Use of strawberry fabpip5k24 / fafpip5k21 gene or protein encoded thereby in regulating strawberry powdery mildew susceptibility

Abstract

Disclosed in the present invention is use of a strawberry FabPIP5K24 / FafPIP5K21 gene or a protein encoded thereby in regulating strawberry powdery mildew susceptibility. The present invention relates to the field of plant genetic engineering. The present invention reveals a positive correlation between the strawberry PI(4,5)P2 content and powdery mildew susceptibility. By means of bioinformatics analysis and molecular biology experiments, the present invention screens and clones the strawberry FabPIP5K24 / FafPIP5K21 gene and establishes overexpression and silencing vectors. By means of transient genetic transformation, it is verified that overexpression of the FabPIP5K24 / FafPIP5K21 gene can increase the PI(4,5)P2 content in strawberry and increase strawberry powdery mildew susceptibility, and silencing of FabPIP5K24 / FafPIP5K21 can reduce the PI(4,5)P2 content in strawberry and decrease strawberry powdery mildew susceptibility, providing a new target for the regulation of postharvest resistance in strawberry.

Description

Application of the strawberry FabPIP5K24 / FafPIP5K21 gene or its encoded protein in regulating susceptibility to strawberry powdery mildew. Technical Field

[0001] This invention relates to the field of plant genetic engineering, specifically to the application of the strawberry FabPIP5K24 / FafPIP5K21 gene or its encoded protein in regulating susceptibility to strawberry powdery mildew. Background Technology

[0002] Powdery mildew is an economically devastating disease affecting strawberry production worldwide. It is caused by the obligate biotic fungus *Podosphaera aphanis*, which can infect and damage almost all above-ground parts of strawberries, including flowers, leaves, buds, runners, and fruits. It can reduce the photosynthetic capacity of leaves, thus reducing yield, or directly infect fruits, causing a decline in fruit quality and making them unsaleable (Palmer MG, Holmes G J. Fungicide sensitivity in strawberry powdery mildew caused by podosphaera aphanis in california[J]. Plant Disease Journal, 2021, 105(9): 2601-2605.).

[0003] The favorable growing environment for powdery mildew growth and reproduction, coupled with the difficulty of early detection, often leads growers to use preventative and therapeutic fungicides to control strawberry powdery mildew. During the peak strawberry production period of 6 to 8 weeks, some growers apply fungicides every two weeks to control powdery mildew. The most common chemical categories are demethylation inhibitors, succinate dehydrogenase inhibitors, and extraquinone inhibitors, which act on specific processes of pathogen cell development or respiration. However, the use of chemical fungicides carries environmental risks, and there have been reports of powdery mildew developing resistance in different fruits from different regions (Sombardier A, Dufour MC, Blancard D, et al. Sensitivity of podosphaera aphanis isolates to dmi fungicides: Distribution and reduced cross-sensitivity[J]. Pest Management Science, 2010, 66(1): 35-43.). Therefore, researchers have conducted extensive studies on the pathogenicity of pathogens and the immune mechanisms of plants, and the development of genomics has brought the possibility of regulating disease resistance in fruits and vegetables through transgenic technology.

[0004] Phosphaidylinositol 4-phosphate 5-kinase (PIP5Ks) is a key enzyme in the phosphaidylinositol signaling pathway and plays an important role in plant growth and development, as well as in responses to biotic and abiotic stresses. PIP5K specifically catalyzes the phosphorylation of phosphaidylinositol-4-phosphate (PI4P) at the D5 position of the inositol ring to generate phosphaidylinositol-4,5-bisphosphate [PI(4,5)P2] (Van Den Bout I, Divecha N. PIP5K-driven PtdIns(4,5)P2 synthesis: regulation and cellular functions[J]. Journal of Cell Science, 2009, 122(21): 3837-3850.). Currently, research on the role of PI(4,5)P2 in plant-pathogen immune interactions mainly focuses on model plants such as Arabidopsis thaliana and rice. Studies have found that PI(4,5)P2 accumulates in cellular structures related to effector secretion and fungal infection specificity, acting as a disease susceptibility factor in plants. However, the role of the endogenous PIP5K gene in strawberry and its mediated PI(4,5)P2 in the regulation of strawberry powdery mildew defense has not been reported. Cloning and functionally validating the PIP5K gene in octoploid strawberry will provide a new target for regulating postharvest resistance to strawberry powdery mildew and a new target gene for the molecular genetic improvement of highly resistant varieties. Fully utilizing strawberry genomic resources, mining powdery mildew-related genes, and breeding disease-resistant varieties will be a more economical, effective, and environmentally friendly strategy for green control of strawberry. Regulating PI(4,5)P2 in strawberry through plant genetic engineering technology may affect the formation of haustorium structures during powdery mildew infection, thereby inducing changes in strawberry susceptibility to powdery mildew. Summary of the Invention

[0005] The purpose of this invention is to provide a gene associated with susceptibility to strawberry powdery mildew, and to use this gene as a target to regulate the content of phosphatidylinositol-4,5-bisphosphate in strawberries, thereby inducing changes in susceptibility to strawberry powdery mildew. Specifically, this invention relates to the application of the FabPIP5K24 / FafPIP5K21 gene or its encoded protein in regulating susceptibility to strawberry powdery mildew.

