to limit the examples disclosed herein to any specific orientation(s).
[0072] The terms first, second, etc. also are not meant to imply a specific orientation or order, but rather are used to distinguish one component from another.
[0073] Flow Cells
[0074] Examples of the flow cells disclosed herein generally include a substrate, a polymeric hydrogel layer positioned over the substrate, the polymeric hydrogel layer having one or more primers attached thereto, and a protective coating positioned over the polymeric hydrogel layer and the one or more primers. While not shown in Fig.1A through Fig.1C, in some instances, the primers are not attached to the polymeric hydrogel layer until the protective coating is removed therefrom.
[0075] Fig.1A depicts an example of the flow cell 10 from a top view. The flow cell 10 shown in Fig.1A may include patterned structure(s), unpatterned structure(s), and / or a lid. An example of an unpatterned structure 15 including a lane 22 defined therein is shown in Fig.1B, and an example of a patterned structure 17 that includes depressions 34 is shown in Fig.1C.
[0076] Enclosed examples of the flow cell 10 disclosed herein may include one unpatterned structure 15 or one patterned structure 17 bonded to a lid (lid not shown), e.g., at a bonding region 21 (as shown in Fig.1B). Enclosed examples of the flow cell 10 may alternatively include one (un)patterned structure 15, 17 bonded to another unpatterned or patterned structure 15 or 17 via a spacer layer at the bonding region 21 (the combination of the second structure and spacer layer are not shown). Open-wafer examples of the flow cell 10 include a single (un)patterned structure 15, 17, where the surface chemistry included in the single (un)patterned structure 15, 17 is open to a surrounding environment.
[0077] In some enclosed versions of the flow cell 10, the spacer layer used to attach the (un)patterned structure 15, 17 to the lid may be any material that will seal portions of the unpatterned structure 15 or patterned structure 17 and the lid. Alternatively, the spacer layer may be any material that will seal portions of the unpatterned structure 15 or patterned structure 17 and the second unpatterned or patterned structure. As examples, the spacer layer may be an adhesive, a radiation-absorbing material that aids in bonding, or the like. In some examples, the spacer layer is the radiation-absorbing material, e.g., KAPTON® black (DuPont de Nemours, Inc.).
[0078] In both enclosed and open-wafer versions of the flow cell 10, the (un)patterned structure 15, 17 of the flow cell 10 may be a single layer substrate 14. Alternatively, the (un)patterned structure 15, 17 may be a multi-layer substrate 16 including a base support 18 having a layer 20 positioned thereon. The single layer substrate 14 and the multi-layer substrate 16 are depicted in each of Fig.1B and Fig.1C.
[0079] Examples of suitable materials for the single layer substrate 14 include siloxanes (e.g., epoxy siloxane), glass, modified or functionalized glass, polymeric materials (including acrylics, polystyrene and copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethanes, polytetrafluoroethylene (such as TEFLON® from Chemours), polyethylene terephthalate (PET), polycarbonate, cyclic olefins / cyclo-olefin polymers (COP) (such as ZEONOR® from Zeon), polyimides, nylon (polyamides), etc.), ceramics / ceramic oxides, silica (i.e., silicon dioxide (SiO2)), fused silica, or silica- based materials, aluminum silicate, silicon and modified silicon (e.g., boron doped p+ silicon), silicon nitride (Si3N4), tantalum pentoxide (Ta2O5) or other tantalum oxide(s) (TaOx), hafnium oxide (HfO2), carbon, metals, resins, or the like. Examples of suitable resins include inorganic oxides, such as tantalum pentoxide (e.g., Ta2O5) or other tantalum oxide(s) (TaOx), aluminum oxide (e.g., Al2O3), silicon oxide (e.g., SiO2), hafnium oxide (e.g., HfO2), indium tin oxide, titanium dioxide, etc., or polymeric resins, such as a polyhedral oligomeric silsesquioxane based resin (e.g., POSS® from Hybrid Plastics), a non-polyhedral oligomeric silsesquioxane epoxy resin, a poly(ethylene glycol) resin, a polyether resin (e.g., ring opened epoxies), an acrylic resin, an acrylate resin, a methacrylate resin, anamorphous fluoropolymer resin (e.g., CYTOP® from Bellex), and combinations thereof. It is to be understood that the material of the substrate 14 may be any material that can be etched, imprinted, or manipulated to form the lane 22 shown in Fig.1B, or to form the depressions 34 shown in Fig.1C.
[0080] As mentioned, examples of the multi-layer substrate 16 include the base support 18 and at least one other layer 20 positioned thereon. Any example of the material of the single layer substrate 14 provided herein may be used as the material for the base support 18 of the multi-layer substrate 16. Examples of suitable materials for the layer 20 include inorganic oxides, such as tantalum oxide (e.g., Ta2O5), aluminum oxide (e.g., Al2O3), silicon oxide (e.g., SiO2), or hafnium oxide (e.g., HfO2), or polymeric resins, such as a polyhedral oligomeric silsesquioxane based resin (e.g., POSS® from Hybrid Plastics), a non-polyhedral oligomeric silsesquioxane epoxy resin, a poly(ethylene glycol) resin, a polyether resin (e.g., ring opened epoxies), an acrylic resin, an acrylate resin, a methacrylate resin, an amorphous fluoropolymer resin (e.g., CYTOP® from Bellex), and combinations thereof. It is to be understood that in examples of the flow cell 10 that include the substrate 16, the other layer 20 (positioned on the base support 18) may be any material that can be etched, imprinted, or manipulated to form the lane 22 shown in Fig.1B, or to form the depressions 34 shown in Fig.1C.
[0081] Suitable deposition techniques for the material(s) of the layer 20 include chemical vapor deposition, dip coating, dunk coating, spin coating, spray coating, puddle dispensing, ultrasonic spray coating, doctor blade coating, aerosol printing, screen printing, microcontact printing, etc. It is to be understood that the deposition technique(s) that is / are used may depend, in part, upon the material used for the layer 20.
[0082] The single layer substrate 14 or the base support 18 (of the multi- layer substrate 16) may be a circular sheet, a panel, a wafer, a die etc. having a diameter ranging from about 2 mm to about 300 mm, e.g., from about 200 mm to about 300 mm, or may be a rectangular sheet, panel, wafer, die etc. having its largest dimension up to about 10 feet (~ 3 meters). For example, a die may have a width ranging from about 0.1 mm to about 10 mm. While example dimensions have been provided, it is to be understood that a substrate 14 or base support 18 with any suitable dimensions may be used.
[0083] The thickness of the layer 20 (when the substrate 16 is used) is variable. In examples of the flow cell 10 that include depressions 34 (as in Fig.1C), the thickness of the layer 20 is greater than the desired depth for the depressions 34 formed therein. In examples of the flow cell 10 that include the lane 22 (as in Fig.1B), the thickness of the layer 20 is greater than the desired depth for the lane 22 formed therein, when the lane 22 is a concave feature in the substrate 14, 16.
[0084] Suitable patterning techniques for the substrate 14 (or for the layer 20 of the substrate 16) include photolithography, nanoimprint lithography (NIL), stamping techniques, embossing techniques, molding techniques, microetching techniques, etc. It is to be understood that the patterning technique(s) that is / are used may depend, in part, upon the material used for the substrate 14 or for the layer 20 of the substrate 16.
[0085] As will be described in more detail in reference to the methods disclosed herein, in some instances, the substrate 14 or the layer 20 of the substrate 16 is activated (e.g., is silanized or has been subjected to plasma ashing). In these instances, the substrate 14 or the layer 20 includes surface functional groups (e.g., -OH groups) that facilitate the attachment of the polymeric hydrogel 26 to the substrate 14 or to the layer 20.
[0086] Regardless of whether the substrate 14 or 16 is used (and regardless of the patterned structure 17 or unpatterned structure 15 that is used), the enclosed flow cell 10 and / or the open-wafer flow cell 10 may include one or more flow channel(s) 12. In the enclosed flow cell 10, the flow channel(s) 12 is / are defined between the one (un)patterned structure 15, 17 and the lid (not shown) or between the one (un)patterned structure 15, 17 and the second (un)patterned structure (not shown), which are bonded together via the spacer layer. Thus, the flow channel(s) 12 in the enclosed form of the flow cell 10 is / are defined by the unpatterned structure 15 or patterned structure 17, the spacer layer, and either the lid or the second patterned or unpatterned structure.
[0087] Alternatively, in the open-wafer form of the flow cell 10, a single unpatterned structure 15 or patterned structure 17 is included, and the flow channel(s) 12 may be defined by the lane 22 that has been defined in the single patterned structure 17 or unpatterned structure 15 (e.g., via nanolithography).
[0088] The depth of each flow channel 12 in the enclosed versions of the flow cell 10 can be as small as a monolayer thick when microcontact, aerosol, or inkjet printing is used to deposit a separate material (e.g., the spacer layer) that defines at least a portion of the sidewalls of the flow channel 12. This depth could be thicker if the spacer layer is pre-formed or applied via another technique. The depth of the flow channel 12 in some of the open-wafer versions of the flow cell 10 is approximately equivalent to the depth of the lane 22. For other examples, the depth of the flow channel 12 can be about 1 μm, about 10 μm, about 50 μm, about 100 μm, or more. In an example, the depth may range from about 10 μm to about 400 μm. In another example, the depth may range from about 10 μm to about 30 μm. In still another example, the depth is about 5 μm or less. It is to be understood that the depth of the flow channel 12 may be greater than, less than or between the values specified above.
[0089] The example flow cell 10 shown in Fig.1A includes eight flow channels 12. While eight flow channels 12 are shown in Fig.1A, it is to be understood that any number of flow channels 12 may be included in the flow cell 10 (e.g., a single flow channel 12, four flow channels 12, twelve flow channels 12, etc.). When multiple flow channels 12 are included in the flow cell 10, each flow channel 12 may be isolated from another flow channel 12 so that fluid introduced into one flow channel 12 does not flow into (an) adjacent flow channel(s) 12.
[0090] Regardless of the number of flow channels 12 that are included in the flow cell 10, each flow channel 12 may have any desirable shape. In an example, the flow channel 12 has a substantially rectangular configuration with curved ends (as shown in Fig.1A). The length of the flow channel 12 depends, in part, upon the size of the substrate 14 or 16 used to form the unpatterned or patterned structure 15, 17. The width of each flow channel 12 depends, in part, upon the size of the substrate 14 or 16 used to form the unpatterned or patterned structure 15, 17, the desired number of flow channels 12, the desired number of depressions 34 (when included), and the desired space at a perimeter of the unpatterned or patterned structure 15, 17.
[0091] Each flow channel 12 that is included in the flow cell 10 may be in fluid communication with an inlet and an outlet (not shown in Fig.1A through Fig. 1C). The inlet and outlet of each flow channel 12 may be positioned at opposedends of the flow cell 10. The inlets and outlets of the respective flow channels 12 may alternatively be positioned anywhere along the length and width of the flow channel 12 that enables desirable fluid flow.
[0092] The inlet allows fluid(s) to be introduced into the flow channel 12, and the outlet allows fluid(s) to be extracted from the flow channel 12. Each of the inlet(s) and outlet(s) is / are fluidly connected to a fluidic control system (e.g., reservoirs, pumps, valves, waste containers, and the like) that controls fluid introduction and expulsion. Some examples of the fluids that may be introduced into the flow channel(s) 12 include reaction components (e.g., DNA library templates, polymerases, sequencing primers, nucleotides, etc.), washing solutions, etc.
[0093] As described, and as shown in Fig.1B and Fig.1C, the lane 22 or the depressions 34 may include the polymeric hydrogel 26, and the polymeric hydrogel 26 forms a layer 26’ in the lane 22 of the unpatterned structure 15 (see Fig.1B) or in each depression 34 of the patterned structure 17 (see Fig.1C).
[0094] The polymeric hydrogel 26 may be any gel material that can swell when liquid is taken up and that can contract when liquid is removed, e.g., by drying. In an example, the polymeric hydrogel 26 includes an acrylamide copolymer, such as poly N-(5-azidoacetamidylpentyl)acrylamide-co-acrylamide, PAZAM. PAZAM and some other forms of the acrylamide copolymer are represented by the following structure (I):wherein: RAis selected from the group consisting of azido, optionally substituted amino, optionally substituted alkenyl, optionally substituted alkyne, halogen,optionally substituted hydrazone, optionally substituted hydrazine, carboxyl, hydroxy, optionally substituted tetrazole, optionally substituted tetrazine, nitrile oxide, nitrone, sulfate, and thiol; RBis H or optionally substituted alkyl; RC, RD, and REare each independently selected from the group consisting of H and optionally substituted alkyl; each of the -(CH2)p- can be optionally substituted; p is an integer in the range of 1 to 50; n is an integer in the range of 1 to 50,000; and m is an integer in the range of 1 to 100,000.
[0095] One of ordinary skill in the art will recognize that the arrangement of the recurring “n” and “m” features in structure (I) are representative, and the monomeric subunits may be present in any order in the polymer structure (e.g., random, block, patterned, or a combination thereof).
[0096] The molecular weight of PAZAM and other forms of the acrylamide copolymer may range from about 5 kDa to about 1500 kDa or from about 10 kDa to about 1000 kDa. In a specific example, the molecular weight of the acrylamide copolymer is about 312 kDa.
[0097] In some examples, PAZAM and other forms of the acrylamide copolymer are linear polymers. In some other examples, PAZAM and other forms of the acrylamide copolymer are lightly cross-linked polymers.
[0098] In other examples, the gel material may be a variation of the structure (I). In one example, the acrylamide unit may be replaced with N,N-dimethylacrylamide ). In this example, the acrylamide unit instructure (I) may be replaced wit , where RD, RE, and RFare each H or a C1-C6 alkyl, and a C1-C6 alkyl (instead of H as is the case with the acrylamide). In this example, q may be an integer in the range of 1 to 100,000. In another example, the N,N-dimethylacrylamide may be used in addition to the acrylamide unit. In this example, structure (I) may include in addition to the recurring “n” and “m” features, whereH or a C1-C6 alkyl, and RGand RHare each a C1-C6 alkyl. In this example, q may be an integer in the range of 1 to 100,000.
