Genetically modified non-human animals producing heavy chain-only antibodies and methods of use

A genetically modified non-human animal model produces HCAbs with high affinity and specificity for complex antigens, addressing limitations in existing methods by incorporating humanized MHC and modified immunoglobulin loci, enabling effective CAR library generation for CAR T cell therapy.

WO2025245358A1PCT designated stage Publication Date: 2025-11-27NEW YORK UNIV
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/030599
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-11-08
Filing Date
2025-05-22
Publication Date
2025-11-27

AI Technical Summary

Technical Problem

Existing methods for generating heavy chain-only antibodies (HCAbs) face limitations in targeting complex antigens, particularly transmembrane and intracellular proteins, and fail to achieve high affinity and specificity, especially in large mammals, and cannot emulate in vivo affinity maturation or generate antibodies against nucleic acid vaccines.

Method used

A genetically modified non-human animal model with a humanized MHC allele and modified immunoglobulin heavy chain locus, lacking IgM and IgD expression, is developed to produce HCAbs with endogenous heavy chain variable regions, using camelid and cartilaginous fish variable domains, and is immunized with peptide-MHC complexes to generate antigen-specific HCAbs.

Benefits of technology

The model enables the production of HCAbs with high affinity and specificity for a broad spectrum of antigens, including transmembrane and intracellular proteins, and allows for the generation of CAR libraries with high-throughput screening for targeted CAR and TCR vectors, enhancing CAR T cell therapy applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025030599_27112025_PF_FP_ABST
    Figure US2025030599_27112025_PF_FP_ABST
Patent Text Reader

Abstract

This application relates to methods for producing modified non-human animals that produce heavy chain-only antibodies (HCAbs) and isolated HCAbs produced by the non-human animals. This application further relates to use of modified non-human animal for CAR library generation.
Need to check novelty before this filing date? Find Prior Art

Description

Attorney Docket No: 243735.000429 GENETICALLY MODIFIED NON-HUMAN ANIMALS PRODUCING HEAVY CHAIN- ONLY ANTIBODIES AND METHODS OF USE CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. Provisional Application No. 63 / 650,772, filedMay 22, 2024, and U.S. Provisional Application No.63 / 718, 307, filed on November 8, 2024, the contents of which are incorporated by reference herein in their entirety. STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH

[0002] This invention was made with government support under AI136141 and AI007180awarded by the National Institutes of Health. The government has certain rights in the invention. SEQUENCE LISTING

[0003] The instant application contains a Sequence Listing which has been submittedelectronically in XML format and is hereby incorporated by reference in its entirety. Said XML copy, created on April 30, 2025, is named 243735_000429_SL.xml and is 171,148 bytes in size. FIELD OF THE INVENTION

[0004] This application relates to methods for producing genetically modified non-humananimals that produce heavy chain-only antibodies (HCAbs) and isolated HCAbs produced by the genetically non-human animals. This application further relates to use of genetically modified non- human animals for chimeric antigen receptor (CAR) library generation. BACKGROUND

[0005] Common methods to generate heavy chain-only antibodies (HCAbs) involve camelidimmunization or the use of camelid variable gene libraries. These have advanced single-domain antibody (sdAb) production but face limitations with complex antigens and in large, genetically inflexible mammals like camelids. Camelids cannot be easily genetically manipulated, hindering the development of models for studying self-antigen cross-reactivity and discovery of novel antigens during natural infections. Moreover, while camelid display libraries enable the animal-Attorney Docket No: 243735.000429 free development of antibodies such as HCAbs or sdAbs, they fall short in emulating the natural process of in vivo affinity maturation, particularly for transmembrane and intracellular proteins. These in vitro libraries also cannot be employed to generate antibodies against nucleic acid vaccines, which significantly restricts the spectrum of antigens that can be effectively targeted. The generation of conventional antibody libraries involve the reshuffling of heavy and light chains into single-domain variable fragments (scFvs) that are conventionally used in display technologies. Native heavy and light chain pairs are lost in the process, and as such native antibody specificities are not captured in conventional libraries without the use of specialized technologies. These limitations have hindered the use of immune repertoires collected from vaccinated animals in the generation of chimeric antigen receptor (CAR) T cell receptors. Traditional heavy chain-only antibody generation processes often fail to reconcile high affinity with the avoidance of healthy tissue cross-reactivity, particularly when dealing with challenging transmembrane and intracellular targets presented on major histocompatibility complex (MHC). Thus, there is an ongoing and unmet need for new approaches that can target transmembrane and intracellular proteins and produce antibodies with high affinity and specificity. SUMMARY OF THE INVENTION

[0006] As specified in Background section above, there is a need in the art to identify novelapproaches to produce heavy chain-only antibodies with high affinity and specificity. The present disclosure addresses these and other needs by developing a small animal model platform that excels in in vivo affinity maturation, producing heavy chain-only antibodies with exceptional specificity.

[0007] In one aspect, provided herein is a genetically modified non-human animal, wherein thegenome of the genetically modified non-human animal comprises: a) a humanized or human major histocompatibility complex (MHC) allele, and b) a modified immunoglobulin heavy chain locus, wherein immunoglobulin (Ig) M, IgD, and their corresponding switch region are deleted or mutated so that IgM and IgD are not expressed and isotype switching is prevented, and wherein a CH1 exon of the immunoglobulin (Ig) constant region and its corresponding switch region are deleted or mutated so that gamma constant region 1 of heavy chain (CH1) exon is not expressed and isotype switching is prevented,Attorney Docket No: 243735.000429 wherein said genetically modified non-human animal is capable of producing heavy chain- only antibodies (HCAbs) or antigen-binding portions thereof comprising endogenous heavy chain variable regions and heavy chain constant regions.

[0008] In some embodiments of the genetically modified non-human animal, the humanized orhuman MHC allele is MHC type I allele.

[0009] In some embodiments of the genetically modified non-human animal, the human MHCI allele is HLA-A, HLA-B, HLA-C, HLA-E, HLA-F, or HLA-G.

[0010] In some embodiments of the genetically modified non-human animal, the human MHCI allele is HLA-A*01:01, HLA-A*02:01, HLA-A2.1, HLA-A11, HLA-A24, HLA-B7, or HLA- B44.

[0011] In some embodiments of the genetically modified non-human animal, the humanized orhuman MHC allele is MHC type II allele.

[0012] In some embodiments of the genetically modified non-human animal, the human MHCII allele is HLA-DP, HLA-DM, HLA-DO, HLA-DQ, HLA-DR, HLA-DRB1, HLA-DQB1, or HLA-DPB1.

[0013] In some embodiments of the genetically modified non-human animal, the endogenouslight chain of the non-human animal is not modified.

[0014] In some embodiments of the genetically modified non-human animal, the endogenousIgKappa (Igκ) or IgLambda (Igλ) light chains are not modified.

[0015] In some embodiments of the genetically modified non-human animal, the modifiedimmunoglobulin heavy chain locus further comprises: (i) at least one unrearranged camelid variable heavy domain of heavy chain (VHH) gene segment and / or at least one unrearranged cartilaginous fish variable new antigen receptor (V- NAR) gene segment and / or at least one unrearranged human heavy chain variable region (HCVR) gene segment; (ii) at least one human immunoglobulin heavy chain D gene segment; and (iii) at least one human immunoglobulin heavy chain J gene segment, wherein the gene segments (i), (ii), and (iii) are operably linked to a functional endogenous Ig heavy chain constant region gene sequence,Attorney Docket No: 243735.000429 wherein said genetically modified non-human animal is capable of producing heavy chain- only antibodies (HCAbs) comprising camelid VHH and / or cartilaginous fish V-NAR and / or human HCVR.

[0016] In some embodiments of the genetically modified non-human animal, the gene segments(i), (ii), and (iii) are inserted into an endogenous immunoglobulin heavy chain locus of the animal, or replace at least one nucleotide of the endogenous immunoglobulin heavy chain locus of the animal, or replace at least one of an endogenous V, D, and J gene segments.

[0017] In some embodiments of the genetically modified non-human animal, the gene segments(i), (ii), and (iii) are capable of rearranging to form a rearranged immunoglobulin heavy chain VDJ sequence.

[0018] In some embodiments of the genetically modified non-human animal, the modifiedimmunoglobulin heavy chain gene locus further comprises a human Emu enhancer.

[0019] In some embodiments of the genetically modified non-human animal, the human Emuenhancer is located upstream of the Ig constant region.

[0020] In some embodiments of the genetically modified non-human animal, the modifiedimmunoglobulin heavy chain gene locus further comprises at least one human immunoglobulin heavy chain variable region (IGHV) promoter.

[0021] In some embodiments of the genetically modified non-human animal, the geneticallymodified non-human animal expresses messenger ribonucleic acid (mRNA) that encodes a protein that has at least 70% amino acid sequence identity to a VHH from alpaca, camel, llama, vicunas, or guanacos or has at least 70% amino acid sequence identity to a V-NAR from a cartilaginous fish or has at least 70% amino acid sequence identity to a human HCVR.

[0022] In some embodiments of the genetically modified non-human animal, the geneticallymodified non-human animal expresses at least one heavy chain-only antibody (HCAb).

[0023] In some embodiments of the genetically modified non-human animal, the geneticallymodified non-human animal is a rodent.

[0024] In some embodiments of the genetically modified non-human animal, the geneticallymodified non-human animal is a mouse.

[0025] In some embodiments of the genetically modified non-human animal, theimmunoglobulin constant region is selected from IgG, IgM, IgD, IgA, IgE, and any combinations thereof.Attorney Docket No: 243735.000429

[0026] In some embodiments of the genetically modified non-human animal, the IgG is IgG1,IgG2, IgG3, IgG4, and any combinations thereof.

[0027] In some embodiments of the genetically modified non-human animal, the IgG constantregion is IgG3.

[0028] In one aspect, provided herein is a method of producing antigen-specific heavy chain-only antibodies (HCAbs) or antigen-binding portions thereof, the method comprising immunizing the genetically modified non-human animal of the present disclosure, wherein the antigen is a peptide presented in complex with a MHC molecule, and wherein the MHC molecule corresponds to the humanized or human MHC allele present within the genetically modified non-human animal.

[0029] In some embodiments of the method of producing antigen-specific heavy chain-onlyantibodies (HCAbs) or antigen-binding portions thereof, the immunization with the peptide-MHC complex is administered as a prime-boost regimen.

[0030] In some embodiments of the method of producing antigen-specific heavy chain-onlyantibodies (HCAbs) or antigen-binding portions thereof, there is a 2-3 week interval between each immunization.

[0031] In some embodiments of the method of producing antigen-specific heavy chain-onlyantibodies (HCAbs) or antigen-binding portions thereof, the peptide is covalently attached to the MHC molecule.

[0032] In some embodiments of the method of producing antigen-specific heavy chain-onlyantibodies (HCAbs) or antigen-binding portions thereof, the peptide is non-covalently attached to the MHC molecule.

[0033] In some embodiments of the method of producing antigen-specific heavy chain-onlyantibodies (HCAbs) or antigen-binding portions thereof, the peptide-MHC complex forms a tetramer.

[0034] In some embodiments of the method of producing antigen-specific heavy chain-onlyantibodies (HCAbs) or antigen-binding portions thereof, the peptide is derived from a disease- associated antigen or is derived from a membrane protein, a transmembrane protein, an intracellular protein, a non-canonical protein, a glyco moiety, or a peptide-major histocompatibility complex (pMHC) protein, and splice variants thereof.Attorney Docket No: 243735.000429

[0035] In some embodiments of the method of producing antigen-specific heavy chain-onlyantibodies (HCAbs) or antigen-binding portions thereof, the disease-associated antigen is a cancer antigen.

[0036] In some embodiments of the method of producing antigen-specific heavy chain-onlyantibodies (HCAbs) or antigen-binding portions thereof, the disease-associated antigen is a melanoma-associated antigen.

[0037] In some embodiments of the method of producing antigen-specific heavy chain-onlyantibodies (HCAbs) or antigen-binding portions thereof, the disease-associated antigen is melanoma-associated antigen 3 (MAGEA3).

[0038] In some embodiments of the method of producing antigen-specific heavy chain-onlyantibodies (HCAbs) or antigen-binding portions thereof, the method further comprises isolating germinal center B cells and / or plasma cells from the animal and analyzing heavy chain-only antibodies (HCAbs) produced from the delta CH1 (ΔCH1) Ig locus.

[0039] In some embodiments of the method of producing antigen-specific heavy chain-onlyantibodies (HCAbs) or antigen-binding portions thereof, the method further comprises isolating germinal center B cells and / or plasma cells from the animal and analyzing heavy chain-only antibodies (HCAbs) produced from the ΔCH1IgG locus.

[0040] In some embodiments of the method of producing antigen-specific heavy chain-onlyantibodies (HCAbs) or antigen-binding portions thereof, the HCAbs are analyzed for antigen binding affinity and / or specificity.

[0041] In some embodiments of the method of producing antigen-specific heavy chain-onlyantibodies (HCAbs) or antigen-binding portions thereof, the antigen binding specificity of the HCAbs is assessed by assessing binding to unrelated antigens and / or by assessing binding to MHC molecules.

[0042] In some embodiments of the method of producing antigen-specific heavy chain-onlyantibodies (HCAbs) or antigen-binding portions thereof, the antigen binding affinity and / or specificity of the HCAbs is assessed using enzyme-linked immunosorbent assay (ELISA), enzyme-linked immunosorbent spot (ELISpot), kinetic exclusion assays, biolayer interferometry, specific protein interactions, surface plasmon resonance, or protein crystallography.

[0043] In some embodiments of the method of producing antigen-specific heavy chain-onlyantibodies (HCAbs) or antigen-binding portions thereof, the method further comprises cloning theAttorney Docket No: 243735.000429 selected HCAbs into chimeric antigen receptor (CAR) vectors to create a CAR library or into recombinant T cell receptor (TCR) vectors to create a TCR library.

[0044] In some embodiments of the method of producing antigen-specific heavy chain-onlyantibodies (HCAbs) or antigen-binding portions thereof, the CAR or TCR vectors are lentiviral or retroviral vectors.

[0045] In some embodiments of the method of producing antigen-specific heavy chain-onlyantibodies (HCAbs) or antigen-binding portions thereof, the method further comprises screening the CAR or TCR library in a high-throughput manner.

[0046] In some embodiments of the method of producing antigen-specific heavy chain-onlyantibodies (HCAbs) or antigen-binding portions thereof, the high-throughput screening comprises the use of CAR or TCR vectors to transduce mammalian host cells at a low multiplicity of infection to ensure single-copy integration.

[0047] In some embodiments of the method of producing antigen-specific heavy chain-onlyantibodies (HCAbs) or antigen-binding portions thereof, the high-throughput screening comprises screening for CAR or TCR binding to the peptide and cross-reactivity to the MHC molecule.

[0048] In some embodiments of the method of producing antigen-specific heavy chain-onlyantibodies (HCAbs) or antigen-binding portions thereof, the method further comprises the steps of: a) introducing the CAR or TCR library into mammalian host cells; b) culturing the CAR or TCR-expressing host cells of step (a) under conditions supporting expression of encoded CARs or TCRs; c) incubating the CAR or TCR-expressing host cells of step (a) with target and off-target antigen and MHC or with on- and off-target cells or tissues; d) selecting host cells exhibiting antigen-specific CAR or TCR binding and activation; e) optionally, identifying the sequence of CARs or TCRs within the host cells selected in step (d); and f) optionally, reformatting the identified sequence of CAR or TCR into a bispecific antibody or antigen-binding portion thereof.

[0049] In some embodiments of the method of producing antigen-specific heavy chain-onlyantibodies (HCAbs) or antigen-binding portions thereof, the mammalian host cells are T cells,Attorney Docket No: 243735.000429 natural killer (NK) cells, natural killer T (NKT) cells, mucosal-associated invariant T cells (MAIT cells), B cells, dendritic cells (DCs), and / or macrophages.

[0050] In one aspect, provided herein is a method of producing antigen-specific heavy chain-only antibodies (HCAbs) or antigen-binding portions thereof, the method comprising immunizing the genetically modified non-human animal of the present disclosure with an antigen, optionally wherein the antigen is encoded by mRNA encapsulated in a lipid nanoparticle (LNP).

[0051] In some embodiments of the method of producing antigen-specific heavy chain-onlyantibodies (HCAbs) or antigen-binding portions thereof, the antigen is a membrane protein, an intracellular protein, a non-canonical protein, a glyco moiety, or a peptide-major histocompatibility complex (pMHC) protein, and splice variants thereof.

[0052] In some embodiments of the method of producing antigen-specific heavy chain-onlyantibodies (HCAbs) or antigen-binding portions thereof, the membrane protein is a transmembrane protein.

[0053] In some embodiments of the method of producing antigen-specific heavy chain-onlyantibodies (HCAbs) or antigen-binding portions thereof, the antigen is a disease-associated antigen.

[0054] In some embodiments of the method of producing antigen-specific heavy chain-onlyantibodies (HCAbs) or antigen-binding portions thereof, the disease-associated antigen is a cancer antigen.

[0055] In some embodiments of the method of producing antigen-specific heavy chain-onlyantibodies (HCAbs) or antigen-binding portions thereof, the disease-associated antigen is a melanoma-associated antigen.

[0056] In some embodiments of the method of producing antigen-specific heavy chain-onlyantibodies (HCAbs) or antigen-binding portions thereof, the disease-associated antigen is MAGEA3.

[0057] In some embodiments of the method of producing antigen-specific heavy chain-onlyantibodies (HCAbs) or antigen-binding portions thereof, the method further comprises isolating germinal center B cells and / or plasma cells from the animal and analyzing heavy chain-only antibodies (HCAbs) produced from the ΔCH1Ig locus.

[0058] In some embodiments of the method of producing antigen-specific heavy chain-onlyantibodies (HCAbs) or antigen-binding portions thereof, the method further comprises isolatingAttorney Docket No: 243735.000429 germinal center B cells and / or plasma cells from the animal and analyzing heavy chain-only antibodies (HCAbs) produced from the ΔCH1IgG locus.

[0059] In some embodiments of the method of producing antigen-specific heavy chain-onlyantibodies (HCAbs) or antigen-binding portions thereof, the HCAbs are analyzed for antigen binding affinity and / or specificity.

[0060] In some embodiments of the method of producing antigen-specific heavy chain-onlyantibodies (HCAbs) or antigen-binding portions thereof, the antigen binding specificity of the HCAbs is assessed by assessing binding to unrelated antigens and / or by assessing binding to MHC molecules.

[0061] In some embodiments of the method of producing antigen-specific heavy chain-onlyantibodies (HCAbs) or antigen-binding portions thereof, the antigen binding affinity and / or specificity of the HCAbs is assessed using ELISA, ELISpot, kinetic exclusion assays, biolayer interferometry, specific protein interactions, surface plasmon resonance, or protein crystallography.

[0062] In some embodiments of the method of producing antigen-specific heavy chain-onlyantibodies (HCAbs) or antigen-binding portions thereof, the method further comprises cloning the selected HCAbs into chimeric antigen receptor (CAR) vectors to create a CAR library or into recombinant T cell receptor (TCR) vectors to create a TCR library.

[0063] In some embodiments of the method of producing antigen-specific heavy chain-onlyantibodies (HCAbs) or antigen-binding portions thereof, the CAR or TCR vectors are lentiviral or retroviral vectors.

[0064] In some embodiments of the method of producing antigen-specific heavy chain-onlyantibodies (HCAbs) or antigen-binding portions thereof, the method further comprises screening the CAR or TCR library in a high-throughput manner.

[0065] In some embodiments of the method of producing antigen-specific heavy chain-onlyantibodies (HCAbs) or antigen-binding portions thereof, the high-throughput screening comprises the use of CAR or TCR vectors to transduce mammalian host cells at a low multiplicity of infection to ensure single-copy integration.

[0066] In some embodiments of the method of producing antigen-specific heavy chain-onlyantibodies (HCAbs) or antigen-binding portions thereof, the high-throughput screening comprises screening for CAR or TCR binding to the peptide and cross-reactivity to the MHC molecule.Attorney Docket No: 243735.000429

[0067] In some embodiments of the method of producing antigen-specific heavy chain-onlyantibodies (HCAbs) or antigen-binding portions thereof, the method further comprises the steps of: a) introducing the CAR or TCR library into mammalian host cells; b) culturing the CAR- or TCR-expressing host cells of step (a) under conditions supporting expression of encoded CARs or TCRs; c) incubating the CAR- or TCR-expressing host cells of step (a) with target and off-target antigen and MHC or with on- and off-target cells or tissues; d) selecting host cells exhibiting antigen-specific CAR or TCR binding and activation; e) optionally, identifying the sequence of CARs or TCRs within the host cells selected in step (d); and f) optionally, reformatting the identified sequence of CAR or TCR into a bispecific antibody or antigen-binding portion thereof.

[0068] In some embodiments of the method of producing antigen-specific heavy chain-onlyantibodies (HCAbs) or antigen-binding portions thereof, the bispecific antibody or antigen-binding portion thereof is a Bi-specific engager.

[0069] In some embodiments of the method of producing antigen-specific heavy chain-onlyantibodies (HCAbs) or antigen-binding portions thereof, the bispecific antibody or antigen-binding portion thereof is a Bi-specific T cell engager (BiTE) or a Bi-specific killing cell engager (BiKE).

[0070] In some embodiments of the method of producing antigen-specific heavy chain-onlyantibodies (HCAbs) or antigen-binding portions thereof, the mammalian host cells are T cells, NK cells, NKT cells, MAIT cells, B cells, dendritic cells (DCs), and / or macrophages.

[0071] In one aspect, provided herein is a biologic molecule produced by the method of thepresent disclosure.

[0072] In some embodiments, the biologic molecule is selected from an antibody or antigen-binding portion thereof, an antibody-drug conjugate, a gene therapy, a cell, a fusion protein, an immunocytokine, or any combinations thereof.

[0073] In some embodiments of the biologic molecules, the antibody or antigen-binding portionthereof is selected from a heavy chain-only antibody or antigen-binding portion thereof, a heavy chain variable domain, a variable domain of heavy chain of heavy chain-only antibody (VHH), aAttorney Docket No: 243735.000429 nanobody, a camelid antibody or antigen-binding portion thereof, or an immunoglobulin novel antigen receptor (IgNAR) antibody or antigen-binding portion thereof.

[0074] In some embodiments of the biologic molecules, the heavy chain-only antibody orantigen-binding portion thereof is a single-domain antibody.

[0075] In some embodiments of the biologic molecules, the biologic molecule is a murine, achimeric, a human, a humanized, a camelid, or an immunoglobulin novel antigen receptor (IgNAR) antibody or antigen-binding portion thereof.

[0076] In some embodiments of the biologic molecules, the biologic molecule is monospecific,bispecific, or multi-specific.

[0077] In some embodiments of the biologic molecules, the biologic molecule is a bispecificantibody or antigen-binding portion thereof or a bi-epitopic antibody or antigen-binding portion thereof.

[0078] In some embodiments of the biologic molecules, the bispecific antibody or antigen-binding portion thereof is a Bi-specific engager.

[0079] In some embodiments of the biologic molecules, the bispecific antibody or antigen-binding portion thereof is a Bi-specific T cell engager (BiTE) or a Bi-specific killing cell engager (BiKE).

[0080] In some embodiments of the biologic molecules, the bispecific antibody or antigen-binding portion thereof is a Bi-specific T cell engager (BiTE).

[0081] In some embodiments of the biologic molecules, the biologic molecule can bind orinteract with an antigen.

[0082] In some embodiments of the biologic molecules, the antigen is a membrane protein, anintracellular protein, a non-canonical protein, a glyco moiety, or a peptide-major histocompatibility complex (pMHC) protein, and splice variants thereof.

[0083] In some embodiments of the biologic molecules, the membrane protein is atransmembrane protein.

[0084] In some embodiments of the biologic molecules, the antigen is a disease-associatedantigen.

[0085] In some embodiments of the biologic molecules, the disease-associated antigen is acancer antigen.Attorney Docket No: 243735.000429

[0086] In some embodiments of the biologic molecules, the disease-associated antigen is amelanoma-associated antigen.

[0087] In some embodiments of the biologic molecules, the disease-associated antigen isMAGEA3.

[0088] In some embodiments of the biologic molecules, the bispecific antibody or antigen-binding portion thereof binds to a cancer-associated antigen and an antigen present on immune cell.

[0089] In some embodiments of the biologic molecules, the immune cell is a T cell, an NK cell,an NKT cell, a MAIT cell, a B cell, a dendritic cell (DC), and / or a macrophage. BRIEF DESCRIPTION OF THE DRAWINGS

[0090] Figures 1A-1H depict representative and non-limiting presentation of a small animalplatform for heavy chain-only antibody (HCAb) generation and peptide-centric chimeric antigen receptor (PC-CAR) library generation from vaccinated single-chain antibody mice. Fig.1A shows structure of conventional antibodies. The CH1 domain of IgH is critical for pairing to light chain via disulfide bonds and hydrophobic interactions as evident from the structure of conventional antibodies. Fig. 1B shows a small animal platform for HCAbs generation. Fig. 1C shows that HCAbs lack a CH1 domain and do not pair with a light chain. Fig. 1D shows that HCAbs have favorable characteristics such as smaller size, increased stability, and suitable for aerosol delivery. Fig.1E shows current ways to generate a single-chain antibody for cancer antigens. Conventional panning approaches predominantly result in binders to MHC, necessitating extensive screening to identify peptide-centric binders. Fig. 1F shows an overview of a next-generation process of the present disclosure. HCAb producing mice were vaccinated with a peptide complexed with MHC (pMHC) to generate affinity matured peptide-centric antibody responses. By crossing mice with humanized HLA mice, the antibody response was directed to the peptide. Fig. 1G shows an application of HCAb mice to make peptide-centric CARs. HCAbs producing mice allow for simple cloning of entire antibody repertoires into CAR T cell libraries. High-throughput single-cell screens are optimized to identify rare peptide-centric CAR T cells. Fig.1H shows an application of HCAb mice to make peptide-centric CARs and alternative identification of HCAb clones via single-cell sequencing.Attorney Docket No: 243735.000429

[0091] Figures 2A-2C depict that CAR Library technology can identify rare clones having apeptide-centric binder. Previous data (Fig. 2A) shows that polyclonal antigen-enriched phage libraries appear to be enriched for antigen-specific binding (left). However, cloning polyclonal scFvs into phage-based CAR T libraries and performing more sensitive pMHC tetramer staining reveals that most clones are highly cross-reactive. This CAR library system allows identification of rare antigen specific clones. Antigen specific clones are screened in single-cell high-throughput assays using cutting edge optofluidic instruments. Cells demonstrating on-target killing and lack of cross-reactivity are exported for further validation (Fig. 2B). Isolated clones demonstrate specific on target binding and antitumor activity (Fig.2C).

[0092] Figures 3A-3B depict selection of pMHC target MAGE-A3 and the carcinoembryonicantigen-related cell adhesion molecule 3 (CEACAM3) transmembrane splicing variant. MAGE- A3 is a highly specific pan-cancer target, highly expressed across multiple tumors (right) and absent across normal tissues (left) (Fig. 3A). A highly tumor-specific splicing variant was identified in myelodysplastic syndromes (MDS), CEACAM3. A Sashimi plot showed the inclusion of a novel exon in MDS that was absent in healthy bone marrow (top). The junction was recurrently expressed in MDS and absent in healthy tissues (bottom) (Fig.3B). Figure 3B discloses SEQ ID NO: 122.

[0093] Figures 4A-4H depict that HCAb producing mice have efficient B cell hematopoiesisand a diverse antibody repertoire. Flow cytometric analysis revealed robust antibody productionfrom the ΔCH1IgG3 locus (IgG3dCH1 or dCH1IgG3 as designated in (Figs. 4B-4C). Fig. 4Ashows that B cell development is dependent on BCR signaling. Fig. 4B shows that IgG3dCH1 mice have robust B cell development in the bone marrow with reduced pre-B compartment. Fig. 4C shows robust B cell development and population of the periphery in homozygous and heterozygous animals. Fig.4D shows histograms that demonstrate that the majority of the IgG3+B cells (targeted locus) did not express intracellular kappa light chain heavy chain-only B cells populate the periphery (Figs. 4C-4D). Analysis of V(D)J repertoire from this HCAb model via 10x Chromium single-cell sequencing highlighted diverse variable gene pairing as visualized by circos plots depicted in Fig. 4E. In these circos plots each line represents an individual B cellconnecting rearranged V and J genes. Fig. 4F shows that HCAb B cells have increased potentialto become plasma cells. Fig.4G shows that HCAb Plasma cells are light chain deficient. Fig.4HAttorney Docket No: 243735.000429 shows that IgG3 usage is evident in transcripts from Model I animals, while only infrequently being detected in WT animals (endogenous IgG3 usage in naïve C57BL / 6 animals is ˜1%).

[0094] Figures 5A-5C depict that single-cell analysis reveals robust clonal responses andaffinity maturation following immunization. Clonal evolution and affinity maturation of immunoglobulin rearrangements in a HCAb mouse post-gp120 immunization are studied. Fig.5A shows a two-dimensional spectral plot representing the diverse V(D)J recombination events within sorted B cells. There are several HCAb expanded clones as indicated. Figs.5B-5C shows diverse VH and JH usage after SP2 immunization. A phylogenetic tree of the dominant clone (center), demonstrating clonal expansion and sequence evolution through somatic hypermutation, with node sizes denoting clonal abundance and branches reflecting the sequence divergence over time. Figure 5B discloses SEQ ID NOS 123, 123, 123, 123-129, 129-130, 130, 130-143, 143, 143-148, and 148-150, respectively, in order of appearance. Figure 5C discloses SEQ ID NOS 123, 123, 123, 123-125, 127, 126, 128-129, 129-130, 130, 130-133, 135, 134, 137, 136, 138-140, 142, 141, 143, 143, 143-148, and 148-150, respectively, in order of appearance, as well as SEQ ID NOS 151-160, 162-164, 161, 165-166, 162, 167, 161, 163, and 161, respectively, in order by column.

[0095] Figures 6A-6C depict LNP-encapsulated mRNA generation for vaccination andcharacterization of vaccine delivery particles. Fig. 6A shows an instrumentation for particle synthesis and encapsulation. Fig.6B shows uniform size distribution profile of LNPs measured by dynamic light scattering. Fig. 6C shows that quantification of mRNA encapsulation efficiency showed that the majority of LNPs contain mRNA.