[0006] This invention provides the application of the strawberry FabPIP5K24 / FafPIP5K21 gene or its encoded protein in regulating susceptibility to strawberry powdery mildew.

[0007] This invention also provides the application of the strawberry FabPIP5K24 / FafPIP5K21 gene or the protein it encodes in the preparation of a drug to reduce susceptibility to strawberry powdery mildew.

[0008] Preferably, the CDS nucleotide sequence of the strawberry FabPIP5K24 / FafPIP5K21 gene is shown in SEQ ID No. 1, and the amino acid sequence of the protein encoded by the strawberry FabPIP5K24 / FafPIP5K21 gene is shown in SEQ ID No. 2.

[0009] This invention relates to the treatment of strawberries with the PIP5K inhibitor UNC3230, which significantly reduced susceptibility to strawberry powdery mildew. Transient silencing of the FabPIP5K24 / FafPIP5K21 gene in strawberries reduced the PI(4,5)P2 content by 31.0%, decreased powdery mildew susceptibility, and reduced the percentage of powdery mildew lesions by 7.9 percentage points. Overexpression of the FabPIP5K24 / FafPIP5K21 gene in strawberries increased the PI(4,5)P2 content by 69.4%, increased powdery mildew susceptibility, and increased the percentage of powdery mildew lesions by 12.4 percentage points, verifying the positive correlation between PI(4,5)P2 content and strawberry powdery mildew susceptibility.

[0010] The present invention also provides a method for regulating susceptibility to strawberry powdery mildew. When it is necessary to reduce susceptibility to strawberry powdery mildew, the FappIP5K24 / FafPIP5K21 gene in strawberry is silenced or knocked out; when it is necessary to increase susceptibility to strawberry powdery mildew, the FappIP5K24 / FafPIP5K21 gene in strawberry is overexpressed.

[0011] This invention relates to the following: overexpression of the FabPIP5K24 / FafPIP5K21 gene promotes the accumulation of PI(4,5)P2 in strawberries, inducing an increase in susceptibility to strawberry powdery mildew; silencing of the FabPIP5K24 / FafPIP5K21 gene inhibits the production of PI(4,5)P2 in strawberries, resulting in a decrease in susceptibility to strawberry powdery mildew.

[0012] Preferably, the CDS nucleotide sequence of the strawberry FabPIP5K24 / FafPIP5K21 gene is shown in SEQ ID No. 1.

[0013] In some embodiments of the present invention, silencing or knocking out the FabPIP5K24 / FafPIP5K21 gene in strawberries includes the following steps:

[0014] (1) Construct a gene silencing or knockout vector, wherein the gene silencing or knockout vector is a plant expression vector containing a sequence for silencing or knocking out the FabpIP5K24 / FafPIP5K21 gene.

[0015] (2) The gene silencing or knockout vector from step (1) was introduced into strawberry cells to silence or knock out the FabpIP5K24 / FafPIP5K21 gene, and transgenic strawberry plants were cultured.

[0016] Specifically, the plant expression vector is pNC-cambia2304. The target sequence for gene knockout is shown in SEQ ID No. 3.

[0017] The specific technical solution of the present invention is as follows:

[0018] This invention first focuses on the role of PI(4,5)P2 in the response to powdery mildew infection. By inhibiting the catalytic activity of phosphatidylinositol 4-phosphate 5-kinase, a key enzyme in the biosynthesis of strawberry PI(4,5)P2, a reduction in susceptibility to strawberry powdery mildew was verified. Based on this, members of the PIP5K gene family in strawberry were identified by combining octoploid strawberry genomic resources and bioinformatics analysis methods. Phylogenetic clustering analysis and spatiotemporally specific expression analysis were performed to screen out the candidate gene cluster FabPI5K21, which exhibits constitutive high-level expression and a significant response to powdery mildew infection.

[0019] This invention uses octoploid cultivated strawberry (Fragaria × ananassa Duch. Benihoppe) as material, optimizes primer sequences and PCR conditions, clones the full-length (2493 bp) CDS of the FabPIP5K24 / FafPIP5K21 gene in the FabPI5K21 cluster, and recovers it by gel extraction. It is constructed in the pNC-AEnTopo blunt-ended vector. The FabPIP5K24 gene from pNC-AEnTopo replaces the NC cloning frame of the overexpression vector via NC cloning reaction. The vector is then transformed into *E. coli*, and plasmids with correct sequencing alignment are transformed into *Agrobacterium* GV3101 and preserved. Transient overexpression of the FabPIP5K24 / FafPIP5K21 gene in strawberry promotes the accumulation of PI(4,5)P2 and induces increased susceptibility to strawberry powdery mildew.

