Coupled microparticle containing indexed PCR primers, and use thereof

By designing microparticles coupled with indexed PCR primers, the problems of limited throughput, high cost, and complex operation in existing high-throughput single-cell sequencing technologies have been solved, enabling efficient and low-cost single-cell multi-omics sequencing suitable for multimodal detection.

WO2025247276A1PCT designated stage Publication Date: 2025-12-04LANTU BIOTECHNOLOGY (SUZHOU) CO LTD
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2025/097790
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-05-28
Filing Date
2025-05-28
Publication Date
2025-12-04

AI Technical Summary

Technical Problem

Existing high-throughput single-cell sequencing technologies suffer from limited throughput, high cost, complex operation, and difficulty in achieving multimodal detection. In particular, the throughput and technological maturity of single-cell multi-omics sequencing lag behind, and existing methods cannot add cell barcodes or partial cell barcodes in the PCR step, which hinders the development of new technologies.

Method used

Design a microparticle that couples to indexed PCR primers, and chemically binds the microbeads to the PCR primers for use in high-throughput parallel reaction systems to achieve barcode labeling of target nucleic acid molecules, including droplet microfluidics and microreaction systems, simplifying operation and reducing costs.

Benefits of technology

It achieves high-throughput, low-cost single-cell multi-omics sequencing, improves cell throughput, reduces the false single-cell rate, maintains data quality and stability, is suitable for multimodal detection, and solves the throughput and cost problems of existing technologies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2025097790_04122025_PF_FP_ABST
    Figure CN2025097790_04122025_PF_FP_ABST
Patent Text Reader

Abstract

The present invention provides a bead-coupled microparticle containing barcoded PCR primers. The microparticle can be delivered to a plurality of different reaction systems in a single reaction by means such as droplet microfluidics, and reaction system-specific barcodes are added to target nucleic acid molecules in the reaction systems in a high-throughput parallel manner, so as to complete the construction of single-cell transcriptome or multi-omics sequencing libraries.
Need to check novelty before this filing date? Find Prior Art

Description

A microparticle coupled with indexed PCR primers and its application Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to high-throughput multimodal indexing, labeling, and sequencing detection of nucleic acid materials in single cells or subcellular structures. Background Technology

[0002] The rapid development of single-cell high-precision sequencing technology has greatly deepened human understanding of cellular diversity and heterogeneity, playing a revolutionary role in the discovery of biological laws and the development of new diagnostic and therapeutic methods in the medical field. The essence of single-cell sequencing is to determine the sequence, copy number, modification state, and interactions with other molecules of nucleic acid target molecules in a single cell, revealing information such as genomic variation, gene expression abundance, epigenetic modification sites, and regulatory elements. Nucleic acid target molecules can be the entirety of DNA and / or RNA, or a specific subset. For example, using the Tn5 enzyme to cleave DNA in its chromatin state can selectively enrich open chromatin regions. Using reverse transcription primers containing PolyT can selectively enrich mRNA. Using sequence-specific primer hybridization can target and enrich specific genes and elements.

[0003] Nucleic acid target molecules can also be non-endogenous, artificially synthesized nucleic acids. For example, Perturb-seq uses viral transfection to deliver sgRNA for embedding in cells for expression, and single-cell transcriptome sequencing simultaneously detects the sgRNA sequence, thus identifying the target gene that is perturbed in each cell.

[0004] Single-cell multi-omics sequencing refers to the joint detection of different modalities within the same cell. There are two main approaches: First, designing two or more capture sequences to capture signals from different modalities, but integrating this information through conjugated delivery and pairing. For example, 10X Genomics' Multiome product uses microspheres to conjugate reverse complementary sequences of PolyT and Tn5 inserts to achieve dual-omics detection of RNA and ATAC in the same cell. Second, modality signal conversion. For example, CITE-seq uses protein-specific antibodies conjugated to pre-encoded nucleic acid molecules, converting the determination of a specific protein modality into the detection of a transcriptome modality, thus enabling simultaneous determination of both RNA and protein information through single-cell transcriptome sequencing.

[0005] Over 400 library preparation techniques have been reported for bulk sequencing. Their individual challenges include the selective labeling of target nucleic acid molecules, while the common core technical challenge is converting these target nucleic acid molecules into nucleic acid fragments suitable for amplification (PCR, RCA, IVT). Furthermore, the core technical challenge of high-throughput single-cell sequencing or high-throughput single-cell multi-omics sequencing is adding cell-specific barcodes to all target nucleic acid molecules within the same cell. Currently, there are two main technical approaches.

[0006] The first type: Single-round high-density microreaction systems and coded microbead capture. Taking the GEM (Gel in Emulsion) technology (PMID:28091601) of the 10X Genomics Chromium platform as an example, the core concept is to form approximately 100,000 or more droplets with a volume of about 1 nanoliter as independent microreaction systems through the physical segmentation of the oil and water phase interfaces in a droplet microfluidic system. Each droplet encapsulates a reaction reagent, a single cell, and microbeads coupled with barcodes to form particles. Microreaction systems can also be implemented using high-density nanopores. Millions of capture sequences (e.g., PolyT) coupled on the same microbead have the same barcode, while different particles have different barcodes. Since there is only one cell within a reaction system, the barcode coupled to the microbeads is both a reaction system-specific barcode and a cell-specific cell barcode. The limitation is that the throughput is almost directly proportional to the pseudo-single-cell rate, and it is difficult to increase the cell throughput to around 10,000, and the cost is high.

[0007] The second type is high-throughput single-cell library construction technology using multi-round tag combination labeling. Represented by the SPLiT-seq technology based on split-pooling established by the AB Rosenberg team in 2018, this technology achieves ultra-high throughput without requiring microfluidic or micropore preparation equipment or particle preparation. Using fixed cells or the cell nucleus itself as the microreaction system, it sequentially adds partial cellular barcodes to target nucleic acid molecules in situ within the cell through 3 to 4 rounds of reactions (including RT, ligation, PCR, etc.). The complete cellular barcode is formed through the combination of multiple rounds of barcodes. In each round of reaction, the reaction system-specific barcode is shared by multiple intracellular and target nucleic acid molecules, typically ranging from dozens to hundreds of types. Its limitations include complex operation and inflexible throughput.

