Compounds for use in the treatment of inflammatory diseases

Methylmalonate-based compounds inhibit IFN-β transcription to treat chronic inflammatory diseases, providing a safer and more effective alternative to existing anti-inflammatory drugs.

WO2025247879A1PCT designated stage Publication Date: 2025-12-04ECOLE POLYTECHNIQUE FEDERALE DE LAUSANNE (EPFL)
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
PCT/EP2025/064605
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-05-27
Filing Date
2025-05-27
Publication Date
2025-12-04

AI Technical Summary

Technical Problem

Current anti-inflammatory drugs have significant limitations such as serious side effects and high treatment costs, necessitating the development of alternative compounds for treating inflammatory diseases.

Method used

Methylmalonate-based compounds, specifically those of formula (I) and their pharmaceutically acceptable salts, are developed to inhibit cellular type I interferon responses by suppressing IFN-β transcription and release, thereby addressing chronic inflammatory diseases.

Benefits of technology

These compounds effectively suppress IFN-γ and IFN-α responses without cytotoxicity, offering a safer and potentially more effective treatment option for autoimmune and chronic inflammatory diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000003_0001
    Figure IMGF000003_0001
  • Figure IMGF000003_0002
    Figure IMGF000003_0002
  • Figure IMGF000005_0001
    Figure IMGF000005_0001
Patent Text Reader

Abstract

The present invention relates to methylmalonate (MMA)-based compounds for use in treating an inflammatory disease.
Need to check novelty before this filing date? Find Prior Art