[0096] Figure 7 depicts a representative approach for replacing mouse heavy chain locus withVHH and human DH and JH with a deletion of IgM, IgD, and CH1 domains. The representation in the figure is to the scale as shown by the scale bar on the bottom left side of the figure. The top panel shows the general organization of endogenous mouse sequence covering heavy chain DHs, JHs, IgM, IgD, and constant region of IgG3 including the CH1 domain in its native structure. The top panel also includes the adjacent 5’ up-stream and 3’ down-stream mouse sequences on mouse chromosome 12. The middle panel depicts the targeting vector used to replace the mouse heavy chain region. The bottom panel depicts the targeted event. The targeted event means the targeting vector with VHHs and human sequences replaced mouse heavy chain DHs, JHs, IgM, IgD, and CH1 at the mouse endogenous locus on chromosome 12.Attorney Docket No: 243735.000429

[0097] Figures 8A-8C depict a representative and non-limiting schematic of a modificationaccording to Model I of this disclosure. Fig. 8A shows the endogenous mouse immunoglobulin heavy chain (IgH) locus when re-engineered to delete switch regions and CH1 gamma 3 (CH1γ3) exon. Fig. 8B shows the modified IgG3dCH1 locus. Fig. 8C shows targeting of the murine IgH locus using two guide RNAs and CRISPR-Cas9 resulted in the removal of IgM and IgD exons and truncation of IgG3 by removal of exon 1 which contains the Ighg3 CH1 domain. Abbreviations: VH: variable heavy domain gene segments; DH: heavy chain diversity gene segments; JH: heavy chain joining gene segments; Eμ: IgM-related enhancer; Sμ, Sγ3, Sα: IgM-, IgG3-, IgA-related switch regions, Cμ, Cδ, Cγ3, Cα: heavy chain constant gene regions (not all shown); NEO: neomycin cassette; 3’RR: heavy chain regulatory region; HCAb: heavy chain-only antibody.

[0098] Figures 9A-9B depict a representative and non-limiting schematic of a modificationaccording to Model III of this disclosure. BAC insertion into the endogenous murine IgH locus resulted in the removal of IgM and IgD exons, truncation of IgG3 by removal of exon 1 which contains the Ighg3 CH1 domain. Abbreviations: VHH: camelid heavy chain variable domain gene segments; hDH: human heavy chain diversity gene segments; hJH: human heavy chain joining gene segments; hEμ: human IgM- related enhancer.

[0099] Figure 10 depicts analysis of germinal centers in Model I animals: Analysis of cluster ofdifferentiation (CD)19+and isoform of the CD45 protein (B220)+B cells from the spleens of the animals following immunization with SRBCs. The representative plots indicate that homozygous Model I animals can form germinal centers to an equal frequency as WT animals. Germinal centers are essential for high affinity antibody generation.

[0100] Figure 11 depicts robust plasma cell differentiation in Model I animals: Ex vivodifferentiation of CD43- naïve mature splenic B cells using LPS (10 µg / mL) stimulation for 72 hours leads to robust differentiation of plasma cells in Model I animals. Proliferation dye staining indicates that Model I B cells are dividing fewer times to differentiate to plasma cells when compared to wild-type B cells.

[0101] Figure 12A-12C depict antibody-target protein interaction measurement for sera fromimmunized Model I animals: Fig. 12A shows immunization of mice with SARS-CoV2 spike protein elicited an antigen-specific antibody (Ab) response. Model I mice generated a robust AbAttorney Docket No: 243735.000429 response to SARS-CoV-2 Spike protein. Figs. 12B and 12C. A KDin the nanomolar range was calculated for the heavy chain-only antibodies from Model I mice as an indication of high-affinity binding. IgG3dCH1 serum had a KD in the nM range as shown in Fig.12C.

[0102] Figure 13A-13C depict a flow cytometry analysis of mesenteric lymph nodes of 6 weekold WT and homozygous VHH-human DH and JH mice. The analysis includes evaluation of IgG3, IgM, and Igκ light chain cell surface expression and the recruitment of conventional and HCAb expressing B cells into germinal centers (GC). Gated on B220+CD19+B cells, there were a dramatic difference between WT and homozygous VHH-human DH and JH mice. Fig.13A shows that the majority of B cells (gated on B220+CD19+) of WT mice express IgM (88.6%). Only 0.35% are IgG3 positive. In sharp contrast, the majority (96%) of B cells in VHH-human DH and JH mice are IgG3 positive (gated on B220+CD19+). This indicates that homozygous VHH-human DH and JH mice were able to use unarranged VHH, DH, and JH elements to generate single-chain antibody receptors on B cells after VDJ recombination. In addition, Fig. 13B further demonstrates the single-chain expression of B cells because Igκ light chain expression was absent in homozygous VHH-human DH and JH mice (Model III) on the plot, yet highly expressed in WT mice. A fluorescence minus one (FMO) control for Igκ light chain is shown as a control for a light chain deficient B cell population. Fig. 13C shows that single-chain B cells responded to antigen stimulation in vivo indicated by the highlighted population of Fashigh, CD38neggerminal center B cells.

[0103] Figure 14 depicts a structure of chimeric antigen receptors.

[0104] Figure 15 depicts a protein gel for Model I, that demonstrates single chain production inthe serum of HCAb mice. Serum antibodies from a wild-type mouse, a mouse producing conventional IgG3, and an IgG3ΔCH1 mouse were purified using Protein A / G Dynabeads. Purified samples were separated by non-reducing SDS-PAGE and stained with GelCode Blue Safe Protein Stain to visualize protein bands. Molecular weights were estimated using a protein ladder. DETAILED DESCRIPTION

[0105] As specified in the Background section above, there is an unmet need for new approachesthat can target intracellular and transmembrane proteins with no or minimal cross-reactivity. CAR T cell therapies have revolutionized treatment of B cell malignancies, by targeting lineage- restricted membrane proteins but have been less successful in solid tumors where essential tissuesAttorney Docket No: 243735.000429 share these molecules. High-throughput CAR library screening tools were developed to identify peptide-centric (PC) binders from phage libraries (see, e.g., International Patent Application Publication No. WO 2023 / 122574 (incorporated herein by reference in its entirety). However, the phage-based CAR library does not contain antibodies that have undergone somatic hypermutations for specific targets (as illustrated in Fig. 2), nor can these antibodies be used to directly capture native antibody specificities from wild-type (WT) mice with heavy and light chains.

[0106] To broaden the application of CAR T cell applications to solid tumors, molecules thatare uniquely altered in cancer cells, including MHC-presented peptides and those modified through alternative splicing or post-translational modifications need to be addressed. The subtle molecular alterations that differentiate these tumor epitopes from parental tissue are limited in targetable surface area. Tumor-specific epitopes from these alterations present minimal distinctive surface areas, necessitating high precision to differentiate cancer-specific features from the larger molecules in which they reside. For example, the peptide within the peptide-MHC (pMHC) comprises only 1-2% of the surface are of the complex – binders to the pMHC must not only avoid cross-reactivity to the 98-99% of the molecular surface that is comprising the MHC, but also avoid cross-reactivity to homologous peptides presented on the MHC in healthy tissue. For instance, MAGE-A3, a highly tumor-specific cancer testis antigen found across various tumor types (Fig 3A), was previously targeted using affinity-matured T cell receptors (TCRs), leading to fatal off target reaction through cross-reactivity with a peptide derived from the TITIN protein presented in heart tissue (Linette et al., Blood 2013). An algorithm and screening strategy were developed to accurately identify such cross-reactivities, indicating that these risks could be mitigated (Yarmarkovich et al, Nature 2023). This methodology underpins the strategy described herein for designing peptide-centric (PC)-CAR receptors, enabling safer, and more selective CAR T therapy for solid tumors.

[0107] The present disclosure illustrates methods for producing genetically modified non-humananimals that can generate an immune response in the form of heavy chain-only antibodies against a broad spectrum of antigens including non-canonical proteins, glycol moieties, peptide-major histocompatibility complex (pMHC) proteins, membrane proteins, transmembrane proteins, and intracellular proteins, as well as splice variants thereof, and can also be used to generate CAR library for the rapid and efficient identification of high-affinity, antigen-specific single-chain antibodies for CAR construction.Attorney Docket No: 243735.000429

[0108] The present invention also describes the generation of polyclonal CAR T cell librariesgenerated from affinity maturated B cell repertoires of genetically modified mice expressing HCAbs that have been vaccinated with difficult tumor antigens, followed by the use of high- throughput screening systems to isolate CAR clones with on-target binding and function. Definitions

[0109] As used herein. “a,” “an,” or “the” can mean one or more than one. As used herein, unlessspecifically indicated otherwise, the word “or” is used in the inclusive sense of “and / or” and not the exclusive sense of “either / or.”

[0110] Gene names of V (variable) and J (joining) regions are designated according to theImMunoGeneTic (IMGT) nomenclature for B cell receptor of human or mouse.

[0111] The term “C region” and grammatical forms of it used herein refer to a constant regionof an antibody heavy chain. The constant region domain has separate gene segments for hinge, transmembrane, and cytoplasmic regions, which provide signal transduction after binding an antigen by the immunoglobulin heavy receptor.

[0112] The term “operably linked” refers to at least two genetic or protein elements that arejoined together in a manner that enables them to carry out their intended function. In this disclosure, portions of humanized protein may be operably linked to retain proper folding, processing, transporting, expression, and other functional properties of the protein in the cell. Further, a nucleic acid sequence encoding a protein may be operably linked to DNA sequences (e.g., promoter, enhancer, silencer, insulator etc.) to retain proper transcription. For example, a nucleic acid sequence of an immunoglobulin variable region (or V(D)J segments) may be operably linked to a nucleic acid sequence of an immunoglobulin constant region so as to allow proper recombination between the sequences into a rearranged immunoglobulin heavy or light chain gene sequence.

[0113] The term “gene segment” or “segment” refers to a V (heavy or light) or D or J (heavy orlight) immunoglobulin gene segment, which includes unrearranged sequences at immunoglobulin loci (in e.g., mice and humans) that can participate in a rearrangement (mediated by, e.g., endogenous recombinases) to form a rearranged V / D / J (heavy) or V / J (light)sequence.

[0114] The term “replacement” refers to a process comprises of placing exogenous geneticmaterial at an endogenous gene locus. As demonstrated in the Examples below, nucleotideAttorney Docket No: 243735.000429 sequences of endogenous non-human antibody B cell receptor heavy chain variable gene loci were replaced by nucleotide sequences corresponding to Camelidae B cell receptor heavy chain variable gene loci.

[0115] VHH regions from Camelidae or camelids may be introduced into the non-humangenetically modified animals described herein. The term “camelid” comprises at least camel, llama, alpaca, vicunas, and guanacos. As an alternative, variable regions from sharks and other cartilaginous fish may be introduced into the non-human genetically modified animals. For example, sharks encode V-NARs and variable genes from these immunoglobulin loci can be used.

[0116] The term “unrearranged” refers to a nucleic acid sequence, and includes nucleic acidsequences that exist in the germline of an animal cell, including a cell derived from an animal that has not been genetically modified, e.g., comprises a wild-type genome. The heavy chain variable region comprises unrearranged VH gene segments, unrearranged DH gene segments and unrearranged JH gene segments while the light chain variable region comprises unrearranged VL gene segments and unrearranged JL gene segments in the native germline configuration. These gene segments rearrange to produce a rearranged variable region gene during the B cell maturation process.

[0117] The term “germline” refers to an immunoglobulin nucleic acid sequence includes anucleic acid sequence that can be passed to progeny.

[0118] The term “non-human animals” refers to any vertebrate such as fish, amphibians, reptiles,non-human mammals, and birds. Suitable non-human mammals include non-human primates, rodents, goats, sheep, pigs, dogs, and cows. Suitable rodents include a mouse, a rat, a squirrel, a porcupine, and a hamster.

[0119] The term “genetically modified”, “modified”, “genetically engineered” or “engineered”refers to a modification, an artificial manipulation and / or a recombination of a nucleic acid sequence resulting in the production of a non-native polypeptide or elimination of a specific native polypeptide by a genetically modified animal. Herein the present disclosure modifications are performed in an immunoglobulin heavy chain (IgH) locus and / or in an MHC locus.

[0120] The term “heavy chain-only antibody” or “HCAb” refers to an immunoglobulin moleculecomprising heavy chain(s) only. As disclosed herein, one non-limiting way of generating HCAbs is by eliminating the CH1 domain. Non-limiting examples of variable region domains of HCAbs include single-domain antibodies (sdAbs), VH, and VHH. VHH may be derived from speciesAttorney Docket No: 243735.000429 including, but are not limited to alpaca, camel, llama, goat, mouse, human, sharks and other cartilaginous fish, and / or rabbit.

[0121] The term “antibody” refers to an immunoglobulin molecule capable of specific bindingto a target, such as a carbohydrate, polynucleotide, lipid, polypeptide, etc., through at least one antigen recognition site, located in the variable region(s) of the immunoglobulin molecule. The term “antibody”, encompasses not only intact (e.g., full-length) polyclonal or monoclonal antibodies, but also antigen-binding portions thereof (or antigen-binding fragments thereof) such as Fab, Fab’, F(ab’)2, Fv), single chain (scFv), mutants thereof, fusion proteins comprising an antibody portion, humanized antibodies, chimeric antibodies, diabodies, nanobodies, linear antibodies, single chain antibodies, multi-specific antibodies (e.g., bispecific antibodies) and any other modified configuration of the immunoglobulin molecule that comprises an antigen recognition site of the required specificity, including glycosylation variants of antibodies, amino acid sequence variants of antibodies, and covalently modified antibodies. Depending on the antibody amino acid sequence of the constant domain of its heavy chains, immunoglobulins can be assigned to different classes. There are five major classes of immunoglobulins depends on the species: IgA, IgD, IgE, IgG, and IgM, and several of these may be further divided into subclasses (isotypes), e.g., IgG1, IgG2a, IgG2b, IgG2c, IgG3, IgG4, IgA1, and IgA2. The heavy chain constant domains that correspond to the different classes of immunoglobulins are called alpha, delta, epsilon, gamma, and mu, respectively. The subunit structures and three-dimensional configurations of different classes of immunoglobulins are well known.

[0122] A typical antibody molecule comprises a heavy chain variable region (VH) and a lightchain variable region (VL), which are usually involved in antigen binding. The VH and VL regions can be further subdivided into regions of hypervariability, also known as “complementarity determining regions” (“CDR”), interspersed with regions that are more conserved, which are known as “framework regions” (“FR”). Each VH and VL is typically composed of three CDRs and four FRs, arranged from amino-terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The extent of the framework region and CDRs can be precisely identified using methodology known in the art, for example, by the Kabat definition, the Chothia definition, the AbM definition, the EU definition, the “Contact” numbering scheme, the “IMGT” numbering scheme, the “Aho” numbering scheme, and / or the contact definition, all of which are well known in the art. (See, e.g., Kabat, E.A., et al. (1991) Sequences of Proteins ofAttorney Docket No: 243735.000429 Immunological Interest, Fifth Edition, U.S. Department of Health and Human Services, NIH Publication No.91-3242, Chothia et al., (1989) Nature 342:877; Chothia, C. et al. (1987) J. Mol. Biol.196:901-917, Al-lazikani et al (1997) J. Molec. Biol.273:927-948; Edelman et al., Proc Natl Acad Sci U S A.1969 May;63(1):78-85; and Almagro, J. Mol. Recognit.17:132-143 (2004); MacCallum et al., J. Mol. Biol.262:732-745 (1996), Lefranc M P et al., Dev Comp Immunol, 2003 January; 27(1):55-77; and Honegger A and Pluckthun A, J Mol Biol, 2001 Jun.8; 309(3):657-70. See also hgmp.mrc.ac.uk and bioinf.org.uk / abs).

[0123] Any of the antibodies described herein can be either monoclonal or polyclonal. A“monoclonal antibody” refers to a homogenous antibody population and a “polyclonal antibody” refers to a heterogeneous antibody population. These two terms do not limit the source of an antibody or the manner in which it is made.

[0124] The term “polynucleotide” as referred to herein means a polymeric form of nucleotidesof at least 10 bases in length, either ribonucleotides or deoxyribonucleotides or a modified form of either type of nucleotide. The term includes single and double stranded forms.

[0125] The term “vector”, as used herein, means a vehicle capable of transporting a nucleic acidinto a host cell. In some embodiments, the vector is a plasmid, i.e., a circular double stranded DNA loop into which additional DNA segments may be ligated. In some embodiments, the vector is a viral vector, wherein additional DNA segments may be ligated into the viral genome. In some embodiments, the vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). In other embodiments, the vectors (e.g., non-episomal mammalian vectors) can be integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operatively linked. Such vectors are referred to herein as “recombinant expression vectors” (or simply, “expression vectors”).

[0126] The term “promoter” as used herein is defined as a DNA sequence recognized by thesynthetic machinery of the cell, or introduced synthetic machinery, required to initiate the specific transcription of a polynucleotide sequence. As used herein, the term “regulatory sequence” means a nucleic acid sequence which can regulate expression of a gene product operably linked to the regulatory sequence. In some instances, this sequence may be the core promoter sequence and in other instances, this sequence may also include an enhancer sequence and other regulatoryAttorney Docket No: 243735.000429 elements which are required for expression of the gene product. The promoter or regulatory sequence may, for example, be one which expresses the gene product in a tissue specific manner.

[0127] The term “recombinant host cell” (or simply “host cell”), as used herein, means a cellinto which an exogenous nucleic acid and / or recombinant vector has been introduced. It should be understood that “recombinant host cell” and “host cell” mean not only the particular subject cell but also the progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term “host cell” as used herein.

[0128] The term “percent sequence identity” means a ratio, expressed as a percent of the numberof identical residues over the total number of residues compared. Sequence identity for nucleic acid sequences may be analyzed over a stretch of at least about nine nucleotides, usually at least about 18 nucleotides, more usually at least about 24 nucleotides, typically at least about 28 nucleotides, more typically at least about 32 nucleotides, and preferably at least about 36, 48 or more nucleotides. There are a number of different algorithms known in the art which can be used to measure nucleotide sequence identity. For instance, polynucleotide sequences can be compared using FASTA, Gap or Bestfit, which are programs in Wisconsin Package Version 10.0, Genetics Computer Group (GCG), Madison, Wis. FASTA, which includes, e.g., the programs FASTA2 and FASTA3, provides alignments and percent sequence identity of the regions of the best overlap between the query and search sequences (Pearson, Methods Enzymol.183:63-98 (1990); Pearson, Methods Mol. Biol. 132:185-219 (2000); Pearson, Methods Enzymol. 266:227-258 (1996); Pearson, J. Mol. Biol. 276:71-84 (1998); herein incorporated by reference). Unless otherwise specified, default parameters for a particular program or algorithm are used. For instance, percent sequence identity between nucleic acid sequences can be determined using FASTA with its default parameters (a word size of 6 and the NOPAM factor for the scoring matrix) or using Gap with its default parameters as provided in GCG Version 6.1, herein incorporated by reference. A reference to a nucleotide sequence encompasses its complement unless otherwise specified. Thus, a reference to a nucleic acid having a particular sequence should be understood to encompass its complementary strand, with its complementary sequence. Sequence identity for polypeptides, is typically measured using sequence analysis software. Protein analysis software matches sequences using measures of similarity assigned to various substitutions, deletions and other modifications,Attorney Docket No: 243735.000429 including conservative amino acid substitutions. For instance, GCG contains programs such as “Gap” and “Bestfit” which can be used with default parameters, as specified with the programs, to determine sequence homology or sequence identity between closely related polypeptides, such as homologous polypeptides from different species of organisms or between a wild-type protein and a mutein thereof. See, e.g., GCG Version 6.1. Polypeptide sequences also can be compared using FASTA using default or recommended parameters, see GCG Version 6.1. (University of Wisconsin Wis.) FASTA (e.g., FASTA2 and FASTA3) provides alignments and percent sequence identity of the regions of the best overlap between the query and search sequences (Pearson, Methods Enzymol.183:63-98 (1990); Pearson, Methods Mol. Biol.132:185-219 (2000)). Another preferred algorithm when comparing a sequence of the invention to a database containing a large number of sequences from different organisms is the computer program BLAST, especially blastp or tblastn, using default parameters, as supplied with the programs. See, e.g., Altschul et al., J. Mol. Biol.215:403-410 (1990); Altschul et al., Nucleic Acids Res.25:3389-402 (1997).

[0129] The length of polypeptide sequences compared for homology will generally be at leastabout 16 amino acid residues, usually at least about 20 residues, more usually at least about 24 residues, typically at least about 28 residues, and preferably more than about 35 residues. When searching a database containing sequences from a large number of different organisms, it is preferable to compare amino acid sequences.

[0130] The term “epitope” refers to any protein determinant capable of specific binding to animmunoglobulin or T-cell receptor. Epitopic determinants consist of chemically active surface groupings of molecules such as amino acids or sugar side chains and may, but not always, have specific three-dimensional structural characteristics, as well as specific charge characteristics.

[0131] The term “chimeric antigen receptor (CAR)” refers to a recombinant or syntheticmolecule which combines antibody-based specificity for a desired antigen with a T cell receptor- activating intracellular domain to generate a chimeric protein that exhibits cellular immune activity to the specific antigen. Genetically Modified Non-Human Animals

[0132] The present disclosure provides a genetically modified non-human animal comprising amodified endogenous MHC locus in the genome of the genetically modified non-human animal. In some embodiments, the modified endogenous MHC locus of the genetically modified non-Attorney Docket No: 243735.000429 human animal comprises an exogenous sequence (e.g., a human MHC sequence also known as human leukocyte antigen (HLA)).

[0133] In some embodiments, the genetically modified non-human animal comprises a modifiedendogenous MHC locus able to distinctly recognize a peptide present on a peptide-MHC tetramer complex as a foreign material. In some embodiments, the genetically modified non-human animal comprises human MHC I or human MHC II genes in the genome. In some embodiments, the genetically modified non-human animal comprises humanized MHC I or humanized MHC II genes in the genome. In some embodiments, the human MHC I genes include one or more, or all MHC I major genes or MHC I minor genes. In some embodiments, the human MHC I major gene is HLA-A, HLA-B, HLA-C, and any combinations thereof. In some embodiments, the human MHC I minor gene is selected from HLA-E, HLA-F, and HLA-G, and any combinations thereof. In some embodiments, the human MHC II gene is selected from HLA-DP, HLA-DM, HLA-DO, HLA-DQ, HLA-DR, HLA-DRB1, HLA-DQB1, HLA-DPB1, and any combinations thereof. In some embodiments, the human MHC gene is selected from HLA-A, HLA-B, HLA-C, HLA- DRB1, HLA-DQB1, HLA-DPB1, HLA-E, HLA-F, HLA-G and any combinations thereof. In some embodiments, the HLA allele is HLA-A*01:01, HLA-A*02:01, HLA-A2.1, HLA-A11, HLA-A24, HLA-B7, or HLA-B44. In some embodiments, the humanized MHC allele is HLA- A*01:01. In some embodiments, the humanized MHC allele is HLA-A*02:01.

[0134] In some embodiments, the genetically modified non-human animal also comprises non-functional immunoglobulin M (IgM) and / or immunoglobulin D (IgD) domains. The non- functional IgM and / or IgD as disclosed herein may include inactivation or deletion of IgM and / or IgD. In some embodiments, the deleted or mutated IgM and / or IgD are not expressed. In some embodiments, a genetically modified non-human animal comprises an inactivated or deleted a switch region(s). In some embodiments, the genetically modified non-human animal comprises an inactivated or deleted the Sμ and Sγ gene segments. Inactivation or deletion of the Sμ and Sγ switch regions prevent isotype class switching, thereby enabling expression of only HCAbs without deleting the CH1 domain in other isotypes. Figure 8 illustrates a non-limiting presentation of an IgH locus of the genetically modified mice comprising inactivation or deletion of genes encoding IgM, IgD, CH1 exon of gamma 3 chain, and switch regions.

[0135] In some embodiments, a genetically modified non-human animal lacks a CH1 domain ofthe immunoglobulin (Ig) constant region. In some embodiments, a genetically modified non-Attorney Docket No: 243735.000429 human animal lacks a H1domain of the IgG constant region. In some embodiments, a genetically modified mouse lacks a H1domain of the murine heavy chain constant region. Such modified mouse is able to produce single-chain antibodies that resemble camelid HCAbs or shark IgNar Abs. Figure 1C illustrates non-limiting HCAbs lacking light chains. In some embodiments, a CH1 exon of the Ig constant region is deleted. In certain embodiments, a CH1 exon of the IgG constant region is deleted. The IgG constant region may include IgG1, IgG2, IgG3, IgG4, and any combinations thereof. In some embodiments, the CH1 exon of Ighg3 is deleted. The CH1 exon of other constant regions can also be deleted and produce similar HCAbs. In some embodiments, the endogenous light chain of the non-human animal is not modified. In some embodiments, the endogenous Ig Kappa or Ig Lambda light chains are not modified.

[0136] In some embodiments, a genetically modified non-human animal that expresses a heavychain-only antibody is provided, wherein the heavy chain-only antibody consists essentially of a heavy chain that lacks a functional CH1 domain or lacks both a functional CH1 domain and a functional hinge region. In some embodiments, the heavy chain comprises a mammalian heavy chain variable domain (VH) that comprises a sequence that is identical to a mammalian heavy chain variable domain (VH) encoded by a germline heavy chain variable domain gene, and the heavy chain comprises a mouse CH2 domain and a mouse CH3 domain. In some embodiments, mammalian VH is murine VH or rat VH. In some embodiments, the mammalian VH is murine VH. In some embodiments, the heavy chain comprises a mammalian VH that comprises a sequence that is not identical to a mammalian VH encoded by a germline variable domain gene, wherein the variable domain is selected from a camelid VHH, cartilaginous fish V-NAR repertoire, or human VH.

[0137] In some embodiments, the genome of the genetically modified non-human animal furthercomprises a modified endogenous immunoglobulin heavy chain locus. In some embodiments, the endogenous light chain of the non-human animal is not modified. In some embodiments, the endogenous Ig Kappa or Ig Lambda light chains are not modified. In some embodiments, the modified endogenous immunoglobulin heavy chain locus comprises an exogenous sequence (e.g., a human sequence and / or a camelid sequence) through, e.g., homologous recombination (HR), in embryonic stem embryonic stem (ES) cells. The animals are generally able to pass the modification to progeny, i.e., through germline transmission. The homologous DNA sequence may be an endogenous chromosomal sequence or an exogenous nucleic acid that was delivered to the cell.Attorney Docket No: 243735.000429

[0138] In some embodiments, the modified endogenous immunoglobulin heavy chain locuscomprises an at least one unrearranged murine heavy chain variable domain (mVH) gene segment, at least one unrearranged human heavy chain variable domain (hVH) gene segment and / or at least one unrearranged camelid VHH gene segment, or cartilaginous fish VH.

[0139] In some embodiments, the modified endogenous immunoglobulin heavy chain locuscomprises a nucleotide sequence comprising (i) at least one unrearranged murine VH gene segment, at least one unrearranged human VH gene segment, at least one unrearranged camelidVHH gene segment, or at least one unrearranged cartilaginous fish V-NAR gene segment; (ii) atleast one unrearranged mouse DH gene segment or at least one unrearranged human DH gene segment; and (iii) at least one unrearranged mouse JH gene segment or at least one unrearranged human JH gene segment.

[0140] In some embodiments, the genetically modified non-human animal comprises atransgene that comprises at least one unrearranged mVH gene segment, at least one unrearranged mouse DH segment, and at least one unrearranged mouse JH segment. In some embodiments, the genetically modified non-human animal comprises a transgene that comprises at least one unrearranged mVH gene segment, at least one unrearranged human DH segment, and at least one unrearranged human JH segment.

[0141] In some embodiments, at least one unrearranged murine VH gene segment, at least oneunrearranged mouse DH gene segment, and at least one unrearranged mouse JH gene segment are operably linked to a functional endogenous Ig heavy chain constant domain gene sequence. In some embodiments, the at least one unrearranged murine VH gene segment, at least one unrearranged mouse DH gene segment, and at least one unrearranged mouse JH gene segment are operably linked to a functional endogenous IgG heavy chain constant domain gene sequence. In some embodiments, the at least one unrearranged murine VH gene segment, at least one unrearranged human DH gene segment, and at least one unrearranged human JH gene segment are operably linked to a functional endogenous Ig heavy chain constant domain gene sequence. In some embodiments, the at least one unrearranged murine VH gene segment, at least one unrearranged human DH gene segment, and at least one unrearranged human JH gene segment are operably linked to a functional endogenous IgG heavy chain constant domain gene sequence. In some embodiments, (i) the at least one unrearranged murine VH gene segment, the at least oneunrearranged camelid VHH gene segment, or at least one unrearranged cartilaginous fish V-NARAttorney Docket No: 243735.000429 gene segment, (ii) the at least one unrearranged mouse DH or human DH gene segment, and (iii) the at least one unrearranged mouse JH or human JH gene segment are operably linked to a functional endogenous Ig heavy chain constant domain gene sequence. In some embodiments, the at least one unrearranged murine VH gene segment, at least one unrearranged human DH gene segment, and at least one unrearranged human JH gene segment are operably linked to a functional endogenous IgG heavy chain constant domain gene sequence. In some embodiments, (i) the at least one unrearranged murine VH gene segment, the at least one unrearranged camelid VHH genesegment, or at least one unrearranged cartilaginous fish V-NAR gene segment, (ii) the at least oneunrearranged mouse DH or human DH gene segment, and (iii) the at least one unrearranged mouse JH or human JH gene segment are operably linked to a functional endogenous Ig heavy chain constant domain gene sequence. In some embodiments, (i) the at least one unrearranged murine VH gene segment, the at least one unrearranged camelid VHH gene segment, or at least oneunrearranged cartilaginous fish V-NAR gene segment, (ii) the at least one unrearranged mouse DHor human DH gene segment, and (iii) the at least one unrearranged mouse JH or human JH gene segment are operably linked to a functional endogenous Ig heavy chain constant domain gene sequence. In some embodiments, the Ig heavy chain constant domain is selected from IgM, IgD, IgA, IgG, IgE, and any combinations thereof. In some embodiments, (i) the at least one unrearranged murine VH gene segment, the at least one unrearranged camelid VHH gene segment,or at least one unrearranged cartilaginous fish V-NAR gene segment, (ii) the at least oneunrearranged mouse DH or human DH gene segment, and (iii) the at least one unrearranged mouse JH or human JH gene segment are operably linked to a functional endogenous IgG heavy chain constant domain gene sequence. In some embodiments, the functional endogenous Ig heavy chain constant domain gene sequence is of non-human origin (e.g., mouse or rodent). In some embodiments, the functional endogenous IgG heavy chain constant domain gene sequence is of non-human origin (e.g., mouse or rodent). In some embodiments, IgG is IgG1, IgG2 (IgG2a / c or IgG2b), IgG3, IgG4, and any combinations thereof. In a non-limiting exemplary camelid- humanized non-human animal of the present disclosure, a majority of complementarity determining domain 3s (CDR3s) comprise human DH and JH gene domains. In some embodiments, the genetically modified non-human animal comprises a transgene that comprises at least one unrearranged mVH gene segment, at least one unrearranged mouse DH segment, at least one unrearranged mouse JH segment, and at least one murine heavy chain constant sequence.Attorney Docket No: 243735.000429 In some embodiments, the genetically modified non-human animal comprises a transgene that comprises at least one unrearranged mVH gene segment, at least one unrearranged human DH segment, at least one unrearranged human JH segment, and at least one murine heavy chain constant sequence. In some embodiments, the genetically modified non-human animal comprises a transgene that comprises at least one unrearranged VHH gene segment, at least one unrearranged human DH segment, at least one unrearranged human JH segment, and at least one murine heavy chain constant sequence. In some embodiments, the genetically modified non-human animal comprises a transgene that comprises at least one unrearranged VHH gene segment, at least one unrearranged mouse DH segment, at least one unrearranged mouse JH segment, and at least one murine heavy chain constant sequence. In some embodiments, the genetically modified non- human animal comprises a transgene that comprises at least one unrearranged cartilaginous fishV-NAR gene segment, at least one unrearranged human DH segment, at least one unrearrangedhuman JH segment, and at least one murine heavy chain constant sequence. In some embodiments, the genetically modified non-human animal comprises a transgene that comprises at least oneunrearranged cartilaginous fish V-NAR gene segment, at least one unrearranged mouse DHsegment, at least one unrearranged mouse JH segment, and at least one murine heavy chain constant sequence.