[0099] As another example of the polymeric hydrogel 26, the recurring “n” feature in structure (I) may be replaced with a monomer including a heterocyclic azido group having structure (II):wherein R1is H or a C1-C6 alkyl; R2 is H or a C1-C6 alkyl; L is a linker including a linear chain with 2 to 20 atoms selected from the group consisting of carbon, oxygen, and nitrogen and 10 optional substituents on the carbon and any nitrogen atoms in the chain; E is a linear chain including 1 to 4 atoms selected from the group consisting of carbon, oxygen and nitrogen, and optional substituents on the carbon and any nitrogen atoms in the chain; A is an N substituted amide with an H or a C1-C4 alkyl attached to the N; and Z is a nitrogen containing heterocycle. Examples of Z include 5 to 10 carbon-containing ring members present as a single cyclic structure or a fused structure. Some specific examples of Z include pyrrolidinyl, pyridinyl, or pyrimidinyl.
[0100] As still another example, the polymeric hydrogel 26 may include a recurring unit of each of structure (III) and (IV):wherein each of R1a, R2a, R1band R2bis independently selected from hydrogen, an optionally substituted alkyl or optionally substituted phenyl; each of R3aand R3bisindependently selected from hydrogen, an optionally substituted alkyl, an optionally substituted phenyl, or an optionally substituted C7-C14 aralkyl; and each of L1and L2is independently selected from an optionally substituted alkylene linker or an optionally substituted heteroalkylene linker.
[0101] It is to be understood that other polymeric hydrogel materials may be used, with the understanding that the hydrogel materials are suitable for grafting primers thereto. Some additional examples of suitable materials for the polymeric hydrogel 26 include functionalized polysilanes, such as azido silane, amine functionalized silane, or any other polysilane having functional groups that can attach the desired biological reactants / primers. Other examples of suitable polymeric hydrogels 26 include those having a polymer mesh structure, such as gelatin (which includes amine groups) or other polypeptides; or a cross-linked polymer structure, such as an azidolyzed version of silane free acrylamide (SFA).
[0102] The polymeric hydrogel 26 may be formed using any suitable copolymerization process and may be deposited using any of the methods disclosed herein. For at least some of the deposition techniques, the polymeric hydrogel 26 may be incorporated into a mixture or solution, e.g., with water or with ethanol and water, and then applied within the lane 22 or within the depressions 34. In some instances, the polymeric hydrogel 26 is a cured hydrogel (e.g., that has been cured using heat, UV / high energy light, or the like). In these instances, the polymeric hydrogel 26 may first be applied as the polymeric hydrogel mixture or solution (with the water and the ethanol) and then subsequently cured to form the polymeric hydrogel layer 26’.
[0103] The attachment of the polymeric hydrogel 26 to the substrate 14 or to the layer 20 of the multi-layer substrate 16 may be through covalent bonding. As described, in some instances, the substrate 14 or the layer 20 of the substrate 16 is activated to facilitate the covalent bonding of the hydrogel 26 / hydrogel layer 26’ to the substrate 14 or to the layer 20. Activation of the substrate 14 or layer 20, when performed, facilitates the attachment of the polymeric hydrogel 26 / polymeric hydrogel layer 26’ to the substrate 14 or layer 20. Covalent linking is helpful for maintaining the primers (attached to the polymeric hydrogel (layer) 26 (26’)) at desired regions of the substrate 14 or layer 20 throughout the lifetime of the flow cell 10 and during a variety of uses.
[0104] The flow cell 10 may include the unpatterned structure 15 shown in Fig.1B (having the lane 22 defined therein). In this example, the polymeric hydrogel layer 26’ is positioned within the lane 22 and includes functional groups that are capable of attaching the primers to the hydrogel layer 26’.
[0105] Alternatively, the flow cell 10 may include the patterned structure 17 shown in Fig.1C having the plurality of depressions 34 defined therein. In the example shown in Fig.1C, the polymeric hydrogel layer 26’ is positioned within each of the depressions 34 and includes functional groups that are capable of attaching primers to the hydrogel layer 26’.
[0106] Many different layouts of the depressions 34 and interstitial regions 24 (when included) may be envisaged, including regular, repeating, and non-regular patterns. In an example, the depressions 34 are disposed in a hexagonal grid for close packing and improved density. Other layouts of the depressions 34 may include, for example, rectilinear (rectangular) layouts, triangular layouts, and so forth. In some examples, the layout or pattern can be an x-y format in rows and columns. In other examples, the layout or pattern can be a repeating arrangement of the depressions 34 and the interstitial regions 24. In still other examples, the layout or pattern can be a random arrangement of the depressions 34 and the interstitial regions 24.
[0107] The layout or pattern of the depressions 34 may be characterized with respect to the density (number) of the depressions 34 in a defined area. For example, the depressions 34 may be present at a density of approximately 2 million per mm2. The density may be tuned to different densities including, for example, a density of about 100 per mm2, about 1,000 per mm2, about 0.1 million per mm2, about 1 million per mm2, about 2 million per mm2, about 5 million per mm2, about 10 million per mm2, about 50 million per mm2, or more, or less. It is to be further understood that the density can be between one of the lower values and one of the upper values selected from the ranges above, or that other densities (outside of the given ranges) may be used. As examples, a high density array may be characterized as having the depressions 34 separated by less than about 100 nm, a medium density array may be characterized as having the depressions 34 separated by about 400 nm to about 1 µm, and a low density array may be characterized as having the depressions 34 separated by greater than about 1 µm.
[0108] The layout or pattern of the depressions 34 may also or alternatively be characterized in terms of the average pitch, or the spacing from the center of one depression 34 to the center of an immediately adjacent depression 34. Alternatively, the average pitch may refer to the spacing from a left edge of one depression 34 to the left edge of an immediately adjacent depression 34. As an additional alternative, the average pitch may refer to the spacing from the right edge of one depression 34 to the right edge of an immediately adjacent depression 34. The pattern can be regular, such that the coefficient of variation around the average pitch is small, or the pattern can be non-regular in which case the coefficient of variation can be relatively large. In either case, the average pitch can be, for example, about 50 nm, about 0.15 μm, about 0.5 μm, about 1 μm, about 5 μm, about 10 μm, about 100 μm, or more or less. The average pitch for a particular pattern of depressions 34 can be between one of the lower values and one of the upper values selected from the ranges herein.
[0109] The size of each of the depressions 34 may be characterized by the volume, opening area, depth, and / or diameter or length and width of the depressions 34. For example, the volume can range from about 1×10−3μm3to about 100 μm3, e.g., about 1×10−2μm3, about 0.1 μm3, about 1 μm3, about 10 μm3, or more, or less. For another example, the opening area can range from about 1×10−3μm2to about 100 μm2, e.g., about 1×10−2μm2, about 0.1 μm2, about 1 μm2, at least about 10 μm2, or more, or less. For still another example, the depth can range from about 0.1 μm to about 100 μm, e.g., about 0.1 μm, about 0.5 μm, about 1 μm, about 10 μm, or more, or less. For another example, the depth can range from about 0.1 μm to about 100 μm, e.g., about 0.5 μm, about 1 μm, about 10 μm, or more, or less. For yet another example, the diameter or each of the length and width can range from about 0.1 μm to about 100 μm, e.g., about 0.5 μm, about 1 μm, about 10 μm, or more, or less.
[0110] As shown in Fig.1B and Fig.1C, the polymeric hydrogel layer 26’ of the flow cell 10 (within the depressions 34 or within the lane 22) may include two primers 30, 32 attached thereto. The primers 30, 32, when included as part of the flow cell 10, may form a primer set and may be different with respect to one another (e.g., in terms of the individual nucleotides that make up each of the primers 30, 32). As will be explained in more detail in reference to the example methoddepicted in Fig.4A through Fig.4F, in some examples, the primers 30, 32 are grafted after the protective coating 28 has been removed from the flow cell 10. In these examples, the primers 30, 32 are not present on the polymeric hydrogel layer 26’ in the lane 22 or in the depressions 34 of the flow cell 10 and are included in a separate solution or mixture (e.g., a primer grafting solution / mixture).
[0111] In an example, the primers 30, 32 are amplification oligonucleotides. In this example, the amplification oligonucleotides can be immobilized to the polymeric hydrogel layer 26’ by single point covalent attachment at or near the 5’ end of the primers 30, 32. This attachment leaves i) an adapter-specific portion of the primers 30, 32 free to anneal to its cognate sequencing-ready nucleic acid fragment and ii) the 3’ hydroxyl group of the primers 30, 32 free / available for nucleotide extension. Any suitable covalent attachment may be used for this purpose. By “adapter-specific,” it is meant that the individual nucleotide(s) that make up each of the primers 30, 32 at or near the 3’ end are selected to be complementary to desired base pairs, such as base pairs that make up adapter sequences attached to molecules (e.g., library templates) being amplified.
[0112] In examples in which different primers 30, 32 are used as part of a set, the primers 30, 32 may be used in sequential paired end sequencing. As examples, the primers 30, 32 may respectively include P5 and P7 primers, P15 and P7 primers, or any combination of the PA primers, the PB primers, the PC primers, and the PD primers set forth hereinbelow. As further examples, the primers 30, 32 may respectively include any two PA, PB, PC, and PD primers, or any combination of one PA primer and one PB, PC, or PD primer, or any combination of one PB primer and one PC or PD primer, or any combination of one PC primer and one PD primer.
[0113] Specific examples of suitable primers for the different primers 30, 32 include P5 and P7 primers used on the surface of commercial flow cells sold by Illumina Inc. for sequencing on HISEQ™, HISEQX™, MISEQ™, MISEQDX™, MINISEQ™, NEXTSEQ™, NEXTSEQDX™, NOVASEQ™, NOVASEQX™, GENOME ANALYZER™, ISEQ™, and other instrument platforms.
[0114] The P5 primer (which may be a cleavable primer due to the cleavable nucleobase uracil or “n”) is:P5 #1: 5’ → 3’ AATGATACGGCGACCACCGAGAUCTACAC (SEQ. ID. NO.1); P5 #2: 5’ → 3’ AATGATACGGCGACCACCGAGAnCTACAC (SEQ. ID. NO.2) where “n” is inosine in SEQ. ID. NO.2; or P5 #3: 5’ → 3’ AATGATACGGCGACCACCGAGAnCTACAC (SEQ. ID. NO.3) where “n” is alkene-thymidine (i.e., alkene-dT) in SEQ. ID. NO.3. The P7 primer (which may be a cleavable primer) may be any of the following: P7 #1: 5’ → 3’ CAAGCAGAAGACGGCATACGAnAT (SEQ. ID. NO.4) where “n” is 8-oxoguanine in SEQ. ID. NO.4; P7 #2: 5’ → 3’ CAAGCAGAAGACGGCATACnAGAT (SEQ. ID. NO.5) where “n” is 8-oxoguanine in SEQ. ID. NO.5; P7 #3: 5’ → 3’ CAAGCAGAAGACGGCATACnAnAT (SEQ. ID. NO.6) where both instances of “n” are 8-oxoguanine in SEQ. ID. NO.6; P7 #4: 5’ → 3’ CAAGCAGAAGACGGCATACGAUAT (SEQ. ID. NO.7); orP7 #5: 5’ → 3’ CAAGCAGAAGACGGCATACUAGAT (SEQ. ID. NO.8). The P15 primer (shown as a cleavable primer) is: P15: 5’ → 3’ AATGATACGGCGACCACCGAGAnCTACAC (SEQ. ID. NO.9) where “n” is allyl-T (i.e., a thymine nucleotide analog having an allyl functionality). The other primers (PA-PD, shown as non-cleavable primers) mentioned above include: PA 5’ → 3’ GCTGGCACGTCCGAACGCTTCGTTAATCCGTTGAG (SEQ. ID. NO.10); PB 5’ → 3’ CGTCGTCTGCCATGGCGCTTCGGTGGATATGAACT (SEQ. ID. NO.11); PC 5’ → 3’ ACGGCCGCTAATATCAACGCGTCGAATCCGCAACT (SEQ. ID. NO.12); and PD 5’ → 3’ GCCGCGTTACGTTAGCCGGACTATTCGATGCAGC (SEQ. ID. NO.13). While not shown in the example sequences for PA-PD, it is to be understood that any of these primers may include a cleavage site, such as uracil, 8-oxoguanine, allyl-T, etc. at any point in the strand. It is to be further understood that the cleavage sites of the primers 30, 32 that make up a primer set are orthogonal, i.e., the cleavage site of one of the primers 30, 32 is not susceptible to a cleaving agent used to remove the cleavage site of the other of the primers 32, 30, and vice versa.
[0115] Each of the primers 30, 32 disclosed herein may also include a polyT sequence at or near the 5’ end of the primer sequence. In some examples, thepolyT region includes from 2 T bases to 20 T bases. As specific examples, the polyT region may include 3, 4, 5, 6, 7, or 10 T bases.
[0116] The flow cell 10 shown in Fig.1A through Fig.1C further includes a protective coating 28 over the polymeric hydrogel layer 26’. In Fig.1B, the protective coating 28 is positioned over the lane 22 of the unpatterned substrate 15, and in Fig.1C, the protective coating 28 is positioned over each of the depressions 34 of the patterned substrate 17 (and is absent from the interstitial regions 24 between the depressions 34). The protective coating 28 passivates the polymeric hydrogel layer 26’ and the primers 30, 32 attached thereto (when the primers 30, 32 are present). In examples, the protective coating 28 is a water-soluble protective coating 28.