Description

COMPOUNDS FOR USE IN THE TREATMENT OF INFLAMMATORY DISEASESThe present invention relates to methylmalonate (MMA)-based compounds for use in treating an inflammatory disease.In this specification, a number of documents including patent applications and manufacturer's manuals are cited. The disclosure of these documents, while not considered relevant for the patentability of this invention, is herewith incorporated by reference in its entirety. More specifically, all referenced documents are incorporated by reference to the same extent as if each individual document was specifically and individually indicated to be incorporated by reference.Inflammatory diseases and conditions, in particular those with underlying pathology related to chronic inflammation contribute significantly to global mortality and morbidity statistics. Chronic inflammatory diseases are the most significant cause of death in the world. The World Health Organization (WHO) ranks chronic diseases as the greatest threat to human health. The prevalence of diseases associated with chronic inflammation is anticipated to increase persistently for the next 30 years in the United States, in 2000, nearly 125 million Americans were living with chronic conditions and 61 million (21%) had more than one. In recent estimates by Rand Corporation, in 2014 nearly 60% of Americans had at least one chronic condition, 42% had more than one and 12% of adults had 5 or more chronic conditions. Worldwide, 3 of 5 people die due to chronic inflammatory diseases like stroke, chronic respiratory diseases, heart disorders, cancer, obesity, and diabetes (StatPearls (2023), Chronic Inflammation, Roma Pahwa; Amandeep Goyal; Ishwarlal Jialal).Metformin is commonly used in the treatment of type II diabetic patients with dyslipidemia and low- grade inflammation. The anti-inflammatory activity of metformin is evident by reductions in circulating TNF-alpha, IL-lbeta, CRP, and fibrinogen in these patients. Statins are anti-inflammatory as they reduce multiple circulating and cellular biomediators of inflammation. This pleiotropic effect appears to contribute in part to the reduction in cardiovascular events. Non-steroidal anti-inflammatory drugs (NSAIDs) like naproxen, ibuprofen, and aspirin acts by inhibiting an enzyme cyclooxygenase (COX) that contributes to inflammation and are mostly used to alleviate the pain caused by inflammation in patients with arthritis. Corticosteroids also prevent several mechanisms involved in inflammation.Glucocorticoids are prescribed for several inflammatory conditions including inflammatory arthritis, systemic lupus, sarcoidosis, and asthma. Herbal supplements like ginger, turmeric, cannabis, hyssop, and Harpagophytum procumbens are shown to have anti-inflammatory properties however one should always consult with a doctor before their use and caution should be taken for using some herbs like hyssop and cannabis.In spite of their proven efficacy, currently available anti-inflammatory drugs have major limitations, such as serious side effects and high cost of treatment (Olajide and Sarker, Annual Reports in Medicinal Chemistry, 2020). Hence, there is an ongoing need for further treatment options for inflammatory diseases.Accordingly, the present invention relates to a compound of formula (I)wherein n is 0 or 1; each Q. is independently OH, SH, SR, OR or formula (II), wherein R is a Ci-Cg linear or branched alkyl containing 0, 1 or 2 unsaturation(s) or a Cg-Cg cycloalkyl, wherein the linear or branched alkyl containing 0, 1 or 2 unsaturation(s) or the Cg-Cg cycloalkyl is optionally substituted with F, Cl, Br, I, OH, OR, NH2, NHR, NR2, SH; SR, COOH; COOR, COHN2; CONHR; CONR2, wherein R is methyl, ethyl, propyl, butyl, isopropyl, tertbutyl, cyclopropyl, cyclobutyl, cyclopentyl or cyclohexyl, wherein formula (II) iswhereinRg is H, methyl or ethyl; andR4is methyl, ethyl, propyl, isopropyl, tert-butyl or cyclopropyl;Z is O or S;Ri is H or methyl; andR2is a Ci-Cg linear or branched alkyl containing 0, 1 or 2 unsaturation(s), a Cg-Cg cycloalkyl, a Ci-Cg linear or branched alkyl substituted with one or more of: F, Cl, Br, I, OH, OR, NHz, NHR, NR?, SH, SR, COOH, COOR, COHN2, CONHR, CONR2, SO2NH2, SO2NHR, SO2NR2, CN or C(O)R, wherein R is methyl, ethyl, propyl, butyl, isopropyl, tertbutyl, cyclopropyl, cyclobutyl, cyclopentyl or cyclohexyl, substituted or unsubstituted phenyl or substituted and unsubstituted benzyl, wherein the substituents of substituted phenyl or substituted benzyl are selected from F, Cl, Br, I, OH, O- Ci-C6alkyl, NH2, NH- Ci-C6alkyl, N- (Ci-C6alkyl)2, SH, S- Ci-C6alkyl, COOH, COOR, CONH2, CONHR, CONR2, SO2NH2, SO2NHR; SO2NR2, CN, Ci-C6alkyl, Ci-C6alkenyl, C3-C6cycloalkyl ethynyl, C(O)R, phenyl or a 5- or 6-membered ring heteroaryl, wherein R is methyl, ethyl, propyl, butyl, isopropyl, tertbutyl, cyclopropyl, cyclobutyl, cyclopentyl or cyclohexyl, or Ri and R2form together a four to six