[0142] In some embodiments, the camelid VHH genes, human DH gene segments, and humanJH gene segments are capable of recombining to form a rearranged immunoglobulin heavy chain VDJ sequence. In some embodiments, the camelid VHH genes, mouse DH gene segments, and mouse JH gene segments are capable of recombining to form a rearranged immunoglobulin heavychain VDJ sequence. In some embodiments, the cartilaginous fish V-NAR genes, human DH genesegments, and human JH gene segments are capable of recombining to form a rearrangedimmunoglobulin heavy chain VDJ sequence. In some embodiments, the cartilaginous fish V-NARgenes, mouse DH gene segments, and mouse JH gene segments are capable of recombining to form a rearranged immunoglobulin heavy chain VDJ sequence. V(D)J recombination refers to mechanisms that contribute to the diversity of B cell receptor heavy chain in the vertebrate immune system. The antibodies produced by the genetically modified non-human animals of the present disclosure are independent of light chain pairing and can be directly humanized by virtue of utilizing human DH and JH elements. In some embodiments, the described genetically modified mice comprise VHH gene segment with a mouse or human DH and JH segments integrated intoAttorney Docket No: 243735.000429 an endogenous mouse heavy chain locus that is operably linked to an endogenous mouse constant region with at least a CH1 domain deletion. In some embodiments, the described geneticallymodified mice comprise cartilaginous fish V-NAR gene segment with a mouse or human DH andJH segments integrated into an endogenous mouse heavy chain locus that is operably linked to an endogenous mouse constant region with at least a CH1 domain deletion.

[0143] In some embodiments, the mouse comprises a B cell that bears on its surface a B cellreceptor, wherein the B cell receptor comprises a rearranged heavy chain VDJ that binds the antigen of interest, and wherein the B cell receptor comprises an immunoglobulin lacking a CH1 domain. In some embodiments, the mouse comprises a B cell that bears on its surface a B cell receptor, wherein the B cell receptor comprises a rearranged heavy chain VDJ that binds the antigen of interest, and wherein the B cell receptor comprises an IgG lacking CH1 domain.

[0144] In some embodiments, the unrearranged murine VH gene segments are from a mouseVH gene family selected from VH1, VH3, VH5, VH7, VH14, and combinations thereof. In some embodiments, the unrearranged murine VH gene segments are selected from a mVH 1-26, 1-42, 1-50, 1-58, 1-72, 3-6, 5-6, 7-1, 14-2, and combinations thereof.

[0145] In some embodiments, the unrearranged human VH gene segments are from a humanVH gene family selected from VH1, VH3, VH4, and combinations thereof. In some embodiments, the unrearranged human VH gene segments are selected from a 1-2, 1-8, 1-18, 1-46, 1-69, 3-21,3- 72, and 4-59.

[0146] In some embodiments, the human DH gene segments are all 27 human DH genesegments. In some embodiments, the human DH gene segments are D1-1, D2-2, D3-3, D6-6, D1- 7, D5-12, D3-10, D6-1, D4-17, D1-20, D4-23, and D1-26. In some embodiments, the human JH gene segments are all 6 human JH gene segments.

[0147] In some embodiments, the gene segments are from a cartilaginous fish VH gene segment.

[0148] In some embodiments, the IgG is selected from IgG1, IgG2 (IgG2a / c or IgG2b), IgG3,IgG4 and combinations thereof. In some embodiments, the genetically modified animal expresses modified IgG3.

[0149] In some embodiments, the genetically modified animal comprises a CDR3 derived froma DH gene segment selected from D1-1, D2-2, D3-3, D6-6, D1-7, D5-12, D3-10, D6-1, D4-17, D1-20, D4-23, and D1-26, and combinations thereof. In one embodiment, the genetically modifiedAttorney Docket No: 243735.000429 animal comprises a CDR3 comprising a sequence encoded by a JH gene segment that is a JH1, JH2, JH3, or JH4.

[0150] In some embodiments, the genetically modified animal comprises a rearranged antibodysequence that encodes a CDR3 that is derived from a rearrangement of a DH gene segment selected from D1-1, D2-2, D3-3, D6-6, D1-7, D5-12, D3-10, D6-1, D4-17, D1-20, D4-23, and D1-26, and a JH1, JH2, JH3, or JH4.

[0151] In another aspect, a genetically modified mouse is provided that expresses a heavy chain-only antibody that lacks a light chain and that lacks a CH1 domain in whole or in part, wherein the mouse expresses a B cell receptor on a B cell, wherein the B cell receptor on its surface displays a binding molecule that comprises an immunoglobulin heavy chain variable domain fused directly to an immunoglobulin hinge region or fused directly to a CH2 domain, wherein the heavy chain- only antibody lacks a CH1 domain. In some embodiments, the heavy chain-only antibody comprises CH2 and CH3 domains of any immunoglobulin constant region. In some embodiments, the heavy chain-only antibody comprises CH2 and CH3 domains of an IgG antibody. In some embodiments, the IgG is selected from IgG1, IgG2 (IgG2a / c or IgG2b), IgG3, IgG4 and any combinations thereof. In some embodiments, the genetically modified animal expresses modified IgG3. In some embodiments, the heavy chain-only antibody comprises an IgG3 CH2 and CH3 domains. In some embodiments, a genetically modified mouse is provided that expresses a heavy chain-only antibody that lacks a light chain and that lacks a CH1 domain in whole or in part, wherein the mouse expresses a B cell receptor on a B cell, wherein the B cell receptor on its surface displays a heavy chain-only antibody that comprises an camelid VHH fused directly to an immunoglobulin hinge region or fused directly to a CH2 domain, wherein the heavy chain-only antibody lacks a CH1 domain.

[0152] In some embodiments, the camelid VHHs are from alpaca, llama and camel. In someembodiments, the genetically modified non-human animal expresses mRNA that encodes a protein that has at least 70% amino acid sequence identity to a VHH from alpaca, camel, llama, vicunas, or guanacos. The sequences encoding the VHHs were modified for codon optimization from original camelid germline elements (such as AP2, LA1, LA2, CA1). In some embodiments, the genetically modified non-human animal expresses mRNA that encodes a protein that has at least 70% amino acid sequence identity to a V-NAR from a cartilaginous fish. In some embodiments,Attorney Docket No: 243735.000429 the genetically modified non-human animal expresses mRNA that encodes a protein that has at least 70% amino acid sequence identity to a human HCVR.

[0153] In some embodiments, a genetically modified non-human animal is selected from a fish,an amphibian, a reptile, a non-human mammal, and a bird. In some embodiments, a genetically modified non-human mammal is selected from a non-human primate, a rodent, a goat, a sheep, a pig, a dog, and a cow. In some embodiments, the genetically modified non-human animal is a rodent. In some embodiments, the rodent is selected from a mouse, a rat, a squirrel, a porcupine, and a hamster. In some embodiments, the genetically modified non-human mammals are any member of the order Rodentia. Non-limiting examples of Rodentia include mice, rats and rabbits. In some embodiments, the genetically modified non-human mammals are Mus musculus. In a specific embodiment, the rodent is selected from a mouse and a rat.

[0154] In some embodiments, the genetically modified non-human animal is a mouse.

[0155] In some embodiments, the mouse is selected from the group of a C57BL strain selectedfrom C57BL / A, C57BL / An, B6NTac, C57BL / GrFa, C57BL / KaLwN, C57BL / O1a, C57BL / 10ScSn, C57BL / 6, C57BL / 6ByJ, C57BL / 6J, C57BL / 6NJ, C57BL / 6NIH, C57BL / 10, and C57BL / 10Cr.

[0156] In some embodiments, the mouse is selected from the group of 129 strain comprising of129P1, 129P2, 129P3, 129S1, 12951 / SV, 12951 / SvIm, 129 / SvEvTac, 129S2, 129S4, 129S5, 12959 / SvEvH, 129S6, 129S7, 129S8, 129T1, 129T2, and 129X1.

[0157] In some embodiments, the mouse is Tg HLA-A*0101 / H2-Kb or B6NTac.B6J-Map4k3Tg(HLA-A*0201 / H2-Kb)A*0201 / Tacor C57BL / 6-Mcph1TgHLA-A2.1)1Enge / J.

[0158] In some embodiments, the mouse is a BALB strain, e.g., BALB / c strain. In someembodiments, the mouse is a mix of a BALB strain and another strain. In some embodiments, the mouse is from a hybrid strain (e.g., 50% BALB / c-50% 12954 / Sv or 50% C57BL / 6-50% 129). The present disclosure includes parental modified non-human mammals and their progeny.

[0159] In some embodiments, the genetically modified non-human animal is a rat. The rat canbe selected from a Dark Agouti strain, a Fischer strain, F344, F6, a Long-Evans Agouti strain, a Sprague Dawley strain, and a Wistar rat. In some embodiments, the rat is a mix of two or more strains selected from the above described group of rat strains.

[0160] The present disclosure illustrates non-limiting genetically modified animal models,Model I, Model III, Model I / +HLA Tg and Model III / +HLA Tg. Further, the present disclosureAttorney Docket No: 243735.000429 illustrates non-limiting genetically modified animal models developed from Model I and Model III by crossing over them with the humanized HLA mice as illustrated in the Examples. In some embodiments, the humanized HLA mouse is C57BL / 6NTac-Tg(HLA-A*0101 / H2-Kb)A1.01 (Model NO. 8909-F and 8909-M). Other humanized HLA mice that can be used to develop the genetically modified mice of the present invention are described in Botten et al., Journal of Virology 2006 Vol. 80, No. 17; Depla et al., Journal of Virology 2008 Jan; 82(1): 435–450; Alexander et al., Human Immunology 2003 Feb; 64(2): 211-223; Le AX, Bernhard EJ, Holterman MJ, Strub S, Parham P, Lacy E, Engelhard. J Immunol. 1989 Feb 15;142(4):1366-71; Newberg MH et al., J Immunol.1996 Apr 1;156(7):2473-80; and Taurog JD et al., J Immunol. 1988 Dec 1;141(11):4020-3. Any HLA transgenic mice that can express any or all human MHC loci can be used to develop the genetically modified mice of the present invention. In some embodiments, the transgenic mice that can be used to develop the genetically modified mice of the present invention are HLA-A2.1. The genetically modified animal of the present disclosure, which is either engineered to contain HLA transgenes or is humanized, is capable of producing B cells. Bone marrow (BM) was extracted from this genetically modified animal to isolate B cells that produce antibodies. This genetically modified animal offers a source of antibodies that are compatible with the human immune system, thereby minimizing immunogenic responses. In some embodiments, a diversity of HCAbs is created to a variety of immunogens using the genetically modified non- human animal of the present disclosure. The diversity of HCAbs is produced at least in part from the rearrangement of VHHs with DH and JH gene segments to form VDJ, e.g., the variable portion of the of HCAb. In some embodiments, the constructs produced by the genetically modified animals of the present invention comprise amino acids that intervene segments of the heavy chain- only antibodies, or other encoded proteins. In some embodiments, intervening sequences are selected from linkers, such as GS linkers, and self-cleaving peptide sequences. In some embodiments, a self-cleaving amino acid sequence is about 18-22 amino acids in length. Non- limiting examples of self-cleaving amino acid sequences are T2A, P2A, E2A, and F2A. Any of the self-cleaving sequences which are known in the art can be intervened the HCAb. In some embodiments, exons of the constant regions are a construct.

[0161] The genetically modified mouse of the present disclosure does not require knock-out ofIg loci.Attorney Docket No: 243735.000429

[0162] The genetically modified mouse of the present disclosure does not include a knock-in atthe mouse IgH locus with a selection of VHH gene segments replacing endogenous murine VH gene segments.

[0163] The genetically modified non-human animals of the present disclosure can be used togenerate therapeutics of the infectious diseases and cancers, or neurodegenerative diseases. The modified non-human animals of the present disclosure also have applications in diagnostics. Methods of producing Genetically Modified Non-Human Animals

[0164] The present disclosure provides methods of producing above described geneticallymodified non-human animals that can produce a wide variety of heavy chain-only antibodies having high affinity and high specificity towards their target antigens.

[0165] In some embodiments, the method of producing genetically modified non-human animalcomprises (i) introducing a human MHC locus into the genome of the non-human animal and (ii) modifying an immunoglobulin heavy chain locus of the non-human animal.

[0166] In some embodiments, the human MHC locus is introduced by crossing over thegenetically modified non-human animal with the transgenic mice expressing human MHC proteins. In some embodiments, Model I or Model III of the present disclosure is crossed over with the humanized HLA allele. In some embodiments, the genetically modified non-human animal comprises human MHC I or human MHC II genes in the genome after crossing over with the transgenic mice expressing human MHC proteins. In some embodiments, the genetically modified non-human animal comprises humanized MHC I or humanized MHC II genes in the genome after crossing over with the transgenic mice expressing human MHC proteins. In some embodiments, the human MHC I genes include one or more, or all MHC I major genes or MHC I minor genes. In some embodiments, the human MHC I major gene is HLA-A, HLA-B, HLA-C, and any combinations thereof. In some embodiments, the human MHC I minor gene is selected from HLA- E, HLA-F, and HLA-G, and any combinations thereof. In some embodiments, the human MHC II gene is selected from HLA-DRB1, HLA-DQB1, HLA-DPB1, and any combinations thereof. In some embodiments, the human MHC gene is selected from HLA-A, HLA-B, HLA-C, HLA-DP, HLA-DM, HLA-DO, HLA-DQ, HLA-DR, HLA-DRB1, HLA-DQB1, HLA-DPB1 HLA-E, HLA- F, HLA-G, and any combinations thereof. In some embodiments, the HLA allele is HLA-A*01:01, HLA-A*02:01, HLA-A2.1, HLA-A11, HLA-A24, HLA-B7, or HLA-B44. In some embodiments,Attorney Docket No: 243735.000429 the humanized MHC allele is HLA-A*01:01. In some embodiments, the humanized MHC allele is HLA-A*02:01. In some embodiments, the humanized HLA mouse is C57BL / 6NTac-Tg(HLA- A*0101 / H2-Kb)A1.01 (Model NO.8909-F and 8909-M). Other humanized HLA mice that can be used to develop the genetically modified mice of the present invention are described in Botten et al. Journal of Virology 2006 Vol. 80, No. 17; Depla et al. Journal of Virology 2008 Jan; 82(1): 435–450; Alexander et al. Human Immunology 2003 Feb; 64(2): 211-223; Le AX, Bernhard EJ, Holterman MJ, Strub S, Parham P, Lacy E, Engelhard. J Immunol.1989 Feb 15;142(4):1366-71; Newberg MH et al., J Immunol. 1996 Apr 1;156(7):2473-80; and Taurog JD et al., J Immunol. 1988 Dec 1;141(11):4020-3.

[0167] In some embodiments, modifying an immunoglobulin heavy chain locus of the non-human animal comprises inactivating genes that can express IgM and IgD isotype antibodies. In some embodiments, the genes that can express IgM and IgD isotype antibodies are inactivated or deleted. In some embodiments, the modifying an immunoglobulin heavy chain locus of the non- human animal comprises inactivating or a deleting CH1 exon to prepare an animal model that can generate heavy chain-only antibodies. In some embodiments, CRISPR mediated modification is used to modify an immunoglobulin heavy chain locus of the non-human animal. In some embodiments, the CRISPR mediated modification comprises use of exogenous nucleases. In some embodiments, exogenous nucleases are CRISPR nucleases (such as Cas nucleases).

[0168] In some embodiments, the methods of producing above described genetically modifiednon-human animals are performed using the described DNA constructs and involve the participation of certain proteins to insert the described targeting vectors, which may be provided as circularized or linear DNA molecules. In some embodiments, the protein is produced within the cell via expression of any suitable expression system that encodes the protein. In some embodiments, any proteins that are required to participate in the described process are modified such that they include a nuclear localization signal. In some embodiments, a protein is administered directly to the cells. For proteins that require an RNA component to function, such as certain Cas proteins as described herein, the protein(s) and the RNA component can be administered to the cells as ribonucleoproteins (RNPs). In some embodiments, the targeting vector is introduced into the described locus using a designer nuclease. In some embodiments, the nuclease is a RNA-guided CRISPR nuclease. Any of the suitable CRISPR nucleases (e.g., Cas nucleases) which are known in the art can be used. Similarly, any of the known methods forAttorney Docket No: 243735.000429 designing and selecting appropriate guide RNA constructs so that homology arms can be precisely inserted at a predetermined location using a Cas nuclease can be used. In some embodiments, an RNA-guided Cas nuclease can be used. In some embodiments, two guide RNAs are included so that the locus is modified in two positions.

[0169] In some embodiments, the methods involve the use of a CRISPR mediated modification,the Cas is selected from a Class 1 or Class 2 Cas enzyme. In some embodiments, a Type I, II, III,or CRISPR Cas nuclease is used. In a specific embodiment, the Cas comprises a Cas9, such as Streptococcus pyogenes (SpCas9). Derivatives of Cas9 are known in the art and may also be used to introduce the LP into a locus. Said derivatives may be, for example, smaller enzymes that Cas9, and / or have different proto adjacent motif (PAM) requirements. Non-limiting examples of Cas enzyme is Cas12a, also known as Cpfl, SpCas9-HF1, and HypaCas 9. Preferably, the CRISPR mediated modifications are used to develop Model III described herein.

[0170] To develop mouse Model I, embryonic murine genome was targeted to mediate a ˜65kbdeletion eliminating exons encoding mouse IgM, IgD, and the CH1 exon of IgG3, which were replaced with a selectable marker cassette, using a Neo cassette. The inserted selectable marker was configured such that it is flanked by recombinase recognition sequences. Thus, when a suitable recombinase is present in the nucleus the selectable marker can be excised by the recombinase and the chromosome repaired by the appropriate repair mechanisms within the nucleus. The recombinase may be provided by mating a mouse having a chromosome comprising the Model I construct with another mouse that expresses the recombinase. For example, if the recombinase recognition sequences Frt sites, the mice may be mated with Flp recombinase expressing mice, e.g., Flp deleter mice. The recombinase recognition sites can be other sites, provided a suitable recombinase is provided to remove the marker cassette. In Model I, the Neo selection is inserted using two CRISPR guide RNAs per side and Cas9, but other approaches can be used to insert the described constructs, as described herein. For Model I, design of the guide RNAs were such that the borders of the deletion and replacement with the marker cassette resulted in deletion of mouse IgM, IgD and IgG3 CH1, while leaving CH2 and CH3 intact. Also left intact are Adam6, the IgG3 hinge, and the Emu enhancer. The resulting modified locus generated HCAbs due to the deletion of CH1, mimicking camelid CH1 skipping, which prevented use of the light chain during antibody assembly. Other conventional antibody production is ablated due to the deletion of IgM and IgD. Modified mice of the present disclosure produce HCAbs that utilize the murine VH gene segmentAttorney Docket No: 243735.000429 but do not pair with the light chain. Model I includes a genetically modified non-human animal, wherein the genome of the animal comprises: at least one unrearranged immunoglobulin heavy chain variable domain gene segment, at least one unrearranged immunoglobulin heavy chain DH gene segment, and one unrearranged immunoglobulin heavy chain JH gene segment that are operably linked to a functional non-human immunoglobulin heavy chain constant region gene sequence, wherein the CH1 exon from constant region is deleted, enabling expression of single immunoglobulin heavy chain on a B cell independent of light chain.

[0171] For Model I, design of the guide RNAs were such the borders of the deletion andreplacement with the marker cassette resulted in deletion of mouse IgM, IgD, and IgG3 CH1, while leaving CH2 and CH3 intact. A pair of Cas9 guides at the 5’ end of the targeted locus (gRNA1: GTCTTTTGAGTACCGTTGTCTGG (SEQ ID NO: 118) gRNA2: CCAGCAGGTCGGCTGGACTAACT (SEQ ID NO:119)) and a pair of guides at the 3’ end of the locus (gRNA3: ATCGGTGAGAGGGTAACTAAGGG (SEQ ID NO: 120) gRNA4: ACCTGTCAATGATCATATCCAGG (SEQ ID NO:121)) were used in this example. Also left intact are Adam6, the IgG3 hinge, and the Emu enhancer.

[0172] In some embodiments, a genetically modified non-human animal further comprises anAdam6a gene (or fragment thereof) and / or an Adam6b gene (or fragment thereof) capable of retaining fertility of a male non-human animal. The Adam6a gene, Adam6b gene, or both are functional in a male non-human animal. For example, the non-human animal is a rodent (e.g., a mouse or a rat) and the Adam6a gene, Adam6b gene, or both are mouse or rat genes, respectively. The maintenance or insertion of the Adam6 gene(s) maintains or confers fertility on the male non- human animal (e.g., on the male mouse or rat).

[0173] In some embodiments, the inserted selectable marker is configured such that it is flankedby recombinase recognition sequences. The selectable marker can be excised by the recombinase and the chromosome repaired by the appropriate repair mechanisms within the nucleus in the presence of suitable recombinase recognition sequence present in the nucleus. Non-limiting examples of such recombinase systems include BxB1 recombinase that functions with attP / attB sites; Cre recombinase that is used with lox sites, such as loxP and LoxM sites; Dre recombinase which functions in the Dre-rox system; or Vika recombinase which functions in the Vika / vox system. In some embodiments, the recombinase may be inducible. In some embodiments, expression of the recombinase may be controlled by a repressor.Attorney Docket No: 243735.000429

[0174] In some embodiments, expression of the recombinase may be from an inducible promoteroperably linked to the sequence encoding the recombinase. The DNA sequences of inducible promoters for use in eukaryotic cells are known in the art, as are the agents that are capable of inducing expression from the promoters. In some embodiments, engineered regulated promoters such as the Tet promoter TRE which is regulated by tetracycline; anhydrotetracycline or doxycline, or the lad-regulated promoter ADHi, which is regulated by IPTG (isopropyl-thio-galactoside) can also be used. In some embodiments, the activity or localization of the recombinase can be regulated. Such embodiments may include but are not limited to the use of tamoxifen based relocalization of a recombinase to the nucleus or ligand-induced dimerization of the enzyme.

[0175] In some embodiments, the modified endogenous immunoglobulin heavy chain locusfurther comprises an enhancer. In some embodiments, the enhancer is human Emu enhancer. In some embodiments, the enhancer is located upstream of the IgG constant region.

[0176] In some embodiments, the modified endogenous immunoglobulin heavy chain locusfurther comprises a promoter.

[0177] The resulting modified locus generates HCAbs due to the deletion of CH1, mimickingcamelid CH1 skipping, which prevents use of the light chain during antibody assembly. Production of conventional antibody IgM and IgD antibodies is ablated due to deletion of these constant regions. Thus, modified mice according to Model I produce a broad repertoire of HCAbs that utilize murine VH, DH and JH elements and that do not pair require pairing with Ig light chain to be expressed on the surface of B lymphocytes or be secreted in response to antigenic challenge. The repertoire diversity was determined using high throughput sequencing following FACS sorting of naïve mature (B220+CD19+CD43-) B cells and using 10xChromium based pipeline to make libraries for Illumina sequencing.

[0178] In some embodiments, the methods can be performed without providing exogenousnucleases. In some embodiments, the modifying an immunoglobulin heavy chain locus of the non- human animal comprises replacing at an endogenous immunoglobulin heavy chain locus, one or more or all, mouse DH and JH gene segments with one or more unrearranged human DH and JH gene segments. In some embodiments, modifying an immunoglobulin heavy chain locus of the non-human animal comprises replacing at an endogenous immunoglobulin heavy chain locus, one or more or all heavy chain constant region genes with one or more unrearranged mouse heavy chain constant region genes lacking the CH1 exon. In some embodiments, absence of the CH1Attorney Docket No: 243735.000429 exon in mouse genome enables the mouse to make heavy chain-only antibodies. In some embodiments, modifying an immunoglobulin heavy chain locus of the non-human animal further comprises introducing one or more VHH genes; one or more or all human DH gene segments; and one or more or all JH gene segments in addition to deletion of genes required to express IgM, IgD, and CH1 domains.

[0179] Preferably, the methods performed without providing exogenous nucleases are used todevelop Model III described herein. In some embodiments, the described constructs are inserted into a selected locus by homologous recombination in the absence of nucleases. Homologous recombination proceeds using first and second homology arms. For CRISPR implemented methods, the first and second homology arms can include sequences that are recognized and cleaved by the same Cas-mediated cleavage system that recognizes and cleaves the chromosomes. Cas cleavage sites may be positioned at or near the end of the homology arms.

[0180] With respect to the homology arms, their length is not limited, provided they have alength that is adequate for homologous recombination to occur when nuclease-mediated cleavage of the selected locus occurs. In some embodiments, the homology arms have a length of from 100 bp-1 Kbp, inclusive, and including all integers and ranges of integers there between.

[0181] In some embodiments, a targeting vector may also be inserted into the described locususing non-Cas based nuclease approaches. Non-limiting examples of non-Cas based approaches are zinc-finger nucleases and MADzymes. Non-limiting examples of MADzymes known in the art include MAD2 and MAD7 and are included in the Cas12a category of nucleases.

[0182] In some embodiments, cells modified according to this disclosure comprise aheterozygous or homozygous insertion of the described targeting vectors. In some embodiments, homozygous insertions are obtained by mating heterozygous mammals and selecting homozygous progeny.

[0183] To develop mouse Model III, a targeting vector was constructed so that upon correcttargeting into a mouse embryonic cell genome, almost all of the mouse DH (except Ighd1-1), all of the mouse JH, IgM, IgD, and the CH1 domain of IgG3 were targeted and replaced by a genetically engineered DNA fragment. The targeting vector construct comprises 2.4 kilobases of human IGHV 3-30 promoter, llama VHH2, and down-stream sequence of human IGHV 3-30, 5 kilobases of human IGHV1-3 promoter, alpaca VHH2, down-stream sequence of human IGHV 1- 3, which includes human endogenous regulatory sequences comprising 13 kilobases of humanAttorney Docket No: 243735.000429 IGHV1-2 promoter, llama VHH1, down-stream sequence of human IGHV 1-2, which includes endogenous human regulatory sequences 47 kilobases of human IGHV6-1 promoter, which includes regulatory sequences, camel VHH1 and down-stream sequence of human IGHV 6-1 the entire human DH locus containing all the IGHD elements, the entire human JH locus containing all the IGJH elements, an Neo selection marker, which is deleted in ES cells by the expression of flp enzyme in the course of ES cell expansion stage, but other recombinase recognition sites and recombinases can be used, as described above. The resulting locus generated HCAbs due to the deletion of CH1 and can utilize VHH 1 and 2 domains from mouse, alpaca, camel, and llama fused to human DH and JH domains and mouse CH2 and CH3 domains.

[0184] In both the models Model I and Model III, additional VHH coding sequences wereincorporated in the targeting vectors. The targeting vectors and the chromosomes comprising them in inserted form may encode 1, 2, 3, 4, 5, or more xenobiotic variable domains. The present invention also includes, but is not limited to, production of HCAbs that are a product of recombination between the introduced and endogenous variable domains and HCAbs or antigen- binding portions thereof that are a product of mutations and selection that naturally occurs following introduction of an immunogen into the modified mammals.