[0117] In some examples, the protective coating 28 comprises a non-cationic synthetic polymer, a natural polysaccharide or a derivative thereof, a natural protein or a derivative thereof, a water-soluble salt, a buffer, a water-soluble surfactant, a sugar, a chelator, a buffer, or a combination thereof. In examples, the protective coating 28 comprises: (a) the non-cationic synthetic polymer, and wherein the non- cationic synthetic polymer is selected from the group consisting of polyacrylamide, poly(acrylic acid), polyacrylate, poly(methacrylic acid), poly(vinyl pyrrolidone), poly(vinyl alcohol), poly (methacrylamide), a poly(N-alkyl acrylamide), a poly(N- dialkyl acrylamide), poly(N-(2-hydroxypropyl)methacrylamide), poly(divinyl ether- maleic anhydride), a poly(phosphate), a poly(2-alkyl-2-oxazoline), poly(hydroxyethyl methacrylate), poly(2-hydroxyethyl acrylate), polyethylene glycol, a polyether, poly(sulfobetaine methacrylate), poly(vinyl ether-maleic acid), a hydroxyl functional polymer, a non-natural polypeptide, a silicone, and a combination thereof; or (b) the natural polysaccharide or the derivative thereof, and wherein the natural polysaccharide or the derivative thereof is selected from the group consisting of starch, carboxymethylcellulose, xanthan gum, pectin, dextran, carrageenan, guar gum, cellulose, hydroxypropylmethyl cellulose (HPMC), hydroxypropyl cellulose (HPC), hydroxyethyl cellulose (HEC), methyl cellulose, carboxymethylhydroxyethyl cellulose (CMHEC), hyaluronic acid, starch phosphate, hydroxypropyl starch, hydroxyethyl starch, agarose, agar, alginate, and a combination thereof; or (c) the natural protein or the derivative thereof, and wherein the natural protein or the derivative thereof is selected from the group consisting of casein, albumin,fibrinogen, and polylysines; or (d) the water-soluble salt, and wherein the water- soluble salt is selected from the group consisting of sodium chloride, sodium bromide, sodium sulfate, sodium phosphate, sodium carbonate, sodium acetate, sodium citrate, potassium chloride, potassium bromide, potassium sulfate, potassium phosphate, potassium carbonate, potassium acetate, potassium citrate, saline sodium citrate, and a combination thereof; or (e) the buffer, and wherein the buffer is selected from the group consisting of an aqueous solution of saline sodium citrate, tris(hydroxymethyl)aminomethane (Tris) optionally with ethylenediaminetetraacetic acid, 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), 3-[[1,3-dihydroxy-2-(hydroxymethyl)propan-2-yl]amino]-2- hydroxypropane-1-sulfonic acid (TAPSO), N-(2-hydroxy-1,1- bis(hydroxymethyl)ethyl)glycine (tricine), 3-(N-morpholino)propanesulfonic acid (MOPS), and 3-(N,N-bis([2-hydroxyethyl]amino)-2-hydroxypropanesulfonic acid (DIPSO); or (f) the water-soluble surfactant, and wherein the water-soluble surfactant is selected from the group consisting of an anionic or nonionic surfactant, an alkyl ethoxylate, an ethoxylated oil, a fat, and a sulfosuccinate; or (g) the sugar, and wherein the sugar is selected from the group consisting of an antioxidant, a glycol, glycerol, and cyclodextrin; or (h) the chelator, and wherein the chelator is selected from the group consisting of ethylenediaminetetraacetic acid sodium salt, tris(3-hydroxypropyltriazolylmethyl)amine, (tris(2- carboxyethyl)phosphine), and bathophenanthrolinedisulfonic acid disodium salt; or (i) a combination thereof.
[0118] An example of a suitable non-cationic synthetic polymer is a polyvinyl alcohol / polyethylene glycol graft copolymer (one example of which includes KOLLICOAT® IR, available from BASF Corp.). An example of a suitable hydroxyl functional polymer is commercially available from BASF Corp. under the tradename KOLLICOAT® IR. Any of the non-cationic synthetic polymers that include acid groups may be used in an alkali metal salt form.
[0119] In some of the examples disclosed herein, the protective coating 28 may be a polyvinyl alcohol / polyethylene glycol graft copolymer (e.g., KOLLICOAT® IR, available from BASF Corp.), sucrose, dextran (e.g., molecular weight of 200,000 Da), polyacrylamide (e.g., molecular weight of 40,000 Da, 200,000 Da, etc.), polyethylene glycol, ethylenediaminetetraacetic acid sodium salt (i.e., EDTA),tris(hydroxymethyl)aminomethane with ethylenediaminetetraacetic acid, (tris(2- carboxyethyl)phosphine), tris(3-hydroxypropyltriazolylmethyl)amine, bathophenanthrolinedisulfonic acid disodium salt, hydroxyl functional polymers, glycerol, or saline sodium citrate. In some other of the examples disclosed herein, the protective coating 28 may be a polyvinyl alcohol / polyethylene glycol graft copolymer, sucrose, polyacrylamide, or polyethylene glycol. In some of these other examples, the graft copolymer comprises about 75% polyvinyl alcohol and about 25% polyethylene glycol.
[0120] In some instances, the protective coating 28 is first applied as a protective coating solution / mixture and subsequently cured to form the protective coating 28. In some of these examples, the protective coating solution / mixture includes the primers 30, 32. In these instances, the primers 30, 32 may be mixed with a protective coating solution, which can be applied (and in some instances, cured) to form the protective coating 28.
[0121] It is to be understood that the protective coating is removable. In other words, when the flow cell 10 is ready to be used or at any other desired time, the protective coating 28 may be removed from the depressions 34 or from the lane 22 to expose the underlying polymeric hydrogel layer 26’. Techniques that may be used to remove the protective coating 28 from the flow cell 10 are described in more detail in reference to Fig.3A through Fig.3E and Fig.4A through Fig.4F.
[0122] The thickness of the protective coating 28 may range from about 5 nm to about 1,000 nm, or from about 10 nm to about 750 nm, or from about 50 nm to about 500 nm, or from about 15 nm to about 200 nm, or from about 25 nm to about 150 nm, or from about 100 nm to about 125 nm. It is to be understood that other thicknesses may be used.
[0123] In addition to the protective coating 28, in some instances, the flow cell 10 further includes a complementary metal oxide semiconductor (CMOS) chip 94 coupled to a bottom of the substrate 14, which forms the flow cell 10’ shown in Fig.2. For ease of illustration, the substrate 14 is shown in Fig.2. It is to be understood, however, that when the multi-layer substrate 16 (including the base support 18 having the layer 20 thereon) is used, the CMOS chip 94 may be coupled to the bottom of the base support 18 of the substrate 16.
[0124] While the flow cell 10’ depicted in Fig.2 is shown as an enclosed version with a lid 116, it is to be understood that other enclosed versions of the flow cell 10’ may be used, such as a flow cell 10’ including two patterned structures 17 that are bonded together. Further, open-wafer versions of the flow cell 10’ may be used, where a single patterned structure 17 is open to the surrounding environment and is coupled to the CMOS chip 94.
[0125] Moreover, for further ease of illustration, the substrate 14 of the flow cell 10’ of Fig.2 is shown as being the patterned structure 17, meaning that the substrate 14 includes a plurality of depressions 34 separated by interstitial regions 24, each of the depressions 34 including the polymeric hydrogel layer 26’ and the primers 30, 32. While the flow cell 10’ shown in Fig.2 includes the depressions 34, the flow cell 10’ of Fig.2 may alternatively include the lane 22 defined therein, where the lane 22 has the polymeric hydrogel layer 26’ and the primers 30, 32 therein (similar to the unpatterned structure 15 shown in Fig.1B).
[0126] In the illustrated example, the substrate 14 of the flow cell 10’ may be affixed directly to, and thus be in physical contact with, the CMOS chip 94 through one or more securing mechanisms (e.g., adhesive, bond, fasteners, and the like). It is to be understood that the substrate 14 (or the base support 18 of the substrate 16) may be removably coupled to the CMOS chip 94.
[0127] The CMOS chip 94 includes a plurality of stacked layers 96 including, for example, silicon layer(s), dielectric layer(s), metal-dielectric layer(s), metal layer(s), etc.). The stacked layers 96 make up the device circuitry, which includes detection circuitry.
[0128] The CMOS chip 94 includes optical components, such as optical sensor(s) 98 and optical waveguide(s) 100. The optical components may be arranged such that each optical sensor 98 at least substantially aligns with, and thus is operatively associated with, a single optical waveguide 100 and a single depression 34 of the flow cell 10’. However, in other examples, a single optical sensor 98 may receive photons through more than one optical waveguide 100 and / or from more than one depression 34. In these other examples, the single optical sensor 98 is operatively associated with more than one optical waveguide 100 and / or more than one depression 34. In an example including the lane 22, it isto be understood that multiple optical waveguides 100 and optical sensors 98 may be positioned to receive signals from different portions of the lane 22.
[0129] As used herein, a single optical sensor 98 may be a light sensor that includes one pixel or more than one pixel. As an example, each optical sensor 98 may have a detection area that is less than about 50 µm2. As another example, the detection area may be less than about 10 µm2. As still another example, the detection area may be less than about 2 µm2. In the latter example, the optical sensor 98 may constitute a single pixel. An average read noise of each pixel of the optical sensor 98 may be, for example, less than about 150 electrons. In other examples, the read noise may be less than about 5 electrons. The resolution of the optical sensor(s) 98 may be greater than about 0.5 megapixels (Mpixels). In other examples, the resolution may be greater than about 5 Mpixels, or greater than about 10 Mpixels.
[0130] Also as used herein, a single optical waveguide 100 may be a light guide including a cured filter material that i) filters the excitation light 104 (propagating from an exterior of the flow cell 10’ into the flow channel 12), and ii) permits the light emissions resulting from reactions at the depressions 34 or the lane 22 (not shown) to propagate therethrough toward corresponding optical sensor(s) 98. In an example, the optical waveguide 100 may be, for example, an organic absorption filter. As a specific example, the organic absorption filter may filter excitation light 104 of about 532 nm wavelength and permit light emissions of about 570 nm or more wavelengths. The optical waveguide 100 may be formed by first forming a guide cavity in a dielectric layer 106, and then filling the guide cavity with a suitable filter material.
[0131] The optical waveguide 100 may be configured relative to the dielectric material 106 in order to form a light-guiding structure. For example, the optical waveguide 100 may have a refractive index of about 2.0 so that the light emissions are substantially reflected at an interface between the optical waveguide 100 and the surrounding dielectric material 106. In certain examples, the optical waveguide 100 is selected such that the optical density (OD) or absorbance of the excitation light 104 is at least about 4 OD. More specifically, the filter material may be selected and the optical waveguide 100 may be dimensioned to achieve at least 4OD. In other examples, the optical waveguide 100 may be configured to achieve at least about 5 OD or at least about 6 OD.
[0132] The substrate 14 (or substrate 16) functions as a passivation layer for the flow cell 10’. At least a portion of the passivating substrate 14 is in contact with a first embedded metal layer 112 of the CMOS chip 94 and also with an input region 110 of the optical waveguide 100. The contact between the passivating substrate 14 and the first embedded metal layer 112 may be direct contact or may be indirect contact through a shield layer 114.
[0133] The substrate 14 (passivation layer) may provide one level of corrosion protection for the embedded metal layer 112 of the CMOS chip 94 that is closest in proximity to the substrate 14. In this example, the substrate 14 may include a passivation material that is transparent to the light emissions resulting from reactions within the depressions 34 (e.g., visible light), and that is at least initially resistant to the fluidic environment and moisture that may be introduced into or present in the flow channel 12. An at least initially resistant material acts as an etch barrier to high pH reagents (e.g., pH ranging from 8 to 14) and as a moisture barrier. Examples of suitable materials for the substrate 14 of the flow cell 10’ include silicon nitride (Si3N4), silicon oxide (SiO2), tantalum pentoxide (Ta2O5), hafnium oxide (HfO2), boron doped p+ silicon, or the like. The thickness of the substrate 14 may vary depending, in part upon the sensor dimensions. In an example, the thickness of the substrate 14 ranges from about 100 nm to about 500 nm.
[0134] As described, in the example shown in Fig.2, the flow cell 10’ also includes a lid 116 that is operatively connected to the substrate 14 to partially define the flow channel 12 between the substrate 14 (and the depressions 34 or the lane 22) and the lid 116. The lid 116 may be any material that is transparent to the excitation light 104 that is directed toward the depressions 34 or toward the lane 22. As examples, the lid 116 may include glass (e.g., borosilicate, fused silica, etc.), plastic, etc. A commercially available example of a suitable borosilicate glass is D 263®, available from Schott North America Inc. Commercially available examples of suitable plastic materials, namely cyclo olefin polymers, are the ZEONOR® products available from Zeon Chemicals L.P.
[0135] The lid 116 may be physically connected to the substrate 14 (or base support 18 of the substrate 16) through a spacer layer 62. In the example shown in Fig.2, the spacer layer(s) 62 is / are coupled to a portion the surface of the substrate 14 (e.g., at bonding regions 21 of the substrate 14). The spacer layer 62 also extends between the surface of the substrate 14 and an interior surface of the lid 116. In some examples, the spacer layer 62 and the lid 116 may be integrally formed such that they 62, 116 are a continuous piece of material (e.g., glass or plastic). In these examples, a thin layer of adhesive may be used to attach the integrally formed piece to the substrate 14 at the bonding region 21. In other examples, the spacer layer 62 and the lid 116 may be separate components that are coupled to each other. In these other examples, the spacer layer 62 may be the same material as, or a different material than the lid 116. In still other examples, the spacer layer 62 includes a curable adhesive layer that bonds the lid 116 to the substrate 14 (at a portion of its surface).
[0136] In an example, the lid 116 may be a substantially rectangular block having an at least substantially planar exterior surface 118, and an at least substantially planar interior surface 120 that defines a portion of the flow channel 12. The block may be mounted onto the spacer layer 62. Alternatively, the block may be etched to define the lid 116 and the spacer layer 62 (which functions as sidewall(s)). For example, a recess may be etched into the transparent block. When the etched block is mounted to the substrate 14, the recess may become the flow channel 12.
[0137] The lid 116 may include inlet and outlet ports 122, 124 that are configured to fluidically engage other ports (not shown) for directing fluid(s) into the flow channel 12 (e.g., from a reagent cartridge or other fluid storage system component) and out of the flow channel 12 (e.g., to a waste removal system).
[0138] The flow channel 12 may be sized and shaped to direct a fluid along the depressions 34 or along the lane 22, depending on the unpatterned or patterned structure 15, 17 that is used in the flow cell 10’. The height of the flow channel 12 and other dimensions of the flow channel 12 may be configured to maintain a substantially even flow of the fluid over the depressions 34 or over the lane 22. The dimensions of the flow channel 12 may also be configured to control bubble formation. In an example, the height of the flow channel 12 may range fromabout 50 µm to about 400 µm. In another example, the height of the flow channel 12 may range from about 80 µm to about 200 µm. It is to be understood that the height of the flow channel 12 may vary.
[0139] Each depression 34, when included in the flow cell 10’, is a localized region in the substrate 14 of the flow cell 10’ where a designated reaction may occur. In an example, each depression 34 is at least substantially aligned with the input region 110 of a single optical waveguide 100. As such, light emissions at the depressions 34 may be directed into the input region 110, through the waveguide 100, and to an associated optical sensor 98. In other examples, one depression 34 may be aligned with several input regions 110 of several optical waveguides 100. In still other examples, several depressions 34 may be aligned with one input region 110 of one optical waveguide 100.