membered ring, preferably cyclobutyl; or a pharmaceutically acceptable salt of a compound of formula (I) for use in treating an inflammatory disease.Inflammatory diseases are conditions in which excess inflammation plays a key role. These conditions can affect different parts or systems in the body of an animal or human. These parts or systems include, for example, the digestive tract (digests food and nutrients), immune system (defends the body from infection), circulatory and respiratory systems (heart and lungs, which circulate blood and oxygen), metabolic system (converts food into energy) and the nervous system (coordinates brain and body).Subjects suffering from an inflammatory disease are typically characterized by the presence of high levels of certain cells, proteins, and enzymes that are critical parts of the immune response in their blood. They may also have more immune cells in specific locations without a clear cause, or they may have small, organized clusters of immune cells, called granulomas.Some common symptoms being associated with inflammatory disease are frequent infections, weight changes, gastrointestinal problems (such as acid reflux, diarrhea, or constipation), depression or anxiety, long-lasting fatigue, insomnia and body pain.Inflammation can be either short-lived (acute) or long-lasting (chronic). Hence, the inflammatory disease my be an acute inflammatory disease or a chronic inflammatory disease. The inflammatory disease is preferably a chronic inflammatory disease.While certain cancer types may be linked to chronic inflammation, cancer is not an inflammatory disease.The subject to be treated is preferably a vertebrate, more preferably a mammal and most preferably human.Herein, n is preferably 0.Q. is preferably -OH or , and is most preferably (i.e. O- acetooxymethyl).Z is preferably O.Particularly, preferred options for Ri and R2 are: Ri is H and R2 is methyl, Ri is H and R2 is H, Ri is H and R2 is ethyl, Ri is methyl and R2 is methyl, Ri is H and R2 is n-propyl, Ri is H and R2 is iso-propyl, Ri is H and R2 is benzyl, and Ri and R2 are together cyclobutyl; see tested compounds in Fig. 4A. Among these options Ri is H and R2 is benzyl is most preferred; see compound 10 in Fig. 4A.When Ri is H and R2 is methyl, it is also preferred that n is H or CH3 in view of compounds 1, 11 and 14 as shown in Fig. 4A.It is shown in the appended examples that MMA, MMA-AM2 and compounds 2 to 6, 10 to 12 and 14 are capable of inhibiting the cellular type I interferon (IFN) response. It was surprisingly found that these compounds function to suppress IFN-p transcription and release. Advantageously, in particular the tested compounds as shown in Fig. 4A did not cause cytotoxicity nor negatively affect mitochondrial respiration. Principal component analysis (PCA) and gene set enrichment analysis (GSEA) showed that the compounds according to the invention effectively supress the 'Hallmark Interferon Gamma Response' and the 'Hallmark Interferon Alpha Response'. On the other hand, signalling events upstream and downstream of / / hbl are left intact, thereby indicating that the point of inhibition likely lies at the level of / / bl transcription and therefore specifically at the cellular inflammatory response. Previously characterised immunometabolites, including succinate, fumarate and itaconate, have been shown to influence the epigenetic landscape through a variety ofmechanisms, so that the compounds according to the invention are expected to be better suitable for the treatment of inflammatory diseases as compared to previously characterised immunometabolites. Hence, the compounds of the invention are particularly well suitable for the treatment of inflammatory diseases.In accordance with a preferred embodiment the inflammatory disease is an IFN-mediated inflammatory disease or a disease being associated with an undesirable IFN response.Interferons (IFNs) are a family of cytokines that were first identified almost half a century ago through their antiviral properties. IFNs not only have important antiviral effects but also have a role in antitumor and immunomodulatory responses. There are two major classes of IFNs: type I (IFN-a subtypes, IFN-P, etc.) and type II (IFN-y).IFN-y plays important roles in controlling diseases caused by intracellular bacteria, parasites, and fungi by induction of reactive oxidant species. It is also important in modulating adaptive immune responses in the lung and participates in the pathogenesis of pulmonary diseases such as pulmonary fibrosis and asthma.The activation of the IFNs type 1 (IFN-I, including IFN-alpha, -beta, -kappa -epsilon and -omega system), as evidenced by genetic, transcriptomic, and immunological data, is a hallmark of multiple immune- mediated inflammatory diseases (IMIDs), such as Systemic Lupus Erythematosus (SLE), Sjogren's disease, inflammatory myopathies, systemic sclerosis, as well as various other connective