[0185] In specific embodiments, modifying an immunoglobulin heavy chain locus of the non-human animal comprises a camelid-humanization of heavy chain locus. A non-limiting camelid- humanization strategy is summarized in Figure 7. Figure 7 shows a general organization of the mouse endogenous heavy chain locus, a targeting vector construct and a targeted modified heavy chain locus. Specifically, 116 kb of mouse sequence including most of the mouse DHs, entire mouse JHs, mouse IgM, mouse IgD, and mouse CH1 was replaced with 157 kb of chimeric sequences corresponding to 4 camelid VHH invariable domains and their human promoters, the entire human DHs, and entire human JHs (Fig. 7). The human sequence stops just after the last human JH and therefore the human IgM, IgD, IgG3 switch region and human CH1 domain were not included in this animal model. The replacement event also removed the mouse CH1 domain, that led to no CH1 domain from either the human or mouse immunoglobulin heavy chain in this animal. Therefore, after the replacement event, VHHs from camel, alpaca, and llama and the entire human DHs and JHs are operably linked to a mouse immunoglobulin constant region (e.g., IgG3). Junctional nucleic acid sequences inside targeting vector among camelid, mouse, human, and prokaryotic / eukaryotic selection cassette are summarized in Table 2.Attorney Docket No: 243735.000429

[0186] Specifically, the first step of generation of a genetically modified mouse with camelid-humanization was to construct a camelid-humanization heavy chain targeting vector. In specific embodiments, the targeting vector has 16 segments - DNA segment 1: A 5’ mouse homology arm; DNA segment 2: A prokaryotic selection cassette with a loxP recombinant site, which can serve as a further deletion or additional DNA insertion landing pad; DNA segment 3: A half hygromycine selection cassette and a Rox recombinant site to facilitate additional DNA landing; DNA segment 4: A human IGHV 3-30 promoter DNA sequence; DNA segment 5: A VHH from llama 2 (DNA SEQ ID NO: 4); DNA segment 6: A human IGHV 1-3 promoter DNA sequence; DNA segment 7: A VHH from alpaca 2 (DNA SEQ ID NO: 2); DNA segment 8: A human IGHV 1-2 promoter DNA sequence; DNA segment 9: A VHH from llama 1 (DNA SEQ ID NO: 3); DNA segment 10: A human IGHV 6-1 promoter DNA sequence; DNA segment 11: A VHH from camel 1 (DNA SEQ ID NO: 1); DNA segment 12: A human DNA sequence connecting the 3’ end of human IGHV 6-1 to the first human heavy chain D (D1-1); DNA segment 13: A human DNA sequence comprising complete human heavy chain DHs; DNA segment 14: A human DNA sequence comprising complete human heavy chain Js; DNA segment 15: A prokaryotic / eukaryotic G418 / Neo selection cassette; DNA segment 16: A 3’ mouse homology arm including mouse constant region C4 (from exon 1 to exon 4). The exons are represented by vertical bars. The bottom panel depicts the targeted event. In the bottom part of Figure 7, “targeted” means the targeting vector with VHHs and human sequence replaced mouse heavy chain DHs, JHs, IgM, IgD, and CH1 at the mouse endogenous locus on chromosome 12.

[0187] One human BAC clone and two mouse fosmid clones were used for construction of thecamelid-humanization heavy chain targeting vector (Human BAC: CH17-236114 and mouse WI1- 921O3 and WIl - 1006115). The 16 DNA segments (DNA segment NO: 1-16) was on a BAC based vector and were put together through DNA ligation and bacteria homology recombination using homology arm with average length of 130 bp (various from 50-200 bp). The bacteria homology recombination was helped by using bacterial Spec and Kan selection cassettes. During the targeting vector construction process, a unique enzyme cutting site Ascl was introduced to allow linearization of the targeting vector (that does not cut into DNA segment NOs: 2, 6, 7, 4). The linearized targeting vector was electroporated into a hybrid mouse embryonic stem (ES) cell line derived from a hybrid strain by crossing mice of two different inbred strains (B6 and 129). ES cells with correct targeted clones were identified and confirmed by combination of variousAttorney Docket No: 243735.000429 methods (e.g., PCR based assays, long arm PCR, long range PCR, southern, and / or human replacement PCR) known in the art. Targeted ES clones were expanded and micro-injected into mouse blastocysts to generate chimeric mice with a human targeted gene segment (DNA SEQ NO: 6). Germline mice were obtained by further mating the chimera with B6 inbred mice and additional PCR confirmation was performed. The Neo cassette was removed by the activity of Flp recombinase ES cells or mouse tissues. Human Emu was also included inside the targeting vector. It is located between DNA segment 14 and 15 as indicated in Figure 7 on the right side of bottom line (targeted allele).

[0188] In some embodiments, a targeting vector comprises a selectable marker. In someembodiments, the selectable markers are selected from Blasticidin S deaminase (bsd), Neomycin (G418) resistance gene (neo), Hygromycin resistance gene (hygB), the HPRT1 gene, the HSV1- TK gene, puromycin N-acetyltransferase (pac), Zeocin resistance gene (Sh bla) and combinations thereof.

[0189] In some embodiments, the methods of producing genetically modified non-human animaldoes not include knock-out of Ig loci. In specific embodiments, the genetic changes described herein are made directly in the endogenous murine IgH locus. The method of producing the genetically modified mouse enables replacement of the murine IgH with no further genetic alternations, except otherwise specifically disclosed herein. Such genetic changes made in the endogenous location within the IgH locus also enables affinity maturation of the naive repertoire via somatic hypermutation within the context of germinal center response.

[0190] In some embodiments, the methods of producing the genetically modified non-humananimal do not include a knock-in at the mouse IgH locus with a selection of VHH gene segments replacing endogenous murine VH gene segments. Such knock-in at the IgH locus with VHH gene segments is described in Xu, J., et al. Nanobodies from camelid mice and llamas neutralize SARS- CoV-2 variants, Nature 595, 278-282. The animal model described in Xu et al. lacks humanized DH and JH elements. Further, the model described in Xu et al. has IgM which dramatically alters the Ig expression and selection of the B cells. The genetically modified animal model described herein ablates IgM and IgD, leaving expression of IgG3(-CH1). Further, humanization of the DH and JH dramatically enhances translational applicability of heavy chain-only antibodies generated by the modified animal model of the present disclosure. Further, it is believed the majority of the B cells that were produced by the Xu et al. model were of the IgM isotype, and IgG+B cells alsoAttorney Docket No: 243735.000429 utilized IgG1 but not the IgG3 constant region unlike the animal model illustrated herein. It is also considered that Xu et al. demonstrates a knock-in mouse capable of producing single-chain Abs (IgM -CH1; IgG1 -CH1), but by removing endogenous murine VH gene segments. In view of these findings, it is considered that Xu et al. model is incapable of producing endogenous VDJs compatible with B cell selection and antibody secretion, in contrast to the present invention. In some embodiments, the genetically modified non-human animal model described herein produces a wide repertoire of single-chain antibody producing B cell receptors (BCRs) that use endogenous VH and / or VHH gene segments with an IgG3 (-CH1) isotype.

[0191] In some embodiments, the methods of producing genetically modified non-humananimals do not include a replacement of an entire mouse VH locus that can prevent use of endogenous VH and / or VHH elements in the production of heavy chain-only Abs or antigen- binding portions thereof.

[0192] In some embodiments, the endogenous light chain of the non-human animal is notmodified. In some embodiments, the endogenous Ig Kappa or Ig Lambda light chains are not modified.

[0193] In one of the aspects, a genetically modified non-human cell is provided, wherein thegenetic modification comprises non-functional Ig CH1, IgM, and IgD domains or deletion of Ig CH1, IgM, and IgD domains. In one of the aspects, a genetically modified non-human cell is provided, wherein the genetic modification comprises non-functional IgG CH1, IgM, and IgD domains or deletion of IgG CH1, IgM, and IgD domains.

[0194] In some embodiments, the cell is selected from a non-human ES cell, a pluripotent cell,and a totipotent cell. In some embodiments, the non-human ES cell is selected from a mouse ES cell and a rat ES cell.

[0195] In one of the aspects, a genetically modified non-human embryo is provided, wherein thegenetic modification comprises a modification as described herein. In some embodiments, the genetic modification comprises non-functional Ig CH1, IgM, and IgD domains or deletion of Ig CH1, IgM, and IgD domains. In some embodiments, the genetic modification comprises non- functional IgG CH1, IgM, and IgD domains or deletion of IgG CH1, IgM, and IgD domains.

[0196] In some embodiments, the non-human embryo is a mouse embryo or a rat embryo. Insome embodiments, a non-human embryo comprising a donor cell is provided, wherein the donor cell is genetically modified, and wherein the genetic modification is a modification as describedAttorney Docket No: 243735.000429 herein. In some embodiments, the genetic modification comprises non-functional Ig CH1, IgM, and IgD domains or deletion of Ig CH1, IgM, and IgD domains. In some embodiments, the genetic modification comprises non-functional IgG CH1, IgM, and IgD domains or deletion of IgG CH1, IgM, and IgD domains.

[0197] In some embodiments, the non-human embryo is a mouse embryo or a rat embryo, andthe donor cell is a mouse ES cell or a rat ES cell, respectively.

[0198] In some embodiments, the genetically modified non-human animal is crossed with ananimal with a humanized MHC allele. Mice generated can be maintained as either heterozygous for either or both alleles, or homozygous for either or both the alleles.Biologics Produced by the Genetically Modified Non-human Animals

[0199] The present disclosure provides biologic molecules produced by a genetically modifiednon-human animal by introducing an immunogen to the modified animal and determining structure preferably sequence of biologic molecules, optionally comprising further conjugation with a heterologous moiety. Non-limiting examples of a heterologous moiety include a cytotoxic agent, siRNA, an antisense oligonucleotide, a radionucleotide, a lysosome-targeting chimera (LYTAC), an immune checkpoint inhibitor, a cytokine, a tumor-associated antigen (TAA)-targeting agent, a peptide, and an immune agonist.

[0200] In some embodiments, the biologic molecules produced using the genetically modifiednon-human animal include, but are not limited to, an antibody or antigen-binding portion thereof, an antibody drug conjugate, a gene therapy, a cell, a fusion protein, an immunocytokine, an anti- sense oligonucleotide, an RNAi molecule (e.g., an siRNA), or any combinations thereof.

[0201] In some embodiments, the biologic molecules produced by the genetically modified non-human animal lack a light chain. In some embodiments, the biologic molecules produced by the genetically modified non-human animal comprise only a heavy chain.

[0202] In some embodiments, the biologic molecule produced by the genetically modified non-human animal is an antibody or antigen-binding portion thereof. In some embodiments, the antibody or antigen-binding portion thereof produced by the genetically modified non-human animal is a monovalent, a bivalent, or a multivalent antibody or antigen-binding portion thereof. In some embodiments, the multivalent antibody or antigen-binding portion thereof is trivalent, or tetravalent. In some embodiments, the antibody or antigen-binding portion thereof produced byAttorney Docket No: 243735.000429 the genetically modified non-human animal is monospecific, bispecific, or multi-specific. In some embodiments, the multi-specific antibody or antigen-binding portion thereof is tri-specific, or tetra-specific. In some embodiments, the antibody or antigen-binding portion thereof produced by the genetically modified non-human animal is in a monomeric, a polymeric, or a chimeric form. In some embodiments, the antibody or antigen-binding portion thereof produced by the genetically modified non-human animal is a murine, a chimeric, a human, a humanized, a camelid, an immunoglobulin novel antigen receptor (IgNAR) antibody or antigen-binding portion thereof.

[0203] In some embodiments, the antibody or antigen-binding portion thereof produced by thegenetically modified non-human animal lacks a light chain. In some embodiments, the antibody or antigen-binding portion thereof produced by the genetically modified non-human animal comprises only a heavy chain.

[0204] In some embodiments, the antibody or antigen-binding portion thereof produced by thegenetically modified non-human animal is a heavy chain variable domain or antigen-binding portion thereof, a variable domain of heavy chain of heavy-chain-only antibody (VHH) or antigen- binding portion thereof, a nanobody such as a heavy-chain only nanobody or antigen-binding portion thereof.

[0205] In some embodiments, the antibody or antigen-binding portion thereof produced by thegenetically modified non-human animal is a bispecific antibody or antigen-binding portion thereof or a bi-epitopic antibody or antigen-binding portion thereof. In some embodiments, the bispecific antibody or antigen-binding portion thereof is a Bi-specific engager. In some embodiments, the bispecific antibody or antigen-binding portion thereof is a Bi-specific T cell engager (BiTE) or a Bi-specific killing cell engager (BiKE). In some embodiments, the bispecific antibody or antigen- binding portion thereof is a Bi-specific T cell engager (BiTE). In some embodiments, the bispecific or bi-epitopic antibody or antigen-binding portion thereof comprising two antigen-binding moieties, wherein the one antigen-binding moiety is capable of binding to a cancer-associated antigen and the other antigen-binding moiety is capable of binding to an antigen present on immune cells. The immune cells may include, but are not limited to, T cells, NK cells, NKT cells, MAIT cells, B cells, dendritic cells (DCs), and / or macrophages.

[0206] In some embodiments, the antibody or antigen-binding portion thereof produced by thegenetically modified non-human animal is used to develop an antibody-drug conjugate. In some embodiments, the antibody-drug conjugate of the present disclosure comprises an antibody orAttorney Docket No: 243735.000429 antigen-binding portion thereof comprising only heavy chain produced by the genetically modified non-human animal of the present disclosure. In some embodiments, the antibody-drug conjugate of the present disclosure comprises an antibody or antigen-binding portion thereof lacking light chain produced by the genetically modified non-human animal of the present disclosure. In some embodiments, the antibody-drug conjugate of the present disclosure comprises a toxin, a cytotoxic agent, or an anti-cancer small molecule as a drug portion of the antibody-drug conjugate.

[0207] In some embodiments, the biologic molecule produced using the genetically modifiednon-human animal is a gene therapy. In some embodiments, the gene therapy is epigenetic. Non- limiting examples of gene editing tools that can be used are CRISPR and zinc finger nucleases. In some embodiments, the gene therapy comprises the antibody or antigen-binding portion thereof produced by the genetically modified non-human animal of the present disclosure. In some embodiments, the gene therapy is a gene regulation system such as a CRISPR interference (CRISPRi) or CRISPRoff molecule. In some embodiments, the biologic molecule produced using the genetically modified non-human animal is a chimeric antigen receptor (CAR) molecule. The CRISPR / Cas9 system can be used to cause a down regulation of an antigen such as cancer- associated antigen.

[0208] In some embodiments, gene therapies comprise recombinant vectors comprising apolynucleotide encoding a peptide or an antibody or antigen-binding portion thereof that can function against target antigen. The terms “vector”, “cloning vector”, and “expression vector” mean the vehicle by which a DNA or RNA sequence (e.g., a foreign gene) can be introduced into a host cell, so as to genetically modify the host and promote expression (e.g., transcription and translation) of the introduced sequence. Vectors include plasmids, synthesized RNA and DNA molecules, phages, viruses, etc. Vector can be a viral vector or non-viral vector. Non-limiting examples of viral vectors are a retroviral vector, a lentiviral vector, an adenoviral vector, an adeno- associated virus vector, an alphaviral vector, a herpes virus vector, or a vaccinia virus vector. Non- limiting examples of non-viral vectors are a plasmid or a transposon (such as, for example, a Sleeping Beauty or a PiggyBac transposon).

[0209] The terms “express” and “expression” mean allowing or causing the information in agene or DNA sequence to become produced, for example producing a protein by activating the cellular functions involved in transcription and translation of a corresponding gene or DNA sequence. A DNA sequence is expressed in or by a cell to form an “expression product” such as aAttorney Docket No: 243735.000429 protein. The expression product itself, e.g., the resulting protein, may also be said to be “expressed” by the cell. An expression product can be characterized as intracellular, extracellular or transmembrane.

[0210] In some embodiments, the biologic molecule produced by the genetically modified non-human animal is an isolated host cell comprising a polynucleotide encoding an antibody or antigen-binding portion thereof, or a CAR molecule that targets an antigen. In some embodiments, the host cell is activated and / or expanded ex vivo. In some embodiments, the polynucleotide can be an oligonucleotide or an siRNA.

[0211] In some embodiments, the biologic molecule produced using the genetically modifiednon-human animal is an immunocytokine. In some embodiments, the immunocytokine comprises an antibody or antigen-binding portion thereof comprising only heavy chain produced by the genetically modified non-human animal of the present disclosure.

[0212] In some embodiments, the biologic molecule produced using the genetically modifiednon-human animal is subjected to a screening method of the present disclosure. The screening method as described herein for HCAbs or antigen-binding portions thereof can be used to screen any biologic molecule produced using the genetically modified non-human animal including, but are not limited to, an antibody or antigen-binding portion thereof, an antibody-drug conjugate, an anti-sense oligonucleotide, an RNAi molecule (e.g., an siRNA), a gene therapy, a cell, a fusion protein, an immunocytokine, or any combinations thereof.

[0213] In some embodiments, the biologic molecule can bind or interact with an antigen. Insome embodiments, the antigen is selected from a membrane protein, an intracellular protein, a non-canonical protein, a glyco moiety, and a peptide-major histocompatibility complex (pMHC) protein, including for example and not limitation, splice variants of the various proteins. In some embodiments, the antigen is a membrane protein. In some embodiments, the membrane protein is a transmembrane protein. In some embodiments, the antigen is a disease-associated antigen. In some embodiments, the disease-associated antigen is a cancer antigen. In some embodiments, the disease-associated antigen is a melanoma-associated antigen. In some embodiments, the disease- associated antigen is MAGEA3.

[0214] In some embodiments, the method of generating a biologic molecule using thegenetically modified non-human animal comprises the steps of: (i) generating high affinity HcAb(s) or sdAb(s) against a target antigen;Attorney Docket No: 243735.000429 (ii) Screening of HcAbs or sdAbs with high specificity against the target antigen; and (iii) optionally, evaluating a therapeutic efficacy of the HcAb(s) or sdAb(s).

[0215] In some embodiments, step (i) of the method of generating a biologic molecule using thegenetically modified non-human animal comprises crossing over of the HCAb mouse model of the present disclosure with the human MHC allele expressing mice. In some embodiments, step (i) of the method of generating a biologic molecule using the genetically modified non-human animal further comprises an in vivo affinity maturation. In some embodiments, step (ii) of the method of generating a biologic molecule using the genetically modified non-human animal is performed in a high-throughput manner. In some embodiments, step (ii) of the method of generating a biologic molecule using the genetically modified non-human animal is performed using flow cytometry and / or optofluidic platform to identify sdAb(s) with superior binding properties and / or specificity. In some embodiments, step (iii) of the method of generating a biologic molecule using the genetically modified non-human animal comprises an in vitro and in vivo evaluation of the therapeutic efficacy of the HcAb(s) or sdAb(s). In some embodiments, when the biologic molecule is a bispecific antibody or antigen-binding fragment thereof, the method of generating a biologic molecule using the genetically modified non-human animal further comprises reformatting the identified HcAb(s) or sdAb(s) into a Bi-specific engager. In some embodiments, when the biologic molecule is a bispecific antibody or antigen-binding fragment thereof, the method of generating a biologic molecule using the genetically modified non-human animal further comprises reformatting the identified HcAb(s) or sdAb(s) into BiTE(s) or BiKE(s). In some embodiments, when the biologic molecule is a bispecific antibody or antigen-binding fragment thereof, the method of generating a biologic molecule using the genetically modified non-human animal further comprises reformatting the identified HcAb(s) or sdAb(s) into BiTE(s).In some embodiments of the method of generating a biologic molecule using the genetically modified non-human animal, the antigen is selected from a membrane protein, an intracellular protein, a non-canonical protein, a glyco moiety, and a peptide-major histocompatibility complex (pMHC) protein, including for example and not limitation, splice variants of the various proteins. In some embodiments, the antigen is a membrane protein. In some embodiments, the membrane protein is a transmembrane protein. In some embodiments, the antigen is a disease-associated antigen. In some embodiments, the disease-associated antigen is aAttorney Docket No: 243735.000429 cancer antigen. In some embodiments, the disease-associated antigen is a melanoma-associated antigen. Heavy chain-only Antibodies (HCAbs) or Single-domain Antibodies (sdAbs) Produced by the Genetically Modified Non-human Animals

[0216] The present disclosure provides heavy chain-only antibodies or antigen-binding portionsthereof produced by a genetically modified non-human animal by introducing an immunogen to the modified animal and determining sequences of produced HCAbs or antigen-binding portions thereof.

[0217] In some embodiments, a method of making heavy chain-only antibodies or antigen-binding portions thereof comprises (i) immunizing genetically modified non-human animals of the present disclosure with an antigen; (ii) isolating heavy chain-only antibodies or antigen-binding portions thereof; or cells that produce heavy chain-only antibodies or antigen-binding portions thereof; or nucleotide sequences encoding heavy chain-only antibodies or antigen-binding portions thereof from genetically modified non-human animals; and optionally (iii) generating an antibody or antigen-binding portion thereof library from these isolated cells obtained from the step (ii). In some embodiments, an antibody or antigen-binding portion thereof library is a heavy chain-only antibody or antigen-binding portions thereof library. In some embodiments, an antibody or antigen-binding portion thereof library is a single-domain antibody library. In some embodiments, a library is a CAR T library. An exemplary CAR T library is illustrated herein the Examples and section below.

[0218] In some embodiments, heavy chain-only antibodies or antigen-binding portions thereofare sequenced to determine the entire heavy chain variable domain, or one or more complementarity-determining regions (CDRs).

[0219] In some embodiments, the heavy chain variable domain comprises a murine heavy chainvariable domain. In some embodiments, the heavy chain-only antibodies or antigen-binding portions thereof comprise a camelid VHH. In some embodiments, the heavy chain variable domain comprises a human heavy chain variable domain. In some embodiments, the heavy chain variable domain comprises a humanized heavy chain variable domain. The heavy chain variable domain (or an antigen-binding portion thereof), an essential portion to interact with the antigen can also be referred as a single-domain antibody. The single-domain antibodies (sdAbs) can be isolatedAttorney Docket No: 243735.000429 variable domains derived from such HCAbs. In some embodiments, the antigen-binding portion thereof is a single-domain antibody.

[0220] In some embodiments, the heavy chain-only antibody or antigen-binding portion thereofcomprises a monomer comprising a single heavy chain lacking a CH1 domain (or lacking a CH1 domain and a hinge region).

[0221] In some embodiments, the heavy chain-only antibody or antigen-binding portion thereofcomprises a dimer of a first heavy chain comprising a first heavy chain variable domain and a second heavy chain comprising a second heavy chain variable domain, wherein each of the first and the second heavy chains lacks a CH1 domain (or lacks a CH1 domain and a hinge region).

[0222] In some embodiments, the human variable domain of the first heavy chain of the dimerbinds a first epitope, and the human variable domain of the second heavy chain of the dimer binds a second epitope, wherein the first and the second epitope are not identical.

[0223] In some embodiments, the heavy chain-only antibody or antigen-binding portion thereofcomprises a dimer of a first heavy chain comprising a first heavy chain variable domain and a second heavy chain comprising a second heavy chain variable domain, wherein the first and the second heavy chains are not identical.

[0224] In some embodiments, the heavy chain-only antibody or antigen-binding portion thereofis a monospecific, a bispecific, or a multispecific antibody or antigen-binding portion thereof. In some embodiments, the heavy chain-only antibody or antigen-binding portion thereof is a bispecific antibody or antigen-binding portion thereof or a bi-epitopic antibody or antigen-binding portion thereof. In some embodiments, the bispecific heavy chain-only antibody or antigen- binding portion thereof is a Bi-specific T-cell engager (BiTE) or a bispecific killer cell engager (BiKE). In some embodiments, the bispecific heavy chain-only antibody is a Bi-specific T-cell engager (BiTE). The term “bispecific” refers to a molecule that comprises at least a first binding domain that is capable of binding to one antigen or target, and a second binding domain that is capable of binding to another antigen or target. In some embodiments, the bispecific molecule comprises at least a first binding domain that is capable of binding to a disease-associated antigen and a second binding domain that is capable of binding to an antigen present on immune cells. Non-limiting example of the disease-associated antigen includes a tumor-associated antigen.

[0225] In some embodiments, heavy chain-only antibodies or antigen-binding portions thereofproduced by the modified animals of the present invention have high affinity and high specificityAttorney Docket No: 243735.000429 towards a target antigen as compared to the antibodies produced by conventional methods. “High specificity” as used herein refers to a property of the isolated heavy chain-only antibodies or antigen-binding portion thereof that make antibodies capable to bind specifically to their target antigens. Such antibodies have minimal or no binding to other antigens having different antigenic specificities than the target antigen. In other words, the antibodies with high specificity have minimal or no cross-reactivity and thus such antibodies when used as therapeutics, generate fewer side effects and less immunogenicity. However, heavy chain-only antibodies or antigen-binding portions thereof with the high specificity of the present disclosure can bind to target antigens from other species.

[0226] In some embodiments, the heavy chain-only antibodies or antigen-binding portionsthereof of the present disclosure recognize an antigen present in the form of a peptide-MHC tetramer complex. In some embodiments, the heavy chain-only antibodies or antigen-binding portions thereof of the present disclosure recognize an antigen in the context of MHC / HLA presentation.

[0227] In some embodiments, the target antigens are selected from membrane proteins,intracellular proteins, non-canonical proteins, glyco moieties, and peptide-major histocompatibility complex (pMHC) proteins, including for example and not limitation, splice variants of the various proteins. In some embodiments, the target antigens are intracellular or transmembrane proteins. In some embodiments, the transmembrane proteins are splice variants of the transmembrane proteins, including but not limited to splice variants of the transmembrane proteins associated with cancers. In some embodiments, the antigen is a MAGE Family Member (MAGEA3) peptide. In some embodiments, the splice variant of the MAGEA3 peptide is carcinoembryonic antigen-related cell adhesion molecule 3 (CEACAM3). In some embodiments, the target antigens are cancer associated antigens.

[0228] Such heavy chain-only antibodies or antigen-binding portions thereof generated by therecombinant production can be used as therapeutics, prophylactics, and / or for diagnostic purposes. In some embodiments, the antigen-binding portion is a heavy chain variable domain or VHH. In some embodiments, the antigen-binding portion is a single-domain antibody. In some embodiments, the antigen-binding portion is a murine heavy chain variable domain. In some embodiments, variable domains, including the entire variable domain, or one or more CDRs (CDR1, CDR2, or CDR3), produced according to the described methods can be recombinantlyAttorney Docket No: 243735.000429 incorporated into other types of binding agents. Non-limiting examples of such other types of binding agents include antigen-binding (Fab) fragments, Fab‘ fragments, (Fab’)2 fragments, Fd (N-terminal part of the heavy chain) fragments, Fv fragments (two variable domains), dAb fragments, isolated CDR domains, single-chain variable fragment (scFv), and other antibody fragments that retain antigen binding function. In some embodiments, one or more of the variable domains of the identified heavy chain-only antibodies or antigen-binding portion thereof are used as a component to construct a Bi-specific T-cell engager (BiTE), bispecific killer cell engager (BiKE), or a chimeric antigen receptor (CAR), such as for producing chimeric antigen receptor T cells (e.g., CAR T cells).

[0229] In some embodiments, heavy chain-only antibodies or antigen-binding portions thereofproduced by the modified animal of the present invention can be used to generate antibody- dependent cell mediated cytotoxicity (ADCC). In some embodiments, heavy chain-only antibodies or antigen-binding portions thereof produced by the modified animal of the present invention may result in T cell activation and / or cytokine production.

[0230] In some embodiments, heavy chain-only antibodies or antigen-binding portions thereofproduced by the modified animal of the present invention can be used to prepare a conjugates comprising a drug or a toxin conjugated to heavy chain-only antibodies or antigen-binding portion thereof such as immunotoxins or antibody-drug conjugates.

[0231] In some embodiments, heavy chain-only antibodies or antigen-binding portions thereofproduced by the modified animal of the present invention can be used to prepare a conjugates comprising a detectable label conjugated to heavy chain-only antibodies or antigen-binding portion thereof for diagnostic purposes.

[0232] Because the heavy chain-only antibodies or antigen-binding portions thereof lack a lightchain, they are smaller and thus expected to exhibit better tissue penetration than antibodies that contain light chains, yet have a similar or more favorable pharmacokinetic profile and retain similar effector function as compared to conventional antibodies. Heavy chain-only antibodies are also capable of administration at a higher dose in a given volume due to their smaller size. A frequent method of administering antibodies is by subcutaneous injection, and a reduction in administration volume for a given dosage of antibody can provide benefits to patients and avoid complications and pain due to subcutaneous injections of large volumes Further, favorablecharacteristics are shown in Figure 1D.Attorney Docket No: 243735.000429

[0233] Heavy chain-only antibodies or antigen-binding portions thereof can be used to makebispecific antibodies by heterodimerizing immunoglobulin chains with specificity for two different epitopes in a single therapeutic. Heavy chain-only antibodies or antigen-binding portions thereof are particularly suited for making bispecific antibodies due to the lack of light chain as there is no light chain rearrangement required which could create a light chain that may interfere with the binding affinity or specificity of the other chain.

[0234] In some embodiments, the genetically modified non-human animal of the presentdisclosure is used to generate heavy chain-only antibodies or antigen-binding portions thereof. In some embodiments, the genetically modified non-human animal of the present disclosure is used to generate bispecific heavy chain-only antibodies or antigen-binding portions thereof. In some embodiments, the bispecific heavy chain-only antibodies or antigen-binding portions thereof are Bi-specific T-cell Engagers. In some embodiments, the genetically modified non-human animal of the present disclosure is used to generate Bi-specific T-cell Engagers (BiTEs). In some embodiments, the genetically modified non-human animal of the present disclosure is used to generate Bi-specific T-cell Engagers (BiTEs) against cancer-associated antigens. In some embodiments, the genetically modified non-human animal of the present disclosure is used to generate Bi-specific T-cell Engagers (BiTEs) against melanoma-associated antigens. In some embodiments, the genetically modified non-human animal of the present disclosure is used to generate Bi-specific T-cell Engagers (BiTEs) against a membrane protein, a non-canonical protein, a glyco moiety, an intracellular protein, a transmembrane protein, or a peptide-major histocompatibility complex (pMHC) protein, including for example and not limitation, splice variants of the various proteins. In some embodiments, the generation of BiTEs includes engineering of the BiTEs using the HCAb against a cancer-associated antigen produced using the genetically modified non-human animal of the present disclosure to pair to another antibody or antigen binding portion thereof, such as for example and not limitation, an anti-CD3 nanobody.

[0235] In some embodiments, the method of producing BiTEs bypasses the need to matchantigen-specific heavy and light chains. In some embodiments, the anti-tumor Bi-specific T-cell Engagers (BiTEs) are generated using the genetically modified non-human animal and high- throughput screening method of the present disclosure. In some embodiments, the antigen that is targeted by BiTEs is selected from a membrane protein, an intracellular protein, a transmembrane protein, a non-canonical protein, a glyco moiety, and a peptide-major histocompatibility complexAttorney Docket No: 243735.000429 (pMHC) protein, including for example and not limitation, splice variants of the various proteins. In some embodiments, the anti-tumor Bi-specific T-cell Engagers (BiTEs) can bind to transmembrane and / or intracellular proteins. In some embodiments, the BiTEs produced by the method of the present invention distinctly recognize a peptide present on a peptide-MHC tetramer complex as a foreign material. In some embodiments, the BiTEs produced by the method of the present invention have high-affinity and high specificity. In some embodiments, the BiTEs produced by the method of the present invention leads to T cell activation and cytokine production.