[0008] Current high-throughput single-cell omics methods all have their own shortcomings and pain points, especially single-cell multi-omics, whose throughput and technological maturity lag far behind single-cell transcriptomics. The core issue of omics technology is to transform target nucleic acid molecules within cells into amplifiable nucleic acid fragments through molecular biology techniques, and finally to construct libraries using PCR with sequencing adapters for sequencing. Hundreds of bulk-sequencing technologies are currently mature enough to detect specific intracellular modalities, but most have not yet reached single-cell accuracy. High-density microreaction systems and encoded microbead capture are the mainstream technologies for commercial single-cell sequencing. However, designers of existing technologies prefer to couple cell barcodes with modality-specific capture sequences, which requires the costly resynthesis of new encoded microbeads for each new single-cell sequencing modality, hindering the development of new technologies. Therefore, it is essential to construct a single-cell barcode labeling technology that is simple to operate, inexpensive, has flexible cell throughput, and is also suitable for multimodal detection. Summary of the Invention

[0009] Current single-cell sequencing technologies primarily focus on adding cell barcodes in early steps such as target nucleic acid molecule capture and the formation of amplifiable nucleic acid fragments. While PCR is an unavoidable final step in all omics library construction methods, there is currently a lack of methods and products for adding cell barcodes or partial cell barcodes in parallel with approximately 100,000 or more samples. This invention designs microbeads coupled with PCR primers containing barcodes. These microbeads can be delivered in a single reaction to two to one million or more different reaction systems via microfluidic means, including but not limited to droplet-based methods. This allows for high-throughput parallel addition of reaction-specific barcodes to target nucleic acid molecules within the reaction system, enabling library construction for single-cell transcriptome or multi-omics sequencing.

[0010] Based on this, the present invention was completed.

[0011] In a first aspect, the present invention provides a microparticle coupled with indexed PCR primers, the microparticle comprising microbeads and indexed PCR primers, wherein the microbeads and primers are coupled by chemical bonds; the microbeads, as a carrier, carry the indexed PCR primers and deliver them to a specific conventional reaction system or microreaction system, and then release the primers in a controlled manner.

[0012] Furthermore, the material of the microbeads is selected from gels, synthetic polymers, or magnetic beads.

[0013] Furthermore, the gel is a natural polymer material, including but not limited to alginate, chitosan, agarose, gelatin, fibrinogen and / or peptides.

[0014] Furthermore, the synthetic polymers include, but are not limited to, polyethylene glycol, polyacrylic acid, polyvinyl alcohol, polyacrylamide, polyhydroxymethyl methacrylate and / or polyacrylamide.

[0015] Furthermore, the magnetic beads are made of iron(III) oxide magnetic material.

[0016] Furthermore, the diameter of the microspheres is 5-50 μm.

[0017] Furthermore, the diameter of the microspheres is 10μm-40μm.

[0018] Furthermore, the indexed PCR primer comprises three parts: a fixed sequence 1, an index sequence, and a fixed sequence 2; wherein the fixed sequence 1 is a sequencing adapter, the fixed sequence 2 is a capture sequence, and the index sequence is a particle-specific barcode sequence.

[0019] Furthermore, the sequencing adapter is selected from the adapters of the Illumina sequencer or the sequencing library combined with the sequencing chip to generate the cluster sequence.

[0020] Furthermore, the sequence of the cluster generated by combining the sequencing library with the sequencing chip is selected from the P5 sequence, the P7 sequence, or a partial sequence of both the P5 and P7 sequences.

[0021] Furthermore, the capture sequence is selected from the sequencing primer binding site sequence of the Illumina sequencer or any targeted sequencing capture sequence.

[0022] Furthermore, the sequencing primer binding site sequence of the Illumina sequencer is selected from partial sequences of TruSeq read1, TruSeq read2, Nextera read1, Nextera read1, or above.

[0023] Furthermore, the fixed sequence 1 and fixed sequence 2 can be adjusted according to the sequencer used in subsequent sequencing reactions.

[0024] Furthermore, the nucleotide sequence of the index sequence is random, and each site can be any of the four bases A, T, C, and G.

[0025] Furthermore, the length of the index sequence is 1-25 bp.

[0026] Furthermore, the connection methods between the microbeads and the indexed PCR primers include, but are not limited to, links that release chemical bonds, polyacrylamide links cleaved by strong reducing agents, or biotin-streptavidin links.

[0027] Furthermore, the linking of the releasable chemical bonds includes dU that can be released by the USER enzyme or amino modifications that can be released by photolysis.

[0028] Furthermore, the copy number ratio between the microbeads and the indexed PCR primers is 1:N, where N is greater than or equal to 1, preferably N is 10. 7 -10 8 .

[0029] Furthermore, different types of PCR primers can be coupled to the same microbead containing indexed PCR primers, preferably 1-5 types of PCR primers.

[0030] Furthermore, 2-5 different types of PCR primers can be coupled to the same microbead containing indexed PCR primers.

[0031] Furthermore, the different types of PCR primers contain at least one different sequence from fixed sequence 1 and fixed sequence 2.

[0032] Furthermore, the index sequences of primers of the same type coupled to the same microbead containing indexed PCR primers are the same, while the index sequences of primers of different types may be the same or different, and the index sequences of primers coupled to different microbeads are different.

[0033] Furthermore, the fixed sequence 2 of the microparticle coupled with the indexed PCR primer hybridizes with the common sequence of the target nucleic acid molecule.

[0034] Furthermore, the target nucleic acid molecule refers to a modified target nucleic acid molecule, wherein the modification involves adding a sequence capable of hybridizing with fixed sequence 2 to one or both ends of the target nucleic acid molecule.

[0035] In a second aspect, the present invention provides a method for preparing microparticles coupled with indexed PCR primers as described in the first aspect, the method comprising the following steps:

[0036] S1: Fixed sequence 1 is synthesized by chemical method, and the 5' end of fixed sequence 1 is chemically modified;

[0037] S2: The modified fixed sequence 1 is affinity-linked with specific microbeads, and then random bases of the index sequence are synthesized by split-pooling using a two-step cyclic enzymatic DNA synthesis method or ligation method.

[0038] S3: After the index sequence is synthesized, the fixed sequence 2 is synthesized by enzymatic method. Specific bases are added to a reaction tank to complete the synthesis of the fixed sequence 2, and the microbeads coupled with the indexed PCR primers of the present invention are obtained.