tissue diseases (CTDs). Those conditions share common pathogenic pathways leading to autoimmunity, of which IFN-I activity is of pivotal importance, whilst they present significant overlap among clinical feature.The IFN-mediated inflammatory disease or disease being associated with an undesirable IFN response is preferably an IFN type l-mediated inflammatory disease or a disease being associated with an undesirable IFN type I response.In accordance with a further preferred embodiment the inflammatory disease is an autoimmune disease.If the inflammatory disease is an autoimmune disease the immune system of a subject causes inflammation by mistakenly attacking its body's own cells or tissues.In accordance with another preferred embodiment the inflammatory disease is selected from systemic lupus erythematosus (SLE), rheumatoid arthritis (RA), periodontitis, inflammatory bowel disease (IBD) (including Crohn's and ulcerative colitis), psoriatic arthritis (PsA), psoriasis, ankylosing spondylitis, hidrosadenitis suppurativa, sarcoidosis, atopic dermatitis (AD), connective tissue disorders, asthma, and multiple sclerosis (MS), a neurodegenerative disease (such as amyotrophe lateral sclerosis, Parkinson's disease, and Alzheimer's disease), a monogenic interferonopathy (such as Aircardi- Goutieres syndrome, stimulator-of-interferon-genes-associated vasculopathy with onset in infancy (SAVI), proteasome associated autoinflammatory syndromes, and familial chilblain lupus).The above diseases are preferred examples of inflammatory diseases being autoimmune diseases to be treated by a compound according to the present invention.In accordance with a preferred embodiment the compound is a compound of Formula (la), Formula(lb), or Formula (Ic)Formula (la) Formula (lb) Formula (Ic) wherein n is 0 or 1; each Q. is independently OH, SH, SR, OR or formula (II), wherein R is a Ci-Cg linear or branched alkyl containing 0, 1 or 2 unsaturation(s) or Cg-Cg cycloalkyl, wherein the linear or branched alkyl containing 0, 1 or 2 unsaturation(s) or the Cg-Cg cycloalkyl is optionally substituted with F, Cl, Br, I, OH, OR, NH2, NHR, NR2, SH; SR, COOH; COOR, COHN2; CONHR;CONR2, wherein R is methyl, ethyl, propyl, butyl, isopropyl, tertbutyl, cyclopropyl, cyclobutyl, cyclopentyl or cyclohexyl, wherein formula (II) iswhereinRs is H, methyl or ethyl; andR4is methyl, ethyl, propyl, isopropyl, tert-butyl or cyclopropyl;Z is O or S;Y is H or methyl; andX is F, Cl, Br, I, OH, O-alkyl; NH2, NH-alkyl, N-alkyh, SH; S-alkyl, COOH, COOR, CONH2, CONHR; CONR2, SO2NH2, SO2NHR; SO2NR2, CN, C1-C6 alkyl, C1-C6 alkenyl, C3-C6 cycloalkyl ethynyl, C(O)R, substituted or unsubstituted phenyl, or a 5- or 6-membered ring or heteroaryl, wherein R is methyl, ethyl, propyl, butyl, isopropyl, tertbutyl, cyclopropyl, cyclobutyl, cyclopentyl or cyclohexyl, wherein the substituents of substituted phenyl are selected from F, Cl, Br, I, OH, O- Ci-Cgalkyl, NH2, NH- Ci-C6alkyl, N- Ci-C6alkyl2, SH, S- Ci-C6alkyl, COOH, COOR, COHN2, CONHR, CONR2, SO2NH2, SO2NHR; SO2NR2, CN, Ci-Cg alkyl, Ci-Cg alkenyl, Ca-Cg cycloalkyl ethynyl, C(O)R, phenyl, or a 5- or 6-membered ring heteroaryl, wherein R is methyl, ethyl, propyl, butyl, isopropyl, tertbutyl, cyclopropyl, cyclobutyl, cyclopentyl or cyclohexyl.The compounds of the above preferred embodiment all resemble compound 10 (BnMMA-AMj) as shown in Fig 4A. They all carry the benzyl group of BnMMA-AMj. Among all methylmalonate (MMA)- based compounds as tested in the examples compound 10 was not effective in the reduction of Ifnbl (interferon beta 1) mRNA expression in bone-marrow-derived macrophages (BMDM); see Fig. 4C.Also in connection with this preferred embodiment n is preferably 0.Q is preferably, and is most preferablyZ is preferably O.In accordance with a further preferred embodiment the compound is a compound of formula (Id)n is 0 or 1; each Q. is independently OH, SH, SR, OR or formula (II), wherein R is a Ci-Cg is a linear or branched alkyl containing 0, 1 or 2 unsaturation(s) or Cg-Cg cycloalkyl, wherein the linear or branched alkyl containing 0, 1 or 2 unsaturation(s) or the Cg-Cg cycloalkyl is optionally substituted with F, Cl, Br, I, OH, OR, NH2, NHR, NR2, SH; SR, COOH; COOR, CONH2; CONHR; CONR2, wherein R is methyl, ethyl, propyl, butyl, isopropyl, tertbutyl, cyclopropyl, cyclobutyl, cyclopentyl or cyclohexyl, wherein formula (II) iswhereinRg is H or methyl; andR4is methyl, ethyl, propyl, isopropyl, tert-butyl or cyclopropyl;Z is O or S;Y is H or methyl; andR is a 6-membered aromatic ring with one to three N, O and / or S heteroatom(s), an indole or a 5- membered aromatic ring with one to three N, O and / or S heteroatom(s), wherein the 6-membered aromatic ring, indole or 5-membered aromatic ring is optionally substituted with methyl, ethyl, propyl, CN, =0; =S; NH2; OH, F, Cl, Br, or I.The compounds of the preferred embodiment resemble compounds 3, 4, and 5 as shown in Fig 4A, noting that