[0020] A 442bp target fragment from the FabPIP5K24 / FafPIP5K21 gene was selected. Primers with universal NC cloning adapter sequences at both ends were designed to simultaneously clone the target fragment into two NC cloning frames of the vector, forming an hpRNA expression structure. This structure was transformed into *E. coli*, and positive clones were selected for colony PCR verification. After sequencing verification, the plasmid was transferred into *Agrobacterium* GV3101 for preservation. Transient silencing of the FabPIP5K24 / FafPIP5K21 gene in strawberry inhibited the production of PI(4,5)P2 and reduced susceptibility to strawberry powdery mildew. This study elucidates the PIP5K gene-mediated changes in PI(4,5)P2 content and its regulatory role in strawberry powdery mildew susceptibility.

[0021] This invention also provides the application of the strawberry FabPIP5K24 / FafPIP5K21 gene or its encoded protein in strawberry breeding. Strawberry lines with low susceptibility to powdery mildew can be obtained by screening strawberry plants with silenced or knocked-out strawberry FabPIP5K24 / FafPIP5K21 gene, or by screening strawberry plants with low or no expression of the protein encoded by the strawberry FabPIP5K24 / FafPIP5K21 gene.

[0022] This invention also provides a drug for reducing susceptibility to strawberry powdery mildew, the active ingredient of which includes a sequence for knocking out or silencing the strawberry FabPIP5K24 / FafPIP5K21 gene.

[0023] Or it could be a compound that inhibits the protein encoded by the strawberry FabPIP5K24 / FafPIP5K21 gene.

[0024] The CDS nucleotide sequence of the strawberry FAPIP5K24 / FafPIP5K21 gene is shown in SEQ ID No. 1.

[0025] The beneficial effects of this invention are:

[0026] 1. This invention reveals a positive correlation between the PI(4,5)P2 content of strawberries and susceptibility to powdery mildew.

[0027] 2. This invention screened and cloned the strawberry FabPIP5K24 / FafPIP5K21 gene through bioinformatics analysis and molecular biology experiments, and established overexpression and silencing vectors. Through transient genetic transformation, it was verified that overexpression of the FabPIP5K24 / FafPIP5K21 gene can increase the PI(4,5)P2 content and increase susceptibility to strawberry powdery mildew, while silencing FabPIP5K24 / FafPIP5K21 can decrease the PI(4,5)P2 content and reduce susceptibility to strawberry powdery mildew. FabPIP5K24 / FafPIP5K21 can be used as a target to regulate the PI(4,5)P2 content and susceptibility to strawberry powdery mildew, laying the foundation for the regulation of food nutrient components and the innovation and breeding of powdery mildew-resistant strawberry germplasm. Attached Figure Description

[0028] Figure 1 shows the effect of treatment with the PIP5K inhibitor UNC3230 on PI(4,5)P2 content and strawberry powdery mildew resistance;

[0029] Figure 2 shows the cluster analysis of the phylogenetic tree of strawberry PIP5K;

[0030] Figure 3 shows a heatmap of PIP5K gene expression in strawberry roots, leaves, receptacles at different maturity levels, and achenes.

[0031] Figure 4 shows the differential expression of the highly expressed PIP5K gene cluster in response to powdery mildew; where ns indicates no significant difference, * indicates p<0.05, and **** indicates p<0.0001; from left to right, the genes are FabPIP5K05, FabPIP5K06, FabPIP5K10, FabPIP5K21, FabPIP5K03, and FabPIP5K34.

[0032] Figure 5 shows the cloned and gel-extracted electrophoretic image of the CDS region of the FabPIP5K24 / FafPIP5K21 gene in the Red Beauty strawberry.

[0033] Figure 6 shows the overexpression vector pNC-cambia2304-FabPIP5K24 / FafPIP5K21-OE.

[0034] Figure 7 shows the map of the silencing vector pNC-cambia2304-FabPIP5K24 / FafPIP5K21-RNAi vector;

[0035] Figure 8 shows the functional validation of the FabpIP5K24 / FafPIP5K21 gene; where * indicates p < 0.05 and ** indicates p < 0.01.

[0036] Figure 9 shows the powdery mildew susceptibility phenotypes of strawberry tissue culture seedlings with transient overexpression and silencing of the FafPIP5K24 / FafPIP5K21 gene; where * indicates p<0.05 and ** indicates p<0.01. Detailed Implementation

[0037] The present invention will be further described below with reference to the embodiments. Unless otherwise specified, the methods used in the following embodiments are conventional methods; unless otherwise specified, the materials and reagents used in the embodiments are commercially available.