[0140] As shown in Fig.2, each of the depressions 34 has the protective coating 28 positioned thereon, and the protective coating 28 passivates the polymeric hydrogel layer 26’ within the depressions 34 (or within the lane 22, not shown).
[0141] As described, at least a portion of the passivating substrate 14 is in contact with a first embedded metal layer 112 of the CMOS chip 94 and also with an input region 110 of the optical waveguide 100. The embedded metal layer 112 may be any suitable CMOS metal, such as aluminum (Al), aluminum chloride (AlCl), tungsten (W), nickel (Ni), or copper (Cu). In an example, the embedded metal layer 112 may be a functioning part of the CMOS AVdd line, and through the stacked layers 96, is also electrically connected to the optical sensor 98. Thus, the embedded metal layer 112 participates in the detection / sensing operation.
[0142] It is to be understood that the other optical sensors 98 and associated components may be configured in an identical or similar manner. It is also to be understood, however, that the CMOS chip 94 may not be manufactured identically or uniformly throughout. Instead, one or more optical sensor 98 and / or associated components may be manufactured differently or have different relationships with respect to one another.
[0143] The stacked layer 96 may include interconnected conductive elements (e.g., conductors, traces, vias, interconnects, etc.) that can conduct electrical current. The circuitry may be configured for selectively transmitting datasignals that are based on detected photons. The circuitry may also be configured for signal amplification, digitization, storage, and / or processing. The circuitry may collect and analyze the detected light emissions and generate data signals for communicating detection data to a bioassay system. The circuitry may also perform additional analog and / or digital signal processing in the CMOS chip 94.
[0144] The CMOS chip 94 may be manufactured using integrated circuit manufacturing processes. The CMOS chip 94 may include multiple layers, such as a sensor base / layer (e.g., a silicon layer or wafer). The sensor base may include the optical sensor 98. When the CMOS chip 94 is fully formed, the optical sensor 98 may be electrically coupled to the rest of the circuitry in the stack layer 96 through gate(s), transistor(s), etc.
[0145] As used in reference to Fig.2, the term “layer” is not limited to a single continuous body of material unless otherwise noted. For example, the sensor base / layer may include multiple sub-layers that are different materials and / or may include coatings, adhesives, and the like. Furthermore, one or more of the layers (or sub-layers) may be modified (e.g., etched, deposited with material, etc.) to provide the features described herein.
[0146] The stacked layer 96 also includes a plurality of metal-dielectric layers. Each of these layers includes metallic elements (e.g., M1-M5, which may be, for example, W (tungsten), Cu (copper), Al (aluminum), or any other suitable CMOS conductive material) and dielectric material 106 (e.g., SiO2). Various metallic elements M1-M5 and dielectric materials 106 may be used, such as those suitable for integrated circuit manufacturing.
[0147] In the example shown in Fig.2, each of the plurality of metal-dielectric layers L1-L6 includes both metallic elements M1, M2, M3, M4, M5 and dielectric material 106. In each of the layers L1-L6, the metallic elements M1, M2, M3, M4, M5 are interconnected and are embedded within dielectric material 106. In some of the metal-dielectric layers L1-L6, additional metallic elements may also be included. Some of these additional metallic elements may be used to address individual pixels through a row and column selector. The voltages at these elements may vary and switch between about -1.4 V and about 4.4 V depending upon which pixel the device is reading out.
[0148] The configuration of the metallic elements M1, M2, M3, M4, M5 and dielectric layer 106 in Fig.2 is illustrative of the circuitry, and it is to be understood that other examples may include fewer or additional layers and / or may have different configurations of the metallic elements M1-M5.
[0149] In the example shown in Fig.2, the shield layer 114 is in contact with at least a portion of the substrate 14. The shield layer 114 has an aperture at least partially adjacent to the input region 110 of the optical waveguide 100. This aperture enables the depressions 34 (and at least some of the light emissions therefrom) to be optically connected to the waveguide 100. It is to be understood that the shield layer 114 may have an aperture at least partially adjacent to the input region 110 of each optical waveguide 100. The shield layer 114 may extend continuously between adjacent apertures.
[0150] The shield layer 114 may include any material that can block, reflect, and / or significantly attenuate the light signals that are propagating through the flow channel 12. The light signals may be the excitation light 104 and / or the light emissions from the depressions 34. As an example, the shield layer 114 may be tungsten (W).
[0151] It is to be understood that the flow cell 10’ may also be used for optical detection.
[0152] Polish-Free Hydrogel Patterning Methods
[0153] Examples of polish-free hydrogel patterning methods will now be described in reference to Fig.3A through Fig.3E and Fig.4A through Fig.4F.
[0154] As shown in Fig.3A through Fig.3E, one example of a polish-free hydrogel patterning method that may be used as part of a process of forming the flow cells 10, 10’ described herein includes depositing a polymeric hydrogel 26 over a substrate 14, 16 including a plurality of depressions 34 separated by interstitial regions 24 such that a polymeric hydrogel layer 26’ is formed within the plurality of depressions 34 and over the interstitial regions 24 (shown at Fig.3B); depositing a protective coating 28, including a plurality of primers 30, 32 therein, over the polymeric hydrogel layer 26’, whereby at least some of the plurality of primers 30, 32 attach to the polymeric hydrogel layer 26’ (shown at Fig.3C); and etching the protective coating 28 and the polymeric hydrogel layer 26’, including the at leastsome of the plurality of primers 30, 32 attached thereto, to expose the interstitial regions 24, whereby a portion of each of the protective coating 28 and polymeric hydrogel layer 26’ including the at least some of the plurality of primers 30, 32 attached thereto remain intact in each of the depressions 34 (shown at Fig.3D). In some instances, the method includes removing the protective coating 28 overlying the polymeric hydrogel layer 26’ within at least one of the plurality of depressions 34 using a second removal process and exposing the at least some of the plurality of primers 30, 32 therein (shown at Fig.3E).
[0155] As shown at Fig.3A, the substrate 14 (or the layer 20 of the substrate 16) has depressions 34 defined therein (similar to the patterned structure 17 depicted in Fig.1C). It is to be understood, however, that the example method shown in Fig.3A through Fig.3E may alternatively utilize a substrate 14, 16 having a lane 22 defined therein (similar to the unpatterned structure 15 in Fig.1B). In any case, either the single layer substrate 14 or the multi-layer substrate 16 including the base support 18 and the layer 20 may be used.
[0156] While not shown, a method that is similar to that shown in Fig.3A through Fig.3E and that utilizes the unpatterned structure 15 may include depositing a polymeric hydrogel 26 over a substrate 14, 16 including a lane 22 surrounded by a bonding region 21 such that a polymeric hydrogel layer 26’ is formed within the lane 22 and over the bonding region 21; depositing a protective coating 28, including a plurality of primers 30, 32 therein, over the polymeric hydrogel layer 26’, whereby at least some of the plurality of primers 30, 32 attach to the polymeric hydrogel layer 26’; and etching the protective coating 28 and the polymeric hydrogel layer 26’, including the at least some of the plurality of primers attached thereto, to expose the bonding region 21, whereby a portion of each of the protective coating 28 and polymeric hydrogel layer 26’, including the at least some of the plurality of primers 30, 32 attached thereto, remain intact in the lane 22.
[0157] Referring back to Fig.3A, the depressions 34 may be defined in the substrate 14 (or in the layer 20 of the substrate 16) using any suitable technique described herein (e.g., etching, nanoimprint lithography, photolithography, etc.). The material of the substrate 14 or the material of the components of the substrate 16 (i.e., the material of the base support 18 and the layer 20) may be any suitable example set forth herein. The patterning technique that is used for the substrate 14or the layer 20 will depend, in part, upon the material selected for the substrate 14 or the layer 20.
[0158] As an example of forming the depressions 34, when the substrate 14 or the layer 20 includes a resin material, a working stamp (including a negative replica of the depressions 34) may be pressed into the resin material of the substrate 14 or layer 20 while the resin is soft. The resin of the substrate 14 or layer 20 may then be cured while the working stamp is in place, e.g., via exposure to actinic radiation or to heat. After curing, the working stamp is released, which forms the depressions 34 in the substrate 14 or in the layer 20. While two depressions 34 are shown as being defined in the substrate 14 (or layer 20) in Fig. 3A, it is to be understood in that any number of depressions 34 may be formed in the substrate 14, 16, including tens, hundreds, thousands, etc., of individual depressions 34. Regardless of the number of individual depressions 34 that are included, the depressions 34 are separated by the interstitial regions 24 (as shown in the figure). As such, some examples of the method further comprise forming the plurality of depressions 34 in the substrate 14, 16 using nanoimprint lithography, or another example lithography, prior to depositing the polymeric hydrogel 26 thereon.
[0159] As an example of forming the lane 22 (when included), when the substrate 14 or the layer 20 includes a resin material, a working stamp (including a negative replica of the lane 22) may be pressed into the resin material of the substrate 14 or layer 20 while the resin is soft. The resin of the substrate 14 or layer 20 may then be cured while the working stamp is in place, e.g., via exposure to actinic radiation or to heat. After curing, the working stamp is released, which forms the lane 22 in the substrate 14 or in the layer 20. As another example of forming the lane 22 (when included), the spacer layer 62 may be applied to a planar substrate 14, where the interior sidewalls of the lane 22 are defined by the spacer layer 62.
[0160] Referring now to Fig.3B, once the depressions 34 are formed in the substrate 14, 16, the polymeric hydrogel 26 may be applied within the depression(s) 34 and over the interstitial regions 24, which forms the polymeric hydrogel layer 26’. The polymeric hydrogel 26 may be any suitable hydrogel material disclosed herein and may be applied as a polymeric hydrogel solution or mixture (e.g., including a hydrogel material disclosed herein and water and / or abuffer). In examples, the polymeric hydrogel 26 is an acrylamide polymer. In a specific example, the polymeric hydrogel 26 is PAZAM. The deposition of the polymeric hydrogel 26 or polymeric hydrogel solution (to form the hydrogel layer 26’) may be performed using any suitable deposition technique disclosed herein. The polymeric hydrogel material, when deposited in the form of a polymeric hydrogel solution, may then be cured using any suitable curing process disclosed herein, such as curing via exposure to heat or high energy light.
[0161] While not shown in Fig.3B, in some examples, the method further includes activating the substrate 14, 16 prior to depositing the polymeric hydrogel 26 thereon. Activation of the substrate 14, 16 may be accomplished via plasma ashing of the substrate 14 or layer 20 (of the substrate 16), or via treatment of the substrate 14 or layer 20 with a silane to generate surface groups that facilitate the attachment of the polymeric hydrogel 26 to the substrate 14 (or layer 20).
[0162] Plasma ashing involves the generation of –OH groups at a surface via exposure of the surface to oxygen plasma. Silanization involves the application of a silane or silane derivative over the surface of the substrate 14 or the layer 20 (of the substrate 16). The selection of the silane or silane derivative may depend, in part, upon the polymeric hydrogel 26 that is to be applied. Some example silane derivatives include a cycloalkene unsaturated moiety, such as norbornene, a norbornene derivative (e.g., a (hetero)norbornene including an oxygen or nitrogen in place of one of the carbon atoms), trans-cyclooctene, trans-cyclooctene derivatives, trans-cyclopentene, trans-ycloheptene, trans-cyclononene, bicyclo[3.3.1]non-1-ene, bicyclo[4.3.1]dec-1 (9)-ene, bicyclo [4.2.1]non-1(8)-ene, and bicyclo[4.2.1]non-1-ene. Any of these cycloalkenes can be substituted, for example, with an R group, such as hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, cycloalkynyl, aryl, heteroaryl, heteroalicyclyl, aralkyl, or (heteroalicyclyl)alkyl. An example of the norbornene derivative includes [(5- bicyclo[2.2.1]hept-2-enyl)ethyl]trimethoxysilane. Other example silane derivatives include a cycloalkyne unsaturated moiety, such as cyclooctyne, a cyclooctyne derivative, or bicyclononynes (e.g., bicyclo[6.1.0]non-4-yne or derivatives thereof, bicyclo[6.1.0]non-2-yne, or bicyclo[6.1.0]non-3-yne). These cycloalkynes can be substituted with any of the R groups described herein for the cycloalkene. The method used to apply the silane or silane derivative may vary depending upon thesilane or silane derivative that is being used. Examples of suitable silanization methods include vapor deposition (e.g., a YES method), spin coating, or other deposition methods.
[0163] Returning to Fig.3C, after the polymeric hydrogel layer 26’ has been formed within the depressions 34 and over the interstitial regions 24, the protective coating 28 (including the primers 30, 32 dispersed therein) is formed over the structure of Fig.3B. As depicted, the protective coating 28 covers the polymeric hydrogel layer 26’ within the depressions 34 and also covers the interstitial regions 24. Alternatively, the protective coating 28 will cover the polymeric hydrogel layer 26’ within the lane 22 and over the bonding region 21. The protective coating 28 may be first applied as a protective coating solution or mixture, which includes a water-soluble material with the primers 30, 32 dispersed therein. The applied protective coating solution or mixture can be dried and / or cured after being deposited to form the protective coating 28.
[0164] The protective coating 28 may include any suitable protective coating materials disclosed herein and may be deposited using any suitable deposition technique disclosed herein. In an example, the depositing of the protective coating 28 involves spin coating or slot die coating. In another example, the depositing of the protective coating 28 involves dispensing with a precision fluid dispensing system, such as those available from GPD Global®.