compounds 3, 4, and 5 all carry Ci-Cg is a linear or branched alkyl as R of formula (Id).R of formula (Id) is preferably a Ci-C4is a linear or branched alkyl as R of formula (Id) and more preferably is ethyl, n-propyl, or iso-propyl.Also in connection with this preferred embodiment n is preferably 0.Q. is preferably -OH or , and is most preferablyZ is preferably O.In accordance with another further preferred embodiment each Q is independently OH or O- acetooxymethyl, and preferably both Q are OH or O-acetooxymethyl.As can be taken from Fig 4A all tested compounds are diacetoxymethyl esters of the dicarboxylic acid ethylmalonic acid. For this reason Q is independently OH or O-acetooxymethyl, and preferably both Q are OH or O-acetooxymethyl in accordance with the above preferred embodiment.In accordance with a further preferred embodiment R1of formula (I) is H and R2of formula (I) is methyl, ethyl, propyl, isopropyl or benzyl.R2of formula (I) being methyl, ethyl, propyl (n-propyl), isopropyl or benzyl is technically supported by compounds 1, 3 to 6, 11 and 14 of Fig 4A. Methyl, ethyl, propyl (n-propyl) and isopropyl are preferred.In accordance with a further preferred embodiment R3of formula (II) is H and R4of formula (II) is methyl, ethyl, propyl, isopropyl or benzyl.R3of formula (II) is H and R4of formula (II) is methyl, ethyl, propyl, isopropyl or benzyl is technically supported by compounds 1, 3 to 6, 11 and 14 of Fig 4A, because these compounds are diacetoxymethyl esters. Among methyl, ethyl, propyl, isopropyl and benzyl methyl and ethyl are preferred and methyl is most preferred.In accordance with another preferred embodiment the compound is (i) methylmalonic acid, malonic acid, ethylmalonic acid, dimethylmalonic acid, isopropylmalonic acid, 2-propylmalonic acid, benzylmalonic acid, cylobutylmalonic acid, (R or S-)2-methylsuccinic acid or a pharmaceutically acceptable salt thereof, or (ii) a diacetoxymethyl ester of any one of the acids of (i).The data in Figure 4 of the application provides evidence that the compounds according to this preferred embodiment are suitable to the treatment of inflammatory diseases, because they reduce Ifnbl (interferon beta 1) mRNA expression in Bone-marrow-derived macrophages (BMDM).The compound according to the present invention is also preferably selected from compounds 1 to 6, 10 to 12 and 14 of Figure 4A. Compound 10 most preferred because this compound reduced Ifnbl mRNA expression the most among the tested.In accordance with a further preferred embodiment the pharmaceutically acceptable salt is a sodium or potassium salt, preferably a disodium or dipotassium salt.Sodium or potassium chloride are both approved table salts of animal and human nutrition. For this reason sodium or potassium salts, including disodium or dipotassium salts are particularly well suitable for medical purposes.In accordance with a preferred embodiment the compound is formulated as a pharmaceutical composition, wherein the pharmaceutical composition preferably comprises the compound and at least one pharmaceutically acceptable carrier, excipient or diluent.In accordance with the present invention, the term "pharmaceutical composition" relates to a composition for administration to a patient, preferably a human patient. The pharmaceutical composition of the invention comprises the compounds recited above. It may, optionally, comprise further molecules capable of altering the characteristics of the compounds of the invention thereby, for example, stabilizing, modulating and / or activating their function. The composition may be in solid, liquid or gaseous form and may be, inter alia, in the form of (a) powder(s), (a) tablet(s), (a) solution(s) or (an) aerosol(s). The pharmaceutical composition of the present invention may, optionally and additionally, comprise a pharmaceutically acceptable carrier, excipient or diluent. Examples of suitable pharmaceutical carriers, excipients or diluents are well known in the art and include phosphate buffered saline solutions, water, emulsions, such as oil / water emulsions, various types of wetting agents, sterile solutions, organic solvents including DMSO etc. Compositions comprising such carriers can be formulated by well known conventional methods. These pharmaceutical compositions can be administered to the subject at a suitable dose. The dosage regimen will be determined by the attending physician and clinical factors. As is well known in the medical arts, dosages for any one patient depends upon many factors, including the patient's size, body surface area, age, the particular compound to be administered, sex, time and route of administration, general health, and other drugs beingadministered concurrently. The therapeutically effective amount for a given situation will readily be determined by routine experimentation and is within the skills and judgement of the ordinary clinician or physician. For instance, drug potency