[0236] The BiTEs produced by the animals and methods of the present disclosure can be furtherevaluated in melanoma cell lines such as patient-derived xenograft (PDX) lines. The efficacy of the BiTEs can be determined by evaluating tumor growth and animal survival following administration of the BiTEs to the animal. Administration in vivo can be by any suitable route including, but not limited to, oral, parenteral, intrathecal, intra-arterial, intraperitoneal, intravenous, subcutaneous, topical, intracranial, intratumoral, intranasal, or intramuscular. In some embodiments, the BiTEs are administered via intravenous, intramuscular, subcutaneous, or intraperitoneal route.

[0237] Heavy chain-only antibodies or antigen-binding portions thereof are disclosed in, forexample, PCT publications WO02085944, WO02085945, WO2006008548, and WO2007096779. See also U.S. Pat. No.5,840,526; U.S. Pat. No.5,874,541; U.S. Pat. No.6,005,079; U.S. Pat. No. 6,765,087; U.S. Pat. No.5,800,988; EP 1589107; WO 9734103; and U.S. Pat. No.6,015,695, each of which is incorporated herein by reference in its entirety.

[0238] Binding affinity (or binding specificity) of the antibodies or antigen-binding portionsthereof of the present disclosure can be determined by a variety of methods including equilibrium dialysis, equilibrium binding, gel filtration, ELISA, ELISpot, kinetic exclusion assays, biolayer interferometry (BLI), specific protein interaction (SPI), surface plasmon resonance (SPR), bead- based assay, radioimmunoassay, or spectroscopy (e.g., using a fluorescence assay). In certain embodiments, an antigen, or derivative thereof, is coated onto a bead or onto the surface of an ELISA plate or other solid phase used for measurement. Examples of bead-based binding assays which may be used for measuring KD of the antibodies and / or antigen-binding portions herein are described in, e.g., Nishikori et al., J Mol Biol.2012 Dec 14;424(5):391-9 (PMID 23041298) and Hattori et al., J Immunol Methods. 2021 Mar; 490:112952 (PMID 33358997), each of which is incorporated herein by reference in its entirety and for all purposes as if fully set forth herein.Attorney Docket No: 243735.000429

[0239] Association and dissociation constants were evaluated via Octet bio-layer interferometryusing synthetic SP2 peptide as the target protein.

[0240] These techniques can be used to measure the concentration of bound antibody or antigen-binding portion as a function of target antigen concentration. Under certain conditions, the fractional concentration of bound antibody or antigen-binding fragment ([Bound] / [Total]) is generally related to the concentration of total target antigen ([Target]) by the following equation: [Bound] / [Total] = [Target] / (KD+[Target])

[0241] It is not always necessary to make an exact determination of KD, though, sincesometimes it is sufficient to obtain a quantitative measurement of affinity, e.g., determined using a method such as ELISA or FACS analysis, is proportional to KD, and thus can be used for comparisons, such as determining whether a higher affinity is, e.g., 2-fold higher, to obtain a qualitative measurement of affinity, or to obtain an inference of affinity, e.g., by activity in a functional assay, e.g., an in vitro or in vivo assay. In some cases, the in vitro binding assay is indicative of in vivo activity. In other cases, the in vitro binding assay is not necessarily indicative of in vivo activity.

[0242] The affinity of an antibody or antigen-binding portion thereof of the present disclosuremay be determined using a soluble form or a membrane-tethered form of the antibody or antigen- binding portion thereof, such as a chimeric antigen receptor (CAR) or T-cell receptor (TCR) fusion protein (TFP). On the other hand, the pMHC complex may be tested in a soluble form or in its native, cell-membrane-bound state.

[0243] In some embodiments, a method of producing antigen-specific heavy chain-onlyantibodies (HCAbs) or antigen-binding portions thereof comprises immunizing the genetically modified non-human animal of the present disclosure with an antigen, wherein the antigen is a peptide presented in complex with an MHC molecule. In some embodiments, the MHC molecule corresponds to the humanized or human MHC allele present within the genetically modified non- human animal.

[0244] In some embodiments, the immunization with the peptide-MHC complex is administeredas a prime-boost regimen. In some embodiments, the genetically modified non-human animal is immunized with a 2-3 week interval between each immunization.

[0245] The efficacy of the antibody or antigen-binding portion thereof of the present disclosuretargeting cancer-associated antigen can be determined by evaluating tumor growth and animalAttorney Docket No: 243735.000429 survival following administration of the antibodies to the animal. Administration in vivo can be by any suitable route including, but not limited to, oral, parenteral, intrathecal, intra-arterial, intraperitoneal, intravenous, subcutaneous, topical, intracranial, intratumoral, intranasal, or intramuscular. In some embodiments, the antibodies of the present disclosure are administered via intravenous, intramuscular, subcutaneous, or intraperitoneal route.

[0246] In some embodiments, the peptide is covalently attached to the MHC molecule. In someembodiments, the peptide is non-covalently attached to the MHC molecule. In some embodiments, the peptide-MHC complex forms a tetramer.

[0247] In some embodiments, the method of producing antigen-specific heavy chain-onlyantibodies (HCAbs) or antigen-binding portions thereof further comprising isolating germinal center B cells and / or plasma cells from the animal and analyzing heavy chain-only antibodies (HCAbs) or antigen-binding portions thereof produced from the ΔCH1Ig locus.

[0248] In some embodiments, the method of producing antigen-specific heavy chain-onlyantibodies (HCAbs) or antigen-binding portions thereof further comprising isolating germinal center B cells and / or plasma cells from the animal and analyzing heavy chain-only antibodies (HCAbs) or antigen-binding portions thereof produced from the ΔCH1IgG locus. Chimeric Antigen Receptor or T-Cell Receptor Library

[0249] The present disclosure provides CAR or TCR libraries generated by seamless integrationof affinity-matured binders isolated from the genetically modified non-human animal of the present disclosure directly into CAR or TCR constructs. These CAR or TCR libraries can then be rapidly screened for clones with desired binding and functional properties with no cross-reactivity, allowing the screening of thousands of different clones in one step, rather than having to synthesize individual CAR or TCR constructs. These CAR or TCR libraries are screened via a high- throughput optofluidic instrument. Such combined techniques of CAR or TCR library generation from the genetically modified mice and high-throughput screening aim to deliver safe CAR or TCR constructs against elusive tumor antigens, offering improved safety and therapeutic potential. The present disclosure provides an efficient and robust strategy for producing CAR T cells that are targeted to specific antigens including complex antigens such as cancer antigens. The CAR or TCR library of the present disclosure is produced by immunizing modified non-human animals capable of producing heavy chain-only antibodies or single-domain antibodies, allowing theAttorney Docket No: 243735.000429 capture of antigen-specific antibodies efficiently through single bulk PCR reaction from sorted B cells. This approach translates native, antigen-specific immune responses into tailor-made CAR vectors, creating CAR T or TCR libraries that encapsulate the immune response’s full breadth in a CAR construct. Downstream screening technologies described herein enable rapid identification of CAR or TCR candidates from affinity selected pools of CAR T cells.

[0250] Current methods for identifying suitable CARs are time-consuming and labor-intensive,relying on the expression and screening of individual clones in protein binding assays. These assays are low-throughput (typically performed as 96-well ELISA assays) and are not predictive of the functional or binding properties of the same receptor in the context of a CAR construct. International Pat. Appl. Pub. No. WO 2023122574 (incorporated herein by reference in its entirety) describes the generation of CAR libraries from synthetic phage heavy chain antibody libraries. As the genetically modified mice of the present disclosure have been shown to develop robust antigen- specific responses and undergo somatic hypermutation, CAR libraries generated from these genetically modified mice vaccinated with antigens of interest are expected to generate superior CAR T cell constructs. This strategy is expected to eliminate the need for performing labor- intensive phage panning and may yield improved therapeutic candidates.

[0251] This approach also addresses a significant unmet need in the field by eliminating thenecessity of immunizing camelids or relying on in vitro antibody libraries, which are standard yet time-consuming and resource-intensive methods. Unlike camelids, the small animal platform is readily manageable in house and amenable to utilization of many standard molecular techniques (hybridoma generation etc.). Unlike the in vitro library screening, the mouse platform has natural germinal-center based affinity maturation and may be compatible with a broader range of antigens (for example, membrane associated, intracellular, etc.). This in vivo approach not only expedites the discovery and development of heavy chain-only antibodies (HCAbs) but also potentially yields antibodies with higher specificity and affinity due to the natural immune response’s involvement. Additionally, this method bypasses the need for hybridoma technology or phage display libraries, offering a more direct path from antigen identification to therapeutic development. Finally, this method circumvents the need to generate paired heavy-light chain antibody pairs from single B cells in order to generate CAR libraries that recapitulate the native immune response, eliminating the need for an additional labor-intensive and specialized workflow.Attorney Docket No: 243735.000429

[0252] In one aspect provided herein are engineered expression vectors (e.g., retroviral orlentiviral vectors) that facilitate cloning and screening of HCAbs directly from isolated B cells from the genetically modified non-human animal. In some embodiments, the expression vectors contain elements coding for the non-antigen binding portions of CARs along with cis-acting regulatory elements. In some embodiments, the expression vectors include additional sequences which makes these vectors suitable for replication and integration in prokaryotes, eukaryotes, or preferably both (e.g., as a shuttle vector). In some embodiments, cloning vectors further contain a transcription and translation initiation sequence, transcription and translation terminator, and a polyadenylation signal sequence.

[0253] In some embodiments, the nucleic acid constructs of the present disclosure include asignal sequence for secretion or presentation of the antibody from a host cell in which it is placed. In some embodiments, the signal sequence is a mammalian signal sequence.

[0254] In some embodiments, the present disclosure provides a chimeric antigen receptor (CAR)expression vector with internal cloning sites that enable the cloning of the antibody into the CAR gene. The antibodies or antigen-binding portion thereof are inserted downstream of the leader sequence, upstream of the hinge domain.

[0255] In some embodiments, the present disclosure provides a chimeric antigen receptor (CAR)expression vector encoding, in a 5’ to 3’ orientation, a promoter, a first restriction enzyme site cleaved by a first restriction enzyme, an antigen receptor, a second restriction enzyme site cleaved by said first restriction enzyme, a transmembrane domain and a CAR endodomain, wherein no other restriction enzyme sites for said first restriction enzyme are present in said vector.

[0256] In some embodiments, the present disclosure provides a chimeric antigen receptor (CAR)expression vector encoding, in a 5’ to 3’ orientation, a promoter, a first restriction enzyme site cleaved by a first restriction enzyme, an antigen receptor, a second restriction enzyme site that may or may not be cleaved by said first restriction enzyme, a transmembrane domain and a CAR endodomain, wherein no other restriction enzyme sites for said first restriction enzyme (and said second restriction enzyme site if different) are present in said vector.

[0257] In some embodiments, the vector further comprises a flexible linker coding domainbetween said second restriction enzyme site and said transmembrane domain. The vector of the present disclosure can be part of a composition comprise a population or “library” of vectors. InAttorney Docket No: 243735.000429 some embodiments, an antigen receptor is the antibody or antigen-binding portion. In some embodiments, the antibody is heavy chain-only antibodies.

[0258] In some embodiments, a chimeric antigen receptor (CAR) expression vector comprisesin a 5’ to 3’ orientation, a promoter, a first restriction enzyme site cleaved by a first restriction enzyme, a transmembrane domain and a CAR endodomain, wherein no other restriction enzyme sites for said first restriction enzyme are present in said vector. In some embodiments, the vector further comprises a flexible linker coding region between said first restriction enzyme site and said transmembrane domain, such as CD8 hinge region.

[0259] In some embodiments, the first restriction enzyme is Sfi1. In some embodiments, thepromoter is an EF1α promoter. In some embodiments, the transmembrane domain is derived from CD8α. In some embodiments, the endodomain comprises signaling domains from CD3ζ and / or 4- 1BB (CD137) and / or CD28. In some embodiments, the expression vector further comprises an origin of replication. In some embodiments, the expression vector further comprises a CD8 leader sequence 5’ to said first restriction enzyme site and 3’ to said promoter.

[0260] In some embodiments, eukaryotic promoters typically contain two types of recognitionsequences, the TATA box and upstream promoter elements. The TATA box, located 25-30 base pairs upstream of the transcription initiation site, is thought to be involved in directing RNA polymerase to begin RNA synthesis. The other upstream promoter elements determine the rate at which transcription is initiated. Preferably, the promoter utilized by the expression vector is active in the specific cell population transformed. Examples of cell type-specific and / or tissue- specific promoters include promoters such as albumin that is liver specific (Pinkert et al., Genes Dev. 1:268-277 (1987)), lymphoid specific promoters (Calame et al., Adv. Immunol. 43:235-275 (1988)); in particular promoters of T-cell receptors (Winoto et al., EMBO J. 8:729-733 (1989)) and immunoglobulins; (Banerji et al., Cell 33:729-740 (1983)), neuron-specific promoters such as the neurofilament promoter (Byrne et al., Proc. Natl. Acad. Sci. USA 86:5473-5477 (1989)), pancreas-specific promoters (Edlunch et al., Science 230:912-916 (1985)) or mammary gland- specific promoters such as the milk whey promoter (U.S. Pat. No. 4,873,316 and European Application Publication No. EP0264166). In some embodiments, the promoter is preferably positioned approximately the same distance from the heterologous transcription start site in the construction of the expression vector, as it is from the transcription start site in its natural setting. Some variation in this distance can be accommodated without loss of promoter function.Attorney Docket No: 243735.000429

[0261] Enhancer elements can stimulate transcription up to 1,000-fold from linked homologousor heterologous promoters. Enhancers are active when placed downstream or upstream from the transcription initiation site. Many enhancer elements derived from viruses have a broad host range and are active in a variety of tissues. For example, the SV40 early gene enhancer is suitable for many cell types. Other enhancer / promoter combinations that are suitable for some embodiments of the disclosure include those derived from polyoma virus, human or murine cytomegalovirus (CMV), the long term repeat from various retroviruses such as murine leukemia virus, murine or Rous sarcoma virus and HIV. See, Enhancers and Eukaryotic Expression, Cold Spring Harbor Press, Cold Spring Harbor, N.Y.1983.

[0262] In some embodiments, polyadenylation sequences are added to the expression vector inorder to increase the efficiency of TCRL mRNA translation. Two distinct sequence elements are required for accurate and efficient polyadenylation: GU or U rich sequences located downstream from the polyadenylation site and a highly conserved sequence of six nucleotides, AAUAAA, located 11-30 nucleotides upstream. In some embodiments, termination and polyadenylation signals include those derived from SV40. In some embodiments, the expression vector of the present disclosure further contains other specialized elements intended to increase the level of expression of cloned nucleic acids or to facilitate the identification of cells that carry the recombinant DNA. For example, a number of animal viruses contain DNA sequences that promote the extra chromosomal replication of the viral genome in permissive cell types. Plasmids bearing these viral replicons are replicated episomally as long as the appropriate factors are provided by genes either carried on the plasmid or with the genome of the host cell. The vector may or may not include a eukaryotic replicon. If a eukaryotic replicon is present, then the vector is amplifiable in eukaryotic cells using the appropriate selectable marker. If the vector does not comprise a eukaryotic replicon, no episomal amplification is possible. Instead, the recombinant DNA integrates into the genome of the engineered cell, where the promoter directs expression of the desired nucleic acid.

[0263] Standard techniques are used for recombinant DNA, oligonucleotide synthesis, and cellculture and transformation (e.g., electroporation, lipofection). Enzymatic reactions and purification techniques are performed according to manufacturer’s specifications or as commonly accomplished in the art or as described herein. The foregoing techniques and procedures are generally performed according to conventional methods known in the art and as described inAttorney Docket No: 243735.000429 various general and more specific references that are cited and discussed throughout the present specification. See, e.g., B. Perbal, A Practical Guide to Molecular Cloning, John Wiley and Sons (1984); J. Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbour Laboratory Press (1989); T.A. Brown (editor), Essential Molecular Biology: A Practical Approach, Volumes 1 and 2, IRL Press (1991); D.M. Glover and B.D. Hames (editors), DNA Cloning: A Practical Approach, Volumes 1-4, IRL Press (1995 and 1996); and F.M. Ausubel et al., (editors), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience (1988, including all updates until present); Ed Harlow and David Lane (editors) Antibodies: A Laboratory Manual, Cold Spring Harbour Laboratory (1988); and J.E. Coligan et al., (editors) Current Protocols in Immunology, John Wiley & Sons (including all updates until present).

[0264] The term “binding” or “binds” or “specifically binds” refers to an antibody:antigen modeof binding, which preferably, in the case of clinically relevant binding agents, means a KD below 1 µM or below 500 nM. The antibodies of the present disclosure can bind PHOX2B:pMHC complexes with a high affinity. In some embodiments, the antibody can bind PHOX2B:pMHC with a dissociation constant (KD) equal to or less than bout 10-6M, such as 1 x 10-6, 10-7, 10-8, 10-9,10-10, 10-11, 10-12, 10-13or 10-14. Specificity of binding is determined with reference to non-target proteins, such as for example bovine serum albumin (BSA). In some embodiments the antibody binds PHOX2B:pMHC complexes with a dissociation constant (KD) at least 2, 3, 4, 5, 10, 20, 50, 100, 200, 500, 1000, 2000, 5000, 104, 105, or 106-fold lower than the antibody’s dissociation constant for BSA, when measured at physiological conditions. In some cases, specificity is determined by measuring binding of an antibody to an MHC that is loaded with a non-target peptide or that is empty. In some embodiments, specificity is determined by measuring binding of an antibody to the target peptide alone or the target peptide loaded on an MHC of a different allotype. In some embodiments, the antibody is MHC-restricted which means that the antibody binds specifically to a target peptide (e.g., PHOX2B peptide) loaded onto an MHC representative of a chosen allelic variant (e.g., HLA-A*24:02) with a dissociation constant (KD) at least 2, 3, 4, 5, 10, 20, 50, 100, 200, 500, 1000, 2000, 5000, 104, 105 or 106- fold lower than the antibody’s dissociation constant for an MHC from another allelic variant. In some embodiments, the antibodies of the present disclosure can bind MAGEA3:pMHC complexes with a high affinity. In some embodiments, the antibody can bind MAGEA3:pMHC with a dissociation constant (KD) equal to or less than bout 10-6 M, such as 1 x 10-6, 10-7, 10-8, 10-9,10-10, 10-11, 10-12, 10-13or 10-14.Attorney Docket No: 243735.000429 In some embodiments, the antibody is MHC-restricted which means that the antibody binds specifically to a target peptide (e.g., MAGEA3 peptide) loaded onto an MHC representative of a chosen allelic variant (e.g., HLA-A*01:01) with a dissociation constant (KD) at least 2, 3, 4, 5, 10, 20, 50, 100, 200, 500, 1000, 2000, 5000, 104, 105, or 106- fold lower than the antibody’s dissociation constant for an MHC from another allelic variant.

[0265] Chimeric antigen receptors (CARs) are fusion proteins comprising antigen recognitionmoieties and T cell-activation domains. Exemplary CARs are provided by US Patent No. 8,399,645 and US Patent No.7,638,325. Other exemplary recombinant receptors, including CARs, recombinant T-cell receptors (TCRs), TCR fusion proteins (TFPs), as well as methods for engineering and introducing the receptors into cells, include those described in Int’l Pat. Appl. Nos. WO2017 / 096329, WO2000 / 14257, WO2013 / 126726, WO2012 / 129514, WO2014031687, WO2013 / 166321, WO2013 / 071154, WO2013 / 123061, and WO / 2014055668; U.S. Pat. App. Nos. US2002131960, US2013287748, and US20130149337; U.S. Pat. Nos. 6,451,995, 7,446,190, 7,638,325, 8,252,592, 8,339,645, 8,398,282, 7,446,179, 6,410,319, 7,070,995, 7,265,209, 7,354,762, 7,446,191, 8,324,353, and 8,479,118; European Pat. App. No. EP2537416; and Sadelain et al., Cancer Discov. April 3(4): 388-398 (2013); Davila et al., PLoS ONE 8(4): e61338 (2013); Turtle et al., Curr. Opin. Immunol. October 24(5): 633-39 (2012); and Wu et al., Cancer, March 18(2): 160-75 (2012). In some embodiments, the antibody is a TFP as described in U.S. Pat. No.15 / 419,398.

[0266] In some embodiments, provided herein are cells which comprise thepolynucleotides / expression vectors as described herein. Such cells are typically selected for high expression of recombinant proteins (e.g., bacterial, plant or eukaryotic cells e.g., CHO, HEK-293 cells), but may also be host cells having a specific immune effector activity (e.g., T cells or NK cells) when for instance the CDRs of the TCRL are implanted in a T Cell Receptor or CAR transduced in said cells which are used in adoptive cell therapy.

[0267] In some embodiments, a CAR library is introduced into mammalian host cells that arethen cultured under conditions supporting expression of encoded CARs. The host cells expressing the CAR are then contacted with target antigen positive host cells exhibiting CAR activation are then identified using a variety of different approaches. Once these cells are identified, the antigen- binding region can be sequenced and further developed.Attorney Docket No: 243735.000429

[0268] In some embodiments, the HCAbs or antigen-binding portions thereof are introduced intorecombinant T cell receptor (TCR) vectors to create a TCR library. In some embodiments, a TCR library is introduced into mammalian host cells that are then cultured under conditions supporting expression of encoded TCR s. The host cells expressing the TCR are then contacted with target antigen positive host cells exhibiting TCR activation are then identified using a variety of different approaches. Once these cells are identified, the antigen-binding region can be sequenced and further developed.

[0269] In some embodiments, provided herein are screening technologies. In another aspect,provided herein is a method of screening a HCAb CAR T or TCR library for binding activity comprising: (a) providing a naive heavy chain-only antibody library; (b) subcloning the heavy chain-only antibody regions into an expression vector encoding, in a 5’ to 3’ orientation, a promoter, a first restriction enzyme site cleaved by a first restriction enzyme, a transmembrane domain and a CAR endodomain, wherein no other restriction enzyme sites for said first restriction enzyme are present in said vector; (c) introducing the CAR or TCR library into mammalian host cells; (d) culturing the CAR or TCR library of step (c) under conditions supporting expression of encoded CARs or TCRs; (d) incubating the host cells of step (c) with target antigen and off-target antigen and HLA- matched tissues; and (d) co-culturing the host cells of step (c) with on- and off- target cells (pMHC targets, HLA matched tissue, for membrane proteins, isogenic lines + / - target expression); and (e) sorting positive host cells exhibiting CAR or TCR activation. In some embodiments, the method further comprises prior to step (a), producing said naive heavy chain- only antibody library by isolating B cells from the genetically modified animals. In some embodiments, the method further comprises performing single-cell functional assays on the sorted positive host cells of step (d). Step (d) may comprise incubating the host cells of step (c) with cells presenting the target antigen. Step (e) may comprise sorting host cells that are positive for on- target cell killing and negative for off-target cell killing. Said sorting of host cells can be done using an on-target killing assay that identifies heavy-chain only antibodies or antigen-binding portions thereof with optimal tumor recognition properties. In some embodiments, the method further comprises sequencing the HCAbs or antigen-binding portions thereof from host cells exhibiting activated T cell receptors. In some embodiments, the method of screening a HCAb CAR T or TCR library comprises sequencing positive host cells after step (e). In some embodiments, the method of screening a bispecific antibody or antigen-binding portion thereof CAR T or TCRAttorney Docket No: 243735.000429 library further comprises engineering of the BiTE using the sorted HCAb or antigen-binding portion thereof of step (e) for the target antigen to pair to another antibody or antigen-binding portion, such as for example and not limitation, an anti-CD3 nanobody. In some embodiments, the method of screening a BiTE CAR T or TCR library further comprises engineering of the BiTE using the sorted HCAb or antigen-binding portion thereof of step (e) for the target antigen to pair to another antibody or antigen-binding portion, such as for example and not limitation, an anti- CD3 nanobody. In some embodiments of the method of screening a bispecific antibody or antigen- binding portion thereof CAR T or TCR library, the antigen is intracellular or transmembrane protein. In some embodiments of the method of screening a BiTE CAR T or TCR library, the antigen is intracellular or transmembrane protein. In some embodiments of the method of screening a bispecific antibody or antigen-binding portion thereof CAR T or TCR library, the antigen is a splice variant of the transmembrane protein, including but not limited to, a splice variant of the transmembrane protein associated with cancer. In some embodiments of the method of screening a BiTE CAR T or TCR library, the antigen is a splice variant of the transmembrane protein, including but not limited to, a splice variant of the transmembrane protein associated with cancer. In some embodiments the target antigen of a bispecific antibody or antigen-binding portion thereof is a cancer-associated antigen. In some embodiments the target antigen of BiTEs is a cancer-associated antigen. In some embodiments, the target antigen of a bispecific antibody or antigen-binding portion thereof is a melanoma-associated antigen. In some embodiments, the target antigen of a bispecific antibody or antigen-binding portion thereof is selected from a membrane protein, an intracellular protein, a transmembrane protein, a non-canonical protein, a glyco moiety, and a peptide-major histocompatibility complex (pMHC) protein, including for example and not limitation, splice variants of the various proteins. In some embodiments, the target antigen of BiTEs is a melanoma-associated antigen. In some embodiments, the target antigen of BiTE is selected from a membrane protein, an intracellular protein, a transmembrane protein, a non-canonical protein, a glyco moiety, and a peptide-major histocompatibility complex (pMHC) protein, including for example and not limitation, splice variants of the various proteins.

[0270] In some embodiments, the mammalian host cells are T cells, NK cells, NKT cells, MAITcells, B cells, dendritic cells (DCs), and / or macrophages.

[0271] The initial step is the generation of a first library, often called a naïve library, of antigenbinding sequences. CAR T or TCR libraries can be employed for rapid screening. Such librariesAttorney Docket No: 243735.000429 may be enhanced for strong / selective binders using various methods. As discuss above, the vectors of the present disclosure permit a screening approach combining the vast diversity of CAR T or TCR libraries with the power of in situ screening in the context of CAR or TCR libraries. The first step is the transfer of heavy chain-only antibodies generated by the modified mice of the present disclosure into specially designed CAR or TCR vectors allows for multiple forms of high- throughput screening using primary T cells or Jurkat reporter systems to assess binding, function, and cross-reactivity on tens of thousands of CARs or TCRs simultaneously. Top clones can be rapidly identified, sequenced, and prioritized for further development.

[0272] In some embodiments, the method of screening a HCAb CAR T or TCR library is in ahigh-throughput manner. In some embodiments, the high-throughput screening comprises the use of CAR or TCR vectors to transduce mammalian host cells at a low multiplicity of infection to ensure single-copy integration.

[0273] In some embodiments, the high-throughput screening comprises screening for CAR orTCR binding to the peptide and cross-reactivity to the MHC molecule.

[0274] In some embodiments, the method further comprises the steps of: a) introducing the CARor TCR library into mammalian host cells; b) culturing the CAR- or TCR-expressing host cells of step (a) under conditions supporting expression of encoded CARs or TCRs; c) incubating the CAR- or TCR-expressing host cells of step (a) with target and off-target antigen and MHC or with on- and off-target cells or tissues; d) selecting host cells exhibiting antigen-specific CAR or TCR binding and activation; e) optionally, identifying the sequence of CARs or TCRs within the host cells selected in step (d); and f) optionally, reformatting the identified sequence of CAR or TCR into a bispecific antibody or antigen-binding portion thereof. In some embodiments, the bispecific antibody or antigen-binding portion thereof is a Bi-specific engager. In some embodiments, the bispecific antibody or antigen-binding portion thereof is a Bi-specific T cell engager (BiTE) or a Bi-specific killing cell engager (BiKE).

[0275] In some embodiments, a method of screening a HCAb CAR T or TCR library for bindingactivity is performed in combination with binding assays using a panel of cross-reactive tetramers. The assay can be done at a single cell level, or the CAR or TCR library can be co-cultured with target cells and functional cells can be sorted using activation markers. In some embodiments, the high-throughput screening further comprises identifying heavy-chain only antibodies or antigen- binding portions thereof with high affinity and high specificity. In some embodiments, anAttorney Docket No: 243735.000429 identification of the heavy-chain only antibodies or antigen-binding portions thereof with high affinity and high specificity is performed using flow cytometry and / or optofluidic platform.

[0276] As discussed above, the CAR vectors encode, in a 5’ to 3’ orientation, a promoter, a firstrestriction enzyme site cleaved by a first restriction enzyme, a transmembrane domain and a CAR endodomain, wherein no other restriction enzyme sites for said first restriction enzyme are present in said vector. Cutting with the first restriction enzyme results in a single opening such that an HCAb coding region, when ligated into the opening, produces a contiguous CAR coding region.

[0277] In some embodiments, the CAR vector is a lentiviral vector or a retroviral vector. In someembodiments, the lentiviral or retroviral CAR vectors are used to transduce primary T cells at a low multiplicity of infection to ensure single-copy integration. In some embodiments, the target antigen is a peptide presented on a MHC or membrane protein, such as one that may or may not be mutated, and that may be presented by non-classic MHC (e.g., MR1). In some embodiments, the host cell is an immune effector cell that can express a T cell receptor, a Jurkat cell with or without NFAT or NF-kB-driven reporters, or a primary T cell, and / or express a fluorescent / luminescent marker upon T cell receptor activation, such as green fluorescent protein (GFP) or luciferase upon CAR activation.