[0038] Example 1: Feasibility verification of regulating strawberry PI(4,5)P2 and strawberry powdery mildew susceptibility based on PIP5K

[0039] 1.1 Effects of exogenous treatment with the PIP5K inhibitor UNC3230 on susceptibility to powdery mildew in strawberries

[0040] 1.1.1 Experimental Materials

[0041] The fluorescent probe vector P24Y of PI(4,5)P2 was kindly provided by Professor Yvon Jaillais of the French National Centre for Scientific Research and was preserved after transformation of Agrobacterium GV3101.

[0042] The tissue culture seedlings of "Hongyan" strawberry (supplied by Jiangsu Fengshou Dadi Seed Industry Development Co., Ltd.; source of mother seedlings: Shanghai Qingpu Strawberry Garden) and tobacco plants were planted in 10×10 cm (diameter×height) flower pots at 25℃, with a 16h / 8h day-night alternation, and a relative humidity of 75%.

[0043] Powdery mildew strains are regularly subcultured and maintained on healthy Red Beauty strawberry potted plants, and cultured in isolation.

[0044] 1.1.2 Isolation, Propagation and Preservation of Powdery Mildew

[0045] Powdery mildew fungus was collected from potted Red Beauty strawberries. The powdery mildew on the strawberry tissue was brushed onto sterile water and filtered through a 40μm cell filter. The spore concentration was measured using a hemocytometer and adjusted to 2×10⁻⁶. 6 CFU / mL was evenly sprayed onto normal, healthy potted strawberry plants, with 5mL of bacterial solution sprayed per plant. After 10 days, a white mycelial layer was visible to the naked eye. Every 30 days, a powdery mildew spore suspension was prepared and sprayed onto transplanted tissue culture seedlings for the propagation and preservation of powdery mildew pathogens.

[0046] 1.1.3 Validation of the function of PIP5K inhibitor UNC3230 in regulating PI(4,5)P2

[0047] Preparation of Agrobacterium benzoate infection solution: Weigh 0.976 g of 2-(N-morpholinoethanesulfonic acid) (MES) and 0.476 g of MgCl2, dissolve in 500 mL of water, adjust pH to 5.4 with NaOH, sterilize at 121 °C for 15 minutes, cool, and store at 4 °C (i.e., 10 mM MgCl2, 10 mM MES, pH 5.6). Prepare a 200 mM acetosyringone (AS) stock solution: Weigh 0.0392 g of AS into a 2 mL sterile test tube, dissolve in 1 mL of DMSO, filter through an oil film for sterilization, and store at -20 °C. Prepare immediately before each use, dilute the AS stock solution 1000 times with the Agrobacterium benzoate infection solution. Frozen P24Y Agrobacterium was streaked onto LB agar plates containing 50 μg / mL spectinomycin and gentamicin using an inoculation loop. The plates were streaked three times and incubated at 28°C for 48 h. After single-colony electrophoresis to verify the bands, the cells were added to 20 mL of LB agar containing antibiotics and incubated with shaking for 48 h. After centrifugation at 5000 rpm for 5 min, the cells were collected, washed twice with Agrobacterium infection solution, and diluted to OD200. 600 The concentration is 0.6-0.8. After being placed in the dark at 28°C for 2 hours, the solution is injected from the back of the tobacco leaf using a 1mL syringe.

[0048] Subcellular localization of fluorescent probes and treatment with UNC3230: Two days after injecting the PI(4,5)P2 fluorescent indicator probe P24Y Agrobacterium infection solution into tobacco, tobacco leaves were sprayed with 1 μM UNC3230 (10 mg UNC3230 was dissolved in 2.9033 mL DMSO to prepare a 10 mM stock solution, which was then diluted with water to 1 μM before actual use). The control was sprayed with an equal volume of diluted DMSO solution. After 24 h of treatment, tobacco leaves were cut, laid flat on glass slides, and water was added. The fluorescent protein CITRINE was observed at an excitation wavelength of 514 nm, the emission wavelength of 530-600 nm, and the chloroplasts were observed at an emission wavelength of 650 nm.

[0049] 1.1.4 UNC3230 regulates susceptibility to strawberry powdery mildew

[0050] UNC3230 treatment of strawberry tissue culture seedlings and powdery mildew inoculation: 1 μM UNC3230 solution was evenly sprayed onto Red Beauty strawberry seedlings. The control group was sprayed with an equal volume of diluted DMSO solution. After 24 hours, 2×10⁻⁶ [unclear text - possibly a reference number or a number of plants] were treated. 6 A suspension of powdery mildew conidia at CFU / mL was evenly sprayed onto the leaves of seedlings, and the disease resistance phenotype was recorded on day 10.