can be measured as the concentration of a drug needed to inhibit a biological process or response by 50% = IC5o- Generally, the regimen as a regular administration of the pharmaceutical composition should be in the range of 1 pg to 5 g units per day. However, a more preferred dosage might be in the range of 0.01 mg to 1000 mg, even more preferably 0.01 mg to 500 mg and most preferably 0.01 mg to 100 mg per day. The length of treatment needed to observe changes and the interval following treatment for responses to occur vary depending on the desired effect. The particular amounts may be determined by conventional tests which are well known to the person skilled in the art.In accordance with a preferred embodiment the compound is conjugated to a heterologous compound, preferably a pharmaceutically or diagnostically active compound.The heterologous compound is not particularly limited. It can be a proteinaceous compound or a non- proteinaceous compound. Examples of proteinaceous and non-proteinaceous compounds will be provided herein below. The compound may be selected from the group consisting of a pharmaceutically active compound and / or a diagnostically active compound. A pharmaceutically active compound is capable of exerting a curative or disease preventive effect in vivo within a subject and a diagnostically active compound is useful for diagnosing a disease in vivo within a subject or in vitro within a sample obtained from the subject.In accordance with a more preferred embodiment the compound is conjugated to the heterologous compound via click chemistry.A linking moiety, such as an alkyne or azide may be used in click-chemistry reactions. "Click-chemistry" is an art-established term; see e.g. Kolb et al. (2001) Click chemistry: diverse chemical function from a few good reactions. Angew. Chem. Int. Ed. 40 (ll):2004; Sletten et al. (2009) Bioorthogonal Chemistry: Fishing for Selectivity in a Sea of Functionality. Angew. Chem. Int. Ed.48:6998; Jewett et al. (2010) Cu- free click cycloaddition reactions in chemical biology. Chem. Soc. Rev. 39(4):1272; Best et al. (2009) Click Chemistry and Bioorthogonal Reactions: Unprecedented Selectivity in the Labeling of Biological Molecules. Biochemistry.48:6571; and Lallana et al. (2011) Reliable and Efficient Procedures for the Conjugation of Biomolecules through Huisgen Azide-Alkyne Cycloadditions. Angew. Chem. Int. Ed. 50:8794. While there are a number of reactions that fulfill the criteria, the Huisgen 1,3-dipolarcycloaddition of azides and terminal alkynes has emerged as the frontrunner and are also preferred in connection with the present invention.Non-limiting examples of suitable linking moieties are an azide, alkyne phenol, secondary or tertiary amine, hydroxyl group, carbamate.In accordance with a further more preferred embodiment the heterologous compound is an antibody or an antibody mimetic, wherein the antibody mimetic is preferably selected from the group consisting of Anticalins, Affibodies, Adnectins, DARPins, Avimers, Nanofitins, Affilinss, P-Wrapins, ADAPT, Monobodies, Raslns, FingRs, Pronectins, Centyrins, Affimers, Adhirons, Affitins, aReps, Repebodies, i- bodies, Fynomers and Kunitz domain proteins.The term "antibody", also known as an immunoglobulin (Ig), as used in accordance with the present invention comprises, for example, polyclonal or monoclonal antibodies. Furthermore, comprised in the term "antibody" are multimeric formats, such as minibodies, diabodies, tribodies or triplebodies, or tetrabodies (see, for example, Harlow and Lane "Antibodies, A Laboratory Manual", Cold Spring Harbor Laboratory Press, 1998; Harlow and Lane "Using Antibodies: A Laboratory Manual" Cold Spring Harbor Laboratory Press, 1999; Altshuler EP, Serebryanaya DV, Katrukha AG. 2010, Biochemistry (Mose)., vol. 75(13), 1584; Holl iger P, Hudson PJ. 2005, Nat BiotechnoL, vol. 23(9), 1126). The multimeric formats in particular comprise bispecific antibodies that can simultaneously bind to two different types of antigens. Non-limiting examples of bispecific antibodies formats are Biclonics (bispecific, full length human IgG antibodies), DART (Dual-affinity Re-targeting Antibody) and BiTE (consisting of two singlechain variable fragments (scFvs) of different antibodies) molecules (Kontermann and Brinkmann (2015), Drug Discovery Today, 20(7):838-847). The term "antibody" also includes embodiments such as chimeric (human constant domain, non-human variable domain), single chain and humanised (human antibody with the exception of non-human CDRs) antibodies.In accordance with the present invention, antibody fragments comprise, inter alia, Fab or Fab' fragments, F(ab')z, Fv or scFv fragments, single domain VH, VL or V-like domains, such as VhH or V- NAR-domains, as well as multimeric formats such as minibodies, diabodies, tribodies, triplebodies, tetrabodies or chemically conjugated Fab'-multimers (see, for example, Altshuler, E. et al.

