High-risk HPV detection and genotyping using lamp
A LAMP-based HPV detection kit with specific primer sets addresses the need for affordable and sensitive point-of-care testing by enabling rapid and accurate HPV genotyping in resource-limited settings, using microfluidic cartridges for isothermal amplification.
Patent Information
- Application Number
- PCT/US2025/030877
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-05-24
- Filing Date
- 2025-05-23
- Publication Date
- 2025-11-27
AI Technical Summary
Current HPV screening methods are expensive and require sophisticated laboratory setups, making them unsuitable for resource-limited settings, and there is a need for affordable, analytically precise, and sensitive point-of-care testing.
Development of a kit containing HPV primer sets for Loop-mediated Isothermal Amplification (LAMP) that can detect high-risk HPV genotypes, including HPV16, HPV18, HPV31, HPV33, HPV35, HPV39, HPV45, HPV52, HPV58, HPV59, and HPV68, which can be used in a microfluidic cartridge with lyophilized reagents for isothermal amplification and detection.
The LAMP-based HPV detection method provides rapid, sensitive, and specific results, suitable for point-of-care testing, reducing the need for expensive laboratory equipment and enabling accurate HPV genotyping in resource-limited settings.
Smart Images

Figure US2025030877_27112025_PF_FP_ABST
Abstract
Description
HIGH-RISK HPV DETECTION AND GENOTYPING USING LAMP CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of and priority to U.S. Provisional Application No. 63 / 651,778 filed on May 24, 2024, the content of which is incorporated by reference in its entirety. STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH
[0002] This invention was made with government support under CA211415 awarded by the National Institutes of Health. The government has certain rights in the invention. BACKGROUND
[0003] The World Health Organization (WHO) recommends primary HPV screening in all resource settings, but it is expensive and requires sophisticated laboratory set-up. Affordable, analytically precise and sensitive point-of-care (POC) testing is of interest. SUMMARY
[0004] In a first aspect, provided herein is a kit comprising at least one HPV primer set selected from: (a) a forward primer comprising SEQ ID NO: 1 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 2 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 3 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 4 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 5 or a sequence having at least 95% identity thereto; (b) a forward primer comprising SEQ ID NO: 6 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 7 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 8 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 9 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 10 or a sequence having at least 95% identity thereto; (c) a forward primer comprising SEQ ID NO: 11 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 12 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 13 or a sequence having at least 95% identity thereto; a backward internalprimer comprising SEQ ID NO: 14 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 15 or a sequence having at least 95% identity thereto; (d) a forward primer comprising SEQ ID NO: 16 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 17 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 18 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 19 or a sequence having at least 95% identity thereto; and a loop forward primer comprising SEQ ID NO: 20 or a sequence having at least 95% identity thereto; (e) a forward primer comprising SEQ ID NO: 21 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 22 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 23 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 24 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 25 or a sequence having at least 95% identity thereto; (f) a forward primer comprising SEQ ID NO: 26 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 27 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 28 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 29 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 30 or a sequence having at least 95% identity thereto; (g) a forward primer comprising SEQ ID NO: 31 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 32 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 33 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 34 or a sequence having at least 95% identity thereto; and a loop forward primer comprising SEQ ID NO: 35 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 36 or a sequence having at least 95% identity thereto; (h) a forward primer comprising SEQ ID NO: 37 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 38 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 39 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 40 or a sequence having at least 95% identity thereto; and a loop forward primer comprising SEQ ID NO: 41 or a sequence having at least 95% identity thereto; (i) a forward primer comprising SEQ ID NO: 42 or a sequence having at least 95% identity thereto; a reverse primer comprisingSEQ ID NO: 43 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 44 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 45 or a sequence having at least 95% identity thereto; a loop forward primer comprising SEQ ID NO: 46 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 47 or a sequence having at least 95% identity thereto; (j) a forward primer comprising SEQ ID NO: 48 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 49 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 50 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 51 or a sequence having at least 95% identity thereto; a loop forward primer comprising SEQ ID NO: 52 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 53 or a sequence having at least 95% identity thereto; (k) a forward primer comprising SEQ ID NO: 54 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 55 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 56 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 57 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 58 or a sequence having at least 95% identity thereto; (l) a forward primer comprising SEQ ID NO: 59 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 60 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 61 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 62 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 63 or a sequence having at least 95% identity thereto; (m) a forward primer comprising SEQ ID NO: 64 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 65 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 66 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 67 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 68 or a sequence having at least 95% identity thereto; (n) a forward primer comprising SEQ ID NO: 69 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 70 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 71 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQID NO: 72 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 73 or a sequence having at least 95% identity thereto; (o) a forward primer comprising SEQ ID NO: 74 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 75 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 76 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 77 or a sequence having at least 95% identity thereto; and a loop forward primer comprising SEQ ID NO: 78 or a sequence having at least 95% identity thereto; (p) a forward primer comprising SEQ ID NO: 79 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 80 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 81 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 82 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 83 or a sequence having at least 95% identity thereto; (q) a forward primer comprising SEQ ID NO: 84 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 85 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 86 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 87 or a sequence having at least 95% identity thereto; and a loop forward primer comprising SEQ ID NO: 88 or a sequence having at least 95% identity thereto; (r) a forward primer comprising SEQ ID NO: 89 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 90 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 91 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 92 or a sequence having at least 95% identity thereto; and a loop forward primer comprising SEQ ID NO: 93 or a sequence having at least 95% identity thereto; and (s) a forward primer comprising SEQ ID NO: 94 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 95 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 96 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 97 or a sequence having at least 95% identity thereto; and a loop forward primer comprising SEQ ID NO: 98 or a sequence having at least 95% identity thereto.
[0005] In embodiments, the kit comprises at least eight of the HPV primer sets. In embodiments, the kit comprises all of the HPV primer sets. The kit may comprise the HPV primer sets of at least one of: f), l), and m); and at least one of: g), and n).
[0006] The kit may further comprise an ACTB primer set, the primer set comprising: a forward primer comprising SEQ ID NO: 99 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 100 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 101 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 102 or a sequence having at least 95% identity thereto; a loop forward primer comprising SEQ ID NO: 103 or a sequence having at least 95% identity thereto; and a loop forward primer comprising SEQ ID NO: 104 or a sequence having at least 95% identity thereto.
[0007] The at least one HPV primer set and the ACTB primer set may be lyophilized. Each of the at least one HPV primer set and the ACTB primer set may be in a separate well of a microfluidic cartridge. Each of the at least one HPV primer set and the ACTB primer set may be in the same well of a microfluidic cartridge. The kit may further comprise reagents necessary to perform a LAMP assay.
[0008] In another aspect, provided herein is a method for detecting high-risk HPV in a sample, the method comprising: (i) contacting a first aliquot of the sample with at least one HPV primer set selected from: (a) a forward primer comprising SEQ ID NO: 1 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 2 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 3 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 4 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 5 or a sequence having at least 95% identity thereto; (b) a forward primer comprising SEQ ID NO: 6 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 7 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 8 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 9 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 10 or a sequence having at least 95% identity thereto; (c) a forward primer comprising SEQ ID NO: 11 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 12 or a sequence having at least 95% identity thereto; a forward internal primercomprising SEQ ID NO: 13 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 14 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 15 or a sequence having at least 95% identity thereto; (d) a forward primer comprising SEQ ID NO: 16 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 17 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 18 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 19 or a sequence having at least 95% identity thereto; and a loop forward primer comprising SEQ ID NO: 20 or a sequence having at least 95% identity thereto; (e) a forward primer comprising SEQ ID NO: 21 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 22 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 23 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 24 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 25 or a sequence having at least 95% identity thereto; (f) a forward primer comprising SEQ ID NO: 26 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 27 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 28 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 29 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 30 or a sequence having at least 95% identity thereto; (g) a forward primer comprising SEQ ID NO: 31 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 32 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 33 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 34 or a sequence having at least 95% identity thereto; a loop forward primer comprising SEQ ID NO: 35 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 36 or a sequence having at least 95% identity thereto; (h) a forward primer comprising SEQ ID NO: 37 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 38 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 39 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 40 or a sequence having at least 95% identity thereto; and a loop forward primer comprising SEQ ID NO: 41 or a sequence having at least 95% identity thereto; (i) a forward primer comprising SEQ IDNO: 42 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 43 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 44 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 45 or a sequence having at least 95% identity thereto; a loop forward primer comprising SEQ ID NO: 46 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 47 or a sequence having at least 95% identity thereto; (j) a forward primer comprising SEQ ID NO: 48 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 49 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 50 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 51 or a sequence having at least 95% identity thereto; a loop forward primer comprising SEQ ID NO: 52 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 53 or a sequence having at least 95% identity thereto; (k) a forward primer comprising SEQ ID NO: 54 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 55 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 56 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 57 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 58 or a sequence having at least 95% identity thereto; (l) a forward primer comprising SEQ ID NO: 59 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 60 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 61 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 62 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 63 or a sequence having at least 95% identity thereto; (m) a forward primer comprising SEQ ID NO: 64 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 65 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 66 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 67 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 68 or a sequence having at least 95% identity thereto; (n) a forward primer comprising SEQ ID NO: 69 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 70 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 71 or asequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 72 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 73 or a sequence having at least 95% identity thereto; (o) a forward primer comprising SEQ ID NO: 74 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 75 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 76 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 77 or a sequence having at least 95% identity thereto; and a loop forward primer comprising SEQ ID NO: 78 or a sequence having at least 95% identity thereto; (p) a forward primer comprising SEQ ID NO: 79 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 80 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 81 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 82 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 83 or a sequence having at least 95% identity thereto; (q) a forward primer comprising SEQ ID NO: 84 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 85 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 86 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 87 or a sequence having at least 95% identity thereto; and a loop forward primer comprising SEQ ID NO: 88 or a sequence having at least 95% identity thereto; (r) a forward primer comprising SEQ ID NO: 89 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 90 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 91 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 92 or a sequence having at least 95% identity thereto; and a loop forward primer comprising SEQ ID NO: 93 or a sequence having at least 95% identity thereto; and (s) a forward primer comprising SEQ ID NO: 94 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 95 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 96 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 97 or a sequence having at least 95% identity thereto; and a loop forward primer comprising SEQ ID NO: 98 or a sequence having at least 95% identity thereto; and (ii) contacting a second aliquot of the sample with a control primer set; and (iii) performing a LAMP assay to generate amplicons.