[0278] The CAR T or TCR library of the present disclosure may comprise at least 1010 uniquebinding sequences. The CAR T or TCR library may comprise sdAbs, scFv, VHH, Fab, monobodies, affibodies, or nanobodies, and or may be synthetic or naive. The method of the present disclosure is a lossless, high-throughput screening method. Rare immune receptors can also be identified. In some embodiments, the method may comprise extension PCR with non- pComb vectors to introduce restriction sites to the library. The CAR T or TCR library of the present disclosure can be derived from a primary B cell population. In some embodiments, the target antigen is a cancer or an autoimmune target. Lipid nanoparticle-based vaccination and other approaches to immunize genetically modified animals

[0279] In some embodiments, the genetically modified non-human animals are immunized witha composition comprising an antigen, wherein the composition comprises a carrier. Non-limiting examples of carriers include liposomes, micelles, nanodisperse albumin and its modifications, polymer nanoparticles, dendrimers, inorganic nanoparticles of different compositions. In someAttorney Docket No: 243735.000429 embodiments, the present disclosure provides the use of nanoparticles to deliver an antigen or a composition comprising an antigen of the present invention. Non-limiting examples of nanoparticles include inorganic nanoparticles, liposomes, lipid nanoparticles (LNP), polymeric nanoparticles, an immune stimulating complex (ISCOM), a virus-like particle (VLP), and a self- assembling protein. Other non-limiting methods to deliver immunogen to the genetically modified non-human animals include, but not limited to, gene gun, microneedle array, nanoparticles, in situ electroporation, direct delivery and a ballistic delivery. In some embodiments, the antigen is introduced to the genetically modified non-human animals via cell-penetrating-peptide-mediated delivery, exosome-mediated delivery, implantable-device-mediated delivery, lipid-nanoparticle- mediated delivery, vector delivery, and / or particle-mediated delivery.

[0280] In one of the non-limiting aspects provided herein is a LNP based vaccination approachto immunize genetically modified non-human animals of the present disclosure.

[0281] Lipid nanoparticles are spherical and nanoscale delivery systems (typically, 80–200 nmin diameter) composed of several distinct types of lipids.

[0282] In some embodiments, the lipid nanoparticles are composed of one or more componentsselected from an ionizable lipid, a phospholipid, cholesterol, a lipid conjugated to polyethylene glycol (PEG-lipid), and combinations thereof. These components are essential for efficiently protecting and delivering mRNA into cells.

[0283] In some embodiments, the ionizable lipid is selected from (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate (DLin-MC3-DMA, shortened as MC3), biodegradable lipids heptadecan-9-yl8-((2-hydroxyethyl)(6-oxo-6- (undecyloxy)hexyl)amino)octanoate (Lipid H(SM-102)) and / or ((4-hydroxybutyl)azanediyl) bis(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315). The ionizable lipid used to prepare lipid nanoparticles becomes protonated in contact with the acidic environment provided by the aqueous mRNA phase. Electrostatic interactions between the positively charged lipids and negatively charged mRNA molecules, together with lipid self-assembly, enable encapsulation of the nucleic acid.

[0284] In some embodiments, the phospholipid is 1,2-distearoyl-sn-glycero-3-phosphocholine(DSPC) and 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE). Phospholipids are helper lipids that can improve the stability and delivery efficiency of lipid nanoparticles.Attorney Docket No: 243735.000429

[0285] In some embodiments, the lipid nanoparticles comprise cholesterol or 7α-hydroxycholesterol. Cholesterol is an essential component for stable nucleic acid encapsulation.

[0286] In some embodiments, methods of making lipid nanoparticles comprises rapid mixing ofan ethanolic lipid mixture with an aqueous mRNA solution, at low pH, to produce lipid nanoparticles via self-assembly.

[0287] In some embodiments, the antigen is formulated in lipid nanoparticle to make an antigenexpressing virus-like particle (VLP). In some embodiments, membrane-protein-expressing viral like particles (VLPs) encoded by mRNAs packaged in lipid nanoparticles (LNPs) is used to immunize the genetically modified non-human animals of the present disclosure. In some embodiments, the VLP expressing antigens are used to generate heavy chain-only antibodies against extracellular domain of the target antigen.

[0288] In some embodiments, provided herein is a method of producing antigen-specific heavychain-only antibodies (HCAbs) comprising immunizing the genetically modified non-human animal of any one of the present disclosure with an antigen, wherein the antigen is encoded by mRNA encapsulated in a lipid nanoparticle (LNP).

[0289] In some embodiments, the present disclosure provides a method of administering anantigen or a composition comprising an antigen to the genetically modified non-human animals. Non-limiting examples of administering which may be used in the practice of the present disclosure, include via intratumoral, intravenous, intradermal, intraperitoneal, subcutaneous, intramuscular delivery, inhalation, oral delivery, lipid nanoparticle (LNP)-based delivery, cellular delivery, viral and / or non-viral delivery, and gene editing, or any combination thereof.

[0290] In some embodiments, the present disclosure provides a method of generating an immuneresponse against an antigen or a composition comprising an antigen in the genetically modified non-human animals. The method of generating an immune response against an antigen or a composition comprising an antigen in the genetically modified non-human animals may comprise administering to the animal an effective amount of an antigen or a composition comprising an antigen. Non-limiting examples of various forms or compositions that can be used to administer the antigen include a conjugated form, a complex form, a nucleic acid molecule, a vector, a cell and a scaffold(such as antigen presenting scaffolds).Attorney Docket No: 243735.000429 EXAMPLES

[0291] The following examples are provided to further describe some of the embodimentsdisclosed herein. The examples are intended to illustrate, not to limit, the disclosed embodiments. Example 1. Generation of genetically modified mice expressing HCAbs with high affinity and specificity

[0292] By targeting the IgH locus and specifically choosing the IgG3 constant region (mostclosely related to the constant region in camel sdAbs), mice were engineered to skip the CH1 exon necessary for light chain pairing and the switch region was eliminated to prevent class switching. This genetic alteration mirrors the conserved mutation in camelids responsible for HCAb generation. This model efficiently supported B cell hematopoiesis, maintenance of diverse peripheral follicular and marginal zone B cells, normal germinal center induction, and robust plasma cell differentiation (Figs.4-5). Immunization with diverse antigens, including HIV gp120 and SARS-CoV2 S1, resulted in demonstrable clonal expansion and affinity maturation, validating the potential of the engineered mice (Fig. 5). For additional details, see U.S. Patent Application Publication No. US 20230062964 (the contents of which are incorporated herein by reference in their entirety).

[0293] Further, to specifically direct the antibody response against the peptide while avoiding“distraction” of the immune response to the MHC, the above-described engineered mice expressing heavy chain-only antibodies (HCAbs) were crossed with the mice expressing human HLA alleles, specifically a humanized HLA-A*01:01 (C57BL / 6NTac-Tg(HLA-A*0101 / H2- Kb)A1.01) such that only the peptide was perceived by the immune system of the genetically modified mice as foreign (Fig. 1F). The mouse IgH locus is on a 129 background and the mice were backcrossed to C57BL / 6.

[0294] In this example, a mouse was further modified so that the mouse contains a nucleic acidsequence comprising VHHs from camel, alpaca, and llama and entire human DHs and JHs operably linked to a mouse Immunoglobulin C region.Attorney Docket No: 243735.000429 Example 2. Expression, refolding, and purification of recombinant pHLA (pMHC) molecules

[0295] HLA-A*02:01, HLA-A*24:02:01, HLA-A*23:01, HLA-B*14:02, and HLA-C*07:02constructs for bacterial expression were cloned into pET24a+plasmids. DNA plasmids encoding HLA heavy chain and human β2M (light chain) were transformed into E. coli BL21-DE3 (Novagen), expressed as inclusion bodies and refolded using previously described methods (Garboczi, D. N. et al., Proc. Natl Acad. Sci. USA 89, 3429–3433 (1992)). E. coli cells were grown in autoinduction medium for 16-18 hours (Cole, D. K. et al., J. Clin. Invest.,126, 2191–2204 (2016)). Afterwards, the E. coli cells were collected by centrifugation and resuspended with 25 ml BugBuster (Milipore Sigma) per liter of culture. The cell lysate was sonicated and subsequently pelleted by centrifugation (5,180g for 20 minutes at 4°C) to collect inclusion bodies. The inclusion bodies were washed with 25 ml of wash buffer (100 mM Tris pH 8.0, 2 mM EDTA and 0.01% v / v deoxycholate), sonicated and pelleted by centrifugation. A second wash was done using 25 ml Tris-EDTA buffer (100 mM Tris pH 8.0 and 2 mM EDTA). The solution was once again resuspended by sonication then centrifuged. The inclusion bodies were then solubilized by resuspending in 6 ml of resuspension buffer (100 mM Tris pH 8.0, 2 mM EDTA, 0.1 mM DTT and 6 M guanidine-HCl). Solubilized inclusion bodies of the heavy and light chain were mixed in a 1:3 molar ratio and then added dropwise over 2 days to 1 litre of refolding buffer (100 mM Tris pH 8.0, 2 mM EDTA, 0.4 M arginine-HCl, 4.9 mM L-glutathione reduced, and 0.57 mM L-glutathione oxidized) containing 10 mg of synthetic peptide at >98% purity confirmed by MS (Genscript). Refolding was allowed to proceed for 4 days at 4 °C without stirring. Following this incubation period, the refolding mixture was dialysed into size-exclusion buffer (25 mM Tris pH 8.0 and 150 mM NaCl). After dialysis, the sample was concentrated first using a Labscale Tangential Flow Filtration system and then using an Amicon Ultra-15 Centrifugal 10 kDa MWCO Filter Unit (Millipore Sigma) to a final volume of 5 ml. Purification was performed using size-exclusion chromatography on a HiLoad 16 / 600 Superdex 75 column. The purified protein was exhaustively exchanged into 20 mM sodium phosphate pH 7.2 and 50 mM NaCl. The final sample was validated using SDS–PAGE to confirm the formation of a pMHC complex containing both the heavy and light chains.Attorney Docket No: 243735.000429 Example 3. Development of CAR library targeting MAGE-A3

[0296] Mice are immunized with 1-10 µg of peptide or tetramer by intramuscular (i.m),subcutaneous (s.c.), or intraperitoneal (i.p.) injections. Antigen is emulsified in Freund’s incomplete adjuvant (ICA). Mice are boosted at 2 week intervals with antigen emulsified in ICA or in PBS by i.m., i.p., or s.c. injections. Antibody levels are monitored in peripheral blood. Mice are boosted a minimum of one time. Following an optimized immunization / boosting regimen, an enhanced pool of affinity matured binders elicited by a natural germinal center response is harnessed for direct cloning into CAR library systems. These binders are amplified from B cell populations through pooled PCR, restriction digested, and cloned into CAR vectors for screening with high-throughput optofluidic instruments (Fig. 1G). For HCAb-CAR T cell library creation, lentiviral transduction of primary T cells is used at a low multiplicity of infection to ensure single- copy integration.

[0297] Primers are designed to reformat HCAbs from the genetically modified mice forcloning into optimized CAR vectors. Post-immunization, germinal center B cells and plasma cells are isolated for CAR library screening, pinpointing PC-CAR T cells specific to MAGE-A3. MAGE-A3 is a highly specific pan-cancer target, highly expressed across multiple tumors (right) and absent across normal tissues (left) (Fig. 3A). Complementarily, the multimodal single-cell expanded CRISPR-compatible cellular indexing of transcriptomes and epitopes by sequencing (ExCITE-seq) platform (Mimitou et al., Nat Methods 2019) is used to identify and clone rearrangements from clonally expanded B cells at various affinity maturation stages (Fig. 5 for example of analysis of clonal response in these animals). This dual approach enables a comprehensive screen of the antibody repertoire, streamlining the identification of potent CAR T cells.

[0298] Both in vitro assays and computational analyses are used to ensure targeted actionwithout harmful cross-reactivity. To screen for cross-reactivity to MAGE-A3, a pool of potentially cross- reactive pMHCs is generated as predicted by an algorithm (Yarmarkovich et al., Nature 2023) and the CAR T libraries are depleted of any cross-reactive CARs by sorting the MAGE- A3+ / cross-reactive-pMHC- population. New CAR T libraries of the antigen-specific population are regenerated by extracting mRNA, generating a cDNA library, and cloning back into the library vector as described in Fig.2B. Starting with the antigen-specific CAR T cell library, the Lightcast system is used to perform single-cell functional assays, using fluorescently labeled HLA-Attorney Docket No: 243735.000429 A01+ / MAGE-A3+target cells and an HLA-A01+ / MAGE-A3-off target cell line. Clones are identified and isolated that selectively eliminate target cells and remain inert to off-target cells. Example 4. Development of CAR library targeting CEACAM3 using VLP based vaccination system

[0299] In addition to pMHC targets, a vaccination system is developed for rapid generation ofCAR libraries against membrane proteins. Viral-like particles (VLPs) are used to express membrane tumor antigens through mRNAs which are encapsulated by lipid nanoparticles (LNPs). The method is optimized as depicted in Fig.6. This vaccination system is used as an immunization strategy to facilitate the generation of antibody responses against difficult membrane protein targets, including the tumor-specific splicing variant of the CEACAM3 protein (Fig.3B). IA splice variant of CEACAM3 unique to MDS was identified using a tool described in Li et al., Sci Tran Med 2024.

[0300] A pool of antigen-specific CAR libraries is prepared that are ready for furtherpreclinical development and an optimized system for the facile generation of CAR libraries for pMHC and membrane protein tumor targets is also prepared. Example 5. Rapid Development of High-Affinity BiTEs Against Cancer Antigen

[0301] A novel platform is utilized for generating anti-tumor Bi-specific T-cell Engagers(BiTEs) using single-domain antibodies (sdAbs) against an antigen (e.g., but not limited to, tumor- specific antigens and / or splice variants thereof). This approach leverages the small animal models and the high-throughput screening technology described herein. The experiment focuses on discovering sdAbs specific to an antigen (e.g., but not limited to an antigen exclusively found with melanoma), and reformatting them into BiTEs optimized for therapeutic efficacy.

[0302] The BiTE therapeutic landscape remains dominated by hematologic malignancytreatments, with limited success in solid tumors due to challenges in specificity and antigen escape. While there are FDA approved BiTEs available in blood cancers, solid tumor applications face significant hurdles due to on-target / off-tumor effects. The small animal platform of the present disclosure offers distinct advantages through: 1) natural affinity maturation in our HLA-expressing mouse model enabling precise targeting of tumor-specific epitopes, 2) compatibility with genetic manipulation for studying self-antigen cross-reactivity, and 3) rapid screening capabilities thatAttorney Docket No: 243735.000429 accelerate lead optimization. This approach directly addresses key limitations in current BiTE development pipelines.

[0303] The method described herein combines a mouse model of the present disclosureproducing heavy chain-only antibodies (HCAbs) with a novel peptide-centric CAR screening platform. HCAbs are similar to camelids, enabling in vivo affinity maturation and bypassing the need to match antigen-specific heavy and light chains for antibody development and enabling the crossing with other genetically modified mice. Traditional methods rely on camelid immunization or in vitro camelid variable gene libraries, which are costly, time-consuming, and limited in their ability to generate antibodies against nucleic acid vaccines or complex antigens. In addition to natural antibody evolution, the in vivo immunization in HCAb / HLA mice of the present disclosure enables immunization with peptide-HLA antigens such as to drive peptide-centric immune responses with minimal antibody response against the HLA. Moreover, the sdAbs allow for facile reformatting of the entire antibody repertoire into CAR T cell library format, enabling high- throughput functional screening and identification of rare clones with desired binding and functional properties. The mouse model(s) described herein and cutting-edge screening technology are utilized to develop BiTEs against an antigen (e.g., but not limited to tumor-specific antigens and splice variants thereof). The BiTEs developed from this approach are expected to overcome current limitations in targeting tumor antigens, providing enhanced specificity and reduced off- target effects, which could significantly improve patient outcomes.

[0304] BiTEs derived from HCAbs: The sdAbs from HCAbs is used to create BiTEs. TheseBiTEs benefits from increased affinity to the peptide through somatic hypermutation, superior tissue penetration and stability of sdAbs, enhancing their therapeutic potential against tumors.

[0305] Small animal model for affinity maturation: The small animal models of the presentdisclosure are unique in their ability to produce naturally matured sdAbs, which are ideal for targeting peptides presented on HLA, which comprise ~1% of the surface area of the pHLA complex. To specifically direct the antibody response against the peptide while avoiding “distraction” of the immune response to the MHC, these mice are crossed with those expressing human HLA alleles, ensuring that only the peptide are perceived as foreign.

[0306] High-throughput screening and reformatting into BiTEs: The high-throughputscreening method of the present disclosure identifies peptide-centric sdAb binders from a comprehensive CAR library and single cell screening approach to identify specific and functionalAttorney Docket No: 243735.000429 binders. Subsequently, these binders are reformatted into BiTEs, ensuring optimal engagement with T cells and tumor targeting.

[0307] The immunization and screening technologies for generating high-quality sdAbs of thepresent disclosure enables the development of potent BiTEs for cancer therapy. By utilizing the strengths of both the animal models and the pMHC binder screening platform, significant advances in BiTE-based immunotherapy can be made. Non-limiting method to generate BiTEs:

[0308] Step 1: Generation of high affinity sdAbs against an antigen: HCAb mouse model ofthe present disclosure is crossed with HLA-A*02:01-expressing mice to generate high affinity sdAbs specifically targeting the tumor-specific antigen variant. This approach combines an in vivo affinity maturation with natural tolerance to HLA, focusing the immune response on the cancer- specific epitope while minimizing off-target recognition.

[0309] Step 2: Establishment of the tumor-specific BiTEs following high-throughputscreening of sdAbs: A comprehensive cellular screening is performed using flow cytometry and optofluidic platform to identify sdAbs with superior binding properties and specificity. T cells are transduced with a library of CAR vectors build from HCAb repertoire of immunized mice. On- target killing assay determines sdAb candidates with optimal tumor recognition properties. Subsequently, the BiTEs are engineered using top sdAb binders for the antigen paired to the anti- CD3 nanobody.

[0310] Step 3: An in vitro and in vivo evaluation of the therapeutic efficacy of BiTE constructs:The newly generated BiTEs are tested against suitable cell lines (e.g., but not limited to, A375 and SK-MEL-28 cell lines) and purified primary T cells. Cell lines deficient for the antigen are used as a negative control. The killing of the cells is monitored over time and the timing of T cell activation and cytokine production is evaluated. The top candidates are tested in suitable cell lines (e.g., but not limited to melanoma PDX lines). Following establishment of the tumors, primary human T cells are introduced and therapeutic potential of the newly generated BiTEs is evaluated upon engraftment. The efficacy of the BiTEs is evaluated following intraperitoneal (and at later stages intravenous) injection by evaluating tumor growth and mouse survival.