[0051] Observe the microstructure using a conventional optical microscope: Cut 3-4 leaves and place them in a 10mL centrifuge tube. Add 2-3mL of trypan blue staining solution (dissolve trypan blue in a solution with a volume ratio of water:glycerol:lactic acid:phenol:ethanol of 1:1:1:1:6, to a final concentration of 0.67mg / mL). Heat the centrifuge tube in a 100℃ water bath for 10-15 minutes, then cool it in a fume hood (about 30 minutes). Aspirate the trypan blue staining solution and add 3mL of chloral hydrate (Sigma, 1kg dissolved in 400mL water, stored in a refrigerator) for decolorization for 24 hours. Repeat this process with another 3mL of chloral hydrate for 1-2 days. The waste chloral hydrate should be collected separately.

[0052] Treatment of tobacco leaves transiently expressing the PI(4,5)P2 fluorescent probe P24Y with UNC3230 resulted in a decrease in the fluorescence distribution indicated by P24Y in the tobacco (Figure 1), indicating that UNC3230 can inhibit the catalytic effect of PIP5K, leading to a reduction in the content of PI(4,5)P2 in the plant. Spraying strawberry tissue culture seedlings with the PIP5K inhibitor UNC3230 significantly reduced the severity of strawberry powdery mildew compared to the control group. Macroscopically, the powdery mildew layer on the leaves of the treated Red Face strawberry was significantly reduced, and microscopically, the number of powdery mildew conidia was also significantly decreased.

[0053] Example 2: PIP5K candidate gene with high expression level and significant response to powdery mildew infection in octoploid strawberries

[0054] 2.1 Identification of the PIP5K gene family in octoploid strawberries

[0055] The Fragaria×ananassa FL15.89-25 Genome v1.0 Assembly & Annotation version strawberry genome data and annotation files were downloaded from the Strawberry Genome Database (https: / / www.rosaceae.org / ). The longest transcript was selected from the CDS and protein files and used as a representative sequence of a gene. The Hidden Markov Model (HMM) PF01504 for the PIP5K gene family was downloaded, and hmmsearch was used to search for sequences containing the PIP5K domain in the strawberry proteome to obtain candidate family proteins. The protein sequences obtained in the previous step were aligned to the pFAM database using hmmscan to further identify protein sequences containing the PIP5K domain (MORN / PIPKc / PIP5K) as target gene family sequences, resulting in a total of 88 genes (Figure 2). The parents of “FL15.89-25” are Florida Beauty and FL12.115-10. This version of the genome is haplotyped, and each haplotype has its own file. The prefix Bea indicates a haplotype inherited from Florida Beauty, and the prefix F12 indicates a haplotype inherited from FL12.115-10. Genes named Fab* are from subgenome Bea, and genes named Faf* are from subgenome F12.

[0056] 2.2 Spatiotemporal expression differences of PIP5K gene in different tissues of strawberry in response to powdery mildew infection

[0057] Transcriptome data from different tissues and fruit maturity stages (receptacle and achene) of *Strombocybe camarosa* (NCBI bioproject: PRJEB12420) and transcriptome data from *Strombocybe rubra* leaves responding to powdery mildew infection (CNCB bioproject: PRJCA001734, GSAs: CRA001964) were downloaded and combined with the identified 88 members of the PIP5K gene family. A heatmap was generated using log2(fpkm+1) transformation (Figure 3). Since the octoploid strawberry genome has eight haplotypes and contains numerous identical or highly homologous alleles or homologous genes, CD-hit-est was used to remove redundancy from highly homologous sequences (-c 0.97) during expression level calculations. Only representative sequences were retained for expression level calculations, simplifying the 88 genes into 27 highly similar gene clusters. The representative sequences in Figures 3 and 4 represent the overall expression levels of the entire highly similar gene group. Highly expressed gene clusters FabPIP5K05, FabPIP5K06, FabPIP5K10, FabPIP5K21, FafPIP5K03, and FafPIP5K34 were identified. Among them, FabPIP5K06, FabPIP5K10, FabPIP5K21, and FafPIP5K03 showed significant responses to powdery mildew infection, exhibiting increasing, decreasing, increasing, and increasing expression patterns, respectively. The FabPIP5K21 cluster showed high expression and a significant response to powdery mildew infection changes, and was selected as a candidate for subsequent cloning.

[0058] Example 3: Cloning of the FafPIP5K21 / FafPIP5K21 gene

[0059] The FabPIP5K21 cluster is a group of highly homologous genes of equal length, actually comprising eight sequences (Table 1): FabPIP5K21, FabPIP5K24, FabPIP5K27, FabPIP5K30, FafPIP5K18, FafPIP5K21, FafPIP5K26, and FafPIP5K27. These sequences are all 2493 bp in length and share a sequence similarity of over 98%. PCR conditions and primer sequences were optimized for cloning of these eight sequences, resulting in FabPIP5K24 and FafPIP5K21 genes with identical copy sequences but located on different chromosomes: Fvb 6-2 in the Bea subgenome and Fvb 6-2 in the F12 subgenome, respectively.