[0009] In embodiments, the method comprises contacting the first aliquot of the sample with at least eight of the HPV primer sets. In embodiments, the method comprises contacting the first aliquot of the sample with all of the HPV primer sets. In embodiments, the method comprises contacting the first aliquot of the sample with the HPV primer sets of at least one of: f), l), and m); and at least one of: g), and n).
[0010] The control primer set may comprise: a forward primer comprising SEQ ID NO: 99 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 100 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 101 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 102 or a sequence having at least 95% identity thereto; a loop forward primer comprising SEQ ID NO: 103 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 104 or a sequence having at least 95% identity thereto.
[0011] The method may further comprise: (iv) sequencing the amplicons. Step (iv) may be done using MinION sequencing.
[0012] The sample may be obtained from a cervical swab.
[0013] Each of the forward primers and each of the reverse primers may be at a concentration of between about 0.1 and about 0.4 μM. Each of the forward internal primers and each of the backward internal primers may be at a concentration of between about 1.2 and about 1.8 μM. Each of the loop forward primers and the loop backward primers may be at a concentration of between about 0.2 and about 0.6 μM. BRIEF DESCRIPTION OF THE DRAWINGS
[0014] Non-limiting embodiments of the present invention will be described by way of example with reference to the accompanying figures, which are schematic and are not intended to be drawn to scale. In the figures, each identical or nearly identical component illustrated is typically represented by a single numeral. For purposes of clarity, not every component is labeled in every figure, nor is every component of each embodiment of the invention shown where illustration is not necessary to allow those of ordinary skill in the art to understand the invention.
[0015] FIGS.1A-1B. (A) Illustrates a specificity matrix for HPV16E6, HPV18E6, and nine other HR-HPV L1 primers (31, 33, 35, 39, 45, 52, 56, 58, 59) tested against 16 different HPV genotypes (n = 3 replicates each). “+” indicates detected amplification, and “–” indicates no detectablefluorescence above background. (B) Illustrates time to detection for the pooled LAMP set targeting the nine HR-HPV L1 genotypes in 25 μL reactions (n = 3, plus no‐template controls). Error bars show mean ± 1 s.d. for positive replicates over 60 min. ND, not detected within 60 min.
[0016] FIG. 2. Illustrates sensitivity and specificity of HPV LAMP assays. Specificity of the HPV16E6, HPV18E6, and HPV35&52L1 primer sets against 18 HPV types. The specificity testing was done in triplicates for each HPV type and amplified for 60 mins. Amplified = “+” and Not Amplified = “-”.
[0017] FIG. 3. Illustrates detection of HPV16 from cervical brush samples in India. (Top) Box plots showing time to detection (mins) for 4-HPV16, and 2-HPV-negative samples tested by custom LAMP assays and detected by lab-based fluorescence qPCR reader. (Middle) HPV16 negative, and (Bottom) HPV16 positive entirely POC on-chip purification, amplification, and detection of HPV16 from cervical brush samples, with lyophilized enzymes and LAMP components.
[0018] FIGS. 4A-4C. Illustrate time to detection (TTD) as a function of input copy number for HPV16E6 (A) and HPV18E6 (B) targets in 25 μL reactions (n = 3 replicates per dilution series and n=9 for ‘0’ copy or NTC, no template control) ). Each reaction was run at 65 °C for 60 min. ND indicates no amplification detected. Shaded regions represent the mean ± 1 s.d. for successful amplifications. Mean and standard deviation (s.d) were calculated only for the replicates that were amplified. (C) Heatmap summarizing the percentage of positive replicates for each copy number (white = 0% to dark grey = 100%).
[0019] FIGS. 5A-5C. Illustrate a biofluid preparation and custom extraction method. (A) Schematic of the simplified custom extraction workflow combining guanidine hydrochloride, proteinase K, and ethanol for nucleic acid recovery. (B) Extraction efficiency of HPV16 from SiHa cells between no lysis (direct input of 10K cells in LAMP reaction), proteinase K treatment, Qiagen DNeasy kit extraction, and rapid extraction method by spiking in 10K SiHa cells (P=7) in 200 μL Digene’s sample transport media (STM). Not statistically significant difference between commercial (Qiagen) and custom extraction methods (p=0.013). (Top) The extracts were detected using Taqman qPCR assay specific to the HPV16E6 target. The bottom table shows the meantime (n=3) to detection using LAMP amplification of HPV16E6 for different extraction methods. (C) (Top) Determination of limit of detection for extraction of HPV16 in STM by serial dilution of ATCC HPV16 genome in 200 μL STM (replicates: n=3). (Bottom). Determination of limit ofdetection for extraction of HPV16 in saliva by serial dilution of ATCC HPV16 genome in 200 μL HPV negative saliva (replicates: n=3). Mean was not calculated if all the replicates weren’t detected. All samples were amplified for 60 mins. ND = not detected during amplification. All salivary samples tested positive for the ß-Actin gene (positive control).
[0020] FIGS.6A-6D. Illustrates detection of high-risk HPV (HR-HPV) in cervical brush samples. (A) Laboratory LAMP workflow: DNA extracted from 31 cervical brush samples in India was added to LAMP reactions and run on a qPCR machine at 65 °C for 60 min. (B) Box plots of time to detection for β‐actin, HPV16, HPV18, and other HR‐HPV from these samples. (C) Schematic of the on‐device testing workflow for cervical specimens in specimen transport medium (STM), including heat treatment, on‐cartridge extraction, and amplification in the point‐of‐care (POC) reader. (D) Concordance between SPRINT‐HPV and Cobas®testing for HPV16, HPV18, and nine other HR‐HPV types. A “positive agreement” entry indicates both tests detected the same HR‐ HPV genotypes.
[0021] FIGS. 7A-7H. Illustrate on‐device limit of detection (LOD) and salivary sample validation. (A) Time to detection (TTD) for β‐actin, HPV16, HPV18, and other HR‐HPV targets using lyophilized LAMP reagents on the point‐of‐care (POC) system with spiked SiHa / HeLa cells (5,000–5 copies) in specimen transport medium (STM). Error bars represent mean ± 1 s.d. (n = 3). Left to right: β-actin, HPV16, HPV18, Other HR-HPV. (B) Heatmap summarizing the number of positive replicates detected in STM and saliva (white = 0%, dark grey = 100%). (C,D) Representative real‐time amplification plots from the POC system, demonstrating background (C) vs. HPV16‐positive (D) signals over a 45–60 min run. (E) Workflow for saliva collection and on‐ cartridge SPRINT‐HPV testing, including heat treatment, on‐chip extraction, isothermal amplification, and real‐time POC readout. (F) Box plots of TTD for salivary samples (n = 25), showing β‐actin, HPV16, HPV18, and other HR‐HPV amplification. (G) SPRINT‐HPV results vs. reference qPCR viral load, illustrating the approximate LOD (dotted line). Each symbol represents a salivary sample tested by both methods. (H) Concordance between SPRINT‐HPV and qPCR for the same salivary cohort, with HPV16 detection at various Cq ranges (20–35 and >35), plus negatives. Overall, the system showed 75% sensitivity and 100% specificity.
[0022] Those of ordinary skill in the art will understand that the compositions and methods specifically described herein and illustrated in the accompanying drawings are non-limiting exemplary embodiments and that the scope of the various embodiments of the present disclosureis defined solely by the claims. The features illustrated or described in connection with one exemplary embodiment may be combined with the features of other embodiments. Such modifications and variations are intended to be included within the scope of the present disclosure. DETAILED DESCRIPTION
[0023] In accordance with some embodiments of the disclosed subject matter, mechanisms (which can include, for example, compositions, systems, methods, and kits) for detecting HPV are provided. Before any embodiments of the disclosure are explained in detail, it is to be understood that the disclosure is not limited in its application to the details of construction and the arrangement of components set forth in the following description or illustrated in the following drawings. The disclosure is capable of other embodiments and of being practiced or of being carried out in various ways.
[0024] Provided herein are novel components including, but not limited to: (1) Loop-mediated isothermal amplification (LAMP) primer sets for amplification of genetic material (E6 / E7, L1) from high-risk (HR) HPV 16, 18, 31, 33, 35, 39, 45, 52, 58, 59 and 68 genotypes. (2) The primer sets can be pooled to detect multiple genotypes in single LAMP reaction or can be used alone to genotype the HPV due to their specificity. (3) The LAMP amplicons from the pooled primer set reaction can be used to type the HPV using MiNION sequencing.