[0311] By integrating cutting-edge technologies in sdAb and BiTE development against anyantigen (e.g., but not limited to, tumor antigens or splice variants thereof), the discovery of next- generation cancer therapeutics can be accelerated. The animal models and methods describedAttorney Docket No: 243735.000429 herein may identify and deliver a set of potent sdAb-based BiTE lead candidates through high- throughput screening, followed by demonstrating their in vivo efficacy in suitable animal models (e.g., but not limited to, tumor models) expressing the antigen, positioning them for further clinical development. Tables Table 1. Origin and sequence description of VHH (Camel, Alpaca, and Llama) Code SEQ ID NO. Source DescriptionTable 2. Junctional nucleic acid sequences for VHHs and human DH and JH targeting vector SEQ ID NO Description se A ce P in in n ce O: ce -3Attorney Docket No: 243735.000429 SEQ ID NO Description i DNA N 1- A A AAttorney Docket No: 243735.000429 Table 3. Primers for detecting RNA expression of VHH and human DH and JH (PCR round 1) Source Code Primer sequence (5’-3’) SEQ ID NOTable 4. Primers for detecting RNA expression of VHH and human DH and JH (PCR round 2) Source Code Primer sequence (5’-3’) SEQ IDTable 5. AP2 CDR3 of humanized (human DHs and JHs) VHH (Spleen) DH JHAttorney Docket No: 243735.000429 DH JH SEQ ID usage usage VTable 6. CA1 CDR3 of humanized (human DHs and JHs) VHH (Spleen) DH SEQ ID usage JH usageTable 7. LA1 CDR3 of humanized (human DHs and JHs) VHH (Spleen) DHTable 8. LA2 CDR3 of humanized (human DHs and JHs) VHH (Spleen)Attorney Docket No: 243735.000429 DH SEQ usage JH usageTable 9.AP2 CDR3 of humanized (human DHs and JHs) VHH (Blood) DH SEQ usa e JH usa eTable 10. LA2 CDR3 of humanized (human DHs and JHs) VHH (Blood)Attorney Docket No: 243735.000429 DH SEQ usage JH usageList of Embodiments The disclosure provided herein also provides the following non-limiting embodiments. 1. A genetically modified non-human animal, wherein the genome of the genetically modified non-human animal comprises: a) a humanized or human major histocompatibility complex (MHC) allele, and b) a modified immunoglobulin heavy chain locus, wherein immunoglobulin (Ig) M, IgD, and their corresponding switch region are deleted or mutated so that IgM and IgD are not expressed and isotype switching is prevented, andAttorney Docket No: 243735.000429 wherein a CH1 exon of the immunoglobulin (Ig) constant region and its corresponding switch region are deleted or mutated so that gamma constant region 1 of heavy chain (CH1) exon is not expressed and isotype switching is prevented, wherein said genetically modified non-human animal is capable of producing heavy chain-only antibodies (HCAbs) or antigen-binding portions thereof comprising endogenous heavy chain variable regions and heavy chain constant regions. 2. The genetically modified non-human animal of embodiment 1, wherein the humanized or human MHC allele is MHC type I allele. 3. The genetically modified non-human animal of embodiment 2, wherein the human MHC I allele is HLA-A, HLA-B, HLA-C, HLA-E, HLA-F, or HLA-G. 4. The genetically modified non-human animal of embodiment 3, wherein the human MHC I allele is HLA-A*01:01, HLA-A*02:01, HLA-A2.1, HLA-A11, HLA-A24, HLA-B7, or HLA-B44. 5. The genetically modified non-human animal of embodiment 1, wherein the humanized or human MHC allele is MHC type II allele. 6. The genetically modified non-human animal of embodiment 5, wherein the human MHC II allele is HLA-DP, HLA-DM, HLA-DO, HLA-DQ, HLA-DR, HLA-DRB1, HLA-DQB1, or HLA- DPB1. 7. The genetically modified non-human animal of any one of embodiments 1-6, wherein the endogenous light chain of the non-human animal is not modified. 8. The genetically modified non-human animal of any one of embodiments 1-6, wherein the endogenous IgKappa or IgLambda light chains are not modified. 9. The genetically modified non-human animal of any one of embodiments 1-8, wherein the modified immunoglobulin heavy chain locus further comprises: (i) at least one unrearranged camelid variable heavy domain of heavy chain (VHH) gene segment and / or at least one unrearranged cartilaginous fish variable new antigen receptor (V- NAR) gene segment and / or at least one unrearranged human heavy chain variable region (HCVR) gene segment; (ii) at least one human immunoglobulin heavy chain D gene segment; and (iii) at least one human immunoglobulin heavy chain J gene segment, wherein the gene segments (i), (ii), and (iii) are operably linked to a functional endogenous Ig heavy chain constant region gene sequence,Attorney Docket No: 243735.000429 wherein said genetically modified non-human animal is capable of producing heavy chain-only antibodies (HCAbs) comprising camelid VHH and / or cartilaginous fish V-NAR and / or human HCVR. 10. The genetically modified non-human animal of embodiment 9, wherein the gene segments (i), (ii), and (iii) are inserted into an endogenous immunoglobulin heavy chain locus of the animal, or replace at least one nucleotide of the endogenous immunoglobulin heavy chain locus of the animal, or replace at least one of an endogenous V, D, and J gene segments. 11. The genetically modified non-human animal of embodiment 9 or embodiment 10, wherein the gene segments (i), (ii), and (iii) are capable of rearranging to form a rearranged immunoglobulin heavy chain VDJ sequence. 12. The genetically modified non-human animal of any one of embodiments 9-11, wherein the modified immunoglobulin heavy chain gene locus further comprises a human Emu enhancer. 13. The genetically modified non-human animal of embodiment 12, wherein the human Emu enhancer is located upstream of the Ig constant region. 14. The genetically modified non-human animal of any one of embodiments 9-13, wherein the modified immunoglobulin heavy chain gene locus further comprises at least one human immunoglobulin heavy chain variable region (IGHV) promoter. 15. The genetically modified non-human animal of any one of embodiments 9-14, wherein the genetically modified non-human animal expresses messenger ribonucleic acid (mRNA) that encodes a protein that has at least 70% amino acid sequence identity to a VHH from alpaca, camel, llama, vicunas, or guanacos or has at least 70% amino acid sequence identity to a V-NAR from a cartilaginous fish or has at least 70% amino acid sequence identity to a human HCVR. 16. The genetically modified non-human animal of any one of embodiments 1-15, wherein the genetically modified non-human animal expresses at least one heavy chain-only antibody (HCAb). 17. The genetically modified non-human animal of any one of embodiments 1-16, wherein the genetically modified non-human animal is a rodent. 18. The genetically modified non-human animal of any one of embodiments 1-17, wherein the genetically modified non-human animal is a mouse. 19. The genetically modified non-human animal of any one of embodiments 1-18, wherein the immunoglobulin constant region is selected from IgG, IgM, IgD, IgA, IgE, and any combinations thereof.Attorney Docket No: 243735.000429 20. The genetically modified non-human animal of embodiment 19, wherein the IgG is IgG1, IgG2, IgG3, IgG4, and any combinations thereof. 21. The genetically modified non-human animal of embodiment 19 or embodiment 20, wherein the IgG constant region is IgG3. 22. A method of producing antigen-specific heavy chain-only antibodies (HCAbs) or antigen- binding portions thereof, the method comprising immunizing the genetically modified non-human animal of any one of embodiments 1-21 with an antigen, wherein the antigen is a peptide presented in complex with a MHC molecule, and wherein the MHC molecule corresponds to the humanized or human MHC allele present within the genetically modified non-human animal. 23. The method of embodiment 22, wherein the immunization with the peptide-MHC complex is administered as a prime-boost regimen. 24. The method of embodiment 23, wherein there is a 2-3 week interval between each immunization. 25. The method of any one of embodiments 22-24, wherein the peptide is covalently attached to the MHC molecule. 26. The method of any one of embodiments 22-24, wherein the peptide is non-covalently attached to the MHC molecule. 27. The method of any one of embodiments 22-26, wherein the peptide-MHC complex forms a tetramer. 28. The method of any one of embodiments 22-27, wherein the peptide is derived from a disease- associated antigen or is derived from a membrane protein, a transmembrane protein, an intracellular protein, a non-canonical protein, a glyco moiety, or a peptide-major histocompatibility complex (pMHC) protein, and splice variants thereof. 29. The method of embodiment 28, wherein the disease-associated antigen is a cancer antigen. 30. The method of embodiment 28, wherein the disease-associated antigen is a melanoma- associated antigen. 31. The method of embodiment 28, wherein the disease-associated antigen is melanoma-associated antigen 3 (MAGEA3). 32. The method of any one of embodiments 22-31, further comprising isolating germinal center B cells and / or plasma cells from the animal and analyzing heavy chain-only antibodies (HCAbs) produced from the delta CH1 (ΔCH1) Ig locus.Attorney Docket No: 243735.000429 33. The method of any one of embodiments 22-32, further comprising isolating germinal center B cells and / or plasma cells from the animal and analyzing heavy chain-only antibodies (HCAbs) produced from the ΔCH1IgG locus. 34. The method of embodiment 32 or embodiment 33, wherein the HCAbs are analyzed for antigen binding affinity and / or specificity. 35. The method of embodiment 34 wherein the antigen binding specificity of the HCAbs is assessed by assessing binding to unrelated antigens and / or by assessing binding to MHC molecules. 36. The method of embodiment 34, wherein the antigen binding affinity and / or specificity of the HCAbs is assessed using enzyme-linked immunosorbent assay (ELISA), enzyme-linked immunosorbent spot (ELISpot), kinetic exclusion assays, biolayer interferometry, specific protein interactions, surface plasmon resonance, or protein crystallography. 37. The method of any one of embodiments 32-36, further comprising cloning the selected HCAbs into chimeric antigen receptor (CAR) vectors to create a CAR library or into recombinant T cell receptor (TCR) vectors to create a TCR library. 38. The method of embodiment 37, wherein the CAR or TCR vectors are lentiviral or retroviral vectors. 39. The method of embodiment 37 or embodiment 38, further comprising screening the CAR or TCR library in a high-throughput manner. 40. The method of embodiment 39, wherein the high-throughput screening comprises the use of CAR or TCR vectors to transduce mammalian host cells at a low multiplicity of infection to ensure single-copy integration. 41. The method of embodiment 39 or embodiment 40, wherein the high-throughput screening comprises screening for CAR or TCR binding to the peptide and cross-reactivity to the MHC molecule. 42. The method of any one of embodiments 37-41, further comprising the steps of: a) introducing the CAR or TCR library into mammalian host cells; b) culturing the CAR or TCR-expressing host cells of step (a) under conditions supporting expression of encoded CARs or TCRs; c) incubating the CAR or TCR-expressing host cells of step (a) with target and off-target antigen and MHC or with on- and off-target cells or tissues;Attorney Docket No: 243735.000429 d) selecting host cells exhibiting antigen-specific CAR or TCR binding and activation; e) optionally, identifying the sequence of CARs or TCRs within the host cells selected in step (d); and f) optionally, reformatting the identified sequence of CAR or TCR into a bispecific antibody or antigen-binding portion thereof. 43. The method of any one of embodiments 40-42, wherein the mammalian host cells are T cells, natural killer (NK) cells, natural killer T (NKT) cells, mucosal-associated invariant T cells (MAIT cells), B cells, dendritic cells (DCs), and / or macrophages. 44. A method of producing antigen-specific heavy chain-only antibodies (HCAbs) or antigen- binding portions thereof, the method comprising immunizing the genetically modified non-human animal of any one of embodiments 1-21 with an antigen, optionally wherein the antigen is encoded by mRNA encapsulated in a lipid nanoparticle (LNP). 45. The method of embodiment 44, wherein the antigen is a membrane protein, an intracellular protein, a non-canonical protein, a glyco moiety, or a peptide-major histocompatibility complex (pMHC) protein, and splice variants thereof. 46. The method of embodiment 45, wherein the membrane protein is a transmembrane protein. 47. The method of any one of embodiments 44-46, wherein the antigen is a disease-associated antigen. 48. The method of embodiment 47, wherein the disease-associated antigen is a cancer antigen. 49. The method of embodiment 47, wherein the disease-associated antigen is a melanoma- associated antigen. 50. The method of embodiment 47, wherein the disease-associated antigen is MAGEA3. 51. The method of any one of embodiments 44-50, further comprising isolating germinal center B cells and / or plasma cells from the animal and analyzing heavy chain-only antibodies (HCAbs) produced from the ΔCH1Ig locus. 52. The method of any one of embodiments 44-51, further comprising isolating germinal center B cells and / or plasma cells from the animal and analyzing heavy chain-only antibodies (HCAbs) produced from the ΔCH1IgG locus. 53. The method of embodiment 51 or embodiment 52, wherein the HCAbs are analyzed for antigen binding affinity and / or specificity.Attorney Docket No: 243735.000429 54. The method of embodiment 53, wherein the antigen binding specificity of the HCAbs is assessed by assessing binding to unrelated antigens and / or by assessing binding to MHC molecules. 55. The method of embodiment 53, wherein the antigen binding affinity and / or specificity of the HCAbs is assessed using ELISA, ELISpot, kinetic exclusion assays, biolayer interferometry, specific protein interactions, surface plasmon resonance, or protein crystallography. 56. The method of any one of embodiments 51-55, further comprising cloning the selected HCAbs into chimeric antigen receptor (CAR) vectors to create a CAR library or into recombinant T cell receptor (TCR) vectors to create a TCR library. 57. The method of embodiment 56, wherein the CAR or TCR vectors are lentiviral or retroviral vectors. 58. The method of embodiment 56 or embodiment 57, further comprising screening the CAR or TCR library in a high-throughput manner. 59. The method of embodiment 58, wherein the high-throughput screening comprises the use of CAR or TCR vectors to transduce mammalian host cells at a low multiplicity of infection to ensure single-copy integration. 60. The method of embodiment 58 or embodiment 59, wherein the high-throughput screening comprises screening for CAR or TCR binding to the peptide and cross-reactivity to the MHC molecule. 61. The method of any one of embodiments 56-60, further comprising the steps of: a) introducing the CAR or TCR library into mammalian host cells; b) culturing the CAR- or TCR-expressing host cells of step (a) under conditions supporting expression of encoded CARs or TCRs; c) incubating the CAR- or TCR-expressing host cells of step (a) with target and off-target antigen and MHC or with on- and off-target cells or tissues; d) selecting host cells exhibiting antigen-specific CAR or TCR binding and activation; e) optionally, identifying the sequence of CARs or TCRs within the host cells selected in step (d); and f) optionally, reformatting the identified sequence of CAR or TCR into a bispecific antibody or antigen-binding portion thereof.Attorney Docket No: 243735.000429 62. The method of embodiment 42 or embodiment 61, wherein the bispecific antibody or antigen- binding portion thereof is a Bi-specific engager. 63. The method of embodiment 42 or embodiment 61, wherein the bispecific antibody or antigen- binding portion thereof is a Bi-specific T cell engager (BiTE) or a Bi-specific killing cell engager (BiKE). 64. The method of any one of embodiments 59-63, wherein the mammalian host cells are T cells, NK cells, NKT cells, MAIT cells, B cells, dendritic cells (DCs), and / or macrophages. 65. A biologic molecule produced by the method of any one of embodiments 22-64. 66. The biologic molecule of embodiment 65 is selected from an antibody or antigen-binding portion thereof, an antibody-drug conjugate, a gene therapy, a cell, a fusion protein, an immunocytokine, or any combinations thereof. 67. The biologic molecule of embodiment 66, wherein the antibody or antigen-binding portion thereof is selected from a heavy chain-only antibody or antigen-binding portion thereof, a heavy chain variable domain, a variable domain of heavy chain of heavy chain-only antibody (VHH), a nanobody, a camelid antibody or antigen-binding portion thereof, or an immunoglobulin novel antigen receptor (IgNAR) antibody or antigen-binding portion thereof. 68. The biologic molecule of embodiment 67, wherein the heavy chain-only antibody or antigen- binding portion thereof is a single-domain antibody. 69. The biologic molecule of any one of embodiments 65-68, wherein the biologic molecule is a murine, a chimeric, a human, a humanized, a camelid, or an immunoglobulin novel antigen receptor (IgNAR) antibody or antigen-binding portion thereof. 70. The biologic molecule of any one of embodiments 65-69, wherein the biologic molecule is monospecific, bispecific, or multi-specific. 71. The biologic molecule of any one of embodiments 65-70, wherein the biologic molecule is a bispecific antibody or antigen-binding portion thereof or a bi-epitopic antibody or antigen-binding portion thereof. 72. The biologic molecule of embodiment 71, wherein the bispecific antibody or antigen-binding portion thereof is a Bi-specific engager. 73. The biologic molecule of embodiment 71, wherein the bispecific antibody or antigen-binding portion thereof is a Bi-specific T cell engager (BiTE) or a Bi-specific killing cell engager (BiKE).Attorney Docket No: 243735.000429 74. The biologic molecule of any one of embodiments 71-73, wherein the bispecific antibody or antigen-binding portion thereof is a Bi-specific T cell engager (BiTE). 75. The biologic molecule of any one of embodiments 65-74, wherein the biologic molecule can bind or interact with an antigen. 76. The biologic molecule of embodiment 75, wherein the antigen is a membrane protein, an intracellular protein, a non-canonical protein, a glyco moiety, or a peptide-major histocompatibility complex (pMHC) protein, and splice variants thereof. 77. The biologic molecule of embodiment 76, wherein the membrane protein is a transmembrane protein. 78. The biologic molecule of any one of embodiments 75-77, wherein the antigen is a disease- associated antigen. 79. The biologic molecule of embodiment 7678 wherein the disease-associated antigen is a cancer antigen. 80. The biologic molecule of embodiment 78, wherein the disease-associated antigen is a melanoma-associated antigen. 81. The biologic molecule of embodiment 78, wherein the disease-associated antigen is MAGEA3. 82. The biologic molecule of any one of embodiments 70-74, wherein the bispecific antibody or antigen-binding portion thereof binds to a cancer-associated antigen and an antigen present on immune cell. 83. The biologic molecule of embodiment 82, wherein the immune cell is a T cell, an NK cell, an NKT cell, a MAIT cell, a B cell, a dendritic cell (DC), and / or a macrophage.Attorney Docket No: 243735.000429 List of Sequences SEQ ID NO: 1 atggaactggggctgagctgggtcgtcctggctgctcttctacaaggtgtccaagctgaggtgcagctggtggagtccgggggaggctcg gtgcaggctggagggtctctgagactctcctgtgcagcttctggatacacctacagtagctgcagcatgggctggtaccgccaagctccag gaaaggagcgcgaattggtctcaactattattagtgatggtagcacacactatgcagattccatgaagggccgattcacaatctccagagac aatgccaagaacgtgctgtatctgcaaatgaacagtctgaaacctgaggatacggccatgtattactgtact ___________________________________ SEQ ID NO:2 atggagctcggactgagctgggtcgtcctggctgctcttctacaaggtgtccaggcacaggtgcagctggtcgagtctggaggagggttgg tgcagcctggagggtctctgaggctctcctgtgcagcctccggaagcatctttagtatcaatgccatggggtggtaccgccaggcaccagg aaagcagcgcgagttagtcgcagctattactagcggtggtagcacatactatgcagactctgtgaagggccaattcaccatctccagagaca acgccaagaacacgctgtatctgcaaatgaacagcctgaaacctggggacacggccgtgtattactgtgcaaaaagggtagtg ___________________________________ SEQ ID NO:3 atggagctggggctgagctgggtggtcctggctgctctactacaaggtgagtgctgtggtcagggactccttcacgggtgaaacatcagtttt cttgtttgtgggcttcatcttcttatgctttctccacaggtgtccaggcccaggtgcagctggtggagtctgggggaggcttggtgcaggctgg gggctctctgagacactcctgtgcagcctctggactcaccttcggtagctatgccatgggctggtaccgccaggctccagggaaggagcg cgagttggtcgcagctattagtagtggtggtagcacatactatgcagactctgtgaagggccaattcaccatctccagagacaacgccaaga acacgctgtatctgcaaatgaacagcctgaaacctggggacacggccgtgtattactgtgcaaaaga ___________________________________ SEQ ID NO:4 atggagttgggtctttctctggtggtccttgccgctttgcttcaggtaattcatggagaacaagagcttctgaggatgtgggtggtcgtgaggg gaatcacaggacgtgggacagcctcctgaccaggatgtctttgtgtttgcagggtgtactggccgaggtgcaactcgtagaaagtggtggg ggtctcgttcagcctgggggctccttgcgactttcttgcgccgcatcaggcttcaccctggattattatagtatcggctggttttgacaagcacc tgggaaagagcgagagggtgtcagttgtatcagcgactccgatgggagaacctactatgctgatagtgtaaaaggtcgattcaccatatctc gggataatgcaaaaaatactgtatatctccagatgaactctcttaaacccgaggacactgctgtttattattgtgcaacag ___________________________________ SEQ ID NO: 5 acatacaaat taaagtaata tgaagctctg tcctgtacc ________________________________________ SEQ ID NO: 6 gggtaatata gaaaggcagg ccaaagaacc tccgaggttt caaccaaaag caattgtgta caccagccag gacagaaatg cctcgacttc gctgctgccc aaggttgccg ggtgacgca ________________________________________ SEQ ID NO: 7 agatcagttg gaagaatttg tccactacgt gaaaggcgag atcaccaagg tagtcggcaa ataaggtaca actagtgggc ccgatatccc cgggtattgc cggcggtacc ataacttcgt ataatgtatg ctatacgaag ttatcggata acactcaggt aggtggt ________________________________________ SEQ ID NO: 8 gagggcaaag gaataggcgg gactctgggg ttcgaataaa gaccgaccaa gcgacgtctg agagctccct gtaactttaa ataattggca ttatttaaag ttaggatcct tgccggctag cactgcaggc atgtctaggc aactccctgt gcactatgac cctggggcgt tggagat ________________________________________ SEQ ID NO: 9 gaggagccca gcactagaag tcggcggtgt ttccattcgg tgatcagcac tgaacacaga ggactcacca tggagttggg tctttctctg gtggtccttg ccgctttgct tcaggtaatt catggagaac aagagcttAttorney Docket No: 243735.000429 ________________________________________ SEQ ID NO: 10 tctcttaaac ccgaggacac tgctgtttat tattgtgcaa cagagacaca gtgaggggaa gtcattgtgc gcccagacac aaacctccct gcaggaacgc tggcgggaaa tcagcggcag ggggcgctca ggagccactg atcagagtca gccctggagg caggtgcaga tggaggctgt ttcctgtcag gatgtgggac tttgtcttct tctgacagtt ccccagggaa cctcttaaat ttagaaaact gtgcctaaca atgtcttctc tatgcatatg aggacctttt ctccctggca caaaatgcag attgacgctg acacggatga aaattcctca accatggtca caaggatcag agtcctgagt aacctcaggg cttcctggtg agtcttctcc aatcagaccc aggacaggga cctccgtgag attccctgac tgctagcggc ttctctgaga tcagccctgg ggggctgtgt tctaggtcat gtctctcact ttccactatg aga ________________________________________ SEQ ID NO: 11 cacccaacaa ccacatccct cctcagaagc ccccagagca caacgcctca ccatggagct ________________________________________ SEQ ID NO: 12 acctgcagat gaatagcctc aaacctgagg acacagccgt ctactattgt aatgcagaca cagtgtgaaa acccacatcc tgagagtgtc agaaacccca ggggggaagc agctgtgctg gcatggagga ________________________________________ SEQ ID NO: 13 tgccctgaga gcatcaccca gcaaccacat ctgtcctcta gagaatcccc tgagagctcc gttcctcacc atggagctgg ggctgagctg ggtggtcctg gctgctctac tacaaggtga gtgctgtggt cagggact ________________________________________ SEQ ID NO: 14 tgtatctgca aatgaacagc ctgaaacctg gggacacggc cgtgtattac tgtgcaaaag acacagtgtg aaaacccaca tcctgagggt gtcagaaacc ccagggagga ggcagctgtg ________________________________________ SEQ ID NO: 15 gaactgcaga gcctgctgaa ttctggctga ccagggcagt caccagagct ccagacaatg gaactggggc tgagctgggt cgtcctggct gctcttctac aaggtgagtg tctcaggaa ________________________________________ SEQ ID NO: 16 atctgcaaat gaacagtctg aaacctgagg atacggccat gtattactgt actagacaca cagtgagggg aagtcagtgt gagcccagac acaaacctcc ctgcagggat gctca ________________________________________ SEQ ID NO: 17 ccagccccca tccaggaggc cccagagctc agggcgccgg ggcagattct gaacagcccc gagtcacggt gggtacaact ggaacgacca ccgtgagaaa aactgtgtcc aaaactctct cctggcccct gctggaggcc gcgccagaga ggggag ________________________________________ SEQ ID NO: 18 gcccggagac agaaggtctc tgggtggctg ggtttttgtg gggtgaggat ggacattctg ccattgtgat tactactact actactacat ggacgtctgg ggcaaaggga ccacggtcac cgtctcctca ggtaagaatg gccactctag ggcctttgtt ttctgctact gcctgtgggg tttcctgagc attgcaggtt ggtcct ________________________________________ SEQ ID NO: 19Attorney Docket No: 243735.000429 ggagactcat ttatgtgagt cttttgagtg accattgtct gggtcactcc catttaactt tccctcgtac gttcgtggga ttgtgtccgt gtcgcgaagt tcctatactt tctagagaat aggaacttcc cgcggttgta agttctccag atctagagta agacagaagt ctggaagaca tggga ________________________________________ SEQ ID NO: 20 ccgcatgctc cagactgcct tgggaaaagc gcctccccta cccggtagaa tgaagttcct atactttcta gagaatagga acttcgttgg taccgtacgg caatgccaat cagggcagtt gggttccttt gtgtctgcct cctagaagcc tcttttcatg ttcctcat ________________________________________ SEQ ID NO: 21 gaagctgaga tattaggctt taacgagggc caagcaataa cactatccct gaccacatgg taaggct ________________________________________ SEQ ID NO: 22 tccagtcctg gtgctggatg gggag ________________________________________ SEQ ID NO: 23 atggagctcg gactgagctg ggtcgtc ________________________________________ SEQ ID NO: 24 atggaactgg ggctgagctg ggtcgtcc ________________________________________ SEQ ID NO: 25 atggagctgg ggctgagctg ggtggtcc ________________________________________ SEQ ID NO: 26 tggagttggg tctttctctg gtggtccttg ________________________________________ SEQ ID NO: 27 gaaggtactg ttgtactgag cttcac ________________________________________ SEQ ID NO: 28 tgcagcctgg agggtctctg aggctctc ________________________________________ SEQ ID NO: 29 agactctcct gtgcagcttc tggatacac ________________________________________ SEQ ID NO: 30 gacactcctg tgcagcctct ggactcac ________________________________________ SEQ ID NO: 31 ggccgaggtg caactcgtag aaagtg ________________________________________ SEQ ID NO: 32 aggtgcagct ggtcgagtct ggaggagggt tggtgcagcc tggagggtct ctgaggctct cctgtgcagc ctccggaagc atctttagta tcaatgccat ggggtggtac cgccaggcac caggaaagca gcgcgagtta gtcgcagcta ttactagcgg tggtagcaca tactatgcag actctgtgaa gggccaattc accatctcca gagacaacgc caagaacacg ctgtatctgcAttorney Docket No: 243735.000429 aaatgaacag cctgaaacct ggggacacgg ccgtgtatta ctgtgcaaaa ggagtgggag ctgatgcttt tgatatctgg ggccaaggga caatggtcac cgtctcttca g ________________________________________ SEQ ID NO: 33 aggtgcagct ggtcgagtct ggaggagggt tggtgcagcc tggagggtct ctgaggctct cctgtgcagc ctccggaagc atctttagta tcaatgccat ggggtggtac cgccaggcac caggaaagca gcgcgagtta gtcgcagcta ttactagcgg tggtagcaca tactatgcag actctgtgaa gggccaattc accatctcca gagacaacgc caagaacacg ctgtatctgc aaatgaacag cctgaaacct ggggacacgg ccgtgtatta ctgtgcaaaa gatgcgagca gcagctggcc gccttactac atggacgtct ggggcaaagg gaccacggtc accgtct ________________________________________ SEQ ID NO: 34 aggtgcagct ggtcgagtct ggaggagggt tggtgcagcc tggagggtct ctgaggctct cctgtgcagc ctccggaagc atctttagta tcaatgccat ggggtggtac cgccaggcac caggaaagca gcgcgagtta gtcgcagcta ttactagcgg tggtagcaca tactatgcag actctgtgaa gggccaattc accatctcca gagacaacgc caagaacacg ctgtatctgc aaatgaacag cctgaaacct ggggacacgg ccgtgtatta ctgtgcaaaa gttgatatag tggacaactg gttcgacccc tggggccagg gaaccctggt caccgtctcc tcag ________________________________________ SEQ ID NO: 35 aggtgcagct ggtcgagtct ggaggaggct cggtgcaggc tggagggtct ctgagactct cctgtgcagc ttctggatac acctacagta gctgcagcat gggctggtac cgccaagctc caggaaagga gcgcgaattg gtctcaacta ttattagtga tggtagcaca cactatgcag attccatgaa gggccgattc acaatctcca gagacaatgc caagaacgtg ctgtatctgc aaatgaacag tctgaaacct gaggatacgg ccatgtatta ctgtactaga ctaagtatta ctatggttcg gggagccccc ctctactact actactacat ggacgtctgg ggcaaaggga ________________________________________ SEQ ID NO: 36 aggtgcagct ggtcgagtct ggaggagggt tggtgcagcc tggagggtct ctgaggctct cctgtgcagc ctccggaagc atctttagta tcaatgccat ggggtggtac cgccaggcac caggaaagca gcgcgagtta gtcgcagcta ttactagcgg tggtagcaca tactatgcag actctgtgaa gggccaattc accatctcca gagacaacgc caagaacacg ctgtatctgc aaatgaacag cctgaaacct ggggacacgg ccgtgtatta ctgtgcagca gcagctggta cagatgcttt tgatatctgg ggccaaggga caatggtcac cgtctcttca g ________________________________________ SEQ ID NO: 37 aggtgcagct ggtcgagtct ggaggagggt tggtgcagcc tggagggtct ctgaggctct cctgtgcagc ctccggaagc atctttagta tcaatgccat ggggtggtac cgccaggcac caggaaagca gcgcgagtta gtcgcagcta ttactagcgg tggtagcaca tactatgcag actctgtgaa gggccaattc accatctcca gagacaacgc caagaacacg ctgtatctgc aaatgaacag cctgaaacct ggggacacgg ccgtgtatta ctgtgcagca gcagctggta cagatgcttt tgatatctgg ggccaaggga caatggtcac cgtctcttca g ________________________________________ SEQ ID NO: 38 aggtgcagct ggtcgagtct ggaggagggt tggtgcagcc tggagggtct ctgaggctct cctgtgcagc ctccggaagc atctttagta tcaatgccat ggggtggtac cgccaggcac caggaaagca gcgcgagtta gtcgcagcta ttactagcgg tggtagcaca tactatgcag actctgtgaa gggccaattc accatctcca gagacaacgc caagaacacg ctgtatctgc aaatgaacag cctgaaacct ggggacacgg ccgtgtatta ctgtgcaaaa gggaggtata gcagcagctg gtactttgac tactggggcc agggaaccct ggtcaccgtc tcctcag ________________________________________ SEQ ID NO: 39Attorney Docket No: 243735.000429 aggtgcagct ggtcgagtct ggaggagggt tggtgcagcc tggagggtct ctgaggctct cctgtgcagc ctccggaagc atctttagta tcaatgccat ggggtggtac cgccaggcac caggaaagca gcgcgagtta gtcgcagcta ttactagcgg tggtagcaca tactatgcag actctgtgaa gggccaattc accatctcca gagacaacgc caagaacacg ctgtatctgc aaatgaacag cctgaaacct ggggacacgg ccgtgtatta ctgtgcaaaa agactaactg gaacttatga tgcttttgat atctggggcc aagggacaat ggtcaccgtc tcttcag ________________________________________ SEQ ID NO: 40 aggtgcagct ggtcgagtct ggaggagggt tggtgcagcc tggagggtct ctgaggctct cctgtgcagc ctccggaagc atctttagta tcaatgccat ggggtggtac cgccaggcac caggaaagca gcgcgagtta gtcgcagcta ttactagcgg tggtagcaca tactatgcag actctgtgaa gggccaattc accatctcca gagacaacgc caagaacacg ctgtatctgc aaatgaacag cctgaaacct ggggacacgg ccgtgtatta ctgtgcaaaa gatcaagact ggaactttcc tttgactact ggggccaggg aaccctggtc accgtctcct cag ________________________________________ SEQ ID NO: 41 gaggtgcagc tggtggagtc cgggggaggc tcggtgcagg ctggagggtc tctgagactc tcctgtgcag cttctggata cacctacagt agctgcagca tgggctggta ccgccaagct ccaggaaagg agcgcgaatt ggtctcaact attattagtg atggtagcac acactatgca gattccatga agggccgatt cacaatctcc agagacaatg ccaagaacgt gctgtatctg caaatgaaca gtctgaaacc tgaggatacg gccatgtatt actgtacttt actacggtgt cctctctttg actactgggg ccagggaacc ctggtcaccg tctcctcag ________________________________________ SEQ ID NO: 42 aggtgcagct ggtcgagtct ggaggagggt tggtgcagcc tggagggtct ctgaggctct cctgtgcagc ctccggaagc atctttagta tcaatgccat ggggtggtac cgccaggcac caggaaagca gcgcgagtta gtcgcagcta ttactagcgg tggtagcaca tactatgcag actctgtgaa gggccaattc accatctcca gagacaacgc caagaacacg ctgtatctgc aaatgaacag cctgaaacct ggggacacgg ccgtgtatta ctgtgatata gtggctacga ttccaggggc ttttgatatc tggggccaag ggacaatggt caccgtctct tcag ________________________________________ SEQ ID NO: 43 aggtgcagct gatcgagtct ggaggagggt tggtgcagcc tggagggtct ctgaggctct cctgtgcagc ctccggaagc atctttagta tcaatgccat ggggtggtac cgccaggcac caggaaagca gcgcgagtta gtcgcagcta ttactagcgg tggtagcaca tactatgcag actctgtgaa gggccaattc accatctcca gagacaacgc caagaacacg ctgtatctgc aaatgaacag cctgaaacct ggggacacgg ccgtgtatta ctgtgcaaag ggggctgggg atctcttctt tgactactgg ggccagggaa ccctggtcac cgtctcctca g ________________________________________ SEQ ID NO: 44 aggtgcagct ggtcgagtct ggaggagggt tggtgcagcc tggagggtct ctgaggctct cctgtgcagc ctccggaagc atctttagta tcaatgccat ggggtggtac cgccaggcac caggaaagca gcgcgagtta gtcgcagcta ttactagcgg tggtagcaca tactatgcag actctgtgaa gggccaattc accatctcca gagacaacgc caagaacacg ctgtatctgc aaatgaacag cctgaaacct ggggacacgg ccgtgtatta ctgtgcaaaa gtagagtggg agctactgga ctggttcgac ccctggggcc agggaaccct ggtcaccgtc tcctcag ________________________________________ SEQ ID NO: 45 aggtgtccag gcacaggtgc agctggtcga gtctggagga gggttggtgc agcctggagg gtctctgagg ctctcctgtg cagcctccgg aagcatcttt agtatcaatg ccatggggtg gtaccgccag gcaccaggaa agcagcgcga gttagtcgca gctattacta gcggtggtag cacatactat gcagactctg tgaagggcca attcaccatc tccagagaca acgccaagaaAttorney Docket No: 243735.000429 cacgctgtat ctgcaaatga acagcctgaa acctggggac acggccgtgt attactgtgc ccccgtaact ggctttgact actggggcca gggaaccctg gtcaccgtct cctcag ________________________________________ SEQ ID NO: 46 gaggtgcaac tcgtagaaag tggtgggggt ctcgttcagc ctgggggctc cttgcgactt tcttgcgccg catcaggctt caccctggat tattatagta tcggctggtt ttgacaagca cctgggaaag agcgagaggg tgtcagttgt atcagcgact ccgatgggag aacctactat gctgatagtg taaaaggtcg attcaccata tctcgggata atgcaaaaaa tactgtatat ctccagatga actctcttaa acccgaggac actgctgttt attattgtgc aacagagaag acgatttttg gagtggttat tatacaactt actactacta ctactacatg gacgtctggg gcaaagggac cacggtcacc gtctcctcag ________________________________________ SEQ ID NO: 47 gaggtgcaac tcgtagaaag tggtgggggt ctcgttcagc ctgggggctc cttgcgactt tcttgcgccg catcaggctt caccctggat tattatagta tcggctggtt ttgacaagca cctgggaaag agcgagaggg tgtcagttgt atcagcgact ccgatgggag aacctactat gctgatagtg taaaaggtcg attcaccata tctcgggata atgcaaaaaa tactgtatat ctccagatga actctcttaa acccgaggac actgctgttt attattgtgc aacaccttcc atagcagctc gtcctactac tactactaca tggacgtctg gggcaaaggg accacggtca ccgtctcctc ag ________________________________________ SEQ ID NO: 48 gaggtgcaac tcgtagaaag tggtgggggt ctcgttcagc ctgggggctc cttgcgactt tcttgcgccg catcaggctt caccctggat tattatagta tcggctggtt ttgacaagca cctgggaaag agcgagaggg tgtcagttgt atcagcgact ccgatgggag aacctactat gctgatagtg taaaaggtcg attcaccata tctcgggata atgcaaaaaa tactgtatat ctccagatga actctcttaa acccgaggac actgctgttt attattgtgc aacagaggag gggtattact atggttcggg gagttatgga agactactac tacatggacg tctggggcaa agggaccacg gtcaccgtct cctcag ________________________________________ SEQ ID NO: 49 gaggtgcaac tcgtagaaag tggtgggggt ctcgttcagc ctgggggctc cttgcgactt tcttgcgccg catcaggctt caccctggat tattatagta tcggctggtt ttgacaagca cctgggaaag agcgagaggg tgtcagttgt atcagcgact ccgatgggag aacctactat gctgatagtg taaaaggtcg attcaccata tctcgggata atgcaaaaaa tactgtatat ctccagatga actctcttaa acccgaggac actgctgttt attattacag cacctggtac ggactactgg ggccagggaa ccctggtcac cgtctcctca ________________________________________ SEQ ID NO: 50 gaggtgcaac tcgtagaaag tggtgggggt ctcgttcagc ctgggggctc cttgcgactt tcttgcgccg catcaggctt caccctggat tattataata tcgtctggtt ttgacaaaca cctgagaaag aacgagaggg tgtcagttgt ttcagcgact ccgatggaaa aacctactct attcatagta taaaaggtcg attcaccata tctcgggata atgcaaaaaa tactgtatat ctccagatga actctcttaa acccgaggac actgctgttt attactgtgc aacagatatt gtaatactac cagctgctat gagaactggt tcgacccctg gggccaggga accctggtca ccgtctcctc ag ________________________________________ SEQ ID NO: 51 gaggtgcaac tcgtagaaag tggtgggggt ctcgttcagc ctgggggctc cttgcgactt tcttgcgccg catcaggctt caccctggat tattatagta tcggctggtt ttgacaagca cctgggaaag agcgagaggg tgtcagttgt atcagcgact ccgatgggag aacctactat gctgatagtg taaaaggtcg attcaccata tctcgggata atgcaaaaaa tactgtatat ctccagatga actctcttaa acccgaggac actgctgttt attattgtgc aactaacatc tggtaccggc tgttggagga ctgtggccac tgaggcctgg taaccctg ________________________________________ SEQ ID NO: 52Attorney Docket No: 243735.000429 gaggtgcaac tcgtagaaag tggtgggggt ctcgttcagc ctgggggctc cttgcgactt tcttgcgccg catcaggctt caccctggat tattatagta tcggctggtt ttgacaagca cctgggaaag agcgagaggg tgtcagttgt atcagcgact ccgatgggag aacctactat gctgatagtg taaaaggtcg attcaccata tctcgggata atgcaaaaaa tactgtatat ctccagatga actctcttaa acccgaggac actgctgttt attattgtgc aacagagact cggggagtta taaactacta ctactacatg gacgtctggg gcaaagggac cacggtcacc gtctcctcag ________________________________________ SEQ ID NO: 53 gaggtgcaac tcgtagaaag tggtgggggt ctcgttcagc ctgggggctc cttgcgactt tcttgcgccg catcaggctt caccctggat tattatagta tcggctggtt ttgacaagca cctgggaaag agcgagaggg tgtcagttgt atcagcgact ccgatgggag aacctactat gctgatagtg taaaaggtcg attcaccata tctcgggata atgcaaaaaa tactgtatat ctccagatga actctcttaa acccgaggac actgctgttt attattgtgc aacatattgt agtagtacca gctgctactg gtacttcgat ctctggggcc gtggcaccct ggtcactgtc tcctcag ________________________________________ SEQ ID NO: 54 gaggtgcaac tcgtagaaag tggtgggggt ctcgttcagc ctgggggctc cttgcgactt tcttgcgccg catcaggctt caccctggat tattatagta tcgactggtt ttgacaagca cctgggaaag agcgagaggg tgtcagttgt atcagcgact ccgatgggag aacctactat gctgatagtg taaaaggtcg attcaccata tctcgggata atgcaaaaaa tactgtatat ctccagatga actctcttaa acccgaggac actgctgttt attattgtgc aacacatata ggtatagcag cagctggtac ctttgactac tggggccagg gaaccctggt caccgtctcc tca ________________________________________ SEQ ID NO: 55 cagcctggag ggtctctgag gctctcctgt gcagcttctg gatacaccta cagtagctgc agcatgggct ggtaccgcca agctccagga aaggagcgcg aattggtctc aactattatt agtgatggta gcacacacta tgcagattcc atgaagggcc gattcacaat ctccagagac aatgccaaga acgtgctgta tctgcaaatg aacagtctga aacctgagga tacggccatg tattactgta ctagacaact cccctttgac tactggggcc agggaaccct ggtcaccgtc tcctcag ________________________________________ SEQ ID NO: 56 gatgcagcct ggagggtctc tgaggctctc ctgtgcagct tctggataca cctacagtag ctgcagcatg ggctggtacc gccaagctcc aggaaaggag cgcgaattgg tctcaactat tattagtgat ggtagcacac actatgcaga ttccatgaag ggccgattca caatctccag agacaatgcc aagaacgtgc tgtatctgca aatgaacagt ctgaaacctg aggatacggc catgtattac tgtacttgta tagcagctcg tccggatgat gcttttgata tctggggcca agggacaatg gtcaccgtct cttcag ________________________________________ SEQ ID NO: 57 cagcctggag ggtctctgag gctctcctgt gcagcctccg gaagcatctt tagtatcaat gccatggggt ggtaccgcca ggcaccagga aagcagcgcg agttagtcgc agctattact agcggtggta gcacatacta tgcagactct gtgaagggcc aattcaccat ctccagagac aacgccaaga acacgctgta tctgcaaatg aacagcctga aacctgggga cacggccgtg tattactgtg caaaagtgat ggagtgggag ctcccttttg actactgggg ccagggaacc ctggtcaccg tctcctcag ________________________________________ SEQ ID NO: 58 cagcctggag ggtctctgag gctctcctgt gcagcctccg gaagcatctt tagtatcaat gccatggggt ggtaccgcca ggcaccagga aagcagcgcg agttagtcgc agctattact agcggtggta gcacatacta tgcagactct gtgaagggcc aattcaccat ctccagagac aacgccaaga acacgctgta tctgcaaatg aacagcctga aacctgggga cacggccgtg tattactgtg caagtatagc agcagctgcc ttgactactt tgactactgg ggccagggaa ccctggtcac cgtctcctca g ________________________________________ SEQ ID NO: 59Attorney Docket No: 243735.000429 gatgcagcct ggagggtctc tgaggctctc ctgtgcagcc tccggaagca tctttagtat caatgccatg gggtggtacc gccaggcacc aggaaagcag cgcgagttag tcgcagctat tactagcggt ggtagcacat actatgcaga ctctgtgaag ggccaattca ccatctccag agacaacgcc aagaacacgc tgtatctgca aatgaacagc ctgaaacctg gggacacggc cgtgtattac tgtgcaaata taactggaac taactgggga tctgactact ggggccaggg aaccctggtc accgtctcct cag ________________________________________ SEQ ID NO: 60 gatgcagcct ggagggtctc tgaggctctc ctgtgcagct tctggataca cctacagtag ctgcagcatg ggctggtacc gccaagctcc aggaaaggag cgcgaattgg tctcaactat tattagtgat ggtagcacac actatgcaga ttccatgaag ggccgattca caatctccag agacaatgcc aagaacgtgc tgtatctgca aatgaacagt ctgaaacctg aggatacggc catgtattac tgtactagac agtgtataac tggaactaag ggatactttg actactgggg ccagggaacc ctggtcaccg tctcctcag ________________________________________ SEQ ID NO: 61 ctctggaagc atctttagta tcaatgccat ggggtggtac cgccaggcac caggaaagca gcgcgagtta gtcgcagcta ttactagcgg tggtagcaca tactatgcag actctgtgaa gggccaattc accatctcca gagacaacgc caagaacacg ctgtatctgc aaatgaacag cctgaaacct ggggacacgg ccgtgtatta ctgtgcaaaa gttgactacg gtgactacct tgactggttc gacccctggg gccagggaac cctggtcacc gtctcctcag ________________________________________ SEQ ID NO: 62 gacactcctg tgcagcctct ggaagcatct ttagtatcaa tgccatgggg tggtaccgcc aggcaccagg aaagcagcgc gagttagtcg cagctattac tagcggtggt agcacatact atgcagactc tgtgaagggc caattcacca tctccagaga caacgccaag aacacgctgt atctgcaaat gaacagcctg aaacctgggg acacggccgt gtattactgt gcaaatttag cgtatagcag ctccgacttt gactactggg gccagggaac cctggtcacc gtctcctcag ________________________________________ SEQ ID NO: 63 gacactcctg tgcagcctct ggaagcatct ttagtatcaa tgccatgggg tggtaccgcc aggcaccagg aaagcagcgc gagttagtcg cagctattac tagcggtggt agcacatact atgcagactc tgtgaagggc caattcacca tctccagaga caacgccaag aacacgctgt atctgcaaat gaacagcctg aaacctgggg acacggccgt gtattactgt gcaaaactgg aaggggacta ctggggccag ggaaccctgg tcaccgtctc ctcag ________________________________________ SEQ ID NO: 64 gacactcctg tgcagcctct ggaagcatct ttagtatcaa tgccatgggg tggtaccgcc aggcaccagg aaagcagcgc gagttagtcg cagctattac tagcggtggt agcacatact atgcagactc tgtgaagggc caattcacca tctccagaga caacgccaag aacacgctgt atctgcaaat gaacagcctg aaacctgggg acacggccgt gtattactgt gcaaaagata gtgggagcta ctggggccag ggaaccctgg tcaccgtctc ctcag ________________________________________ SEQ ID NO: 65 tgtgcagcct ctggaagcat ctttagtatc aatgccatgg ggtggtaccg ccaggcacca ggaaagcagc gcgagttagt cgcagctatt actagcggtg gtagcacata ctatgcagac tctgtgaagg gccaattcac catctccaga gacaacgcca agaacacgct gtatctgcaa atgaacagcc tgaaacctgg ggacacggcc gtgtattact gtgcaaaaga tctaactgga actacggact actggggcca gggaaccctg gtcaccgtct cctcag ________________________________________ SEQ ID NO: 66 gacactcctg tgcagcctct ggaagcatct ttagtatcaa tgccatgggg tggtaccgcc aggcaccagg aaagcagcgc gagttagtcg cagctattac tagcggtggt agcacatact atgcagactc tgtgaagggc caattcacca tctccagaga caacgccaag aacacgctgt atctgcaaat gaacagcctg aaacctgggg acacggccgt gtattactgt gcaaaacgta ctggggatgc ttttgatatc tggggccaag ggacaatggt caccgtctct tcagAttorney Docket No: 243735.000429 ________________________________________ SEQ ID NO: 67 gacactcctg tgcagcctct ggaagcatct ttagtatcaa tgccatgggg tggtaccgcc aggcaccagg aaagcagcgc gagttagtcg cagctattac tagcggtggt agcacatact atgcagactc tgtgaagggc caattcacca tctccagaga caacgccaag aacacgctgt atctgcaaat gaacagcctg aaacctgggg acacggccgt gtattactgt gcaaaagatc tccgactggg gaagggccct gactactggg gccagggaac cctggtcacc gtctcctcag ________________________________________ SEQ ID NO: 68 gacactcctg tgcagcctct ggactcatct ttagtatcaa tgccatgggg tggtaccgcc aggcaccagg aaagcagcgc gagttagtcg cagctattac tagcggtggt agcacatact atgcagactc tgtgaagggc caattcacca tctccagaga caacgccaag aacacgctgt atctgcaaat gaacagcctg aaacctgggg acacggccgt gtattactgt gcaaaaagga ctggaactac cctctactac tactactaca tggacgtctg gggcaaaggg accacggtca ccgtctcctc ag ________________________________________ SEQ ID NO: 69 gacactcctg tgcagcctct ggaagcatct ttagtatcaa tgccatgggg tggtaccgcc aggcaccagg aaagcagcgc gagttagtcg cagctattac tagcggtggt agcacatact atgcagactc tgtgaagggc caattcacca tctccagaga caacgccaag aacacgctgt atctgcaaat gaacagcctg aaacctgggg acacggccgt gtattactgt gcaaaagatc aagactggaa ctttcctttg actactgggg ccagggaacc ctggtcaccg tctcctcag ________________________________________ SEQ ID NO: 70 gacactcctg tgcagcctct ggaagcatct ttagtatcaa tgccatgggg tggtaccgcc aggcaccagg aaagcagcgc gagttagtcg cagctattac tagcggtggt agcacatact atgcagactc tgtgaagggc caattcacca tctccagaga caacgccaag aacacgctgt atctgcaaat gaacagcctg aaacctgggg acacggccgt gtattactgt gcaaaagtga tggagtggga gctccctttt gactactggg gccagggaac cctggtcacc gtctcctca ________________________________________ SEQ ID NO: 71 gacactcctg tgcagcctct ggaagcatct ttagtatcaa tgccatgggg tggtaccgcc aggcaccagg aaagcagcgc gagttagtcg cagctattac tagcggtggt agcacatact atgcagactc tgtgaagggc caattcacca tctccagaga caacgccaag aacacgctgt atctgcaaat gaacagcctg aaacctgggg acacggccgt gtattactgt gcaaaaggta taactggaac tactgactac tggggccagg gaaccctggt caccgtctcc tcag ________________________________________ SEQ ID NO: 72 gacactcctg tgcagcctct ggacgcatct ttagtatcaa tgccatgggg tggtaccgcc aggcaccagg aaagcagcgc gagttagtcg cagctattac tagcggtggt agcacatact atgcagactc tgtgaagggc caattcacca tctccagaga caacgccaag aacacgctgt atctgcaaat gaacagcctg aaacctgggg acacggccgt gtattactgt gcaaaaggcg aggactggaa ccttgactac tggggccagg gaaccctggt caccgtctcc tcag ________________________________________ SEQ ID NO: 73 gacactcctg tgcagcctct ggaagcatct ttagtatcaa tgccatgggg tggtaccgcc aggcaccagg aaagcagcgc gagttagtcg cagctattac tagcggtggt agcacatact atgcagactc tgtgaagggc caattcacca tctccagaga caacgccaag aacacgctgt atctgcaaat gaacagcctg aaacctgggg acacggccgt gtattactgt gcagcagcag ctggtacaga tgcttttgat atctggggcc aagggacaat ggtcaccgtc tcttcag ________________________________________ SEQ ID NO: 74 gacactcctg tgcagcctct ggaagcatct ttagtatcaa tgccatgggg tggtaccgcc aggcaccagg aaagcagcgc gagttagtcg cagctattac tagcggtggt agcacatact atgcagactc tgtgaagggc caattcacca tctccagagaAttorney Docket No: 243735.000429 caacgccaag aacacgctgt atctgcaaat gaacagcctg aaacctgggg acacggccgt gtattactgt gcaaaagatt actatggttc ggggagttat tataacgtga ctggttcgac ccctggggcc agggaaccct ggtcaccgtc tcctcag ________________________________________ SEQ ID NO: 75 AKGVGADAFD I ________________________________________ SEQ ID NO: 76 AKDASSSWPP YYMDV ________________________________________ SEQ ID NO: 77 AKVDIVDNWF DP ________________________________________ SEQ ID NO: 78 APADFDY ________________________________________ SEQ ID NO: 79 TRLSITMVRG APLYYYYYMD V ________________________________________ SEQ ID NO: 80 AAAAGTDAFD I ________________________________________ SEQ ID NO: 81 AKGRYSSSWY FDY ________________________________________ SEQ ID NO: 82 AKRLTGTYDA FDI ________________________________________ SEQ ID NO: 83 AKDQDWNFPL TT ________________________________________ SEQ ID NO: 84 TLLRCPLFDY ________________________________________ SEQ ID NO: 85 DIVATIPGAF DI ________________________________________ SEQ ID NO: 86 AKGAGDLFFD Y ________________________________________ SEQ ID NO: 87 AKVEWELLDW FDP ________________________________________ SEQ ID NO: 88 APVTGFDY ________________________________________ SEQ ID NO: 89Attorney Docket No: 243735.000429 ATEKTIFGVV IIQLTTTTTT WTS ________________________________________ SEQ ID NO: 90 ATPSIAARPT TTTTWTS ________________________________________ SEQ ID NO: 91 ATEEGYYYGS GSYGRLLLHG R ________________________________________ SEQ ID NO: 92 STWYGL ________________________________________ SEQ ID NO: 93 ATDIVILPAA MRTGSTP ________________________________________ SEQ ID NO: 94 ATNIWYRLLE DCGH ________________________________________ SEQ ID NO: 95 ATETRGVINY YYYMDV ________________________________________ SEQ ID NO: 96 ATYCSSTSCY WYFDL ________________________________________ SEQ ID NO: 97 ATHIGIAAAG TFDY ________________________________________ SEQ ID NO: 98 TRQLPFDY ________________________________________ SEQ ID NO: 99 TCIAARPDDA FDI ________________________________________ SEQ ID NO: 100 AKVMEWELPF DY ________________________________________ SEQ ID NO: 101 ASIAAAALTT LTT ________________________________________ SEQ ID NO: 102 ANITGTNWGS DY ________________________________________ SEQ ID NO: 103 TRQCITGTKG YFDY ________________________________________ SEQ ID NO: 104 AKVDYGDYLD WFDPAttorney Docket No: 243735.000429 ________________________________________ SEQ ID NO: 105 ANLAYSSSDF DY ________________________________________ SEQ ID NO: 106 AKLEGDY ________________________________________ SEQ ID NO: 107 AKDSGSY ________________________________________ SEQ ID NO: 108 AKDLTGTTDY ________________________________________ SEQ ID NO: 109 AKRTGDAFDI ________________________________________ SEQ ID NO: 110 AKDLRLGKGP DY ________________________________________ SEQ ID NO: 111 AKRTGTTLYY YYYMDV ________________________________________ SEQ ID NO: 112 AKDQDWNFPL TT ________________________________________ SEQ ID NO: 113 AKVMEWELPF DY ________________________________________ SEQ ID NO: 114 AKGITGTTDY ________________________________________ SEQ ID NO: 115 AKGEDWNLDY ________________________________________ SEQ ID NO: 116 AAAAGTDAFD I ________________________________________ SEQ ID NO: 117 AKDYYGSGSY YNVTGSTP ________________________________________ SEQ ID NO: 118 gtcttttgag taccgttgtc tgg ________________________________________ SEQ ID NO: 119 ccagcaggtc ggctggacta act ________________________________________Attorney Docket No: 243735.000429 SEQ ID NO: 120 atcggtgaga gggtaactaa ggg ________________________________________ SEQ ID NO: 121 acctgtcaat gatcatatcc agg * * *