[2010] Biochem. (Mose.) 75:1584-1605 or Holliger, P. & Hudson, PJ.

[2005] Nat. BiotechnoL 23:1126-1136)."Anticalins" are an emerging class of clinical-stage biopharmaceuticals with high potential as an alternative to antibodies. Anticalin molecules are generated by combinatorial design from naturallipocalins, which are abundant plasma proteins in humans, and reveal a simple, compact fold dominated by a central p-barrel, supporting four structurally variable loops that form a binding site. Reshaping of this loop region results in Anticalin proteins that can recognize and tightly bind a wide range of medically relevant targets, from small molecules to peptides and proteins, as validated by X- ray structural analysis. Their robust format allows for modification in several ways, both as fusion proteins and by chemical conjugation, for example, to tune plasma half-life (Rothe and Skerra (2018) BioDrugs 32, 233-243)."Affibodies", in accordance with the present invention, are a family of antibody mimetics derived from the Z-domain of staphylococcal protein A. Affibodies are structurally based on a three-helix bundle domain. An affibody has a molecular mass of around 6 kDa and is stable at high temperatures and under acidic or alkaline conditions. Target specificity is obtained by randomisation of amino acids located in two alpha-helices involved in the binding activity of the parent protein domain (Feldwisch, J & Tolmachev, V.