[0025] Loop-mediated Amplification (LAMP) is an isothermal PCR alternative used for detecting pathogen sequences in crude sample types. LAMP can amplify and detect a DNA / RNA target using the Bst polymersae and 4-6 primers working in conjunction at a fixed temperature (i.e., 65°C) unlike traditional PCR which requires costly thermal cyclers, lasers and photomultiplier tubes. Thus, LAMP is ideal for equipment-free and fast detection of pathogens especially in point of care settings. Typically, a LAMP reaction takes about 20 minutes to about one hour and is performed at a set temperature between 60-85 °C to optimize template melting and primer annealing. Typically, a LAMP reaction comprises (1) a thermostable strand displacing polymerase, (2) a sample comprising nucleic acid (e.g. a RNA or DNA nucleic acid template), (3) at least four or more sequence specific primers, (4) nucleotide triphosphates, (5) a divalent metal ion (e.g. Mg+2), and (6) a buffer. Some LAMP reactions further comprise a detectable agent, such as, a dye.
[0026] As used herein, the term "human papillomavirus" or "HPV" refers to a DNA virus from the Papillomaviridae family. Over 170 types have been described. High-risk HPV (HR-HPV) types are strains of the virus that can cause cervical, vaginal, vulvar, anal, and throat cancers. HPV16 and HPV18 are the most common high-risk types, accounting for 70% of cases. HPV16 is responsible for almost 90% of HPV-positive oropharyngeal cancers. In addition to HPV 16 and 18, other high-risk types include 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 68, 73, and 82.
[0027] In a first aspect, a kit is provided herein, the kit comprising at least one HPV primer set selected from (a) – (s) listed below, and as specified in Table 1.
[0028] Primer sets (f) , (l), and (m) detect HPV18. Primer set (f) comprises a forward primer comprising or consisting of SEQ ID NO: 26 or a sequence having at least 95% identity thereto; a reverse primer comprising or consisting of SEQ ID NO: 27 or a sequence having at least 95% identity thereto; a forward internal primer comprising or consisting of SEQ ID NO: 28 or a sequence having at least 95% identity thereto; a backward internal primer comprising or consisting of SEQ ID NO: 29 or a sequence having at least 95% identity thereto; and a loop backward primer comprising or consisting of SEQ ID NO: 30 or a sequence having at least 95% identity thereto. Primer set (l) comprises a forward primer comprising or consisting of SEQ ID NO: 59 or a sequence having at least 95% identity thereto; a reverse primer comprising or consisting of SEQ ID NO: 60 or a sequence having at least 95% identity thereto; a forward internal primer comprising or consisting of SEQ ID NO: 61 or a sequence having at least 95% identity thereto; a backward internal primer comprising or consisting of SEQ ID NO: 62 or a sequence having at least 95% identity thereto; and a loop backward primer comprising or consisting of SEQ ID NO: 63 or a sequence having at least 95% identity thereto. Primer set (m) comprises a forward primer comprising or consisting of SEQ ID NO: 64 or a sequence having at least 95% identity thereto; a reverse primer comprising or consisting of SEQ ID NO: 65 or a sequence having at least 95% identity thereto; a forward internal primer comprising or consisting of SEQ ID NO: 66 or a sequence having at least 95% identity thereto; a backward internal primer comprising or consisting of SEQ ID NO: 67 or a sequence having at least 95% identity thereto; and a loop backward primer comprising or consisting of SEQ ID NO: 68 or a sequence having at least 95% identity thereto.
[0029] Primer sets (g) and (n) detect HPV16. Primer set (g) comprises a forward primer comprising or consisting of SEQ ID NO: 31 or a sequence having at least 95% identity thereto; a reverse primer comprising or consisting of SEQ ID NO: 32 or a sequence having at least 95%identity thereto; a forward internal primer comprising or consisting of SEQ ID NO: 33 or a sequence having at least 95% identity thereto; a backward internal primer comprising or consisting of SEQ ID NO: 34 or a sequence having at least 95% identity thereto; and a loop forward primer comprising or consisting of SEQ ID NO: 35 or a sequence having at least 95% identity thereto; and a loop backward primer comprising or consisting of SEQ ID NO: 36 or a sequence having at least 95% identity thereto. Primer set (n) comprises a forward primer comprising or consisting of SEQ ID NO: 69 or a sequence having at least 95% identity thereto; a reverse primer comprising or consisting of SEQ ID NO: 70 or a sequence having at least 95% identity thereto; a forward internal primer comprising or consisting of SEQ ID NO: 71 or a sequence having at least 95% identity thereto; a backward internal primer comprising or consisting of SEQ ID NO: 72 or a sequence having at least 95% identity thereto; and a loop backward primer comprising or consisting of SEQ ID NO: 73 or a sequence having at least 95% identity thereto.
[0030] Primer sets (a) and (p) detect HPV45. Primer set (a) comprises a forward primer comprising or consisting of SEQ ID NO: 1 or a sequence having at least 95% identity thereto; a reverse primer comprising or consisting of SEQ ID NO: 2 or a sequence having at least 95% identity thereto; a forward internal primer comprising or consisting of SEQ ID NO: 3 or a sequence having at least 95% identity thereto; a backward internal primer comprising or consisting of SEQ ID NO: 4 or a sequence having at least 95% identity thereto; and a loop backward primer comprising or consisting of SEQ ID NO: 5 or a sequence having at least 95% identity thereto). Primer set (p) comprises a forward primer comprising or consisting of SEQ ID NO: 79 or a sequence having at least 95% identity thereto; a reverse primer comprising or consisting of SEQ ID NO: 80 or a sequence having at least 95% identity thereto; a forward internal primer comprising or consisting of SEQ ID NO: 81 or a sequence having at least 95% identity thereto; a backward internal primer comprising or consisting of SEQ ID NO: 82 or a sequence having at least 95% identity thereto; and a loop backward primer comprising or consisting of SEQ ID NO: 83 or a sequence having at least 95% identity thereto.
[0031] Primer sets (b) and (o) detect HPV33. Primer set (b) comprises a forward primer comprising or consisting of SEQ ID NO: 6 or a sequence having at least 95% identity thereto; a reverse primer comprising or consisting of SEQ ID NO: 7 or a sequence having at least 95% identity thereto; a forward internal primer comprising or consisting of SEQ ID NO: 8 or a sequence having at least 95% identity thereto; a backward internal primer comprising or consisting of SEQID NO: 9 or a sequence having at least 95% identity thereto; and a loop backward primer comprising or consisting of SEQ ID NO: 10 or a sequence having at least 95% identity thereto). Primer set (o) comprises a forward primer comprising or consisting of SEQ ID NO: 74 or a sequence having at least 95% identity thereto; a reverse primer comprising or consisting of SEQ ID NO: 75 or a sequence having at least 95% identity thereto; a forward internal primer comprising or consisting of SEQ ID NO: 76 or a sequence having at least 95% identity thereto; a backward internal primer comprising or consisting of SEQ ID NO: 77 or a sequence having at least 95% identity thereto; and a loop forward primer comprising or consisting of SEQ ID NO: 78 or a sequence having at least 95% identity thereto.
[0032] Primer sets (c) and (q) detect HPV58. Primer set (c) comprises a forward primer comprising or consisting of SEQ ID NO: 11 or a sequence having at least 95% identity thereto; a reverse primer comprising or consisting of SEQ ID NO: 12 or a sequence having at least 95% identity thereto; a forward internal primer comprising or consisting of SEQ ID NO: 13 or a sequence having at least 95% identity thereto; a backward internal primer comprising or consisting of SEQ ID NO: 14 or a sequence having at least 95% identity thereto; and a loop backward primer comprising or consisting of SEQ ID NO: 15 or a sequence having at least 95% identity thereto. Primer set (q) comprises a forward primer comprising or consisting of SEQ ID NO: 84 or a sequence having at least 95% identity thereto; a reverse primer comprising or consisting of SEQ ID NO: 85 or a sequence having at least 95% identity thereto; a forward internal primer comprising or consisting of SEQ ID NO: 86 or a sequence having at least 95% identity thereto; a backward internal primer comprising or consisting of SEQ ID NO: 87 or a sequence having at least 95% identity thereto; and a loop forward primer comprising or consisting of SEQ ID NO: 88 or a sequence having at least 95% identity thereto.
[0033] Primer sets (d) and (r) detect HPV31. Primer set (d) comprises a forward primer comprising or consisting of SEQ ID NO: 16 or a sequence having at least 95% identity thereto; a reverse primer comprising or consisting of SEQ ID NO: 17 or a sequence having at least 95% identity thereto; a forward internal primer comprising or consisting of SEQ ID NO: 18 or a sequence having at least 95% identity thereto; a backward internal primer comprising or consisting of SEQ ID NO: 19 or a sequence having at least 95% identity thereto; and a loop forward primer comprising or consisting of SEQ ID NO: 20 or a sequence having at least 95% identity thereto. Primer set (r) comprises a forward primer comprising or consisting of SEQ ID NO: 89 or a sequence having atleast 95% identity thereto; a reverse primer comprising or consisting of SEQ ID NO: 90 or a sequence having at least 95% identity thereto; a forward internal primer comprising or consisting of SEQ ID NO: 91 or a sequence having at least 95% identity thereto; a backward internal primer comprising or consisting of SEQ ID NO: 92 or a sequence having at least 95% identity thereto; and a loop forward primer comprising or consisting of SEQ ID NO: 93 or a sequence having at least 95% identity thereto.