[0060] Table 1 FabPIP5K21 cluster members

[0061] RNA extraction and cDNA synthesis: Leaves from tissue culture seedlings of *Strombocys rubescens* were ground into powder in liquid nitrogen. 50-100 mg of the powder was weighed and RNA was extracted according to the instructions of the Novizan Fast Pure Universal Plant Total RNA Isolation Kit (RC411). Electrophoresis and Nano-Drop were used to verify the RNA extraction efficiency, and the RNA concentration was determined. cDNA synthesis was performed using the Novizan HiScript III All-in-one RT SuperMix Perfect for qPCR (R333) reagent. 1 pg-1 ng of RNA was used to synthesize cDNA in one step according to the reagent instructions. The cDNA was stored at -20℃.

[0062] Cloning of the FabPIP5K24 / FafPIP5K21 gene: Cloning was performed using Novizan high-fidelity enzyme 2×Phanta Max Master Mix (Dye Plus). The primer sequences were ACATTCCCGAGGGTAAGGGA (upstream primer 5′–3′) and TCGCCCTCATAAACAGCACC (downstream primer 5′–3′). The PCR system consisted of 8 μL ddH2O, 12.5 μL Mix, 1 μL forward primer, 1 μL reverse primer, and 2.5 μL cDNA. Annealing was performed at 56℃, extension time was 2 min 17 s, and the cycle number was 33. After confirming the bands were correct by electrophoresis, a 50 μL PCR system was prepared. The gel was cut and recovered when the electrophoretic bands were correct (Figure 5). The procedure was performed according to the Novizan kit instructions. The recovered fragments were analyzed for concentration and purity using Nano-Drop, transformed into E. coli DH5α, and positive single colonies verified by PCR were sent to Qingke Biotechnology (Hangzhou) for sequencing and comparison with predicted sequences (CDS nucleotide sequences are shown in SEQ ID No. 1, and the amino acid sequence of the protein encoded by the strawberry FafPIP5K24 / FafPIP5K21 gene is shown in SEQ ID No. 2). Plasmids confirmed by comparison were transformed into Agrobacterium, and Agrobacterium with correct bands were cryopreserved in glycerol (Agrobacterium bacterial culture: 50% glycerol volume ratio = 1:1) at -80℃.

[0063] T-vector construction: Gene clones were recovered via gel extraction and constructed into T-vectors according to the pNC-AEnTopo blunt-end cloning vector kit instructions. After transformation into *E. coli* DH5α, the vectors were plated, and single clones were picked for electrophoresis to verify the bands. The bacterial cultures corresponding to positive clones were sent to Qingke Biotechnology Co., Ltd. (Hangzhou) for sequencing. Sequencing results that correctly aligned were used to transform the overexpression vector.

[0064] Example 4: Construction of FabpIP5K24 / FafPIP5K21 gene overexpression and silencing vectors

[0065] Overexpression vector construction: The FabPIP5K24 / FafPIP5K21 gene from pNC-AEnTopo was used to replace the NC cloning frame of the overexpression vector, resulting in pNC-cambia2304-FabPIP5K24 / FafPIP5K21-OE (map shown in Figure 6). This vector was transformed into *E. coli*, and kanamycin (50 μg / mL) was added to the transformation plate. Sequencing confirmed the plasmid transformation into *Agrobacterium* GV3101. *E. coli* and *Agrobacterium* were stored at -80℃.

[0066] Silent vector construction: A 442bp fragment (sequence 1) on the CDS region of FappIP5K24 / FafPIP5K21 was selected as the target fragment with a GC content of 45%. Primers with universal NC cloning adapter sequences at both ends were designed to clone the target fragment into the two NC cloning frames of the vector simultaneously in both directions, resulting in pNC-cambia2304-FabPIP5K24 / FafPIP5K21-RNAi (map shown in Figure 7), forming an hpRNA expression structure. After confirming the correctness of the bands by electrophoresis, the vector was transformed into E. coli. Kanamycin (50 μg / mL) and chloramphenicol (5 μg / mL) were added to the transformation plate. After confirming the correctness by sequencing, the vector was transformed into Agrobacterium GV3101 and stored at -80℃.

[0067] (1) The nucleic acid sequence of the RNAi vector targeting fragment sequence 1 is shown in SEQ ID No. 3:

[0068] (2) Sequence 1 fragment cloning primers (underlined parts are NC universal adapters):

[0069] F-RNAi:

[0070]

[0071] R-RNAi:

[0072]

[0073] Example 5: Functional verification of the FabPIP5K24 / FafPIP5K21 gene

[0074] Antibiotic preparation method: Weigh rifampicin powder, add DMSO to dissolve, and prepare a solution of 25 mg / mL; dissolve chloramphenicol in anhydrous ethanol to prepare a solution of 50 mg / mL; dissolve kanamycin in sterile water to prepare a solution of 50 mg / mL; filter through a filter membrane for sterilization and dispense into 1.5 mL sterile EP tubes.