[0165] The protective coating solution / mixture may be an aqueous solution, which may include water and up to about 15% (mass to volume) of the water- soluble material. In some examples, the water-soluble material makes up 15% or less of the aqueous solution. In other examples, the aqueous solution includes from about 2% to about 13% of the water-soluble material, or from about 2.5% to about 10% of the water-soluble material. It is to be understood that the concentration of the aqueous solution may vary depending upon the flow cell architecture (e.g., the dimensions of the flow channel, input and output ports, etc.). For example, when flow through deposition is utilized, the concentration may be selected so that the aqueous solution can flow through the flow cell without clogging the port(s), flow channel, etc. As such, in some examples, the concentration may also be greater than about 15%. To obtain a desirable thickness for the protective coating 28, the lower limit of the concentration may beabout 2 wt% (mass to volume). The water-soluble material (and the resulting protective coating 28) in this example method may be any of the examples disclosed herein (i.e., a non-cationic synthetic polymer; a natural polysaccharide or a derivative thereof; a natural protein or a derivative thereof; a water-soluble salt; a water-soluble surfactant, a sugar, a chelator, or a buffer. In an example, the water- soluble material may be a polyvinyl alcohol / polyethylene glycol graft copolymer (an example of this is commercially available as KOLLICOAT® IR, available from BASF Corp.), sucrose, dextran, polyacrylamide, polyethylene glycol, ethylenediaminetetraacetic acid disodium salt (EDTA), tris(hydroxymethyl)aminomethane with ethylenediaminetetraacetic acid, (tris(2- carboxyethyl)phosphine), tris(3-hydroxypropyltriazolylmethyl)amine, bathophenanthrolinedisulfonic acid disodium salt, or glycerol.
[0166] The protective coating solution / mixture may also include additives, such as water-soluble co-solvents, antioxidants, dyes, ultraviolet light stabilizers, processing aids, or the like. These additives may be included in the protective coating solution / mixture in amounts that do not deleteriously affect the flowability or the solution / mixture or the film forming ability of the water-soluble, film forming material. For example, a co-solvent, such as ethanol, may be present in the solution / mixture, optionally in an amount ranging from about 1% to about 10%, or from about 2.5% to about 7.5%. In another example, the solution / mixture may include about 5% of the water-soluble material, about 5% of the co-solvent, and a balance (about 90%) of water. In other examples, the aqueous solution may include about 5 to about 7.5% of the water-soluble material, and about 5 to about 10% co-solvent, with the balance of water (e.g., 7.5% w / v KOLLICOAT® IR in 10% aq. ethanol).
[0167] After the protective coating solution / mixture is applied (when used), it may be dried to form the protective coating 28 in solid or gel form. Drying may be accomplished via air exposure, nitrogen exposure, vacuum, heating (e.g., in an oven), or spin coating (i.e., spinning until dry).
[0168] When the protective coating 28 or protective coating solution / mixture is formed or applied over the structure of Fig.3B (and in some instances, cured) to form the structure of Fig.3C, at least some of the primers 30, 32 within the protective coating 28 or within the protective coating solution / mixture becomeattached to the polymeric hydrogel layer 26’ within the depressions 34 and over the interstitial regions 24. The attachment of the primers 30, 32 to the polymeric hydrogel layer 26’ within the depressions 34 and over the interstitial regions 24 is shown in Fig.3C. Alternatively, at least some of the primers 30, 32 will attach to the polymeric hydrogel layer 26’ within the lane 22 and over the bonding region 21.
[0169] The thickness of the resultant protective coating 28 that is shown in Fig.3C will depend, in part, upon the amount and type of water-soluble material used in the protective coating 28 and upon the technique that is used to apply the protective coating 28. As an example of the amount, a higher percentage of the water-soluble material will lead to a thicker coating 28. For example, the application of a 2% solution of a polyvinyl alcohol / polyethylene glycol graft copolymer in water is performed using spin coating at a speed of 2000 rpm, and the thickness of the resulting protective coating 28 ranges from about 30 nm to about 40 nm; and the application of a 5% solution of the same graft copolymer in water at the same spin coating speed will generate a protecting coating 28 with the thickness ranging from about 99 nm to about 141 nm. As an example of the coating technique, a thinner coating will be generated when higher speeds are used for spin coating compared to when lower speeds are used. As examples, coating thicknesses ranging from about 25 nm to about 250 nm can be achieved when using spin coating at speeds ranging from about 200 rpm to about 13,000 rpm. In one example, the spin coating speed ranges from about 1500 rpm to about 4000 rpm. In one specific example, the application of a 5% solution of a polyvinyl alcohol / polyethylene glycol graft copolymer in water is performed using spin coating at a speed of about 4000 rpm, and the thickness of the resulting protective coating 28 ranges from about 108 nm to about 117 nm. In another specific example, the application of a 5% solution of a polyvinyl alcohol / polyethylene glycol graft copolymer is performed using spin coating at a speed of about 2000 rpm, and the thickness of the resulting protective coating 28 ranges from about 149 nm to about 155 nm. In still another specific example, the application of a 5% solution of a polyvinyl alcohol / polyethylene glycol graft copolymer is performed using spin coating at a speed of about 1500 rpm, and the thickness of the resulting protective coating 28 ranges from about 168 nm to about 179 nm.
[0170] As described, the protective coating solution / mixture and the resulting protective coating 28 include the primers 30, 32. It is to be understood that the primers 30, 32 included in the protective coating solution / mixture and the resulting protective coating 28 may include any example of the P5, P7, P15, and PA-PD primers disclosed herein.
[0171] In this example method, the attachment of the primers 30, 32 to the polymeric hydrogel layer 26’ may be facilitated by utilizing / providing a high concentration of the primers 30, 32 in the protective coating 28 or the protective coating solution / mixture and by performing drying.
[0172] After the protective coating 28 has been formed within the depressions 34 and over the interstitial regions 24, and at least some of the primers 30, 32 attach to the polymeric hydrogel layer 26’, the method proceeds with etching. Etching is performed to remove at least some of the protective coating 28 and the polymeric hydrogel layer 26’ (including the primers 30, 32 attached thereto) and to expose the interstitial regions 24. Etching is controlled so that portions of the protective coating 28 and the polymeric hydrogel layer 26’ (including the primers 30, 32 attached thereto) remain intact in each of the depressions 34. This is shown in Fig.3D. The etching is represented by the three arrows shown in the figure.
[0173] In some examples, the etching of the protective coating 28 and the polymeric hydrogel layer 26’ involves reactive ion etching. In an example, the etching is performed using oxygen plasma. Other reactive species may be used for etching (e.g., fluorine plasma or others) and will depend, in part, upon the materials used for the protective coating 28 and the polymeric hydrogel 26. As shown in Fig. 3D, the etching of the protective coating 28, of the underlying polymeric hydrogel layer 26’, and of the primers 30, 32 (which may be dispersed in the coating 28 or attached to the polymeric hydrogel layer 26’) from the interstitial regions 24 removes the protective coating 28, the polymeric hydrogel layer 26’, and the primers 30, 32 from the interstitial regions 24. It is to be understood that after etching is complete, portions of the polymeric hydrogel layer 26’, the primers 30, 32 attached thereto, and the overlying protective coating 28 remain intact within the depressions 34.
[0174] In an example, the reactive ion etching process involves etching the protective coating 28, the polymeric hydrogel layer 26’, and the primers 30, 32 at a rate of about 1 nm per second. The reactive ion etching process may be a timed dry etch based on the rate at which the materials are etched. Alternatively, the substrate 14 (or the layer 20 of the substrate 18) may act as an etch stop at the interstitial regions 24 of the substrate 14, 16, and thus etching does not deleteriously affect the interstitial regions 24. In this example, etching is stopped with the interstitial regions 24 are exposed. As an additional alternative, the material of the substrate 14 or the layer 20 that makes up the interstitial regions 24 may include a chemical signaler that is released upon exposure of the interstitial regions 24, and this chemical signaler may be detected by the etching tool being used. In this example, the etching tool is configured to cease etching when the chemical signaler is detected. As yet another alternative, the protective coating 28 can include a chemical additive that is released when the protective coating 28 is etched. In this example, the etching tool is configured to cease etching when a change in the concentration of the released chemical additive or a change in the release rate is detected. In this example, when the protectective coating 28 is removed from the interstitial regions 24, the concentration of the released chemical additive and / or the rate at which the chemical additive is released may significantly decrease, as compared to when the protective coating is present over the interstitial regions 24.
[0175] The duration of the reactive ion etching process will depend, in part, upon the material used for the protective coating 28, the reactive gas used in the etching process, the etch rate, and the thickness of the protective coating 28. In an example, the protective coating 28 has a thickness ranging from about 1 nm to about 200 nm, and the etching of the protective coating 28 (from the interstitial regions 24) is performed at a rate ranging from about 1 nm / s to about 2 nm / s for a period of time ranging from about 1 second to about 250 seconds. In further examples, the etching of the protective coating 28 is performed at a rate ranging from about 0.3 nm / s to about 10 nm / s.
[0176] After the protective coating 28, the polymeric hydrogel layer 26’, and the primers 30, 32 have been etched from the interstitial regions 24, the method may further include removing the (remaining) protective coating 28 overlying thepolymeric hydrogel layer 26’ within at least one of the plurality of depressions 34 using a second removal process and exposing the primers 30, 32 therein. This is shown in Fig.3E.
[0177] The second removal process may involve exposing the protective coating 28 within the depressions 34 (or within the lane 22) to an aqueous or organic dissolving solution. The dissolving solution used will depend upon the material used to form the protective coatin 28. This exposure may be accomplished using a process in which water and a buffer, or water alone, or an organic solvent is introduced to the depressions 34 or lane 22 and is allowed to incubate for a period suitable for dissolving the protective coating 28. The second removal process exposes the primers 30, 32 that are attached to the polymeric hydrogel layer 26’ within the depressions 34, rendering the primers 30, 32 ready for use (e.g., in a biological sequencing operation). As an example, when the protective coating 28 includes a water-soluble material, the water or the water and the buffer may be used to remove the protective coating 28. Because water is used during many sequencing operations, the removal of the water-soluble protective coating 28 may take place as part of the sequencing operation workflow. As an additional example, when the protective coating 28 includes a water- insoluble material, the organic dissolving solution may be used.
[0178] In another example of the method, the polymeric hydrogel layer 26’ that is formed is pre-grafted with primers 30, 32 (and is thus a “pre-grafted” polymeric hydrogel layer). This example method may be performed similarly to that shown and described in reference to Fig.3A through Fig.3E, except that the protective coating solution / mixture does not include the primers 30, 32 because they are pre-attached to the polymeric hydrogel 26. Thus, this example method may include depositing a pre-grafted polymeric hydrogel (including a plurality of primers 30, 32 attached thereto) over a substrate 14, 16 including a plurality of depressions 34 separated by interstitial regions 24 such that a pre-grafted polymeric hydrogel layer is formed within the plurality of depressions 34 and over the interstitial regions 24; depositing a protective coating 28 over the pre-grafted polymeric hydrogel layer; and etching the protective coating 28 and the pre-grafted polymeric hydrogel layer to expose the interstitial regions 24, whereby a portion of each of the protective coating 28 and pre-grafted polymeric hydrogel layer remainintact in each of the depressions 34. In some instances, the method includes removing the protective coating 28 overlying the pre-grafted polymeric hydrogel layer within at least one of the plurality of depressions 34 using a second removal process and exposing the plurality of primers 30, 32 therein.
[0179] In still another example of the method, after the structure of Fig.3D is generated by etching at least some of the protective coating 28 and the polymeric hydrogel layer 26’ (including the primers 30, 32 attached thereto) to expose the interstitial regions 24, the method proceeds to Fig.5A instead of Fig.3E (as represented by the arrows in Fig.3D). In this example, after the etching of the protective coating 28 and the polymeric hydrogel layer 26’ and after the exposure of the interstitial regions 24, the method further comprises continuing etching such that some of the portion of each of the protective coating 28 and the polymeric hydrogel layer 26’ including at least some of the plurality of primers 30, 32 attached thereto are removed from an upper portion 36 of the depressions 34, and such that some other of the portion of each of the protective coating 28 and the polymeric hydrogel layer 26’ including the primers 30, 32 attached thereto remain intact in a bottom portion 38 of the depressions 34.
[0180] Fig.5B depicts the continued etching, which removes some of the remaining portion of each of the protective coating 28 and the polymeric hydrogel layer 26’ from an upper portion 36 of each of the depressions 34. The continued etching may be performed using any suitable etching process described herein, such as reactive ion etching. The continued etching may be a seamless process which continues after the interstitial regions 24 are exposed, or may be stopped and restarted after the interstitial regions 24 are exposed. In an example, the continued etching process involves etching the protective coating 28, the polymeric hydrogel layer 26’, and the primers 30, 32 from the upper portion 36 of the depressions 34 at a rate of about 1 nm per second. The reactive ion etching process may be a timed dry etch based on the rate at which the materials are etched. The upper portion 36 extends from the opening of the depression 34 to some depth of the depression 34 that is less than the full depth. The extent of the upper portion 36 may depend upon, at least in part, on the full depth of the depression 34, whether it is desirable to maintain the polymeric hydrogel 28 onsidewalls of the depression 34, and the desired thickness of the polymeric hydrogel 28 that aligns a bottom surface of the depression 34.
[0181] As shown in Fig.5B, during and after this continued etching process, at least some other of the portion of each of the polymeric hydrogel layer 26’ (including the primers 30, 32 attached thereto) and the protective coating 28 remain intact in the bottom portion 38 of the depressions 34. Further, the continued etching of the protective coating 28 and of the polymeric hydrogel layer 26’ may be performed such that the distance (represented by “d” in the figure) between the top / opening of the depressions (i.e., which is at the plane of the interstitial regions 24) and the polymeric hydrogel layer 26’ on the sidewalls of the depressions 34 or on the bottom surface of the depressions 34 is about 50 nm, or about 75 nm, or about 100 nm, or about 125 nm, or about 150 nm. It is believed that this distance “d” between the polymeric hydrogel layer 26’ and the top / opening of the depressions 34 aids in reducing or eliminating pad hopping, which leads to more monoclonal cluster and improved sequencing metrics.
[0182] After the continued etching ceases, the method further comprises removing the at least some other of the portion of the protective coating 28 using a second removal process, thereby exposing at least some of the plurality of primers 30, 32 therein. The second removal process may involve exposing the remaining protective coating 28 (i.e., that which remains within the bottom portion 38 of the depressions 34 after continued etching) to an aqueous dissolving solution or to an organic solvent. During this exposure, water, or water and a buffer, or the organic solvent is introduced into the depressions 34 and is allowed to incubate for a period suitable for dissolving the remaining protective coating 28. In this example, the second removal process exposes the primers 30, 32 that are attached to the polymeric hydrogel layer 26’ that remains within the bottom portion 38 of the depressions 34. This renders the primers 30, 32 ready for use (e.g., in a biological sequencing operation).