[0039] Furthermore, in step S1, the chemical synthesis refers to the use of solid-phase phosphoramidite method to fix DNA on a solid support to complete the synthesis of DNA strands, with the synthesis extending from the 3' end to the 5' end of the primer to be synthesized, and adjacent nucleotides being linked by 3'→5' phosphodiester bonds.

[0040] Furthermore, in step S1, the chemical modification includes Acrydite or Biotin modification.

[0041] Furthermore, in step S1, the fixed sequence 1 is a sequencing adapter, selected from the adapter of the Illumina sequencer or the sequencing library combined with the sequencing chip to generate the cluster sequence.

[0042] Furthermore, the sequence of the cluster generated by combining the sequencing library with the sequencing chip is selected from the P5 sequence, the P7 sequence, or a partial sequence of both the P5 and P7 sequences.

[0043] Furthermore, in step S2, the fixed sequence 1 and the specific microbead affinity linking refers to the use of acrylic acid-modified primers to bind to polyacrylamide hydrogel microspheres, and biotin-containing primers to link to gel beads or magnetic beads with streptavidin on their surface.

[0044] Furthermore, in step S2, the microbeads coupled with fixed sequence 1 are divided into 4 reaction chambers, and each reaction chamber contains only one type of synthetic base material. A base is synthesized at the 3' of fixed sequence 1 using TdT enzyme. After the reaction is completed, the microbeads in the 4 reaction chambers are mixed and then evenly distributed into 3-4 reaction chambers containing only one type of synthetic base material. This process is repeated multiple times to generate different throughputs of barcodes.

[0045] Furthermore, the reaction tank contains one of the bases dATP, dTTP, dCTP, or dGTP.

[0046] Furthermore, in step S2, the length of the index sequence is 1-25 bp.

[0047] Furthermore, in step S3, the fixed sequence 2 is selected from Truseq read1, Truseq read1, Nextera read1, Nextera read2 or a portion thereof.

[0048] Furthermore, the 5' end of the fixed sequence 2 is phosphorylated.

[0049] Thirdly, the present invention provides the application of the microparticles coupled with indexed PCR primers as described in the first aspect in the construction of high-throughput single-cell sequencing libraries for multiple omics modalities; wherein, when cells undergo PCR amplification, at least one amplification is performed on the sequencing cells by indexed-PCR amplification using the microparticles coupled with indexed PCR primers as described in the first aspect.

[0050] Furthermore, the various omics modalities include, but are not limited to, single modalities and combinations of single modalities such as scRNA-seq, scVDJ-seq, scATAC-seq, sc-whole genome sequencing, and scCUT&Tag, such as scRNA-seq+scATAC-seq single-cell dual-omics modality.

[0051] Furthermore, the indexed-PCR amplifies nucleic acids while simultaneously labeling them. Specifically, the fixed sequence 2 of the indexed-PCR primers specifically captures the target sequence, which is a sequence complementary to the fixed sequence 2 introduced into the target RNA and DNA molecules in situ through reverse transcription, ligation, transposition, and other reaction processes. Through indexed-PCR, the cellular origin of molecules in the final sequencing library can be distinguished.

[0052] Furthermore, the fixed sequence 2 of the microbead-conjugated PCR primer-containing microparticles hybridizes with the target nucleic acid molecule.

[0053] Furthermore, the target nucleic acid molecule refers to a modified target nucleic acid molecule, wherein the modification involves adding a sequence capable of hybridizing with fixed sequence 2 to one or both ends of the target nucleic acid molecule.

[0054] Fourthly, this invention provides a method for constructing high-throughput single-cell sequencing libraries with multiple omics modalities, the method comprising the following steps:

[0055] S1: Prepare single-cell suspensions for cell fixation and permeabilization;

[0056] S2: Perform indexed-PCR amplification on the cells, wherein the primers used for indexed-PCR are microparticles coupled with indexed PCR primers as described in the first aspect of the present invention.

[0057] Furthermore, the cell index introduced by the indexed-PCR can be a unique cell index or the last index of a multi-round combined index.

[0058] Furthermore, before introducing partial cell barcodes into cells using indexed-PCR, the target molecule is pre-labeled in situ on the cells / nucleus for multiple rounds, and the number of rounds for introducing partial cell barcodes of the same target molecule can be 1, 2, 3 or more.

[0059] Furthermore, the cell segmentation methods when introducing cell barcodes include, but are not limited to, microfluidics, manual and machine pipetting, or flow cytometry sorting.

[0060] Furthermore, the cell segmentation carrier when introducing cell barcodes can be water-in-oil microdroplets, nanopores, or microporous PCR plates.

[0061] Fifthly, the present invention provides a high-throughput single-cell sequencing library construction system with multiple omics modalities, comprising a tissue sample processing module and a cell indexing module;

[0062] The tissue sample processing module is used to prepare tissue into a single-cell suspension, and then perform cell fixation and permeabilization.

[0063] The cell indexing module refers to the high-density microreaction system indexed-PCR indexing of the treated cells, and the primers used in the indexed-PCR are the microparticles coupled with indexed PCR primers as described in the first aspect of this invention.

[0064] Furthermore, the cell indexing is performed in droplet microfluidics using GEM indexed-PCR indexing or in microplate equipment using indexed-PCR indexing of cells.

[0065] In one embodiment of the present invention, when the target cell library is less than 20,000 cells, it can be achieved independently using the droplet microfluidic GEM indexed-PCR of the present invention.

[0066] In one embodiment of the present invention, when the target cell library is 20,000 to 200,000 cells, it can be achieved by two rounds of labeling using the disclosed droplet microfluidic GEM indexed-RT and the droplet microfluidic GEM indexed-PCR of the present invention.

[0067] In one embodiment of the present invention, when the target cell library is 200,000 to 2,000,000 cells, a 96-well plate indexed Tn5 or the disclosed droplet microfluidic GEM indexed-ligation technology can be used, and the droplet microfluidic indexed-PCR of the present invention can be achieved through three rounds of labeling.