[0075] Preparation of Agrobacterium infection solution: Prepare the infection solution Co-buffer according to MS 4.44 g / L + sucrose 20 g / L, pH=5.8, sterilize and store at 4℃. Prepare a 200 mM acetylsylgenin (AS) stock solution, and dilute it 1000 times in the Co-buffer before use.

[0076] Preparation of Agrobacterium infection solution: Take out the glycerol bacteria of pNC-cambia2304-FabPIP5K24 / FafPIP5K21-OE and pNC-cambia2304-OE-empty vector stored at -80℃ and streak them on LB agar plates resistant to kanamycin and rifampicin using an inoculation loop; single colony glycerol bacteria of pNC-cambia2304-FabPIP5K24 / FafPIP5K21-RNAi and pNC-cambia2304-FabPIP5K24 / FafPIP5K21-RNAi-empty vector stored at -80℃ and streak them on LB agar plates resistant to chloramphenicol, kanamycin and rifampicin using an inoculation loop. After streaking three times, the culture was incubated at 28℃ for 48 hours. Single-colony electrophoresis confirmed the bands were correct. The culture was then added to 20 mL of LB broth with the appropriate antibiotic and incubated on a shaker at 180 rpm for 24 hours. The culture was then transferred to 200 mL of LB broth for expansion until the OD reached approximately 0.8. The culture was centrifuged at 4000 rpm for 5 minutes and resuspended in Agrobacterium infection solution (with acetylsyleugenone added before use) and incubated at 28℃ for 2-3 hours.

[0077] Agrobacterium-mediated vacuum permeation of strawberry tissue culture seedlings: Large volumes of Agrobacterium-mediated infection solutions of FabPIP5K24 / FafPIP5K21-OE and empty vector-OE, and FabPIP5K24 / FafPIP5K21-RNAi and empty vector-RNAi were prepared and dispensed into sterile plant tissue culture glass flasks, 200 mL per flask. The tissue culture seedlings, along with their roots, were carefully removed from the agar medium in a clean bench and placed in the Agrobacterium suspension with the leaves facing down and the roots facing up. The flasks were then placed in a water-circulating vacuum pump container with the caps open, and the vacuum pressure was maintained at 0.7 MPa. During the process, air bubbles were observed to escape from the leaves. After 10 min of treatment, the seedlings were removed, dried on absorbent paper, and then transplanted into flower pots. On day 5, samples were taken to determine the PI(4,5)P2 content in the leaves.

[0078] Extraction and determination of PI(4,5)P2 from strawberry tissue culture seedling leaves: Strawberry leaves were ground into powder in liquid nitrogen. Approximately 100-200 mg of powder was weighed for each sample. 1 mL of 0.5 M trichloroacetic acid (TCA) was added, and the mixture was incubated on ice for 5 min. The mixture was then centrifuged at 3000 rpm for 7 min at 4℃, and the supernatant was discarded. 1 mL of 5% TCA / 1 mM EDTA was added to the precipitate in the test tube, vortexed for 30 s, and centrifuged at 3000 rpm for 5 min. The supernatant was discarded, and the washing process was repeated once. 1 mL of MeOH:CHCl3 (2:1) was added, and the mixture was vortexed at room temperature for 10 min, centrifuged at 3000 rpm for 5 min, and the supernatant was discarded. The extraction process was repeated once. Add 750 μL MeOH:CHCl3:HCl (80:40:1), vortex for 25 min at room temperature, centrifuge at 3000 rpm for 5 min, transfer the supernatant to a new 2 mL centrifuge tube, add 250 μL CHCl3 and 450 μL 0.1N HCl, vortex for 30 s, centrifuge at 3000 rpm for 5 min, separating the organic and aqueous phases. Use a pipette tip to transfer 0.5 mL of the lower organic phase to a 1.5 mL centrifuge tube, and desiccate in a vacuum desiccator for 45-60 min. The organic phase will evaporate; the dried lipids are invisible to the naked eye and can be stored at -20℃. For sample determination, resuspend in PBS for subsequent ELISA absorbance measurements. The PI(4,5)P2 enzyme-linked immunosorbent assay kit (Echelon Biosciences) was used to determine the PI(4,5)P2 levels in different samples using a competitive enzyme-linked immunosorbent assay. According to the detection protocol, the colorimetric signal was read at an absorbance of 450 nm. The colorimetric signal was inversely proportional to the amount of PI(4,5)P2 extracted from the cells. The results are shown in Figure 8. The PI(4,5)P2 content in strawberry leaves transiently transformed with the overexpression vector increased by 69.4% compared with the empty vector, while the PI(4,5)P2 content in strawberry leaves transiently transformed with the silencing vector decreased by 31.0% compared with the empty vector. This indicates that the FabPIP5K24 / FafPIP5K21 gene can be successfully expressed in strawberry leaves and can play a catalytic role in producing a higher content of PI(4,5)P2, thus verifying the function of the FabPIP5K24 / FafPIP5K21 gene in strawberries.