[0034] Primer sets (e) and (s) detect HPV52. Primer set (e) comprises a forward primer comprising or consisting of SEQ ID NO: 21 or a sequence having at least 95% identity thereto; a reverse primer comprising or consisting of SEQ ID NO: 22 or a sequence having at least 95% identity thereto; a forward internal primer comprising or consisting of SEQ ID NO: 23 or a sequence having at least 95% identity thereto; a backward internal primer comprising or consisting of SEQ ID NO: 24 or a sequence having at least 95% identity thereto; and a loop backward primer comprising or consisting of SEQ ID NO: 25 or a sequence having at least 95% identity thereto. Primer set (s) comprises a forward primer comprising or consisting of SEQ ID NO: 94 or a sequence having at least 95% identity thereto; a reverse primer comprising or consisting of SEQ ID NO: 95 or a sequence having at least 95% identity thereto; a forward internal primer comprising or consisting of SEQ ID NO: 96 or a sequence having at least 95% identity thereto; a backward internal primer comprising or consisting of SEQ ID NO: 97 or a sequence having at least 95% identity thereto; and a loop forward primer comprising or consisting of SEQ ID NO: 98 or a sequence having at least 95% identity thereto.
[0035] Primer set (h) detects HPV35 and comprises a forward primer comprising or consisting of SEQ ID NO: 37 or a sequence having at least 95% identity thereto; a reverse primer comprising or consisting of SEQ ID NO: 38 or a sequence having at least 95% identity thereto; a forward internal primer comprising or consisting of SEQ ID NO: 39 or a sequence having at least 95% identity thereto; a backward internal primer comprising or consisting of SEQ ID NO: 40 or a sequence having at least 95% identity thereto; and a loop forward primer comprising or consisting of SEQ ID NO: 41 or a sequence having at least 95% identity thereto.
[0036] Primer set (i) detects HPV39 and comprises a forward primer comprising or consisting of SEQ ID NO: 42 or a sequence having at least 95% identity thereto; a reverse primer comprising or consisting of SEQ ID NO: 43 or a sequence having at least 95% identity thereto; a forward internal primer comprising or consisting of SEQ ID NO: 44 or a sequence having at least 95%identity thereto; a backward internal primer comprising or consisting of SEQ ID NO: 45 or a sequence having at least 95% identity thereto; a loop forward primer comprising or consisting of SEQ ID NO: 46 or a sequence having at least 95% identity thereto; and a loop backward primer comprising or consisting of SEQ ID NO: 47 or a sequence having at least 95% identity thereto.
[0037] Primer set (j) detects HPV59 and comprises a forward primer comprising or consisting of SEQ ID NO: 48 or a sequence having at least 95% identity thereto; a reverse primer comprising or consisting of SEQ ID NO: 49 or a sequence having at least 95% identity thereto; a forward internal primer comprising or consisting of SEQ ID NO: 50 or a sequence having at least 95% identity thereto; a backward internal primer comprising or consisting of SEQ ID NO: 51 or a sequence having at least 95% identity thereto; a loop forward primer comprising or consisting of SEQ ID NO: 52 or a sequence having at least 95% identity thereto; and a loop backward primer comprising or consisting of SEQ ID NO: 53 or a sequence having at least 95% identity thereto.
[0038] Primer set (k) detects HPV68 and comprises a forward primer comprising or consisting of SEQ ID NO: 54 or a sequence having at least 95% identity thereto; a reverse primer comprising or consisting of SEQ ID NO: 55 or a sequence having at least 95% identity thereto; a forward internal primer comprising or consisting of SEQ ID NO: 56 or a sequence having at least 95% identity thereto; a backward internal primer comprising or consisting of SEQ ID NO: 57 or a sequence having at least 95% identity thereto; and a loop backward primer comprising or consisting of SEQ ID NO: 58 or a sequence having at least 95% identity thereto.
[0039] In embodiments, the kit comprises at least eight of the HPV primer sets. In other embodiments, the kit comprises all of the HPV primer sets (a)-(s).
[0040] The HPV primer sets may comprise at least one primer set of (f), (l), and (m), for detecting HPV18, and at least one primer set of (g) and (n), for detecting HPV16.
[0041] The kit may further comprise a control primer set. The control primer set may detect β- actin (ACTB). The ACTB primer set may comprise a forward primer comprising or consisting of SEQ ID NO: 99 or a sequence having at least 95% identity thereto; a reverse primer comprising or consisting of SEQ ID NO: 100 or a sequence having at least 95% identity thereto; a forward internal primer comprising or consisting of SEQ ID NO: 101 or a sequence having at least 95% identity thereto; a backward internal primer comprising or consisting of SEQ ID NO: 102 or a sequence having at least 95% identity thereto; a loop forward primer comprising or consisting ofSEQ ID NO: 103 or a sequence having at least 95% identity thereto; and a loop forward primer comprising or consisting of SEQ ID NO: 104 or a sequence having at least 95% identity thereto.
[0042] The kit may further comprise reagents necessary to perform a LAMP assay. The kit may also comprise an intercalating dye for tracking a LAMP reaction in real-time. Any of the primers, LAMP reagents, and intercalating dye may be lyophilized. In embodiments, each of the one or more primer sets is provided in a separate vessel. In other embodiments, each of the one or more primer sets is provided in the same vessel. The vessel may be a microfluidic cartridge or a tube.
[0043] As used herein, “primer” refers to a single-stranded nucleotide used to initiate replication of nucleic acids.
[0044] The terms “polynucleotide,” “polynucleotide sequence,” “nucleic acid,” and “nucleic acid sequence” refer to a nucleotide, oligonucleotide, polynucleotide (which terms may be used interchangeably), or any fragment thereof. A “polynucleotide” may refer to a polydeoxyribonucleotide (containing 2-deoxy-D-ribose), a polyribonucleotide (containing D- ribose), and to any other type of polynucleotide that is an N glycoside of a purine or pyrimidine base. There is no intended distinction in length between the terms “nucleic acid”, “oligonucleotide” and “polynucleotide”, and these terms will be used interchangeably. These terms refer only to the primary structure of the molecule. Thus, these terms include double- and single-stranded DNA, as well as double- and single-stranded RNA. For use in the present methods, an oligonucleotide also can comprise nucleotide analogs in which the base, sugar, or phosphate backbone is modified as well as non-purine or non-pyrimidine nucleotide analogs. These phrases also refer to DNA or RNA of genomic, natural, or synthetic origin (which may be single-stranded or double-stranded and may represent the sense or the antisense strand). As used herein, “subject” refers to a mammal (e.g., a primate such as a human). In one embodiment, a subject may be a “patient”, i.e., a warm- blooded animal (e.g., a primate such as a human) who / which is awaiting the receipt of, or is receiving medical care or was / is / will be the object of a medical procedure, or is monitored for the development of a disease.
[0045] In a second aspect, a method for detecting high-risk HPV in a sample is provided, the method comprising i) contacting a first aliquot of the sample with at least one HPV primer set selected from (a)-(s) described above; (ii) contacting a second aliquot of the sample with a control primer set; and (iii) performing a LAMP assay to generate amplicons. The LAMP assay may comprise a reverse transcription step (RT-LAMP).
[0046] In embodiments, the method comprises contacting the first aliquot of sample with at least eight of the HPV primer sets. In other embodiments, the method comprises contacting the first aliquot of sample with all of the HPV primer sets (a)-(s). The method may comprise contacting the first aliquot of sample with at least one primer set of (f), (l), and (m), for detecting HPV18, and at least one primer set of (g) and (n), for detecting HPV16.
[0047] The control primer set may comprise the ACTB primer set (SEQ ID NOs: 99-104), described above.
[0048] In embodiments, all of the HPV primer sets and the control primer set are provided in one vessel. In such embodiments, the method may be used to determine if the sample as any of the high-risk HPV viruses. In other embodiments, each of the HPV primer sets are provided in separate vessels, and each vessel also comprises a control primer set. In such embodiments, the method may be used to type the high-risk HPV in the sample.
[0049] The method may further comprise sequencing the amplicons. In embodiments, sequencing is done using MinION sequencing. However, any available long-read sequencing platform or short-read sequencing technology known in the art may be used.
[0050] Each of the forward primers and each of the reverse primers may be provided at a concentration of between about 0.1 and about 0.4 μM; each of the forward internal primers and each of the backward internal primers may be provided at a concentration of between about 1.2 and about 1.8 μM; and / or each of the loop forward primers and the loop backward primers may be provided at a concentration of between about 0.2 and about 0.6 μM.
[0051] The term “subject” may be used interchangeably with the terms “individual” and “patient” and includes human and non-human subjects.