[0068] In a sixth aspect, the present invention provides a reagent kit for single-cell or subcellular indexing, the reagent comprising microparticles coupled with indexed PCR primers as described in the first aspect of the present invention; the microparticles comprising microbeads and indexed PCR primers, wherein the microbeads and primers are coupled by chemical bonds; the microbeads, acting as carriers, carry the indexed PCR primers and deliver them to a specific conventional reaction system or microreaction system, and then release the primers in a controlled manner. Beneficial effects

[0069] This invention develops a novel single-cell sequencing strategy. First, cells or subcellular structures are immobilized and permeable, or semi-permeable shells are constructed using polymer materials to encapsulate cells or subcellular structures, forming nucleic acid aggregates capable of multi-step reactions. This allows steps prior to PCR to be performed in bulk reactions. Based on this premise, microbeads coupled with barcoded PCR primers are designed. These microbeads can be delivered in a single reaction to two to one million or more different reaction systems via microfluidic means, including but not limited to droplet-based methods, adding reaction-specific barcodes to target nucleic acid molecules within the reaction system in a high-throughput, parallel manner. One embodiment of this invention achieves single-cell transcriptome sequencing using GEM-indexed-PCR instead of the existing GEM-indexed-RT, demonstrating the feasibility of this bulk sequencing to single-cell sequencing transformation. Furthermore, since PCR is the final step in all omics library construction, this transformation, by replacing the conventional PCR step with a large-scale indexed PCR step, is also universally applicable, enabling the detection of many modalities that have not yet reached single-cell precision to enter the single-cell era.

[0070] Furthermore, since the principles of this invention and existing single-cell sequencing technologies are orthogonal, they can be combined to achieve ultra-high throughput. When the required cell throughput is low, this invention can be used independently to complete library construction for single-cell sequencing through a single-round indexing process where only one cell is expected in a reaction system. When the required cell throughput is high, it can be combined with existing non-indexed-PCR cell barcoding techniques to define the final cell barcode through combined indexing, thus completing ultra-high throughput single-cell sequencing library construction. In particular, for existing multimodal detection that has already achieved single-cell accuracy, this invention can be integrated to achieve two or more rounds of indexing through extremely simple steps, thereby significantly increasing cell throughput, effectively reducing the false single-cell rate and cost, while maintaining high data quality and high stability. This solves the problem that existing methods cannot simultaneously achieve high cell throughput, ease of operation, low cost, low false single-cell rate, low empty load rate in microreaction systems, high data quality, and strong applicability. Attached Figure Description

[0071] Figure 1. Schematic diagram of microparticles coupled with indexed PCR primers. a represents the microparticle and sequence structure; bi represents examples of specific primer sequences. Each microparticle can independently perform the function of single-cell sequencing library construction.

[0072] Figure 2 illustrates a single-cell omics library construction (one-round labeling) scheme based on microparticles coupled with indexed PCR primers. Immobilized and permeabilized cells or nuclei undergo in situ reverse transcription (RT), transposition (Tn5) reactions, or a combination of Tn5 and RT reactions followed by droplet microfluidic techniques to create microreactions. Each droplet encapsulates a microparticle coupled with an indexed PCR primer and a single cell. Using different upstream reactions and various PCR sequences, single-cell transcriptomics (RNA-seq), chromatin accessibility (ATAC-seq), and RNA+ATAC-seq co-omics detection can be achieved.

[0073] Figure 3 shows the library construction process and library structure for conventional high-throughput single-cell omics (one-round labeling) based on droplet microfluidics using this invention. a. Library construction process and library structure for single-cell transcriptomics including 3' RNA-seq and 5' RNA; b. Library construction process and library structure for single-cell ATAC-seq; c. Library construction process and library structure for RNA+ATAC co-omics.

[0074] Figure 4 shows a scheme for applying microparticles with indexed PCR primers to single-cell omics library construction (2 rounds of labeling).

[0075] Figure 5 shows the library structure of microparticles based on indexed PCR primers applied to single-cell omics sequencing (2 rounds of labeling).

[0076] Figure 6 shows a scheme for applying microparticles with indexed PCR primers to single-cell omics library construction (3 rounds of labeling).

[0077] Figure 7 shows the library structure of a single-cell omics library (3 rounds of labeling) based on microparticles coupled with indexed PCR primers.

[0078] Figure 8 shows the dimensionality reduction visualization of the single-cell transcriptome species pooling experiment with one round of labeling. The single-cell transcriptome data were pooled according to a 1:1:10 ratio of human Hela:HEK293T:mouse cortical cells. Unsupervised clustering of the obtained data yielded three distinct cell clusters: clusters 1 and 2 represented Hela and HEK293T cells, respectively, while cluster 3 consisted of mouse cortical cells. Detailed Implementation

[0079] The specific embodiments of the present invention will be further described below. It should be noted that these descriptions are for the purpose of aiding understanding the present invention, but do not constitute a limitation thereof. Furthermore, the technical features involved in the embodiments described below can be combined with each other as long as they do not conflict with each other.

[0080] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, and the experimental materials used in the following embodiments are all available through conventional commercial channels.

[0081] The present invention relates to microparticles coupled with indexed PCR primers. The microparticles comprise microbeads and indexed PCR primers, wherein the microbeads and primers are chemically coupled. The microbeads act as carriers carrying the indexed PCR primers, delivering them to a specific conventional reaction system or microreaction system, and then releasing the primers in a controlled manner. The indexed PCR primers comprise three parts: a fixed sequence 1, an index sequence, and a fixed sequence 2. Fixed sequence 1 is a sequencing adapter, fixed sequence 2 is a capture sequence, and the index sequence is a microparticle-specific barcode sequence. The specific structure is shown in Figure 1a.

[0082] The application scenario of this invention is single-cell sequencing, but the smallest unit of the labeled target needs to be a nucleic acid aggregate coupled together to perform multi-step molecular biological reactions. The unit can be a cell, a subcellular component, such as a cell nucleus, organelle, vesicle, exosome, or any artificially defined nucleic acid aggregate. For simplicity, the terminology of single-cell sequencing will be used consistently. Achieving the coupling of the target nucleic acid includes, but is not limited to, treating natural cells or subcellular components with immobilizing agents, and also includes, but is not limited to, using polymeric materials to form a semi-permeable shell, so that the large nucleic acid molecules of the same cell are encapsulated and cannot flow out, but small molecules and reagents such as enzymes can pass through.

[0083] The templates for the PCR primers of this invention can be any publicly available omics technology used to convert target nucleic acid molecules into amplifiable nucleic acid fragments through molecular biology techniques. They can be molecules derived from single-modality or multi-modality sources.

[0084] The particle-specific barcode (index) of this invention can serve as a complete cell barcode, thus expecting only one cell in each reaction system. The PCR primer template is an amplifiable nucleic acid fragment that does not carry any cell barcode. This particle barcode can also serve as a partial cell barcode, allowing 2-1000 or more cells in each reaction system. The PCR primer template is an amplifiable nucleic acid fragment for which partial cell barcodes have been added in previous steps using other disclosed methods.