[0079] Example 6: Regulating powdery mildew susceptibility using the FabpIP5K24 / FafPIP5K21 gene

[0080] Genetic transformation of strawberry tissue culture seedlings using overexpression and silencing vectors: As in Example 5, strawberry tissue culture seedlings were transformed by vacuum permeation with Agrobacterium and planted in flower pots for 48 hours. Strawberry powdery mildew spore suspension was sprayed evenly, and the phenotype was recorded on the 10th day after powdery mildew inoculation.

[0081] The method for calculating the percentage of lesion area is as follows: calculate the proportion of the area of ​​the white mycelial layer on the surface of the whole leaf to the total leaf area at 10 dpi, and calculate the average percentage of lesions in the experimental group and the control group.

[0082] FabPIP5K24 / FafPIP5K21 gene regulates powdery mildew susceptibility: Agrobacterium infection solution was immersed in seedling leaf tissue using the Agrobacterium vacuum permeation method. The expression level of FabPIP5K24 / FafPIP5K21 gene was measured at 10 dpi (the primers for the measurement are shown in Table 2), and the phenotype of powdery mildew disease severity was observed.

[0083] Table 2 Primers for determining the expression levels of the strawberry FabpIP5K24 / FafPIP5K21 gene

[0084] As shown in Figure 9, the expression level of the FabPIP5K24 / FafPIP5K21 gene in transiently transformed strawberries overexpressed was 3 times that of the empty vector control, and the percentage of powdery mildew-affected area increased by an average of 12.4 percentage points; the expression level of the FabPIP5K24 / FafPIP5K21 gene in transiently transformed strawberries silenced was 0.7 times that of the empty vector control, and the percentage of powdery mildew-affected area decreased by an average of 7.9 percentage points.

Claims

1. Application of a strawberry FabPIP5K24 / FafPIP5K21 gene or a protein encoded by the same in regulating susceptibility of strawberry to powdery mildew.

2. Application of a strawberry FabPIP5K24 / FafPIP5K21 gene or a protein encoded by the same in preparing a medicine for reducing susceptibility of strawberry to powdery mildew.

3. Use according to claim 1 or 2, characterized in that, The CDS nucleotide sequence of the strawberry FabPIP5K24 / FafPIP5K21 gene is shown as SEQ ID No. 1, and the amino acid sequence of the protein encoded by the strawberry FabPIP5K24 / FafPIP5K21 gene is shown as SEQ ID No.

2.

4. A method of modulating the susceptibility to powdery mildew in Fragaria, characterized in that, When it is necessary to reduce the susceptibility of strawberry to powdery mildew, the FabPIP5K24 / FafPIP5K21 gene in strawberry is silenced or knocked out; when it is necessary to increase the susceptibility of strawberry to powdery mildew, the FabPIP5K24 / FafPIP5K21 gene in strawberry is overexpressed.

5. The method of claim 4, wherein, The CDS nucleotide sequence of the strawberry FabPIP5K24 / FafPIP5K21 gene is shown as SEQ ID No.

1.

6. The method of claim 5, wherein, When the FabPIP5K24 / FafPIP5K21 gene in strawberry is silenced or knocked out, the following steps are included: (1) constructing a gene silencing or knocking out vector, wherein the gene silencing or knocking out vector is a plant expression vector with a sequence for silencing or knocking out the FabPIP5K24 / FafPIP5K21 gene; (2) introducing the gene silencing or knocking out vector of step (1) into cells of strawberry to silence or knock out the FabPIP5K24 / FafPIP5K21 gene, and culturing the transgenic strawberry plant.

7. The method of claim 6, wherein, The plant expression vector is pNC-cambia2304.

8. The method of claim 6, wherein, The target sequence for gene knockout is shown as SEQ ID No.

3.

9. Application of a strawberry FabPIP5K24 / FafPIP5K21 gene or a protein encoded by the same in breeding of strawberry, wherein a strawberry plant line with low susceptibility to powdery mildew is obtained by screening a strawberry plant with silenced or knocked out FabPIP5K24 / FafPIP5K21 gene, or a strawberry plant line with low susceptibility to powdery mildew is obtained by screening a strawberry plant with low or no expression of a protein encoded by the FabPIP5K24 / FafPIP5K21 gene.

10. A medicament for reducing the susceptibility of strawberry powdery mildew, characterized by, The active ingredient includes a sequence for knocking out or silencing the FabPIP5K24 / FafPIP5K21 gene of strawberry, or a compound for inhibiting the protein encoded by the FabPIP5K24 / FafPIP5K21 gene of strawberry, The CDS nucleotide sequence of the strawberry FabPIP5K24 / FafPIP5K21 gene is shown as SEQ ID No. 1.

Images