[0052] The sample may be a biological sample, including but not limited to a tissue sample, blood, plasma, and urine. The sample may be obtained from a cervical swab, saliva, an anal swab, a nasal swab, a penile swab, a vaginal swab, an oral swab, an oral rinse, a tissue biopsy, or any other suitable source. The sample may be used as a raw sample, undergoing no preparation step. In other embodiments, samples may be prepared for use as nucleic acid templates in the methods of this disclosure using conventional techniques, for example, a nucleic acid extraction. A sample comprising nucleic acids may be prepared from samples using conventional techniques, which typically depend on the source from which a sample is taken, including but not limited to a simple nucleic acid extraction comprising a cell lysis step, a centrifugation step to remove cellular debris,a proteolytic step to degrade proteins, an organic solvent precipitation step to remove proteins (e.g. using phenol or a mixture of phenol and chloroform), and a nucleic acid precipitation step using an alcohol (e.g. ethanol or isopropanol). Alternative nucleic acid sample preparation methods known in the art include silica-based methods for nucleic acid adsorption (e.g. silica membranes, beads or particles), magnetic-based solid support technologies (e.g. magnetic beads), anion exchange methods, and chromatographic methods using different resins. In some embodiments, the nucleic acid template sample is first prepared using a reverse transcriptase reaction known in the art. An aliquot of the sample is a portion taken from the sample. As each aliquot is taken from the same sample, each aliquot is identical in substance.
[0053] The sample may be heated during the LAMP assay. For instance, samples can be heated at a temperature of about 65 °C or greater, which kills the virus and releases nucleic acids. In other cases, samples may be frozen (e.g., at -80 °C) for storage.
[0054] The term “detecting,” “detect” or “detection” as used herein indicates the determination of the existence or presence of a target molecule or signal in a limited portion of space, including but not limited to a sample, a reaction mixture, a molecular complex and a substrate including a platform and an array. Detection is “quantitative” when it refers, relates to, or involves the measurement of quantity or amount of the target molecule or signal (also referred to as quantitation), which includes but is not limited to any analysis designed to determine the amounts or proportions of the target or signal. Detection is “qualitative” when it refers, relates to, or involves identification of a quality or kind of the target or signal in terms of relative abundance to another target or signal, which is not quantified. An “optical detection” indicates detection performed through a detectable light signal(s): fluorescence, spectra, or images of an isolated or eluted labeled ribonucleoprotein-target nucleic acid complex.
[0055] Miscellaneous
[0056] Unless otherwise specified or indicated by context, the terms “a”, “an”, and “the” mean “one or more.” For example, “a molecule” should be interpreted to mean “one or more molecules.”
[0057] As used herein, “about”, “approximately,” “substantially,” and “significantly” will be understood by persons of ordinary skill in the art and will vary to some extent on the context in which they are used. If there are uses of the term which are not clear to persons of ordinary skill in the art given the context in which it is used, “about” and “approximately” will mean plus orminus ≤10% of the particular term and “substantially” and “significantly” will mean plus or minus >10% of the particular term.
[0058] As used herein, the terms “include” and “including” have the same meaning as the terms “comprise” and “comprising.” The terms “comprise” and “comprising” should be interpreted as being “open” transitional terms that permit the inclusion of additional components further to those components recited in the claims. The terms “consist” and “consisting of” should be interpreted as being “closed” transitional terms that do not permit the inclusion additional components other than the components recited in the claims. The term “consisting essentially of” should be interpreted to be partially closed and allowing the inclusion only of additional components that do not fundamentally alter the nature of the claimed subject matter. Embodiments recited as “including,” “comprising,” or “having” certain elements are also contemplated as “consisting essentially of” and “consisting of” those certain elements.
[0059] The modal verb “may” refers to the preferred use or selection of one or more options or choices among the several described embodiments or features contained within the same. Where no options or choices are disclosed regarding a particular embodiment or feature contained in the same, the modal verb “may” refers to an affirmative act regarding how to make or use and aspect of a described embodiment or feature contained in the same, or a definitive decision to use a specific skill regarding a described embodiment or feature contained in the same. In this latter context, the modal verb “may” has the same meaning and connotation as the auxiliary verb “can.”
[0060] Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. For example, if a concentration range is stated as 1% to 50%, it is intended that values such as 2% to 40%, 10% to 30%, or 1% to 3%, etc., are expressly enumerated in this specification. These are only examples of what is specifically intended, and all possible combinations of numerical values between and including the lowest value and the highest value enumerated are to be considered to be expressly stated in this disclosure. Use of the word “about” to describe a particular recited amount or range of amounts is meant to indicate that values very near to the recited amount are included in that amount, such as values that could or naturally would be accounted for due to manufacturing tolerances, instrument and human error in formingmeasurements, and the like. All percentages referring to amounts are by weight unless indicated otherwise.
[0061] In those instances where a convention analogous to “at least one of A, B and C, etc.” is used, in general such a construction is intended in the sense of one having ordinary skill in the art would understand the convention (e.g., “a system having at least one of A, B and C” would include but not be limited to systems that have A alone, B alone, C alone, A and B together, A and C together, B and C together, and / or A, B, and C together.). It will be further understood by those within the art that virtually any disjunctive word and / or phrase presenting two or more alternative terms, whether in the description or figures, should be understood to contemplate the possibilities of including one of the terms, either of the terms, or both terms. For example, the phrase “A or B” will be understood to include the possibilities of “A” or ‘B or “A and B.”
[0062] No admission is made that any reference, including any non-patent or patent document cited in this specification, constitutes prior art. In particular, it will be understood that, unless otherwise stated, reference to any document herein does not constitute an admission that any of these documents forms part of the common general knowledge in the art in the United States or in any other country. Any discussion of the references states what their authors assert, and the applicant reserves the right to challenge the accuracy and pertinence of any of the documents cited herein. All references cited herein are fully incorporated by reference, unless explicitly indicated otherwise. The present disclosure shall control in the event there are any disparities between any definitions and / or description found in the cited references.
[0063] All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., “such as”) provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.
[0064] Preferred aspects of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of those preferred aspects may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect a person having ordinary skill in the art to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein.Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.