[0085] In the context of this invention, the terms "barcode" and "index" have the same meaning and are used interchangeably.

[0086] Example 1: Preparation of Microbeads

[0087] This invention provides a method for preparing primer-coupled gel beads, using highly monodisperse, biodegradable gel beads as a solid-phase carrier to covalently link PCR primers. The specific experimental procedure includes:

[0088] (1) Reagent preparation

[0089] Aqueous phase: a mixture of acrylamide solution, N,N'-bis(acryloyl)cysteine ​​BAC solution (cross-linking agent), ammonium persulfate APS solution (catalyst), TBSET buffer, and modified fixed sequence 1 (fixed sequence is Illumina P5 / P7, the 5' end of the sequence is modified with acrydite followed by Int HS-SH C6 modification), to achieve a final concentration of 0.392% acrylamide, 0.6% cross-linking agent, and 25 μM Oligo DNA.

[0090] Oil phase: Add 12 μL of catalytic accelerator: tetramethylethylenediamine (TEMED) to 3 mL of drop-surf oil and shake to mix.

[0091] (2) Preparation and curing of adhesive beads

[0092] The microdroplet preparation apparatus was installed and connected to the gas source, power supply, and PDMS chip (PDMS-FF-50 superhydrophobic chip). Aqueous and oil phases were added to their respective storage tanks. The gas source was turned on to purge air from the system, and the flow rates were set to 20 μL / min for the oil phase and 10 μL / min for the aqueous phase. After the microdroplets were stably generated, they were allowed to stand, transferred to centrifuge tubes, sealed with mineral oil, and cured overnight in an oven.

[0093] (3) Demulsification and cleaning of glue beads

[0094] Remove the oil phase and mineral oil from the centrifuge tubes, add demulsifier at a 1:2 volume ratio, shake and centrifuge, repeating until the microspheres are transparent. Then wash with 1% Span 80 hexane and TET buffer respectively. Finally, disperse the microspheres in TET buffer to obtain immobilized microspheres containing fixed sequences.

[0095] Example 2: Generation of PCR primers on microbeads

[0096] In Example 1, the fixed sequence 1 of the PCR primers was covalently bound to the polyacrylamide backbone of the microbeads via 5'-Acrydite modification. Subsequently, random sequences and fixed sequences 2 were generated on the microbeads using various methods.

[0097] Method 1: Random bases of index sequences are gradually added to microbeads through multiple rounds of enzymatic DNA synthesis reactions. Specifically, equal amounts of microbeads are added to four TDT enzyme synthesis reaction solutions, each containing only one type of nucleotide (3'-ONH2-dATP, 3'-ONH2-dGTP, 3'-ONH2-dCTP, or 3'-ONH2-dTTP). After one base extension, the reaction is terminated, and the reaction solution is washed away. The microbeads from the four reactions are then mixed and divided equally among four synthesis reactions containing only one type of nucleotide. Through 12 rounds of extension (split)-mixing (pool) reactions, a 12bp random sequence is generated, enabling combinations of over 700,000 tag sequences. Finally, a ligation reaction is performed to ligate a fixed sequence 2 (Fixed sequence 2 is Truseq read1, Truseq read1, Nextera read1, Nextera read2, or a portion thereof, with a phosphorylation modification at the 5' end) to the random sequence.

[0098] Method 2: A step-by-step, modular construction of the tag sequence is achieved through multi-round connection reactions. The random sequence is actually a combination of 96*96*96 tag sequences and 2 bridging sequences. The specific operation is as follows:

[0099] (1) Six primer sequences were synthesized, each with 96 tags. Primer 1 contains the 6nt terminal of fixed sequence 1 and an 8nt tag sequence 1 (e.g., 5'p-CCGATCT[tag sequence 1]-3'); sequence 2 includes a 14nt complementary sequence to the terminal of fixed sequence 1, the complementary sequence of the 8nt tag sequence 1 of primer 1, and the complementary sequence of the 4nt bridging sequence 1 (e.g., 3'-GCGAGAAGGCTAGA[tag sequence 1]CAGT-5'p); primer 3 consists of a 4nt bridging sequence 1 and an 8nt tag sequence 2 (e.g., 5'p-GTCA). [Tag sequence 2]-3'); Primer 4 contains the complementary sequence of 8nt tag sequence 2 and the complementary sequence of 4nt bridging sequence 2 (e.g., 3'-[Tag sequence 2]TGTC-5'p); Primer 5 contains the 4nt bridging sequence 2, the 8nt tag sequence 3, and the fixed sequence 2 or part of the fixed sequence 2 (e.g., 5'p-ACAG[tag sequence 3][fixed sequence 2: ACACTCTTTCCCTACACGACGCTCTTCCGATCT]); Primer 6 is the complementary sequence of tag sequence 3.

[0100] (2) First, in a 96-well plate, primers 1 and 2, primers 3 and 4, and primers 5 and 6 with the same tag sequence are annealed in pairs so that their complementary regions are bound by base pairing.

[0101] (3) The microbeads containing fixed sequence 1 obtained in Example 1 were divided into 96-well plates. T4 ligase reaction system was added to the 96-well plates, and an annealing product of primers 1 and 2 was added to each well for ligation reaction.

[0102] (4) After the reaction is complete, remove the annealing product from the previous step by centrifugation and washing. Collect the microbeads from the 96-well plate, mix them well, and dispense them into a new 96-well plate. Add the T4 ligase reaction system and add the annealing product of primers 3 and 4 to each well to carry out the second ligation reaction.

[0103] (5) Following the same procedure as above, add the annealing products of primers 5 and 6 to carry out the third ligation reaction.

[0104] (6) After centrifugation and washing to remove the reaction solution, collect all the microbeads in the 96-well plate into a tube.

[0105] Example 3: Independently Achieve Conventional Throughput Single-Cell Omics Library Construction for One Round of GEM-indexed PCR Labeling

[0106] The microparticles of the present invention, coupled with indexed PCR primers, are introduced as tags for single cells using droplet microfluidic GEM technology, enabling single-cell omics sequencing of multiple omics modalities (Figures 2 and 4). Note: N represents any bit of ATCG; V represents any bit of ACG; rG represents riboguanosines; +G represents LNA-modified guanosine.