[0183] Another example method of polish-free hydrogel patterning is shown in Fig.4A through Fig.4F. This example method involves depositing a polymeric hydrogel 26 over a substrate 14, 16 including a plurality of depressions 34 separated by interstitial regions 24 such that a polymeric hydrogel layer 26’ is formed within the plurality of depressions 34 and over the interstitial regions 24(shown in Fig.4B); depositing a protective coating 28 over the polymeric hydrogel layer 26’ (shown in Fig.4C); and etching the protective coating 28 and the polymeric hydrogel layer 26’ to expose the interstitial regions 24, whereby portions of the polymeric hydrogel layer 26’ and the protective coating 28 remain intact within each of the plurality of depressions 34 (shown in Fig.4D). In some instances, the method further comprises dissolving the portions of the protective coating 28, thereby exposing the polymeric hydrogel layer 26’ within at least some of the plurality of depressions 34 (Fig.4E); and grafting primers 30, 32 to the polymeric hydrogel layer 26’ within the at least some of the plurality of depressions 34 (Fig.4F).
[0184] As shown at Fig.4A, the substrate 14 (or the layer 20 of the substrate 16) has depressions 34 defined therein (similar to the patterned structure 17 depicted in Fig.1C). It is to be understood, however, that the example method shown in Fig.4A through Fig.4F may alternatively utilize a substrate 14, 16 having a lane 22 defined therein (similar to the unpatterned structure 15 in Fig.1B). In any case, either the single layer substrate 14 or the multi-layer substrate 16 including the base support 18 and the layer 20 may be used.
[0185] While not shown, a method that is similar to that shown in Fig.4A through Fig.4F and that utilizes the unpatterned structure 15 may include depositing a polymeric hydrogel 26 over a substrate 14, 16 including a lane 22 surrounded by a bonding region 21 such that a polymeric hydrogel layer 26’ is formed within the lane 22 and over the bonding regions 21; depositing a protective coating 28 over the polymeric hydrogel layer 26’; and etching the protective coating 28 and the polymeric hydrogel layer 26’ to expose the bonding regions 21, whereby the polymeric hydrogel layer 26’ and the protective coating 28 remain intact within the lane 22. In some instances, the method further comprises dissolving the protective coating 28, thereby exposing the polymeric hydrogel layer 26’ within the lane 22; and grafting primers 30, 32 to the polymeric hydrogel layer 26’ within the lane 22.
[0186] Referring back to Fig.4A, the depressions 34 may be defined in the substrate 14 (or in the layer 20 of the substrate 16) using any suitable technique described herein (e.g., etching, nanoimprint lithography, photolithography, etc.). The material of the substrate 14 or the material of the components of the substrate16 (i.e., the material of the base support 18 and the layer 20) may be any suitable example set forth herein. The patterning technique that is used for the substrate 14 or the layer 20 will depend, in part, upon the material selected for the substrate 14 or the layer 20. In a specific example, the method further includes forming the plurality of depressions 34 in the substrate 14, 16 using (nanoimprint) lithography prior to depositing the polymeric hydrogel 26 thereon. Formation of the depressions 34 in the substrate 14, 16 generates the structure shown in Fig.4A. While Fig.4A depicts the substrate 14, 16 including two depressions 34, it is to be understood that any number of depressions 34 can be included in the substrate 14, 16 (e.g., tens, hundreds, thousands, etc.)
[0187] Once the depressions 34 are formed in the substrate 14, 16, the polymeric hydrogel 26 may be applied within the depression(s) 34 and over the interstitial regions 24, such that the polymeric hydrogel 26 forms a layer 26’ within the depressions 34 and over the interstitial regions 24. This is shown in Fig.4B. The polymeric hydrogel 26 may be any suitable hydrogel material disclosed herein, and may be applied as a polymeric hydrogel solution (as described in reference to Fig.3A through Fig.3E). The polymeric hydrogel material, when applied in the form of the polymeric hydrogel solution, may be cured using any suitable curing process disclosed herein to form the polymeric hydrogel layer 26’. In examples, the polymeric hydrogel 26 is an acrylamide polymer. In a specific example, the polymeric hydrogel 26 is PAZAM. The deposition of the polymeric hydrogel 26 (or polymeric hydrogel solution) may be performed using any suitable deposition technique disclosed herein.
[0188] While not shown in Fig.4B, in some examples, the method further includes activating the substrate 14, 16 prior to depositing the polymeric hydrogel 26 thereon. Activation of the substrate 14, 16 may be accomplished via plasma ashing of the substrate 14 or layer 20 (of the substrate 16), or via treatment of the substrate 14 or layer 20 with a silane to generate surface groups. These groups may be used to facilitate the attachment of the polymeric hydrogel 26 to the substrate 14 (or layer 20). Plasma ashing and / or silanization of the substrate 14 or of the layer 20 may be performed in accordance with techniques disclosed herein in regard to the method depicted in Fig.3A through Fig.3E.
[0189] As shown in Fig.4C, after the polymeric hydrogel layer 26’ has been formed within the depressions 34, the protective coating 28 is formed over the structure of Fig.4B, such that the protective coating 28 covers the polymeric hydrogel layer 26’ within the depressions 34 and over the interstitial regions 24. Alternatively, the protective coating 28 may be applied to cover the polymeric hydrogel layer 26’ within the lane 22 and over the bonding region 21.
[0190] In the method of Fig.4A through Fig.4F, the protective coating 28 may be first applied as a protective coating solution, which can be dried and / or cured after being deposited. In this example method, the protective coating solution may be any example of the aqueous solution or organic solvent described herein in reference to Fig.3A through Fig.3E. It is to be understood, however, that in this example method, the aqueous solution does not include the primers 30, 32, as they are grafted after protective coating 28 removal. Thus, the protective coating 28 may include any suitable protective coating materials (e.g., water- soluble materials) disclosed herein and may deposited using any suitable deposition technique disclosed herein. In an example, the depositing of the protective coating 28 involves spin coating or slot die coating. In another example, the depositing of the protective coating 28 involves dispensing with a fluid dispensing system, such as those available from GPD Global®.
[0191] Returning now to Fig.4D, after the protective coating 28 has been formed over the polymeric hydrogel layer 26’ within the depressions 34 (or within the lane 22) and over the interstitial regions 24 (or over the bonding region 21), the method proceeds by etching the protective coating 28 and the polymeric hydrogel layer 26’ to expose the interstitial regions 24 (or the bonding region 21), whereby portions of the protective coating 28 and the polymeric hydrogel layer 26’ remain intact in each of the depressions 34 (or in the lane 22). The etching is represented by the three arrows shown in Fig.4D.
[0192] In some examples, the etching of the protective coating 28 and the polymeric hydrogel layer 26’ from the interstitial regions 24 is performed using reactive ion etching, for example, using a chemically reactive plasma (such as oxygen plasma). Other reactive species described herein and / or that are compatible with the protective coating 28 and the polymeric hydrogel 26 may be used to etch the protective coating 28 and the polymeric hydrogel layer 26’ from theinterstitial regions 24. The etching of the protective coating 28 and of the underlying polymeric hydrogel layer 26’ from the interstitial regions 24 removes the protective coating 28 and the polymeric hydrogel layer 26’ from the interstitial regions 24, while leaving portions of the polymeric hydrogel layer 26’ and portions of the overlying protective coating 28 intact within the depressions 34. Etching may be used in a similar manner to remove the protective coating 28 and the polymeric hydrogel layer 26’ from the bonding region 21 when the unpatterned structure 15 is used.
[0193] In an example, the reactive ion etching process involves etching the protective coating 28 and the polymeric hydrogel layer 26’ at a rate ranging from about 1 nm per second to about 2 nm per second, or from about 0.3 nm / s to about 10 nm / s. In one example, timed etching may be used, which takes into account the etch rate and the thickness of the coating 28 and layer 26’ overlying the interstitial regions 24. In another example, the substrate 14 (or the layer 20 of the substrate 18) may act as an etch stop at the interstitial regions 24 of the substrate 14, 16. In still another example, the material of the substrate 14 or the layer 20 that makes up the interstitial regions 24 may include a chemical signaler that is released upon exposure of the interstitial regions 24, and this chemical signaler may be detected by the etching tool being used. In this example, the etching tool is configured to cease etching when the chemical signaler is detected. In yet another example, protective coating 28 can include a chemical additive that is released when the protective coating 28 is etched. In this example, the etching tool is configured to cease etching when i) a change in concentration of or ii) a change in the rate of release of the chemical additive is detected.
[0194] The duration of the reactive ion etching process will depend, in part, upon the material used for the protective coating 28, the reactive gas used in the etching process, the etch rate, the tool involved in the reactive ion etching process, and the thickness of the protective coating 28. In an example, the protective coating 28 has a thickness ranging from about 1 nm to about 250 nm, and the etching of the protective coating 28 (from the interstitial regions 24) is performed at a rate ranging from about 0.1 nm / s to about 10 nm / s for a period of time ranging from about 1 second to about 750 seconds. In one example, the tool involved in reactive ion etching is a TRION® Oracle Dry Etcher reactive ion etcher, the time foretching ranges from 13 sec to about 250 sec and the etch rate ranges from about 1 nm / s to about 2 nm / s. In this example, a pressure setting of about 40 mTorr, a power setting of about 100 watts, and a gas flow rate of about 50 standard cubic centimeters per minute may be used. In another example, the tool involved in reactive ion etching is a NORDSON® etching tool (i.e., NORDSON® AP-600), the time for etching ranges from 70 sec to about 700 sec and the etch rate ranges from about 25 nm / s to about 250 nm / s. In this example, a pressure setting of about 400 mTorr, a power setting of about 150 watts, and a gas flow rate of about 200 standard cubic centimeters per minute may be used. While examples have been provided, it is to be understood that the operating parameters (e.g., pressure, power, gas flow rate) may be tuned for a particular tool and / or application.
[0195] After the protective coating 28 and the polymeric hydrogel layer 26’ have been etched from the interstitial regions 24, the method may further include removing the protective coating 28 overlying the polymeric hydrogel layer 26’ within at least one of the plurality of depressions 34 using a second removal process. The second removal process exposes the polymeric hydrogel layer 26’ within the depression(s) 34. This is shown in Fig.4E.
[0196] The second removal process may involve exposing the protective coating 28 within the depressions 34 (or within the lane 22) to an aqueous dissolving solution. This exposure may be accomplished using a process in which water and a buffer (or water alone) is introduced to the depressions 34 or lane 22 and dissolves the protective coating 28.
[0197] As shown in Fig.4F, after the portions of the protective coating 28 overlying the polymeric hydrogel layer 26’ within at least one of the depressions 34 have been removed, the method further includes grafting primers 30, 32 to the exposed polymeric hydrogel layer 26’ within the depression(s) 34. Primer grafting may be performed using a primer grafting solution or mixture that includes the primers 30, 32, water, a buffer, and a catalyst. The deposition of the primer grafting solution or mixture over the exposed polymeric hydrogel layer 26’ may involve dunk coating, spray coating, puddle dispensing, or any other suitable technique that will attach the primers 30, 32 in the solution / mixture to the exposed polymeric hydrogel layer 26’ in the depression(s) 34.
[0198] Dunk coating may involve submerging the substrate 14, 16 (having the exposed polymeric hydrogel layer 26’ in the depressions 34 thereof) into a series of temperature controlled baths. The baths may also be flow controlled and / or covered with a nitrogen blanket. The baths may include the primer grafting solution or mixture. Throughout the various baths, the primers 30, 32 will attach to the exposed polymeric hydrogel layer 26’ in at least some of the depressions 34. In an example, substrate 14, 16 will be introduced into a first bath including the primer solution or mixture where a reaction takes place to attach the primers 30, 32, and then the substrate 14, 16 will be moved to additional baths for washing. The substrate 14, 16 may be moved from bath to bath with a robotic arm or manually. A drying system may also be used in dunk coating.
[0199] Spray coating may be accomplished by spraying the primer grafting solution or mixture directly onto substrate 14, 16 (e.g., within the depressions 34). The spray coated substrate 14, 16 may be incubated for a time ranging from about 4 minutes to about 60 minutes at a temperature ranging from about 0 °C to about 70 °C. After incubation, the primer grafting solution or mixture may be diluted and removed using, for example, a spin coater.
[0200] Puddle dispensing may be performed according to a pool and spin off method, and thus may be accomplished with a spin coater. The primer grafting solution or mixture may be applied (manually or via an automated process) to the substrate 14, 16. The applied primer solution or mixture may be applied to or spread across the entire surface of the substrate 14, 16. The substrate 14, 16 may be incubated for a time ranging from about 2 minutes to about 60 minutes at a temperature ranging from about 0°C to about 80°C to achieve primer grafting. After incubation, the primer grafting solution or mixture (including any ungrafted primers) may be diluted and removed using, for example, the spin coater.
[0201] Grafting of the primers 30, 32 to the exposed polymeric hydrogel layer 26’ may also be accomplished using the flow through process. In the flow through process, the primer grafting solution or mixture may be introduced into the flow channel(s) 12 of the flow cell(s) 10, 10’ through respective input port(s), may be maintained in the flow channel(s) 12 for a time sufficient (i.e., an incubation period) for the primers 30, 32 to attach to the exposed polymeric hydrogel layer 26’ in one or more of the depressions 34, and then may be removed from respective outputport(s). After primer attachment, additional fluid(s) may be directed through the flow channel(s) 12 to wash the depressions 34 and the flow channel(s) 12.
[0202] The primers 30, 32 may include any example of the P5, P7, P15, and PA-PD primers disclosed herein. The attachment of the primers 30, 32 to the polymeric hydrogel layer 26’ (within the depressions 34 or within the lane 22) may be facilitated by a catalyst (and the catalyst may be including the primer grafting solution or mixture). In an example, the attaching of the primers 30, 32 to the polymeric hydrogel layer 26’ is catalyzed via exposure to a copper-based catalyst. The copper-based catalyst may be a copper sulfide catalyst.
[0203] In another example of the method, after the structure of Fig.4D is generated by etching at least some of the protective coating 28 and the polymeric hydrogel layer 26’ to expose the interstitial regions 24, the method proceeds to Fig. 6A instead of Fig.4E (as represented by the arrows in Fig.4D). In this example, after the etching of the protective coating 28 and the polymeric hydrogel layer 26’ and after the exposure of the interstitial regions 24, the method further comprises continuing etching such that some of the portion of each of the protective coating 28 and the polymeric hydrogel layer 26’ are removed from an upper portion 36 of the depressions 34, and such that some other of the portion of each of the protective coating 28 and the polymeric hydrogel layer 26’ remain intact in a bottom portion 38 of the depressions 34.