[0065] The following examples are meant only to be illustrative and are not meant as limitations on the scope of the invention or of the appended claims. EXAMPLES
[0066] Example 1. LAMP Primer Sets for the Amplification of HR-HPV Genes
[0067] Sequences and IDs of working primer sets for the amplification and the fluorescent (Syto family of dyes specifically Syto-9, and SYBR green I) and / or colorimetric detection of HR-HPV from synthetic DNA, cervical cell lines and human specimens are provided in Table 1. The LAMP reactions can be performed based on manufacturer or custom protocols using laboratory instruments, such as qPCR machines and heat blocks. The following primers can also be used in POC devices in microfluidic well format. For example, in a 4-plex detection, each well / reaction contains 16E6, 18E6 and pooled HR-HPV L1 primers and positive control (ACTB). Additional primers included can also detect other regions of HR-HPV L1 and E6 / E7. A positive control set for ACTB is provided in Table 2.
[0068] Table 1. HR-HPV Primer Sets SEQ ID Name Sequence NO: 1 HPV45L1_F3 TTTAGGGTTGTACCTAATGGT 2 HPV45L1_B3 ATTATAAAATGGATGGCCACTT 3 HPV45L1_FIP CGGGTAAAGCTACTCTAAACACCCAGGTAATAAACA GGCTGTTCC 4 HPV45L1_BIP AATCCTGAAACACAACGTTTGGTTACCTAAAGGCTG CCCAC 5 HPV45L1_LB GCATGTGTAGGTATGGAAATTGGTC 6 HPV33L1_2_F3 GGATTTCCTGACACCTCCT 7 HPV33L1_2_B3 ACATCCAAGTAAACATAACTGTGHPV33L1_2_FIP GCCCTCTACCTATTTCAAGGCCTTTATAACCCTGATA CACAACG HPV33L1_2_BIP ACAAATTTGATGACACTGAAACCGTCCATGGATAAA CATTCCCTA HPV33L1_2_LB TGGACAACCGGGTGCTGATA HPV58L1_F3 AACAGATATCCCGCACAG HPV58L1_B3 TCTACCATGTCACCATCCT HPV58L1_FIP TGGGAGGTTTACAGCCAATTAAACACCAGGGTCTGA TAACAGG HPV58L1_BIP CTGGTGAGCATTGGGGTAAAGTTAAAAAGTTCCAAT GGAGGAC HPV58L1_LB CCTGTAACAATAATGCAGCTGCTAC HPV31L1_2_F3 CCTAGCGAGGCTACTGTC HPV31L1_2_B3 AACGAACCCTAAATACCCTAT HPV31L1_2_FIP GCGTGATAATATATGTTGGTTCGTGTACTTACCACCT GTCCCA HPV31L1_2_BIP AGGCCATCCATATTATTCCATACCTTGTAATCCTGAC ACCTTTGG HPV31L1_2_LF TCATCCGTGCTTACAACTTTAGACA HPV52L1_F3 TCCTGTACCTGTCTCTAAGG HPV52L1_B3 AGATGTATCTGGAAAACCAAAT HPV52L1_FIP GTAATCGAGAACTGCCTGCATAATGTAAGCACTGAT GAGTATGTGT HPV52L1_BIP AACACCAGTAGTGGTAATGGTAAAAGGCAATTTAAT TCTAAATACCCTGT HPV52L1_LB GTTTTAGTTCCCAAGGTGTCTGGC HPV18E6_F3 ACGCAGAGAAACACAAGT HPV18E6_B3 CGGGCTGGTAAATGTTGA HPV18E6_FIP TCATTTTGGGGCTCTAAATGCAATTTTAAGTATGCAT GGACCTAAGGHPV18E6_BIP AATTCCGGTTGACCTTCTATGTCTTTTTGATTAACTC CATCTATTTCATCGT HPV18E6_LB GCAATTAAGCGACTCAGAGGAAGA HPV16E6_F3 ATGCACCAAAAGAGAACTG HPV16E6_B3 AGCATATGGATTCCCATCTC HPV16E6_FIP GCAGCTCTGTGCATAACTGTCAATGTTTCAGGACCC ACA HPV16E6_BIP AGAATGTGTGTACTGCAAGCAATCCCGAAAAGCAAA GTCAT HPV16E6_LoopF GGTAACTTTCTGGGTCGCTCC HPV16E6_Loop CAGTTACTGCGACGTGAGGT B HPV35L1_F3 TGGATTTCCAGACACATCA HPV35L1_B3 CATAGAAATGCATTCCCTGTT HPV35L1_FIP CCACGACCTACTTCAACTCCTTTTATGATCCTGCCTC CCA HPV35L1_BIP GGTGTAGGTATTAGTGGTCATCCTTGTACCAGAGTT ACCAACAT HPV35L1_LF ACAGGCCCAAACCAAACGC HPV39L1_2_F3 AGGACAGTAGGGATAATGTG HPV39L1_2_B3 CCATAGCTCCATAGCCAGTA HPV39L1_2_FIP CTTTCCCTTACCCCAGTGCTTGTGGATTATAAACAGA CACAGT HPV39L1_2_BIP ATGCAAGCCCAATAATGTATCTACGTCAATCATATC ACCATCCTCAA HPV39L1_2_LF CCCAATGGCGGGAACACA HPV39L1_2_LB TCCTCCTTTGGAACTAGTAAACACC HPV59L1_F3 GGTAGGACTCAGTGGTCA HPV59L1_B3 TAGTGGAGGACAATCGCCHPV59L1_FIP AATCCACAGATACATTATCACGTGTGGATGACACTG AAAACTCTCAT HPV59L1_BIP ACAAACTCAGCTGTGTATTATTGGCTACAAGCAGTG CCCTTTG HPV59L1_LF TCTTTGGTATCAACAGCAGATGCT HPV59L1_LB TGTGTACCTGCCATTGGAGAAC HPV68L1_F3 GGCATCCACTATATAATAGGCT HPV68L1_B3 CCCTTGTTGTACATTGGTAG HPV68L1_FIP GCAACATTGTCCCTACTGTCTTTAGGATGATACTGAA AATTCCCCG HPV68L1_BIP CTGTAAACAAACACAGCTGTGTATTGCTTACAAGAT TTACCTTTGGC HPV68L1_LB TTCCTGCTATTGGCGAGCAC HPV18E6_2_F3 AACGACGCAGAGAAACAC HPV18E6_2_B3 TGTGTGACGTTGTGGTTC HPV18E6_2_FIP TGGGGCTCTAAATGCAATACAATGTTTTGTATAATAT TAAGTATGCATGGACC HPV18E6_2_BIP GTTGACCTTCTATGTCACGAGCAATTTTTGGTAAATG TTGATGATTAACTCC HPV18E6_2_LB CGACTCAGAGGAAGAAAACGATGA HPV18-L1_F3 CACTGAAAGTTCCCATGC HPV18-L1_B3 CAGTATCTACCATATCACCATCT HPV18-L1_FIP GCCCAAAATACATAACTGTGTCTGCACGTCTAATGT TTCTGAGGAC HPV18-L1_BIP GGCTAAAGGCACTGCTTGTAACCAAAACTGTGTTTT TAAGTTCT HPV18-L1_LB GCGTCCTTTATCACAGGGCG HPV16-L1_F3 GCCATATCTACTTCAGAAACTACA HPV16-L1_B3 GCCTGGGATGTTACAAACCHPV16-L1_FIP ACGTCTGCAGTTAAGGTTATTTTGCACTTTAAGGAGT ACCTACGAC HPV16-L1_BIP TGAATTCCACTATTTTGGAGGACTGTTCTAGTGTGCC TCCTGG HPV16-L1_LB GAATTTTGGTCTACAACCTCCC HPV33L1_F3 TGTACCTGCCTCCTGTAC HPV33L1_B3 CGGACCCTAAAAACCCTAT HPV33L1_FIP GAAGTCTGGAACTACCAGCATAATCTGTATCTAAAG TTGTCAGCACT HPV33L1_BIP TTGCTGTTGGCCATCCATATTTTTTGCAAGCCTGATA CTTTGG HPV33L1_LF TGCTTGTGCGAGACACATATTCA HPV45L1_2_F3 ATGATACAGAAAGTGCTCATG HPV45L1_2_B3 ACCATCCTCAATAATGGTGTT HPV45L1_2_FIP AACCTAAAATACACAGCTGTGTTTGCAGCTACAGCT GTTATTACG HPV45L1_2_BIP CCTGCTATTGGTGAGCACTGCCAAAGGAGGACAGTC AC HPV45L1_2_LB GCCAAGGGCACACTTTGTAAAC HPV58L1_2_F3 AGTGAGGCCACTGTGTAC HPV58L1_2_B3 ACCCTAAAGACCCTATACTGTA HPV58L1_2_FIP TCTGGAACTGCCAGCATAATAATAACTGTGCCTGTG TCTAAGG HPV58L1_2_BIP GCTGTTGGCAATCCATATTTTTCCGCCTGATACCTTG GGAAC HPV58L1_2_LF TGCTTGTGCGTGACACATATTCA HPV31L1_F3 AGTTGTAAGCACGGATGA HPV31L1_B3 CAGGATTATAAAAAGATGTATCAGG HPV31L1_FIP TGGAATAATATGGATGGCCTACTGTCACGAACCAAC ATATATTATCACG92 HPV31L1_BIP AATAGTTGTACCAAAGGTGTCAGGGTTTGGATCTGG TAAACGAA 93 HPV31L1_LF AGCAGCCTAGCACTGCCT 94 HPV52L1_2_F3 GTGTACCTGCCTCCTGTA 95 HPV52L1_2_B3 GGCAATTTAATTCTAAATACCCTGT 96 HPV52L1_2_FIP ACTGCCTGCATAATAATAGATGCTCCTGTCTCTAAG GTTGTAAGC 97 HPV52L1_2_BIP TCGATTACTAACAGTAGGACATCCCGGGAACTAAAA CTTTTTTACCAT 98 HPV52L1_2_LF TGTGCGAGACACATACTCATCAG
[0069] Table 2. ACTB Primer Sets SEQ ID Name Sequence NO: 99 ACTB_001-F3 GGCATCCACGAAACTACCTT 100 ACTB_001-B3 GCCGATCCACACGGAGTAC 101 ACTB_001-FIP TGCCGCCAGACAGCACTGTGTGAAGTGTGACGTGGA CATC 102 ACTB_001-BIP TTGCCGACAGGATGCAGAAGGGCGCTCAGGAGGAG CAAT 103 ACTB_001-LF GGCGTACAGGTCTTTGCG 104 ACTB_001-LB CCCTGGCACCCAGCACAATG
[0070] Pan HR-HPV detection and HR-HPV genotyping using LAMP
[0071] To detect multiple HR-HPV types in lab or on a single microfluidic well, the HR-HPV LAMP primers listed above can be combined based on the need or prevalence of the HPV genotypes in that demography.
[0072] For initial testing, we ran individual reaction wells, each containing pooled L1 primer sets for HPV-31, 33, 35, 39, 45, 52, 56, 59, and 58, alongside separate wells for HPV-16 E6 / E7 and HPV-18 E6 / E7, to detect HR-HPV from synthetic plasmids and human specimens (see FIG. 1). This pan / pooled HR-HPV reaction can detect most of the International Agency for Research on Cancer (IARC) (World Health Organization) group 1 classified HR-HPV. Thus, we can detect upto 8 HR-HPV types using a single microfluidic cartridge. FIG.1 shows the specificity of each HPV type specific primer set. These primers can also be used stand alone in a reaction or well to genotype the HR-HPV types. The primers can be used at 1.2-1.8 μM FIP / BIP, 0.1-0.4 μM F3 / B3, 0.2-0.6 μM LoopF / B). When combining multiple primers, the primers master mix can be prepared as 10X-100X, so the final reaction volume remains within the recommendation. The HPV18E6 and HPV16E6 are specific to the gene and genotype and were validated by testing against two Low-risk HPV and 15 HR-HPV E6 / E7 genes (not shown). Also, the HPV52L1 primer set can detect both HPV 52 and 35 but not any other HPV type listed above.
[0073] HR-HPV genotyping using LAMP-nanopore sequencing
[0074] The amplicons resulting from the pooled HR-HPV primer reaction can be used as a sample input for HRHPV genotyping on long read nanopore sequencing (i.e. Oxford Nanopore Minion). The amplicons are barcoded with MiNION adapters using 0.1 ug – 2 ug of amplified product as an input. Then the adapter ligated amplicons (1-2 μg) are loaded and sequenced on MinION flowcell (R.9.4.1). The amplicons from the pooled HR-HPV primers can also be used to genotype using both short and long read sequencers such as Illumina and PacBio.
[0075] We have adapted loop-mediated isothermal amplification (LAMP), an isothermal PCR alternative carried out at 65°C, for rapid amplification of viral template. LAMP is well-suited for point of care devices, as well as detection of viral homologues due to its unique primer constraints. We designed LAMP primers for detection of HPV16 / 31 L1, HPV18 / 45 L1, HPV16 E6, HPV18 E6, HPV 35 / 52 L1, as well as a custom beta-actin positive control. HPV-16 E6 / E7 primers amplify HPV-16 E6 but do not cross-react with HPV-31 E6. HPV-18 E6 / E7 primers amplify HPV-18 E6 but do not cross-react with HPV-45 E6. The 16 / 18E6 and 35 / 52L1 assays are shown in FIG.2 and Table 3.