[0107] Compared with the original experimental methods, the method of the present invention can greatly simplify the experimental operation and improve the data quality and stability.

[0108] The specific experimental procedures include: in situ reverse transcription of immobilized and permeabilized cells / nuclei (scRNA-seq, scVDJ-seq for RNA); or in situ transposition (scATAC-seq for open chromatin regions); or in situ transposition followed by RT reaction (dual-omics capture for both RNA and open chromatin regions). After completing the above reactions, the cells / nuclei are aliquoted with the indexed PCR primers of this invention using droplet microfluidics, ensuring that each effective microdroplet, microwell, or PCR plate contains one cell, one microbead, and the reaction components required for PCR amplification (including PCR enzyme, buffer, dNTPs, and paired primers). The number of microreactions can be adjusted according to the actual required cell throughput, achieving labeling of 1-10,000 cells. Different types of primers are used for different omics modalities (see Figures 2 and 3 for details). After the PCR reaction is completed, the target nucleic acid molecule of each cell is introduced into the microparticles of the indexed PCR primers of this invention as a cell tag and at least one sequencing adapter. Therefore, the products of all cells can be mixed and purified thereafter. The purified scRNA-seq is now a full-length cDNA product with both a cell tag and a sequencing adapter at one end. Further library construction is required, and after random fragmentation, another sequencing adapter is loaded at the other end of the sequence with the cell tag. In addition, TCR / BCR can be enriched from the full-length cDNA product using specific primers or probes and a library can be constructed to achieve sequencing of paired immune receptor sequences of the same cell (Figure 3.a). The purified scATAC-seq has a complete next-generation sequencing library structure and can be used for subsequent sequencing (Figure 3.b). The scRNA-seq and scATAC-seq dual-omics approach further enriches the full-length cDNA product and the chromatin open region library separately from the PCR pre-amplified product using specific primers. The scRNA-seq is further used for library construction, ultimately achieving single-cell dual-omics sequencing (Figure 3.c).

[0109] Specific experimental steps for high-throughput single-cell RNA + ATAC dual-omics:

[0110] (1) Prepare single-cell suspensions or cell nuclei and fix and permeabilize them;

[0111] (2) Add the processed cells or cell nuclei to a PCR tube, and add Tn5 transposition reaction solution (including TN5 enzyme and Mg2+). 2+ (buffer solution), mix well and then transpose;

[0112] (3) After the reverse transcription reaction is completed, the cells are centrifuged, the supernatant is removed, and the cells are resuspended in reverse transcription solution (including reverse transcriptase, buffer, dNTP, RT primer, TSO sequence). After thorough mixing, the reverse transcription reaction is carried out.

[0113] (4) Centrifuge the cells that have completed the reverse transcription reaction, remove the supernatant, resuspend the cells in PBS, centrifuge again to remove the supernatant, resuspend the cells in PBS, and count them.

[0114] (5) Take 10,000 cells and add PCR reaction solution (including NEBNext Ultra IIQ5 PCR enzyme, buffer, dNTP, TSO primer, P7 primer) and mix well.

[0115] (6) Load cells, reaction solution, 150,000 microbeads with barcode PCR primers (see Figure 1.e for structure details) and mineral oil into the corresponding well of one channel of a microfluidic chip to prepare water-in-oil microdroplets;

[0116] (7) Collect the prepared microdroplets (about 100,000) into a PCR tube and perform indexed PCR reaction;

[0117] (8) After completing the PCR reaction, break the water-in-oil structure and take the aqueous phase for use. Purified using the SILANE genomic DNA Kit (ThermoFisher, 37012D), and then purified using 1.8x XPbeads (Beckman Coulter, A63881);

[0118] (9) Take 1 / 4 of the indexed PCR product and perform PCR amplification with P5 primer + P7 primer to specifically enrich the scATAC-seq library (in which the i5 end of the library is loaded with barcode primers), purify with 1.2x XPbead to obtain the final scATAC-seq library.

[0119] (10) Take 1 / 4 of the indexed PCR product and perform PCR amplification with P5 primer + TSO primer to specifically enrich the full-length cDNA amplification product (where the RNA 3' end is loaded with a barcode primer).

[0120] (11) Insert the entire cDNA amplification product into the read2 sequencing adapter using the i7-only TN5 transposal, or randomly break the cDNA amplification product with nuclease, repair the ends and add an A tail, and connect to the read2 sequencing adapter.

[0121] (12) The product introduced by the read2 sequencing adapter was purified with 1x XPbeads (Beckman Coulter, A63881), and then further amplified by PCR with P5 primers and P7 sample index primers. The product was purified with 0.8x XPbeads to obtain the final scRNA-seq library.

[0122] (13) Sequencing the constructed library (compatible with all second-generation sequencers). Paired-end sequencing, 50 kreads per cell.

[0123] In this embodiment, a species pooling test was conducted using human cell lines HeLa and HEK293T with mouse cerebral cortex cells at a ratio of 1:1:10. The analysis results showed that 5753 cells were detected, with a cell capture rate of approximately 57%. Unsupervised clustering was sufficient to clearly distinguish the three cell types (see Figure 6 for details). The number of genes detected by scRNA-seq was greater than 1500; the scATAC-seq TSS enrichment score was greater than 6.5, and the reads in peak / cell ratio was greater than 8000.

[0124] Example 4: Combining well-indexed RT with the GEM-indexed PCR of this invention to achieve high-throughput single-cell transcriptomics library construction with two rounds of tagging.

[0125] Using well plates, after one round of RT labeling in situ on cells, a second round of cell tagging is introduced via microfluidic droplet binding of microparticles with indexed PCR primers of this invention. This enables ultra-high throughput, sample multiplexing, and extremely low pseudo-single-cell rate single-cell sequencing. See Figure 4 for detailed experimental steps.

[0126] Based on the reverse transcription reaction used in SPLiT-seq and other methods to load labels in situ on cells, the cells and the microbead primers of this invention are subjected to indexed PCR reaction in droplet microfluidics, thereby achieving high-throughput single-cell transcriptome sequencing.

[0127] After data analysis, 200,000 cells were captured, with a cell capture rate of about 40%; the number of genes detected by scRNA-seq was greater than 1,500.

[0128] Example 5: Combining existing GEM-indexed RT technology with the Plate-indexed PCR of this invention to achieve high-throughput single-cell transcription library assembly with two rounds of tagging.