[0204] Fig.6B depicts the continued etching, which removes some of the remaining portion of each of the protective coating 28 and the polymeric hydrogel layer 26’ from an upper portion 36 of each of the depressions 34. The continued etching may be performed using any suitable etching process described herein, such as reactive ion etching. The continued etching may be a seamless process which continues after the interstitial regions 24 are exposed, or may be stopped and restarted after the interstitial regions 24 are exposed. In an example, the continued etching process involves etching the protective coating 28 and the polymeric hydrogel layer 26’ from the upper portion 36 of the depressions 34 at a rate of about 1 nm per second. The reactive ion etching process may be a timed dry etch based on the rate at which the materials are etched. The upper portion 36 extends from the opening of the depression 34 to some depth of the depression 34 that is less than the full depth. The extent of the upper portion 36 may dependupon, at least in part, on the full depth of the depression 34, whether it is desirable to maintain the polymeric hydrogel 28 on sidewalls of the depression 34, and the desired thickness of the polymeric hydrogel 28 that aligns a bottom surface of the depression 34.
[0205] As shown in Fig.6B, during and after this continued etching process, at least some other of the portion of each of the polymeric hydrogel layer 26’ and the protective coating 28 remain intact in the bottom portion 38 of the depressions 34. Further, the continued etching of the protective coating 28 and of the polymeric hydrogel layer 26’ may be performed such that the distance (represented by “d” in the figure) between the top / opening of the depressions 34 (i.e., which is at the plane of the interstitial regions 24) and the polymeric hydrogel layer 26’ is about 50 nm, or about 75 nm, or about 100 nm, or about 125 nm, or about 150 nm. It is believed that this distance “d” between the polymeric hydrogel layer 26’ and the top / opening of the depressions 34 aids in reducing or eliminating pad hopping, which leads to more monoclonal cluster and improved sequencing metrics.
[0206] After the continued etching ceases, the method further comprises removing the some other of the portion of the protective coating 28 using a second removal process. The second removal process may involve exposing the remaining protective coating 28 (i.e., that which remains within the bottom portion 38 of the depressions 34 after continued etching) to an aqueous dissolving solution, or to an organic solvent. This exposure may be accomplished as described herein, using water, or water and a buffer, or the organic solvent. The incubation period is suitable for dissolving the protective coating 28.
[0207] After the second removal process has been performed and the polymeric hydrogel layer 26’ within the bottom portion 38 of the depressions 34 has been exposed, the method proceeds by grafting primers 30, 32 to the polymeric hydrogel layer 26’ within the bottom portion 38 of the depressions 34. Any example grafting process described herein may be used to attach the primers 30, 32 to the polymeric hydrogel layer 26’, such as puddle dispensing, spray coating, dunk coating, flow-through grafting, and the like. The primers 30, 32 may include any example of the P5, P7, P15, and PA-PD primers disclosed herein. In some examples, the attachment of the primers 30, 32 to the polymeric hydrogel layer 26’within the bottom portion 38 of the depressions 34 is facilitated by a catalyst, such as a copper-based catalyst.
[0208] Kit
[0209] The flow cell 10, 10’ disclosed herein may be included in a kit. One example biological sequencing kit generally comprises i) the flow cell including a substrate 14, 16, a polymeric hydrogel layer 26’ positioned over at least a portion of the substrate 14, 16, primers 30, 32 attached to the polymeric hydrogel layer 26’, and a protective coating 28 positioned over the polymeric hydrogel layer 26’ and the primers; and ii) a protective coating removal agent (e.g., water or another solution in which the protective coating 28 is dissolvable).
[0210] Another example biological sequencing kit generally comprises i) the flow cell including a substrate 14, 16, a polymeric hydrogel layer 26’ positioned over at least a portion of the substrate 14, 16, and a protective coating 28 positioned over the polymeric hydrogel layer 26’; ii) a protective coating removal agent (e.g., water or another solution in which the protective coating 28 is dissolvable); and iii) a primer grafting solution including a liquid carrier and the primers 30, 32.
[0211] In either kit, the substrate 14, 16, polymeric hydrogel layer 26’, primers 30, 32, and protective coating 28 may include any of the respective materials disclosed herein. In the second kit, the primer grafting solution
[0212] Sequencing Operation
[0213] The flow cell 10, 10’ as depicted in Fig.73E, or in Fig.4F may be used in a sequencing operation. In an example, the sequencing operation involves sequencing by synthesis.
[0214] At the outset of sequencing by synthesis, template strands may be formed. In template strand formation, library fragments / templates may be prepared from any nucleic acid sample (e.g., a DNA sample or an RNA sample). This process occurs off board the flow cell 10, 10’. The DNA nucleic acid sample may be fragmented into single-stranded, similarly sized (e.g., < 1000 bp) DNA fragments. The RNA nucleic acid sample may be used to synthesize complementary DNA (cDNA), and the cDNA may be fragmented into single- stranded, similarly sized (e.g., < 1000 bp) cDNA fragments. During preparation,adapters may be added to the ends of any of the fragments. Through reduced cycle amplification, different motifs may be introduced in the adapters, such as sequencing primer binding sites, indices, and regions that are complementary to the primers 30, 32. In some examples, the fragments from a single nucleic acid sample have the same adapters added thereto. The final library templates include the DNA or cDNA fragment and adapters at both ends. The DNA or cDNA fragment represents the portion of the final library template that is to be sequenced.
[0215] A plurality of library templates may be introduced to the flow cell 10, 10’. Multiple library templates are hybridized, for example, to one of the primers 30, 32 immobilized on the polymeric hydrogel layer 26’.
[0216] In sequencing by synthesis, amplification of the library templates involves cluster generation. In one example of cluster generation, library templates become seeded to the primers 30, 32 attached to the flow cell surface as described herein. The library templates are copied from the hybridized oligonucleotides (i.e., the primers 30, 32) by 3’ extension using a high-fidelity DNA polymerase. The original library templates are denatured, leaving the copies immobilized in the depression 34 or in the lane 22. Isothermal bridge amplification or some other form of amplification may be used to amplify the immobilized copies. For example, the copied templates loop over to hybridize to an adjacent, complementary oligonucleotide, and a polymerase copies the copied templates to form double stranded bridges, which are denatured to form two single stranded strands. These two strands loop over and hybridize to adjacent, complementary oligonucleotide and are extended again to form two new double stranded loops. The process is repeated on each template copy by cycles of isothermal denaturation and amplification to create dense clonal clusters in the depressions 34 or in the lane 22. In the lane 22, several distinct clonal clusters may be formed and may be intermingled depending upon how the templates seed and amplify. Each cluster of double stranded bridges is denatured. In an example, the reverse strand is removed by cleaving at the cleavage site (e.g., specific base cleavage), leaving forward template strands. In another example, the forward strand is removed by cleaving at the cleavage site, leaving reverse template strands. Clustering results in the formation of several different template strand copies immobilized in different regions of the flow cell 10, 10’. The clusters in a given region will depend upon thesequence of the library template that is seeded and amplified within a given depression 34 or at a particular region of the lane 22. This example of clustering is referred to as bridge amplification, and is one example of the amplification that may be performed. It is to be understood that other amplification techniques may be used, e.g., exclusion amplification.
[0217] Sequencing primers may then be introduced to the flow cell 10, 10’. The sequencing primers hybridize to a complementary portion of the sequence of the template strand copies that are attached in the depressions 34 or in the lane 22. The sequencing primers render the template strand copies ready for sequencing.
[0218] An incorporation mix including labeled nucleotides may then be introduced into the flow cell 10, 10’ e.g., via the inlet. In addition to the labeled nucleotides, the incorporation mix may include water, a buffer, and polymerases capable of nucleotide incorporation. When the incorporation mix is introduced into the flow cell 10, 10’, the mix enters the flow channel 12, and contacts the template strand copies.
[0219] The incorporation mix is allowed to incubate in the flow cell 10, 10’, and labeled nucleotides (including optical labels) are incorporated by respective polymerases into the nascent strands along the template strand copies. During incorporation, one of the labeled nucleotides is incorporated, by a respective polymerase, into one nascent strand that extends one sequencing primer and that is complementary to one of the template strand copies. Incorporation is performed in a template strand dependent fashion, and thus detection of the order and type of labeled nucleotides added to the nascent strand can be used to determine the sequence of the template strand copies. Incorporation occurs in at least some of the template strand copies during a single sequencing cycle.
[0220] The incorporated labeled nucleotides may include a reversible termination property due to the presence of a 3’ OH blocking group, which terminates further sequencing primer extension once the labeled nucleotide has been added. After a desired time for incubation and incorporation, the incorporation mix, including non-incorporated labeled nucleotides, may be removed from the flow cell 10, 10’ during a wash cycle. The wash cycle may involve a flow-through technique, where a washing solution (e.g., buffer) is directed into, through, and then out of flow channel 12, e.g., by a pump or other suitable mechanism.
[0221] Without further incorporation taking place, the most recently incorporated labeled nucleotides can be detected through an imaging event. During the imaging event, an illumination system may provide an excitation light to the flow cell 10, 10’. The optical labels of the incorporated labeled nucleotides emit optical signals in response to the excitation light. When the flow cell 10’ is used, these optical signals are converted into electrical signals which are detected.
[0222] After imaging or electrical detection is performed, a cleavage mix may then be introduced into the flow cell 10, 10’. In an example, the cleavage mix is capable of i) removing the 3’ OH blocking group from the incorporated nucleotides, and ii) cleaving the optical label from the incorporated nucleotide. Examples of 3’ OH blocking groups and suitable de-blocking agents / components in the cleavage mix may include: ester moieties that can be removed by base hydrolysis; allyl- moieties that can be removed with Nal, chlorotrimethylsilane and Na2S2O3 or with Hg(II) in acetone / water; azidomethyl which can be cleaved with phosphines, such as tris(2-carboxyethyl)phosphine (TCEP) or tri(hydroxypropyl)phosphine (THP); acetals, such as tert-butoxy-ethoxy which can be cleaved with acidic conditions; MOM (—CH2OCH3) moieties that can be cleaved with LiBF4 and CH3CN / H2O; 2,4- dinitrobenzene sulfenyl which can be cleaved with nucleophiles such as thiophenol and thiosulfate; tetrahydrofuranyl ether which can be cleaved with Ag(I) or Hg(II); and 3’ phosphate which can be cleaved by phosphatase enzymes (e.g., polynucleotide kinase). Examples of suitable optical label cleaving agents / components in the cleavage mix may include: sodium periodate, which can cleave a vicinal diol; phosphines, such as tris(2-carboxyethyl)phosphine (TCEP) or tris(hydroxypropyl)phosphine (THP), which can cleave azidomethyl linkages; palladium and THP, which can cleave an allyl; bases, which can cleave ester moieties; or any other suitable cleaving agent.
[0223] Additional sequencing cycles may then be performed until the template strand copies are sequenced.
[0224] To further illustrate the present disclosure, an example is given herein. It is to be understood that this example is provided for illustrative purposes and is not to be construed as limiting the scope of the present disclosure.NON-LIMITING WORKING EXAMPLE
[0225] Six individual patterned structures (hereinafter “example flow cell 1,” “example flow cell 2,” “example flow cell 3,” “example flow cell 4,” “example flow cell 5,” and “example flow cell 6”) were used in this example, where each of the patterned structures included discrete flow channels. The substrate of each the individual patterned structures was a multi-layer substrate and the outer layer was a resin material patterned with depressions (within the flow channel). Thus, each of the discrete flow channels had its own set of depressions.
[0226] During preparation of example flow cells 1-6, chemical vapor deposition was used to apply a norbornene silane to the patterned outer layer in each of the flow channels. PAZAM was then applied to the silanized, patterned outer layer in each of the flow channels, and then the PAZAM was cured at about 60°C for about 60 minutes.
[0227] For example flow cells 3 and 6, a primer solution (including water, 5 µM primers, and a carbonate buffer) was spread over the patterned structures, and thus introduced into the flow channels, and allowed to incubate at ambient laboratory temperature and relative humidity until they were dry.
[0228] For example flow cells 1, 2, 4 and 5, a precision deposition tool was used to specifically introduce the primer solution to the flow channels. The primer solution was allowed to incubate at ambient laboratory temperature and relative humidity until they were dry.
[0229] A protective coating was then formed over the grafted PAZAM in each of the flow channels. The protective coating was formed using a solution of 5% KOLLICOAT® IR in water. This solution was applied using a spin coating process, and was then dried using nitrogen gas.
[0230] Each of example flow cells 1-6 was exposed to etching, using one of two different etching tools, for about 420 seconds. Example flow cells 1-3 were etched using a NORDSON® etching tool (i.e., NORDSON® AP-600), and example flow cells 4-6 were etching using a TRION® etching tool (i.e., TRION® Oracle Dry Etcher). The results of the etching processes are shown in Fig.7A through Fig.7D, with protective coating thickness being shown on the y axis (in nm), and time being shown on the x axis (in seconds). The etching results for example flow cells 1 and2 are shown in Fig.7A. These flow cells were etched using the NORDSON® etching tool and were grafted with primers that were included in the protective coating solution. The etching results for example flow cell 3 are shown in Fig.7B. This flow cell was etched using the NORDSON® etching tool and included the PAZAM that was pre-grafted with primers. The etching results for example flow cells 4 and 5 are shown in Fig.7C. These flow cells were etched using the TRION® etching tool and were grafted with primers that were included in the protective coating solution. The etching results for example flow cell 6 are shown in Fig.7D. This flow cell was etched using the TRION® etching tool and included the PAZAM that was pre-grafted with primers.
[0231] The results shown in Fig.7A through Fig.7D indicate that both etching tools were successfully used to etch the protective coating overlying the depressions (having the PAZAM and the primers therein) at substantially linear rates.
[0232] Another flow cell was prepared for testing sequencing metrics after the protective coating was removed using an example of the method described herein. The substrate of this additional flow cell was also a multi-layer substrate, where the outer layer was a resin material patterned with depressions (within the flow channel).
[0233] The outer resin material was exposed to plasma ashing, and then PAZAM was spin coated on the outer resin layer. The PAZAM was cured at about 60°C for about 60 minutes.
[0234] A primer solution (including water, 5 µM primers, and a carbonate buffer) was spread over the patterned structure, and thus introduced into the flow channel, and allowed to incubate at 60°C for about 30 minutes.