[0076] Table 3. Percentage of replicates amplified for each HPV template copy number Copy Number 50K 5K 500 50 5 0 HPV16L1 3 / 3 3 / 3 3 / 3 3 / 3 1 / 3 0 / 9 HPV18L1 3 / 3 3 / 3 3 / 3 3 / 3 1 / 3 0 / 9 HPV16E6 3 / 3 3 / 3 3 / 3 3 / 3 2 / 3 0 / 9 HPV18E6 3 / 3 3 / 3 3 / 3 3 / 3 3 / 3 0 / 9
[0077] In a study of invasive cervical cancer in New Delhi by Dr. Bhatla, the highest frequencies of HPV were HPV16 (73.6%), HPV18 (14.2%), and HPV45 (11.3%). Detection of HPV16 from cervical brush samples in India are shown at FIG.3. Our design enables us to distinguish clinically actionable HPV16 and HPV18 from other HR HPVs while minimizing reagent costs.
[0078] The limit of detection was determined for the primer sets by titrating spiked-in HR-HPV DNA across a physiologically relevant range (50,000–5 copies / 25 μL). Three technical replicates were performed. Specificity was assessed using control HPV DNA templates and results cross- validated with HPV-16 and HPV-18 qPCR assays. See FIG.4. An outline of the limit of detection experiment is illustrated at FIG.5A.
[0079] A LAMP assay using the primer sets for HPV 16 and 18 was compared against the “gold standard” COBAS assay. 147 samples were tested. The results are shown at Tables 4 and 5. Diagonal concordance = 142 / 147 = 96.6%, Kappa (chance-corrected concordance) = 92.3%. Considering COBAS as gold standard, sensitivity for LAMP = 46 / 48 = 95.8%, specificity = 96 / 99 = 97%.
[0080] Table 4. Concordance LAMP Total YES NO YES 46 2 48 COBAS NO 3 96 99 Total 49 98 147
[0081] Table 5. Concordance with HPV 16 and 18 data split LAMP Total HPV16 HPV16 NEITHER HPV16 37 0 2 39 COBAS HPV18 0 9 0 9 NEITHER 3 0 96 99 Total 40 9 98 147
[0082] Example 2. SPRINT-HPV: HR-HPV Detection From Cervical Samples in Point of Care
[0083] Introduction: Cervical cancer, primarily caused by high-risk human papillomavirus (HR- HPV), has disproportionately higher rates in low- and middle-income countries (LMICs) due in part to limited screening rates. Point-of-care (POC) technologies have the potential to improve screening coverage due to their affordability and portability. We developed a POC system that detects HPV types 16 and 18, and nine others.
[0084] Methods: Cervical brush samples were collected at AIIMS in New Delhi, India, and stored using a Digene specimen transport medium (STM). The collected samples were processed on a custom microfluidic cartridge with a silica matrix to extract HPV nucleic acids, which were eluted to wells containing lyophilized loop-mediated isothermal amplification (LAMP) reagents, SYTO 9 fluorescent dye, and target primers. The 4-plex microfluidic cartridge was heated in a custom POC reader to detect targets in real-time. Target genes included β-actin (internal control), HPV16- E6, HPV18-E6, and a combinational primer set for nine additional HR-HPV types.
[0085] Results: Using spiked DNA template controls, the lower limit of detection was 0.25 copies / μL for HPV16-E6 and 0.025 copies / μL for HPV18-E6. On-chip, the POC system detected down to 50 HeLa cells and 500 SiHa cells in 200 μL STM for three replicates. A total of 4 positive HPV16, 2 positive HPV18, and 7 negative HPV16 / 18 cervical brush samples were genotyped using the Roche-COBAS system and subsequently tested on the POC system. All samples were accurately detected on-chip.
[0086] Conclusion: We developed and performed pilot testing of a portable isothermal POC system for HPV detection from cervical samples in low-resource settings. Further validation of the system is needed to establish analytic performance, especially for non-HPV16 / 18 genotypes. This fully integrated sample-to-answer platform offers a rapid, cost-effective solution for HR-HPV screening in LMICs.
[0087] Example 3. New Developments in HPV Testing for Cervical Cancer Screening
[0088] Introduction: WHO recommends primary HPV screening in all resource settings but it is expensive and requires sophisticated laboratory set-up. Affordable, analytically precise and sensitive point-of-care (POC) testing will enable widespread screening in low-middle income countries. Loop-mediated isothermal amplification (LAMP) testing is an isothermal PCR alternative for detection of high-risk HPV DNA subtypes adaptable to an inexpensive, compact and disposable configuration with high analytical sensitivity and rapid quantitative output. It requires minimal training and infrastructure.
[0089] Objective: To develop a LAMP test that can detect HPV 16 / 18 / other genotypes and to determine its performance and concordance with standard laboratory-based Cobas test (Roche).
[0090] Methodology: Prospective study, women aged 30-65 years, referred for colposcopy in view of screen positivity, symptoms like postcoital / intermenstrual / postmenopausal bleeding, persistent discharge, suspicious cervix on examination or cervical growth suggestive of cancer. The LAMP test we developed detects HPV 16 / 18 / others (31,33,45,52,55,58); Cobas detects HPV 16 / 18 / others (31,33,35,39,45,51,52,56,58,59,66,68). All women underwent LAMP and Cobas testing on cervical swab specimens. Positive cases underwent colposcopy and biopsy. Concordance for HPV detection and performance for detection of CIN2+ (high grade cervical intraepithelial neoplasia (CIN)) disease between LAMP and Cobas was determined.
[0091] Results:173 women were included with mean age 42.3 years, mean parity 3; 17 (9.8%) had CIN 2 / 3; 48 (27.7%) had cervical cancer. There was 96.03% concordance (Kappa=0.91) for detection of HPV 16 / 18; 85.5% concordance (Kappa=0.70) for detection of HPV 16 / 18 / other hrHPV. LAMP negative / Cobas positive result was seen in 25 (14.5%) women (HPV 16:4; others:19; HPV 16 / others:2). These included 7 cases of CIN 2 / 3 (2 HPV 16, 5 others) and 5 cancer cervix (no 16 / 18). Sensitivity, specificity, positive and negative predictive values for detection of CIN2+ disease were 69.2%, 88.9%, 78.9% and 82.8% respectively with LAMP and 87.7%, 76.9%, 69.5%, 91.2% respectively with Cobas.
[0092] Conclusion: LAMP POC test may be an effective and affordable option for HPV screening in public health programs.
[0093] Example 4. HPV detection and genotyping using point-of-care (cervical samples)
[0094] DNA was extracted from 31 cervical brush samples for laboratory LAMP workflow. Results are shown at FIG.6.
[0095] Example 5. HPV detection and genotyping using point-of-care (saliva samples)
[0096] Time to detection analysis was done for HPV16, HV18, and other HR-HPV targets in saliva samples. Results are shown at FIG.7.
[0097] It will be readily apparent to one skilled in the art that varying substitutions and modifications may be made to the invention disclosed herein without departing from the scope and spirit of the invention. The invention illustratively described herein suitably may be practiced in the absence of any element or elements, limitation or limitations which is not specifically disclosed herein. The terms and expressions which have been employed are used as terms of description andnot of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention. Thus, it should be understood that although the present invention has been illustrated by specific embodiments and optional features, modification and / or variation of the concepts herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention.
Claims
CLAIMS What is claimed:
1. A kit comprising at least one HPV primer set selected from: a) a forward primer comprising SEQ ID NO: 1 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 2 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 3 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 4 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 5 or a sequence having at least 95% identity thereto; b) a forward primer comprising SEQ ID NO: 6 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 7 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 8 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 9 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 10 or a sequence having at least 95% identity thereto; c) a forward primer comprising SEQ ID NO: 11 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 12 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 13 or a sequence having at least 95% identity thereto;a backward internal primer comprising SEQ ID NO: 14 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 15 or a sequence having at least 95% identity thereto; d) a forward primer comprising SEQ ID NO: 16 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 17 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 18 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 19 or a sequence having at least 95% identity thereto; and a loop forward primer comprising SEQ ID NO: 20 or a sequence having at least 95% identity thereto; e) a forward primer comprising SEQ ID NO: 21 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 22 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 23 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 24 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 25 or a sequence having at least 95% identity thereto; f) a forward primer comprising SEQ ID NO: 26 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 27 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 28 or a sequence having at least 95% identity thereto;a backward internal primer comprising SEQ ID NO: 29 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 30 or a sequence having at least 95% identity thereto; g) a forward primer comprising SEQ ID NO: 31 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 32 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 33 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 34 or a sequence having at least 95% identity thereto; and a loop forward primer comprising SEQ ID NO: 35 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 36 or a sequence having at least 95% identity thereto; h) a forward primer comprising SEQ ID NO: 37 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 38 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 39 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 40 or a sequence having at least 95% identity thereto; and a loop forward primer comprising SEQ ID NO: 41 or a sequence having at least 95% identity thereto; i) a forward primer comprising SEQ ID NO: 42 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 43 or a sequence having at least 95% identity thereto;a forward internal primer comprising SEQ ID NO: 44 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 45 or a sequence having at least 95% identity thereto; a loop forward primer comprising SEQ ID NO: 46 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 47 or a sequence having at least 95% identity thereto; j) a forward primer comprising SEQ ID NO: 48 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 49 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 50 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 51 or a sequence having at least 95% identity thereto; a loop forward primer comprising SEQ ID NO: 52 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 53 or a sequence having at least 95% identity thereto; k) a forward primer comprising SEQ ID NO: 54 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 55 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 56 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 57 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 58 or a sequence having at least 95% identity thereto;l) a forward primer comprising SEQ ID NO: 59 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 60 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 61 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 62 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 63 or a sequence having at least 95% identity thereto; m) a forward primer comprising SEQ ID NO: 64 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 65 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 66 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 67 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 68 or a sequence having at least 95% identity thereto; n) a forward primer comprising SEQ ID NO: 69 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 70 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 71 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 72 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 73 or a sequence having at least 95% identity thereto;o) a forward primer comprising SEQ ID NO: 74 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 75 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 76 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 77 or a sequence having at least 95% identity thereto; and a loop forward primer comprising SEQ ID NO: 78 or a sequence having at least 95% identity thereto; p) a forward primer comprising SEQ ID NO: 79 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 80 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 81 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 82 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 83 or a sequence having at least 95% identity thereto; q) a forward primer comprising SEQ ID NO: 84 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 85 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 86 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 87 or a sequence having at least 95% identity thereto; and a loop forward primer comprising SEQ ID NO: 88 or a sequence having at least 95% identity thereto;r) a forward primer comprising SEQ ID NO: 89 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 90 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 91 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 92 or a sequence having at least 95% identity thereto; and a loop forward primer comprising SEQ ID NO: 93 or a sequence having at least 95% identity thereto; and s) a forward primer comprising SEQ ID NO: 94 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 95 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 96 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 97 or a sequence having at least 95% identity thereto; and a loop forward primer comprising SEQ ID NO: 98 or a sequence having at least 95% identity thereto.