[0129] Based on the existing droplet microfluidic technology, which performs the first round of labeling in situ on cells, the present invention uses microparticles coupled with indexed PCR primers to introduce the cell tags in the second round through a well plate, achieving ultra-high throughput, sample multiplexing, and extremely low pseudo-single cell rate in single-cell transcriptomics sequencing (see Figure 4).

[0130] Cells were fixed, and the first round of cell tag loading was performed using a 10x Genomics microfluidic platform and 5' RNA reagent. After droplet rupture, the cells were remixed into a cell suspension. Then, the cells and microparticles coupled with indexed PCR primers of this invention were subjected to indexed PCR reaction in a 96-well plate to achieve ultra-high throughput sc5'RNA-seq (library structure is shown in Figure 5). The specific steps are as follows:

[0131] First, following the 10x Genomics 5' RNA-seq instructions, immobilized and permeabilized cells / nuclei, along with relevant reagents and gel beads, were loaded into a microfluidic chip to prepare a water-in-oil emulsion. The number of cells loaded could be, but was not limited to, 10,000 to 1,000,000 (300,000 cells were loaded in this example). The obtained water-in-oil product underwent reverse transcription, allowing the nucleic acid sequence on the 10x Genomics gel beads to be loaded onto the 3' end of the cDNA through reverse transcription and template substitution, achieving the first round of in situ cell tagging. Then, the water-in-oil structure was broken to separate the aqueous and oil phases, releasing the cells from the water-in-oil droplets. Subsequently, the thoroughly mixed cell suspension was aliquoted into one 96-well plate, fewer than one 96-well plate, or multiple 96-well plates (each well containing 1,000-3,000 cells) according to the number of cells loaded. Each well contained microbeads of type-specific random sequence primers (primer structures are shown in Figure 1b) and PCR reaction solution. After the PCR reaction, all products from the 96-well plate were collected, mixed, and purified to obtain full-length cDNA amplification products with two rounds of tags. These products were then randomly fragmented using TN5 or nucleic acid, and a second sequencing adapter was loaded onto the other end of the cell-tagged sequence, thus completing the construction of the sc5' RNA-seq next-generation sequencing library. After sequencing, a single cell was defined using both rounds of molecular tags.

[0132] In this embodiment, the human cell line HeLa was tested. Data analysis showed that 150,000 cells were detected, with a cell capture rate of about 50%; the number of genes detected by scRNA-seq was greater than 2,500 (see Table 1 for details).

[0133] Table 1

[0134] Example 6: Combining existing GEM-indexed RT&Tn5 technology with the Plate-indexed PCR of this invention to achieve high-throughput single-cell RNA + ATAC dual-omics library construction with two rounds of tagging.

[0135] The first round of cell tagging was performed using the 10x Genomics microfluidic platform and scRNA-seq and scATAC-seq Multiome reagents. Then, the cells and microparticles coupled with indexed PCR primers of this invention were introduced into a 96-well plate for the second round of tagging, achieving ultra-high throughput scMultiome dual-omics (library structure shown in Figure 5). Specific experimental steps are as follows:

[0136] First, following the 10x Genomics Multiome instructions, immobilized and permeabilized cells / nuclei were transposed using Tn5 transposition. The transposable cells / nuclei, along with relevant reagents and gel beads, were loaded into a microfluidic chip for water-in-oil preparation. The number of cells loaded could be, but was not limited to, 10,000 to 1,000,000 (300,000 cells were loaded in this example). The obtained water-in-oil product underwent reverse transcription (RNA capture) and ligation (gDNA capture in chromatin development regions). This allowed the nucleic acid sequences on the 10x Genomics Gel beads to be loaded onto the 5' end of cDNA via reverse transcription and onto gDNA via ligation, achieving the first round of in situ cell tagging. Then, the water-in-oil structure was broken, releasing the cells from the water-in-oil droplets. Subsequently, the thoroughly mixed cell suspension was aliquoted into 96-well plates (1000-3000 cells per well) according to the number of cells loaded. Each well contained microbeads with specific random sequence primers (primer structures are detailed in Figure 1h) and PCR reaction solution. After the PCR reaction, all products from the 96-well plate were collected, mixed, and purified to obtain full-length cDNA amplified with two rounds of tags, and gDNA from the chromatin development region. The cDNA and gDNA were then enriched and amplified using specific primers (which may be biotin-modified), and scATAC-seq was used to complete library construction. The transcriptome portion followed the same procedure as in the first application scenario. After completing the subsequent library construction, sequencing was performed. After sequencing, two rounds of molecular tags were used to define a single cell.

[0137] After data analysis, 200,000 cells were detected, with a cell capture rate of over 40%; the number of genes detected by scRNA-seq was over 1,600; the scATAC-seq TSS enrichment score was over 6.5, and the number of reads inpeak / cell was over 8,000.

[0138] Example 7: Combining existing GEM-indexed RT&Tn5 technology with the GEM-indexed PCR of this invention to achieve high-throughput single-cell multi-omics library construction with two rounds of tagging.

[0139] The first round of cell tag loading was performed using the 10x Genomics microfluidic platform and Multiome reagents. Then, the cells and microparticles containing indexed PCR primers of this invention were introduced into microfluidic droplets for the second round of tagging, achieving ultra-high throughput single-cell transcription library assembly (library structure shown in Figure 5). The specific experimental steps are as follows:

[0140] In Example 6, cells labeled using the 10x Genomics Multiome manual were demulsified and washed from a GEM. The cells, PCR reaction solution, and PCR primer beads were then used to prepare water-in-oil microdroplets. Each droplet contained a microbead with a specific random sequence primer (primer structure detailed in Figure 1h) and the PCR reaction solution. After the PCR reaction, the emulsion was demulsified and the nucleic acid products were purified to obtain full-length amplified cDNA with two rounds of labels, and gDNA from the chromatin development region. The cDNA and gDNA were then enriched and amplified using specific primers (which could be biotin-modified). scATAC-seq completed library construction. The transcriptome portion followed the same procedure as in the first application scenario. After sequencing, the two rounds of molecular tags were used to define a single cell.

[0141] After data analysis, 200,000 cells were detected, with a cell capture rate of over 40%; the number of genes detected by scRNA-seq was over 1,500; the scATAC-seq TSS enrichment score was over 5.5, and the number of reads inpeak / cell was over 7,000.