[0235] A protective coating was then formed over the grafted PAZAM in the flow channel. The protective coating was formed using a solution of 5% KOLLICOAT® IR in water. This solution was applied using a spin coating process, and was then dried using nitrogen gas.
[0236] The flow cell was exposed to etching, using the TRION® etching tool (i.e., TRION® ORACLE DRY ETCHER) using the conditions described in this example.
[0237] The patterned structure was then bonded to a lid overnight under vacuum.
[0238] Sequencing was performed with a 650 pM PhiX sample and a NOVASEQ® 2000 sequencing instrument (available from Illumina Inc.). One of the sequencing metrics that was analyzed included %Occupied. %Occupied is a quantitative measurement of the percentage of depressions that are occupied by a cluster of amplicons (i.e., the percentage of depressions from which a fluorescence signal is detected, and thus by extension, containing a cluster). The results of the sequencing operation indicated that about 59.26% of the depressions were occupied by primers, with the best sequencing tile displaying a fluorescent intensity reflecting an average occupancy of about 90%. These results indicate that the protective coatings disclosed herein can be etched to expose primers that can be subsequently hybridized to DNA templates, whereupon the templates can be amplified and sequenced.
[0239] Additional Notes
[0240] It should be appreciated that all combinations of the foregoing concepts and additional concepts discussed in greater detail below (provided such concepts are not mutually inconsistent) are contemplated as being part of the inventive subject matter disclosed herein. In particular, all combinations of claimed subject matter appearing at the end of this disclosure are contemplated as being part of the inventive subject matter disclosed herein. It should also be appreciated that terminology explicitly employed herein that also may appear in any disclosure incorporated by reference should be accorded a meaning most consistent with the particular concepts disclosed herein.
[0241] Reference throughout the specification to “one example”, “another example”, “an example”, and so forth, means that a particular element (e.g., feature, structure, and / or characteristic) described in connection with the example is included in at least one example described herein, and may or may not be present in other examples. In addition, it is to be understood that the described elements for any example may be combined in any suitable manner in the various examples unless the context clearly dictates otherwise.
[0242] It is to be understood that the ranges provided herein include the stated range and any value or sub-range within the stated range, as if such values or sub-ranges were explicitly recited. For example, a range of about 400 nm to about 1 µm (1000 nm), should be interpreted to include not only the explicitly recited limits of about 400 nm to about 1 µm, but also to include individual values, such as about 708 nm, about 945.5 nm, etc., and sub-ranges, such as from about 425 nm to about 825 nm, from about 550 nm to about 940 nm, etc. Furthermore, when “about” and / or “substantially” are / is utilized to describe a value, they are meant to encompass minor variations (up to + / - 10%) from the stated value.
[0243] While several examples have been described in detail, it is to be understood that the disclosed examples may be modified. Therefore, the foregoing description is to be considered non-limiting.
Claims
What is claimed is:
1. A method, comprising: depositing a polymeric hydrogel over a substrate including a plurality of depressions separated by interstitial regions such that a polymeric hydrogel layer is formed within the plurality of depressions and over the interstitial regions; depositing a protective coating, including a plurality of primers therein, over the polymeric hydrogel layer, whereby at least some of the plurality of primers attach to the polymeric hydrogel layer; and etching the protective coating and the polymeric hydrogel layer, including the at least some of the plurality of primers attached thereto, to expose the interstitial regions, whereby a portion of each of the protective coating and the polymeric hydrogel layer including the at least some of the plurality of primers attached thereto remain intact in each of the depressions.
2. The method as defined in claim 1, further comprising removing the protective coating overlying the polymeric hydrogel within at least one of the plurality of depressions using a second removal process, thereby exposing the at least some of the plurality of primers therein.
3. The method as defined in claim 1, further comprising activating the substrate prior to depositing the polymeric hydrogel thereon.
4. The method as defined in claim 1, wherein the depositing of the protective coating involves spin coating or slot die coating.
5. The method as defined in claim 1, wherein the etching of the protective coating and the polymeric hydrogel layer involves reactive ion etching.
6. The method as defined in claim 5, wherein the reactive ion etching is performed at a rate of 0.3 nm per second to 10 nm per second.
7. The method as defined in claim 1, further comprising forming the plurality of depressions in the substrate using lithography prior to depositing the polymeric hydrogel thereon.
8. The method as defined in claim 1, wherein the protective coating includes a non-cationic synthetic polymer, a natural polysaccharide or a derivative thereof, a natural protein or a derivative thereof, a water-soluble salt, a buffer, a water-soluble surfactant, a sugar, a chelator, a buffer, or a combination thereof.
9. The method as defined in claim 8, wherein the protective coating includes: (a) the non-cationic synthetic polymer, and wherein the non-cationic synthetic polymer is selected from the group consisting of polyacrylamide, poly(acrylic acid), polyacrylate, poly(methacrylic acid), poly(vinyl pyrrolidone), poly(vinyl alcohol), poly (methacrylamide), a poly(N-alkyl acrylamide), a poly(N- dialkyl acrylamide), poly(N-(2-hydroxypropyl)methacrylamide), poly(divinyl ether- maleic anhydride), a poly(phosphate), a poly(2-alkyl-2-oxazoline), poly(hydroxyethyl methacrylate), poly(2-hydroxyethyl acrylate), polyethylene glycol, a polyether, poly(sulfobetaine methacrylate), poly(vinyl ether-maleic acid), a hydroxyl functional polymer, a non-natural polypeptide, a silicone, and a combination thereof; or (b) the natural polysaccharide or the derivative thereof, and wherein the natural polysaccharide or the derivative thereof is selected from the group consisting of starch, carboxymethylcellulose, xanthan gum, pectin, dextran, carrageenan, guar gum, cellulose, hydroxypropylmethyl cellulose (HPMC), hydroxypropyl cellulose (HPC), hydroxyethyl cellulose (HEC), methyl cellulose, carboxymethylhydroxyethyl cellulose (CMHEC), hyaluronic acid, starch phosphate, hydroxypropyl starch, hydroxyethyl starch, agarose, agar, alginate, and a combination thereof; or (c) the natural protein or the derivative thereof, and wherein the natural protein or the derivative thereof is selected from the group consisting of casein and albumin; or (d) the water-soluble salt, and wherein the water-soluble salt is selected from the group consisting of sodium chloride, sodium bromide, sodium sulfate, sodiumphosphate, sodium carbonate, sodium acetate, sodium citrate, potassium chloride, potassium bromide, potassium sulfate, potassium phosphate, potassium carbonate, potassium acetate, potassium citrate, saline sodium citrate, and a combination thereof; or (e) the buffer, and wherein the buffer is selected from the group consisting of an aqueous solution of saline sodium citrate, tris(hydroxymethyl)aminomethane (Tris) optionally with ethylenediaminetetraacetic acid, 4-(2-hydroxyethyl)-1- piperazineethanesulfonic acid (HEPES), 3-[[1,3-dihydroxy-2- (hydroxymethyl)propan-2-yl]amino]-2-hydroxypropane-1-sulfonic acid (TAPSO), N- (2-hydroxy-1,1-bis(hydroxymethyl)ethyl)glycine (tricine), 3-(N- morpholino)propanesulfonic acid (MOPS), and 3-(N,N-bis([2-hydroxyethyl]amino)- 2-hydroxypropanesulfonic acid (DIPSO); or (f) the water-soluble surfactant, and wherein the water-soluble surfactant is selected from the group consisting of an anionic or nonionic surfactant, an alkyl ethoxylate, an ethoxylated oil, a fat, and a sulfosuccinate; or (g) the sugar, and wherein the sugar is selected from the group consisting of an antioxidant, a glycol, glycerol, and cyclodextrin; or (h) the chelator, and wherein the chelator is selected from the group consisting of ethylenediaminetetraacetic acid sodium salt, tris(3- hydroxypropyltriazolylmethyl)amine, (tris(2-carboxyethyl)phosphine), and bathophenanthrolinedisulfonic acid disodium salt; or (i) a combination thereof.
10. The method as defined in claim 1, wherein after the etching of the protective coating and the polymeric hydrogel layer and the exposure of the interstitial regions, the method further comprises continuing etching such that some of the portion of each of the protective coating and the polymeric hydrogel layer including the at least some of the plurality of primers attached thereto are removed from an upper portion of the depressions, and such that some other of the portion of each of the protective coating and the polymeric hydrogel layer including the at least some of the plurality of primers attached thereto remain intact in a bottom portion of the depressions.
11. The method as defined in claim 10, wherein after the continued etching ceases, the method further comprises removing the some other of the portion of the protective coating using a second removal process.
12. A method, comprising: depositing a polymeric hydrogel over a substrate including a plurality of depressions separated by interstitial regions such that a polymeric hydrogel layer is formed within the plurality of depressions and over the interstitial regions; depositing a protective coating over the polymeric hydrogel layer; and etching the protective coating and the polymeric hydrogel layer to expose the interstitial regions, whereby portions of the polymeric hydrogel layer and the protective coating remain intact within each of the plurality of depressions.
13. The method as defined in claim 12, further comprising: dissolving the portions of the protective coating, thereby exposing the portions of the polymeric hydrogel layer within at least some of the plurality of depressions; and grafting primers to the portions of the polymeric hydrogel layer within the at least some of the plurality of depressions.
14. The method as defined in claim 12, further comprising activating the substrate prior to depositing the polymeric hydrogel thereon.
15. The method as defined in claim 12, wherein the depositing of the protective coating involves spin coating or slot die coating.
16. The method as defined in claim 12, wherein the etching of the protective coating and the polymeric hydrogel layer involves reactive ion etching.
17. The method as defined in claim 16, wherein the reactive ion etching is performed at a rate of 0.3 nm per second to 10 nm per second.
18. The method as defined in claim 12, further comprising forming the plurality of depressions in the substrate using lithography prior to depositing the polymeric hydrogel thereon.
19. The method as defined in claim 12, wherein the protective coating includes a non-cationic synthetic polymer, a natural polysaccharide or a derivative thereof, a natural protein or a derivative thereof, a water-soluble salt, a buffer, a water-soluble surfactant, a sugar, a chelator, a buffer, or a combination thereof.
20. The method as defined in claim 19, wherein the protective coating includes: (a) the non-cationic synthetic polymer, and wherein the non-cationic synthetic polymer is selected from the group consisting of polyacrylamide, poly(acrylic acid), polyacrylate, poly(methacrylic acid), poly(vinyl pyrrolidone), poly(vinyl alcohol), poly (methacrylamide), a poly(N-alkyl acrylamide), a poly(N- dialkyl acrylamide), poly(N-(2-hydroxypropyl)methacrylamide), poly(divinyl ether- maleic anhydride), a poly(phosphate), a poly(2-alkyl-2-oxazoline), poly(hydroxyethyl methacrylate), poly(2-hydroxyethyl acrylate), polyethylene glycol, a polyether, poly(sulfobetaine methacrylate), poly(vinyl ether-maleic acid), a hydroxyl functional polymer, a non-natural polypeptide, a silicone, and a combination thereof; or (b) the natural polysaccharide or the derivative thereof, and wherein the natural polysaccharide or the derivative thereof is selected from the group consisting of starch, carboxymethylcellulose, xanthan gum, pectin, dextran, carrageenan, guar gum, cellulose, hydroxypropylmethyl cellulose (HPMC), hydroxypropyl cellulose (HPC), hydroxyethyl cellulose (HEC), methyl cellulose, carboxymethylhydroxyethyl cellulose (CMHEC), hyaluronic acid, starch phosphate, hydroxypropyl starch, hydroxyethyl starch, agarose, agar, alginate, and a combination thereof; or (c) the natural protein or the derivative thereof, and wherein the natural protein or the derivative thereof is selected from the group consisting of casein and albumin; or (d) the water-soluble salt, and wherein the water-soluble salt is selected from the group consisting of sodium chloride, sodium bromide, sodium sulfate, sodiumphosphate, sodium carbonate, sodium acetate, sodium citrate, potassium chloride, potassium bromide, potassium sulfate, potassium phosphate, potassium carbonate, potassium acetate, potassium citrate, saline sodium citrate, and a combination thereof; or (e) the buffer, and wherein the buffer is selected from the group consisting of an aqueous solution of saline sodium citrate, tris(hydroxymethyl)aminomethane (Tris) optionally with ethylenediaminetetraacetic acid, 4-(2-hydroxyethyl)-1- piperazineethanesulfonic acid (HEPES), 3-[[1,3-dihydroxy-2- (hydroxymethyl)propan-2-yl]amino]-2-hydroxypropane-1-sulfonic acid (TAPSO), N- (2-hydroxy-1,1-bis(hydroxymethyl)ethyl)glycine (tricine), 3-(N- morpholino)propanesulfonic acid (MOPS), and 3-(N,N-bis([2-hydroxyethyl]amino)- 2-hydroxypropanesulfonic acid (DIPSO); or (f) the water-soluble surfactant, and wherein the water-soluble surfactant is selected from the group consisting of an anionic or nonionic surfactant, an alkyl ethoxylate, an ethoxylated oil, a fat, and a sulfosuccinate; or (g) the sugar, and wherein the sugar is selected from the group consisting of an antioxidant, a glycol, glycerol, and cyclodextrin; or (h) the chelator, and wherein the chelator is selected from the group consisting of ethylenediaminetetraacetic acid sodium salt, tris(3- hydroxypropyltriazolylmethyl)amine, (tris(2-carboxyethyl)phosphine), and bathophenanthrolinedisulfonic acid disodium salt; or (i) a combination thereof.
21. The method as defined in claim 12, wherein after the etching of the protective coating and the polymeric hydrogel layer and the exposure of the interstitial regions, the method further comprises continuing etching such that some of the portion of each of the protective coating and the polymeric hydrogel layer are removed from an upper portion of the depressions, and such that some other of the portion of each of the protective coating and the polymeric hydrogel layer remain intact in a bottom portion of the depressions.
22. The method as defined in claim 21, wherein after the continued etching ceases, the method further comprises:removing the some other of the portion of the protective coating using a second removal process; and attaching a plurality of primers to the some other of the portion of the polymeric hydrogel layer within the bottom portion of the depressions.
Citation Information
Patent Citations
Flow cells with hydrogel coating
US20200129974A1
Flow cell coating methods
US20220187710A1
Flow cell surface patterning
US20230285926A1