2. The kit of claim 1, wherein the kit comprises at least eight of the HPV primer sets.
3. The kit of claim 1, wherein the kit comprises all of the HPV primer sets.
4. The kit of claim 1, wherein the kit comprises the HPV primer sets of at least one of: f), l), and m); and at least one of: g), and n).
5. The kit of any one of claims 1-4, further comprising an ACTB primer set, the primer set comprising: a forward primer comprising SEQ ID NO: 99 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 100 or a sequence having at least 95% identity thereto;a forward internal primer comprising SEQ ID NO: 101 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 102 or a sequence having at least 95% identity thereto; a loop forward primer comprising SEQ ID NO: 103 or a sequence having at least 95% identity thereto; and a loop forward primer comprising SEQ ID NO: 104 or a sequence having at least 95% identity thereto.
6. The kit of any one of claims 1-5, wherein the at least one HPV primer set and the ACTB primer set is lyophilized.
7. The kit of any one of claims 1-6, wherein each of the at least one HPV primer set and the ACTB primer set is in a separate well of a microfluidic cartridge.
8. The kit of any one of claims 1-6, wherein each of the at least one HPV primer set and the ACTB primer set is in the same well of a microfluidic cartridge.
9. The kit of any one of claims 1-8, further comprising reagents necessary to perform a LAMP assay.
10. A method for detecting high-risk HPV in a sample, the method comprising: i) contacting a first aliquot of the sample with at least one HPV primer set selected from: a) a forward primer comprising SEQ ID NO: 1 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 2 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 3 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 4 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 5 or a sequence having at least 95% identity thereto; b) a forward primer comprising SEQ ID NO: 6 or a sequence having at least 95% identity thereto;a reverse primer comprising SEQ ID NO: 7 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 8 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 9 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 10 or a sequence having at least 95% identity thereto; c) a forward primer comprising SEQ ID NO: 11 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 12 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 13 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 14 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 15 or a sequence having at least 95% identity thereto; d) a forward primer comprising SEQ ID NO: 16 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 17 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 18 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 19 or a sequence having at least 95% identity thereto; and a loop forward primer comprising SEQ ID NO: 20 or a sequence having at least 95% identity thereto; e) a forward primer comprising SEQ ID NO: 21 or a sequence having at least 95% identity thereto;a reverse primer comprising SEQ ID NO: 22 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 23 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 24 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 25 or a sequence having at least 95% identity thereto; f) a forward primer comprising SEQ ID NO: 26 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 27 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 28 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 29 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 30 or a sequence having at least 95% identity thereto; g) a forward primer comprising SEQ ID NO: 31 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 32 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 33 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 34 or a sequence having at least 95% identity thereto; and a loop forward primer comprising SEQ ID NO: 35 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 36 or a sequence having at least 95% identity thereto;h) a forward primer comprising SEQ ID NO: 37 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 38 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 39 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 40 or a sequence having at least 95% identity thereto; and a loop forward primer comprising SEQ ID NO: 41 or a sequence having at least 95% identity thereto; i) a forward primer comprising SEQ ID NO: 42 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 43 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 44 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 45 or a sequence having at least 95% identity thereto; a loop forward primer comprising SEQ ID NO: 46 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 47 or a sequence having at least 95% identity thereto; j) a forward primer comprising SEQ ID NO: 48 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 49 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 50 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 51 or a sequence having at least 95% identity thereto;a loop forward primer comprising SEQ ID NO: 52 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 53 or a sequence having at least 95% identity thereto; k) a forward primer comprising SEQ ID NO: 54 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 55 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 56 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 57 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 58 or a sequence having at least 95% identity thereto; l) a forward primer comprising SEQ ID NO: 59 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 60 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 61 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 62 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 63 or a sequence having at least 95% identity thereto; m) a forward primer comprising SEQ ID NO: 64 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 65 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 66 or a sequence having at least 95% identity thereto;a backward internal primer comprising SEQ ID NO: 67 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 68 or a sequence having at least 95% identity thereto; n) a forward primer comprising SEQ ID NO: 69 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 70 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 71 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 72 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 73 or a sequence having at least 95% identity thereto; o) a forward primer comprising SEQ ID NO: 74 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 75 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 76 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 77 or a sequence having at least 95% identity thereto; and a loop forward primer comprising SEQ ID NO: 78 or a sequence having at least 95% identity thereto; p) a forward primer comprising SEQ ID NO: 79 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 80 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 81 or a sequence having at least 95% identity thereto;a backward internal primer comprising SEQ ID NO: 82 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 83 or a sequence having at least 95% identity thereto; q) a forward primer comprising SEQ ID NO: 84 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 85 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 86 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 87 or a sequence having at least 95% identity thereto; and a loop forward primer comprising SEQ ID NO: 88 or a sequence having at least 95% identity thereto; r) a forward primer comprising SEQ ID NO: 89 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 90 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 91 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 92 or a sequence having at least 95% identity thereto; and a loop forward primer comprising SEQ ID NO: 93 or a sequence having at least 95% identity thereto; and s) a forward primer comprising SEQ ID NO: 94 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 95 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 96 or a sequence having at least 95% identity thereto;a backward internal primer comprising SEQ ID NO: 97 or a sequence having at least 95% identity thereto; and a loop forward primer comprising SEQ ID NO: 98 or a sequence having at least 95% identity thereto; and ii) contacting a second aliquot of the sample with a control primer set; and iii) performing a LAMP assay to generate amplicons.
11. The method of claim 10, wherein the method comprises contacting the first aliquot of the sample with at least eight of the HPV primer sets.
12. The method of claim 10, wherein the method comprises contacting the first aliquot of the sample with all of the HPV primer sets.
13. The method of claim 10, wherein the method comprises contacting the first aliquot of the sample with the HPV primer sets of at least one of: f), l), and m); and at least one of: g), and n).
14. The method of any one of claims 10-13, wherein the control primer set comprises: a forward primer comprising SEQ ID NO: 99 or a sequence having at least 95% identity thereto; a reverse primer comprising SEQ ID NO: 100 or a sequence having at least 95% identity thereto; a forward internal primer comprising SEQ ID NO: 101 or a sequence having at least 95% identity thereto; a backward internal primer comprising SEQ ID NO: 102 or a sequence having at least 95% identity thereto; a loop forward primer comprising SEQ ID NO: 103 or a sequence having at least 95% identity thereto; and a loop backward primer comprising SEQ ID NO: 104 or a sequence having at least 95% identity thereto.
15. The method of any one of claims 10-14, further comprising: iv) sequencing the amplicons.
16. The method of claim 15, wherein step iv) is done using MinION sequencing.
17. The method of any one of claims 10-16, wherein the sample is obtained from a cervical swab.
18. The method of any one of claims 10-17, wherein each of the forward primers and each of the reverse primers is at a concentration of between about 0.1 and about 0.4 μM.
19. The method of any one of claims 10-18, wherein each of the forward internal primers and each of the backward internal primers is at a concentration of between about 1.2 and about 1.8 μM.
20. The method of any one of claims 10-19, wherein each of the loop forward primers and the loop backward primers is at a concentration of between about 0.2 and about 0.6 μM.
Citation Information
Patent Citations
LAMP (loop-mediated isothermal amplification) primer combination for quickly detecting 13 high-risk type HPVs (human papillomaviruses) and application
CN110093459A
Primer combinations, kits, and methods for LAMP amplification to detect and genotype HPV.
CN110607399B
Primer design and use for loop-mediated isothermal amplification (LAMP) pathogen detection
US20220290261A1
Detection of circulating tumor DNA using double stranded hybrid capture
US20220411780A1