[0142] Example 8: Combining existing GEM technology with the GEM-indexed PCR of this invention to achieve high-throughput single-cell multi-omics library construction with three rounds of tagging.

[0143] After two rounds of in situ cell labeling, microparticles coupled with indexed PCR primers of this invention are introduced into a third round of cell tagging through a well plate, achieving ultra-high throughput, sample multiplexing, and extremely low pseudo-single-cell rate single-cell sequencing (Figure 6). The specific experimental steps are as follows:

[0144] Before loading cell tags using the 10x Genomics microfluidic platform and scRNA-seq and scATAC-seq Multiome reagents, cells from different sample sources were aliquoted into different reaction chambers and pre-indexed with different indexedTn5s (indexedTn5s can be, but are not limited to, 2-96 types). This allowed for the in-situ loading of different tags onto open chromatin regions of cells in different reaction chambers. The pre-indexed cells / nuclei were then used for 10x Genomics Multiome GEM preparation and cell labeling. The demulsified cells were then subjected to droplet microfluidic preparation again. Each droplet generated a microparticle containing one PCR primer (primer structure shown in Figure 1f) and PCR reaction solution. Multiple cells were allowed to exist in each droplet (Figure 6 right, Figure 7 library structure). Subsequent library construction was the same as in Example 7. After sequencing, three rounds of molecular tags were used to define a single cell.

[0145] After data analysis, cells from different sample sources can be traced back based on the first round of indexed Tn5 pre-indexing. 300,000 cells were captured, with a cell capture rate greater than 35%; the number of genes detected by scRNA-seq was greater than 1500; the scATAC-seq TSS enrichment score was greater than 5.5, and the reads inpeak / cell ratio was greater than 7000.

Claims

1. A microparticle coupled with indexed PCR primers, the microparticle comprising microbeads and indexed PCR primers, wherein the microbeads and primers are coupled by chemical bonds; the microbeads act as a carrier carrying the indexed PCR primers, delivered to a specific conventional reaction system or microreaction system, and then releasing the primers in a controlled manner.

2. The microparticle as described in claim 1, wherein the indexed PCR primer comprises three parts: a fixed sequence 1, an index sequence, and a fixed sequence 2; wherein the fixed sequence 1 is a sequencing adapter, the fixed sequence 2 is a capture sequence, and the index sequence is a microparticle-specific barcode sequence.

3. As described in claim 1, different types of PCR primers or the same type of PCR primers can be coupled to the same microbead of the microbead coupled with indexed PCR primers; the index sequences of the same type of primers coupled to the same microbead are the same, the index sequences of different types of primers can be the same or different, and the index sequences of primer types coupled to different microbeads are different.

4. The method for preparing microparticles coupled with indexed PCR primers as described in claim 1, the method comprising the following steps: S1: Fixed sequence 1 is synthesized by chemical method, and the 5' end of fixed sequence 1 is chemically modified; S2: The modified fixed sequence 1 is affinity-linked with specific microbeads, and then random bases of the index sequence are synthesized by split-pooling using a two-step cyclic enzymatic DNA synthesis method or ligation method. S3: After the index sequence is synthesized, the fixed sequence 2 is synthesized by enzymatic method. Specific bases are added to a reaction tank to complete the synthesis of the fixed sequence 2, and the microbeads coupled with the indexed PCR primers as described in claim 1 are obtained.

5. The preparation method according to claim 4, wherein in step S1, the chemical synthesis refers to the use of solid-phase phosphoramidite method to fix DNA on a solid support to complete the synthesis of the DNA chain, extending from the 3' end to the 5' end of the primer to be synthesized, with adjacent nucleotides linked by a 3'→5' phosphodiester bond; the chemical modification includes Acrydite or Biotin modification; the fixed sequence 1 is a sequencing adapter, selected from Illumina sequencer adapters or sequencing libraries combined with sequencing chips to generate cluster sequences; In step S2, the fixed sequence 1 and the specific microbead affinity linking refers to the use of acrylic acid-modified primers to bind to polyacrylamide hydrogel microspheres, and biotin-containing primers to link to gel beads or magnetic beads with streptavidin on the surface. In step S3, the fixed sequence 2 is selected from Truseq read1, Truseq read1, Nextera read1, Nextera read2 or a portion thereof.

6. The application of the microparticles coupled with indexed PCR primers as described in claim 1 in the construction of high-throughput single-cell sequencing libraries for multiple omics modalities; wherein, When cells undergo PCR amplification, at least one amplification is performed by indexed-PCR amplification of the sequencing cells using microparticles coupled with indexed PCR primers as described in claim 1.

7. The application as described in claim 6, wherein the multiple omics modalities include, but are not limited to, single modalities and combinations thereof such as scRNA-seq, scVDJ-seq, scATAC-seq, sc-whole genome sequencing, scCUT&Tag, etc.

8. A method for constructing a high-throughput single-cell sequencing library with multiple omics modalities, the method comprising the following steps: S1: Prepare single-cell suspensions for cell fixation and permeabilization; S2: Perform indexed-PCR amplification on the cells, wherein the primers used for the indexed-PCR are the microparticles coupled with the indexed PCR primers as described in claim 1.

9. A high-throughput single-cell sequencing library construction system with multiple omics modalities, comprising a tissue sample processing module and a cell indexing module; The tissue sample processing module is used to prepare tissue into a single-cell suspension, and then perform cell fixation and permeabilization. The cell indexing module refers to the high-density microreaction system indexed-PCR indexing of the treated cells, and the primers used in the indexed-PCR are the microparticles coupled with the indexed PCR primers as described in claim 1.

10. A reagent kit for single-cell or subcellular indexing, the reagent comprising microparticles coupled with indexed PCR primers as described in claim 1; the microparticles comprising microbeads and indexed PCR primers, wherein the microbeads are chemically coupled to the primers; the microbeads act as carriers carrying the indexed PCR primers, delivered to a specific conventional reaction system or microreaction system, and subsequently releasing the primers in a controlled manner.

Citation Information

Patent Citations

  • Macromolecule analysis employing nucleic acid encoding

    CN110199019A

  • Coded gel particles and preparation method and application thereof

    CN111172257A

  • High-flux single-cell chromatin accessibility sequencing method

    CN113025695A

  • Simultaneous sequencing of RNA and DNA from the same sample

    US20180080021A1

  • Long indexed-linked read generation on transposome bound beads

    US20240018584A1