[0312] The present invention is not to be limited in scope by the specific embodiments describedherein. Indeed, various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description. Such modifications are intended to fall within the scope of the appended claims.

[0313] All patents, applications, publications, test methods, literature, and other materials citedherein are hereby incorporated by reference in their entirety as if physically present in this specification.

Claims

Attorney Docket No: 243735.000429 CLAIMS 1. A genetically modified non-human animal, wherein the genome of the genetically modified non-human animal comprises: a) a humanized or human major histocompatibility complex (MHC) allele, and b) a modified immunoglobulin heavy chain locus, wherein immunoglobulin (Ig) M, IgD, and their corresponding switch region are deleted or mutated so that IgM and IgD are not expressed and isotype switching is prevented, and wherein a CH1 exon of the immunoglobulin (Ig) constant region and its corresponding switch region are deleted or mutated so that gamma constant region 1 of heavy chain (CH1) exon is not expressed and isotype switching is prevented, wherein said genetically modified non-human animal is capable of producing heavy chain- only antibodies (HCAbs) or antigen-binding portions thereof comprising endogenous heavy chain variable regions and heavy chain constant regions.

2. The genetically modified non-human animal of claim 1, wherein the humanized or human MHC allele is MHC type I allele.

3. The genetically modified non-human animal of claim 2, wherein the human MHC I allele is HLA-A, HLA-B, HLA-C, HLA-E, HLA-F, or HLA-G.

4. The genetically modified non-human animal of claim 3, wherein the human MHC I allele is HLA-A*01:01, HLA-A*02:01, HLA-A2.1, HLA-A11, HLA-A24, HLA-B7, or HLA-B44.

5. The genetically modified non-human animal of claim 1, wherein the humanized or human MHC allele is MHC type II allele.

6. The genetically modified non-human animal of claim 5, wherein the human MHC II allele is HLA-DP, HLA-DM, HLA-DO, HLA-DQ, HLA-DR, HLA-DRB1, HLA-DQB1, or HLA-DPB1.

7. The genetically modified non-human animal of any one of claims 1-6, wherein the endogenous light chain of the non-human animal is not modified.Attorney Docket No: 243735.000429 8. The genetically modified non-human animal of any one of claims 1-6, wherein the endogenous IgKappa or IgLambda light chains are not modified.

9. The genetically modified non-human animal of any one of claims 1-8, wherein the modified immunoglobulin heavy chain locus further comprises: (i) at least one unrearranged camelid variable heavy domain of heavy chain (VHH) gene segment and / or at least one unrearranged cartilaginous fish variable new antigen receptor (V- NAR) gene segment and / or at least one unrearranged human heavy chain variable region (HCVR) gene segment; (ii) at least one human immunoglobulin heavy chain D gene segment; and (iii) at least one human immunoglobulin heavy chain J gene segment, wherein the gene segments (i), (ii), and (iii) are operably linked to a functional endogenous Ig heavy chain constant region gene sequence, wherein said genetically modified non-human animal is capable of producing heavy chain- only antibodies (HCAbs) comprising camelid VHH and / or cartilaginous fish V-NAR and / or human HCVR.

10. The genetically modified non-human animal of claim 9, wherein the gene segments (i), (ii), and (iii) are inserted into an endogenous immunoglobulin heavy chain locus of the animal, or replace at least one nucleotide of the endogenous immunoglobulin heavy chain locus of the animal, or replace at least one of an endogenous V, D, and J gene segments.

11. The genetically modified non-human animal of claim 9 or claim 10, wherein the gene segments (i), (ii), and (iii) are capable of rearranging to form a rearranged immunoglobulin heavy chain VDJ sequence.

12. The genetically modified non-human animal of any one of claims 9-11, wherein the modified immunoglobulin heavy chain gene locus further comprises a human Emu enhancer.Attorney Docket No: 243735.000429 13. The genetically modified non-human animal of claim 12, wherein the human Emu enhancer is located upstream of the Ig constant region.

14. The genetically modified non-human animal of any one of claims 9-13, wherein the modified immunoglobulin heavy chain gene locus further comprises at least one human immunoglobulin heavy chain variable region (IGHV) promoter.

15. The genetically modified non-human animal of any one of claims 9-14, wherein the genetically modified non-human animal expresses messenger ribonucleic acid (mRNA) that encodes a protein that has at least 70% amino acid sequence identity to a VHH from alpaca, camel, llama, vicunas, or guanacos or has at least 70% amino acid sequence identity to a V-NAR from a cartilaginous fish or has at least 70% amino acid sequence identity to a human HCVR.

16. The genetically modified non-human animal of any one of claims 1-15, wherein the genetically modified non-human animal expresses at least one heavy chain-only antibody (HCAb).

17. The genetically modified non-human animal of any one of claims 1-16, wherein the genetically modified non-human animal is a rodent.

18. The genetically modified non-human animal of any one of claims 1-17, wherein the genetically modified non-human animal is a mouse.

19. The genetically modified non-human animal of any one of claims 1-18, wherein the immunoglobulin constant region is selected from IgG, IgM, IgD, IgA, IgE, and any combinations thereof.

20. The genetically modified non-human animal of claim 19, wherein the IgG is IgG1, IgG2, IgG3, IgG4, and any combinations thereof.

21. The genetically modified non-human animal of claim 19 or claim 20, wherein the IgG constant region is IgG3.Attorney Docket No: 243735.000429 22. A method of producing antigen-specific heavy chain-only antibodies (HCAbs) or antigen- binding portions thereof, the method comprising immunizing the genetically modified non-human animal of any one of claims 1-21 with an antigen, wherein the antigen is a peptide presented in complex with a MHC molecule, and wherein the MHC molecule corresponds to the humanized or human MHC allele present within the genetically modified non-human animal.

23. The method of claim 22, wherein the immunization with the peptide-MHC complex is administered as a prime-boost regimen.

24. The method of claim 23, wherein there is a 2-3 week interval between each immunization.

25. The method of any one of claims 22-24, wherein the peptide is covalently attached to the MHC molecule.

26. The method of any one of claims 22-24, wherein the peptide is non-covalently attached to the MHC molecule.

27. The method of any one of claims 22-26, wherein the peptide-MHC complex forms a tetramer.

28. The method of any one of claims 22-27, wherein the peptide is derived from a disease- associated antigen or is derived from a membrane protein, a transmembrane protein, an intracellular protein, a non-canonical protein, a glyco moiety, or a peptide-major histocompatibility complex (pMHC) protein, and splice variants thereof.

29. The method of claim 28, wherein the disease-associated antigen is a cancer antigen.

30. The method of claim 28, wherein the disease-associated antigen is a melanoma-associated antigen.Attorney Docket No: 243735.000429 31. The method of claim 28, wherein the disease-associated antigen is melanoma-associated antigen 3 (MAGEA3).

32. The method of any one of claims 22-31, further comprising isolating germinal center B cells and / or plasma cells from the animal and analyzing heavy chain-only antibodies (HCAbs) produced from the delta CH1 (ΔCH1) Ig locus.

33. The method of any one of claims 22-32, further comprising isolating germinal center B cells and / or plasma cells from the animal and analyzing heavy chain-only antibodies (HCAbs) produced from the ΔCH1IgG locus.

34. The method of claim 32 or claim 33, wherein the HCAbs are analyzed for antigen binding affinity and / or specificity.

35. The method of claim 34 wherein the antigen binding specificity of the HCAbs is assessed by assessing binding to unrelated antigens and / or by assessing binding to MHC molecules.

36. The method of claim 34, wherein the antigen binding affinity and / or specificity of the HCAbs is assessed using enzyme-linked immunosorbent assay (ELISA), enzyme-linked immunosorbent spot (ELISpot), kinetic exclusion assays, biolayer interferometry, specific protein interactions, surface plasmon resonance, or protein crystallography.

37. The method of any one of claims 32-36, further comprising cloning the selected HCAbs into chimeric antigen receptor (CAR) vectors to create a CAR library or into recombinant T cell receptor (TCR) vectors to create a TCR library.

38. The method of claim 37, wherein the CAR or TCR vectors are lentiviral or retroviral vectors.

39. The method of claim 37 or claim 38, further comprising screening the CAR or TCR library in a high-throughput manner.Attorney Docket No: 243735.000429 40. The method of claim 39, wherein the high-throughput screening comprises the use of CAR or TCR vectors to transduce mammalian host cells at a low multiplicity of infection to ensure single- copy integration.

41. The method of claim 39 or claim 40, wherein the high-throughput screening comprises screening for CAR or TCR binding to the peptide and cross-reactivity to the MHC molecule.

42. The method of any one of claims 37-41, further comprising the steps of: a) introducing the CAR or TCR library into mammalian host cells; b) culturing the CAR or TCR-expressing host cells of step (a) under conditions supporting expression of encoded CARs or TCRs; c) incubating the CAR or TCR-expressing host cells of step (a) with target and off-target antigen and MHC or with on- and off-target cells or tissues; d) selecting host cells exhibiting antigen-specific CAR or TCR binding and activation; e) optionally, identifying the sequence of CARs or TCRs within the host cells selected in step (d); and f) optionally, reformatting the identified sequence of CAR or TCR into a bispecific antibody or antigen-binding portion thereof.

43. The method of any one of claims 40-42, wherein the mammalian host cells are T cells, natural killer (NK) cells, natural killer T (NKT) cells, mucosal-associated invariant T cells (MAIT cells), B cells, dendritic cells (DCs), and / or macrophages.

44. A method of producing antigen-specific heavy chain-only antibodies (HCAbs) or antigen- binding portions thereof, the method comprising immunizing the genetically modified non-human animal of any one of claims 1-21 with an antigen, optionally wherein the antigen is encoded by mRNA encapsulated in a lipid nanoparticle (LNP).

45. The method of claim 44, wherein the antigen is a membrane protein, an intracellular protein, a non-canonical protein, a glyco moiety, or a peptide-major histocompatibility complex (pMHC) protein, and splice variants thereof.Attorney Docket No: 243735.000429 46. The method of claim 45, wherein the membrane protein is a transmembrane protein.

47. The method of any one of claims 44-46, wherein the antigen is a disease-associated antigen.

48. The method of claim 47, wherein the disease-associated antigen is a cancer antigen.

49. The method of claim 47, wherein the disease-associated antigen is a melanoma-associated antigen.

50. The method of claim 47, wherein the disease-associated antigen is MAGEA3.

51. The method of any one of claims 44-50, further comprising isolating germinal center B cells and / or plasma cells from the animal and analyzing heavy chain-only antibodies (HCAbs) produced from the ΔCH1Ig locus.

52. The method of any one of claims 44-51, further comprising isolating germinal center B cells and / or plasma cells from the animal and analyzing heavy chain-only antibodies (HCAbs) produced from the ΔCH1IgG locus.

53. The method of claim 51 or claim 52, wherein the HCAbs are analyzed for antigen binding affinity and / or specificity.

54. The method of claim 53, wherein the antigen binding specificity of the HCAbs is assessed by assessing binding to unrelated antigens and / or by assessing binding to MHC molecules.

55. The method of claim 53, wherein the antigen binding affinity and / or specificity of the HCAbs is assessed using ELISA, ELISpot, kinetic exclusion assays, biolayer interferometry, specific protein interactions, surface plasmon resonance, or protein crystallography.Attorney Docket No: 243735.000429 56. The method of any one of claims 51-55, further comprising cloning the selected HCAbs into chimeric antigen receptor (CAR) vectors to create a CAR library or into recombinant T cell receptor (TCR) vectors to create a TCR library.

57. The method of claim 56, wherein the CAR or TCR vectors are lentiviral or retroviral vectors.

58. The method of claim 56 or claim 57, further comprising screening the CAR or TCR library in a high-throughput manner.

59. The method of claim 58, wherein the high-throughput screening comprises the use of CAR or TCR vectors to transduce mammalian host cells at a low multiplicity of infection to ensure single- copy integration.

60. The method of claim 58 or claim 59, wherein the high-throughput screening comprises screening for CAR or TCR binding to the peptide and cross-reactivity to the MHC molecule.

61. The method of any one of claims 56-60, further comprising the steps of: a) introducing the CAR or TCR library into mammalian host cells; b) culturing the CAR- or TCR-expressing host cells of step (a) under conditions supporting expression of encoded CARs or TCRs; c) incubating the CAR- or TCR-expressing host cells of step (a) with target and off-target antigen and MHC or with on- and off-target cells or tissues; d) selecting host cells exhibiting antigen-specific CAR or TCR binding and activation; e) optionally, identifying the sequence of CARs or TCRs within the host cells selected in step (d); and f) optionally, reformatting the identified sequence of CAR or TCR into a bispecific antibody or antigen-binding portion thereof.

62. The method of claim 42 or claim 61, wherein the bispecific antibody or antigen-binding portion thereof is a Bi-specific engager.Attorney Docket No: 243735.000429 63. The method of claim 42 or claim 61, wherein the bispecific antibody or antigen-binding portion thereof is a Bi-specific T cell engager (BiTE) or a Bi-specific killing cell engager (BiKE).

64. The method of any one of claims 59-63, wherein the mammalian host cells are T cells, NK cells, NKT cells, MAIT cells, B cells, dendritic cells (DCs), and / or macrophages.

65. A biologic molecule produced by the method of any one of claims 22-64.

66. The biologic molecule of claim 65 is selected from an antibody or antigen-binding portion thereof, an antibody-drug conjugate, a gene therapy, a cell, a fusion protein, an immunocytokine, or any combinations thereof.

67. The biologic molecule of claim 66, wherein the antibody or antigen-binding portion thereof is selected from a heavy chain-only antibody or antigen-binding portion thereof, a heavy chain variable domain, a variable domain of heavy chain of heavy chain-only antibody (VHH), a nanobody, a camelid antibody or antigen-binding portion thereof, or an immunoglobulin novel antigen receptor (IgNAR) antibody or antigen-binding portion thereof.

68. The biologic molecule of claim 67, wherein the heavy chain-only antibody or antigen-binding portion thereof is a single-domain antibody.

69. The biologic molecule of any one of claims 65-68, wherein the biologic molecule is a murine, a chimeric, a human, a humanized, a camelid, or an immunoglobulin novel antigen receptor (IgNAR) antibody or antigen-binding portion thereof.

70. The biologic molecule of any one of claims 65-69, wherein the biologic molecule is monospecific, bispecific, or multi-specific.

71. The biologic molecule of any one of claims 65-70, wherein the biologic molecule is a bispecific antibody or antigen-binding portion thereof or a bi-epitopic antibody or antigen-binding portion thereof.Attorney Docket No: 243735.000429 72. The biologic molecule of claim 71, wherein the bispecific antibody or antigen-binding portion thereof is a Bi-specific engager.

73. The biologic molecule of claim 71, wherein the bispecific antibody or antigen-binding portion thereof is a Bi-specific T cell engager (BiTE) or a Bi-specific killing cell engager (BiKE).

74. The biologic molecule of any one of claims 71-73, wherein the bispecific antibody or antigen- binding portion thereof is a Bi-specific T cell engager (BiTE).

75. The biologic molecule of any one of claims 65-74, wherein the biologic molecule can bind or interact with an antigen.

76. The biologic molecule of claim 75, wherein the antigen is a membrane protein, an intracellular protein, a non-canonical protein, a glyco moiety, or a peptide-major histocompatibility complex (pMHC) protein, and splice variants thereof.

77. The biologic molecule of claim 76, wherein the membrane protein is a transmembrane protein.

78. The biologic molecule of any one of claims 75-77, wherein the antigen is a disease-associated antigen.

79. The biologic molecule of claim 7678 wherein the disease-associated antigen is a cancer antigen.

80. The biologic molecule of claim 78, wherein the disease-associated antigen is a melanoma- associated antigen.

81. The biologic molecule of claim 78, wherein the disease-associated antigen is MAGEA3.Attorney Docket No: 243735.000429 82. The biologic molecule of any one of claims 70-74, wherein the bispecific antibody or antigen- binding portion thereof binds to a cancer-associated antigen and an antigen present on immune cell.

83. The biologic molecule of claim 82, wherein the immune cell is a T cell, an NK cell, an NKT cell, a MAIT cell, a B cell, a dendritic cell (DC), and / or a macrophage.

Citation Information

Patent Citations

  • Genetically modified non-human animals for generating therapeutic antibodies against peptide-MHC complexes, methods of making and uses thereof

    US20190292263A1

  • Modified mice that produce heavy chain only antibodies

    US20230062964A1

  • Transgenic animals expressing heavy chain antibodies

    US20230270086A1

  • Genetically modified non-human animals and methods for producing heavy-chain antibodies

    WO2024056044A1