[2012] , Methods Mol. Biol. 899:103-126)."Adnectins" and also "Monobodies", in accordance with the present invention, are based on the 10th extracellular domain of human fibronectin III (10Fn3), which adopts an Ig-like sandwich fold with 2 to 3 exposed loops, but lacks the central disulphide bridge (Gebauer, M. & Skerra, A.

[2009] Curr. Opin. Chem. Biol. 13:245-255). Adnectins and Monobodies with the desired target specificity can be genetically engineered by introducing modifications into specific loops or other surface areas of the protein."DARPins", in accordance with the present invention, are designed ankyrin repeat domains that provide a rigid interface arising from typically three repeats corresponding to an artificial consensus sequence, whereby six positions per repeat are randomised. Consequently, DARPins lack structural flexibility (Gebauer, M. & Skerra, A.

[2009] Curr. Opin. Chem. Biol. 13:245-255).The term "Avimer", as used herein, refers to a class of antibody mimetics which consist of two or more peptide sequences of 30 to 35 amino acids each, which are derived from A-domains of various membrane receptors and which are connected by linker peptides. Binding of target molecules occurs via the A-domain and domains with desired binding specificity can be selected, for example, by phage display techniques. The target specificity of the different A-domains contained in an avimer may, but do not have to be identical (Weidle UH, et al., (2013), Cancer Genomics Proteomics; 10(4):155-68)."Nanofitins" and also an "Affitins" are antibody mimetic proteins that are derived from the DNA binding protein Sac7d of Sulfolobus acidocaldarius. Nanofitins and Affitins usually have a molecular weight of around 7kDa and are designed to specifically bind a target molecule by randomising the amino acids on the binding surface (Mouratou B, Behar G, Paillard-Laurance L, Colinet S, Pecorari F., (2012) Methods Mol Biol.; 805:315-31 and Koide et al. 1998, J. Mol. Biol. 284:1141-51).The term "Affilin", as used herein, refers to antibody mimetics that are developed by using either gamma-B crystalline or ubiquitin as a scaffold and modifying amino-acids on the surface of these proteins by random mutagenesis. Selection of affilins with the desired target specificity is effected, for example, by phage display or ribosome display techniques. Depending on the scaffold, affilins have a molecular weight of approximately 10 or 20kDa. As used herein, the term affilin also refers to di- or multimerised forms of affilins (Weidle UH, et al., (2013), Cancer Genomics Proteomics; 10(4):155-68).As used herein, the term "P-Wrapins" designates affibody protein homodimers with a disulfide bond between the pair of Cys28 residues connecting the two identical monomer subunits, referred to as subunits 1 and 2. The scaffold used in engineering p-wrapins is ZAp3, an AP-binding affibody protein that not only prohibits the initial aggregation of AP monomers into toxic forms, but also dissociates pre-formed oligomeric aggregates by sequestering and stabilizing a p-hairpin conformation of AP monomers (Orr et al. (2018), Computers & Chemical Engineering, 116(4):322-332).As used herein, the term "ABD-Derived Affinity Proteins (ADAPT)" refers to a class of antibody mimetics that has been created using the albumin-binding domain (ABD) of streptococcal protein G as a stable protein scaffold (Garousi et al (2015), Cancer Res.; 75(20):4364-71). By diversifying a surface of the domain that is not directly involved in albumin binding, molecules can be selected to bind a novel target and still retain their ability to bind albumin. This strategy has been used to select binders to a number of proteins, for example, the cancer-related epidermal growth factor receptor 3.As used herein "Raslns" are lOFnlll-based antibody mimetics. Hence, they use the 10th domain of human fibronectin as their scaffold Raslns are disulfide-free intrabodies. They were shown to be stable inside cells and also when fused with a fluorescent protein label (Cetin et al. (2017), J Mol Biol.; 429(4):562-573).As used herein, the term "FingRs (Fibronectin intrabodies generated with mRNA display)" designates recombinant antibody-like proteins also being based on the lOFnlll scaffold (Gross et al. (2013), Neuron.; 78(6): 971-985.).As used herein, the term "Pronectins" designates recombinant antibody-like proteins being based on the fourteenth type-ill scaffold of human fibronectin (14Fn3). The well-characterized fibronectin protein is prevalent throughout the human body. Human fibronectin, an extracellular protein, is naturally abundant in human serum. Intelligent loop-diversity has been designed to closely mimic the natural human repertoire and avoid sequence immunogenicity. The intrinsic properties of a Pronectin align with the pharmacological properties needed to make it a successful drug, including high potency, specificity, stability, favorable small size, and high-yield production in E. coli and yeast (http: / / www.protelica.com / pronectin_tech.html).As used herein, the term "Centyrins" designates recombinant antibody-like proteins being based on the consensus tenascin FN3 framework (Tencon) (Diem et al. (2014), Protein Eng., Des. and Sei. 27, 419-429). Centryins against different targets, e.g. human c-MET, rTNFa and mlL-17A, were generated.As used herein, "Affimers" refer to small proteins that bind to target molecules with similar specificity and affinity to that of antibodies. These engineered non-antibody binding proteins are designed to mimic the molecular recognition characteristics of monoclonal antibodies in different applications. In addition, these affinity reagents have been optimized to increase their stability, make them tolerant to a range of temperatures and pH, reduce their size, and to increase their expression in E. coli and mammalian cells. Derived from the cysteine protease inhibitor family of cystatins, which function in nature as cysteine protease inhibitors, these 12-14 kDa proteins share the common tertiary structure of an a-helix lying on top of an anti-parallel -sheet (Tiede et al. (2017), eLife.; 6: e24903).The class of recombinant antibody-like proteins designated as "Adhirons" herein is based on a phytocystatin consensus sequence as the scaffold (Tiede et al. (2014) Protein Eng. Des. Sei. 27, 145- 55).The class of recombinant antibody-like proteins designated as "aRep" herein is derived from alpha- helicoidal HEAT-like repeat protein scaffolds. In more detail, the aRep proteins are derived from a natural family of modular proteins comprising alpha-helical repeats, related to HEAT repeats, named after Huntingtin, the elongation factor 3 (EF3), the protein phosphatase 2A (PP2A), and the yeast kinase TOR. The association of several HEAT repeats forms alpha-solenoids of various lengths, which are naturally found in a number of cellular proteins involved in intracellular transport and proteinprotein interaction (Hadpech et al. (2017), Scientific Reports; 7:Article numberl6335).As used herein, the term "Repebodies" designates recombinant antibody-like proteins which are composed of leucine-rich repeat (LRR) modules. In more detail, the binding scaffold of Repebodies is based on variable lymphocyte receptors, which are nonimmunoglobulin antibodies composed of LRR modules in jawless vertebrates. A template scaffold was first constructed by joining consensus repeat modules between the N- and C-capping motifs of variable lymphocyte receptors. The N-terminal domain of the template scaffold was redesigned based on the internalin-B cap by analyzing the modular similarity between the respective repeat units using a computational approach (Lee at al. (2012), Proc Natl Acad Sci; 109(9): 3299-3304).As used herein, the term "i-bodies" refers to recombinant antibody-like proteins built on the scaffold of a human protein and engineered with two loops that mimic the shape of shark antibodies. These loops are responsible for binding or interacting with a particular target (in circulation or on a cell) that is causing disease. The i-body is a human analogue of the antigen binding domain of the shark antibody, which combines the advantages of monoclonal antibodies (high target specificity and affinity) with the beneficial stability features of small molecules (https: / / www.ibodies.eu / ).As used herein, the term "Fynomer" refers to a non-immunoglobulin-derived binding polypeptide derived from the human Fyn SH3 domain. Fyn SH3-derived polypeptides are well-known in the art and have been described e.g. in Grabulovski et al. (2007) JBC, 282, p. 3196-3204, WO 2008 / 022759, Bertschinger et al (2007) Protein Eng Des Sei 20(2):57-68, Gebauer and Skerra (2009) Curr Opinion in Chemical Biology 13:245-255, or Schlatter et al. (2012), MAbs 4:4, 1-12).A "Kunitz domain peptide" is derived from the Kunitz domain of a Kunitz-type protease inhibitor such as bovine pancreatic trypsin inhibitor (BPTI), amyloid precursor protein (APP) or tissue factor pathway inhibitor (TFPI). Kunitz domains have a molecular weight of approximately 6kDa and domains with the required target specificity can be selected by display techniques such as phage display (Weidle et al., (2013), Cancer Genomics Proteomics; 10(4):155-68).Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In case of conflict, the patent specification including definitions, will prevail.Regarding the embodiments characterized in this specification, in particular in the claims, it is intended that each embodiment mentioned in a dependent claim is combined with each embodiment of each claim (independent or dependent) said dependent claim depends from. For example, in case of anindependent claim 1 reciting 3 alternatives A, B and C, a dependent claim 2 reciting 3 alternatives D, E and F and a claim 3 depending from claims 1 and 2 and reciting 3 alternatives G, H and I, it is to be understood that the specification unambiguously discloses embodiments corresponding to combinations A, D, G; A, D, H; A, D, I; A, E, G; A, E, H; A, E, I; A, F, G; A, F, H; A, F, I; B, D, G; B, D, H; B, D, I; B, E, G; B, E, H; B, E, I; B, F, G; B, F, H; B, F, I; C, D, G; C, D, H; C, D, I; C, E, G; C, E, H; C, E, I; C, F, G; C, F, H; C, F, I, unless specifically mentioned otherwise.Similarly, and also in those cases where independent and / or dependent claims do not recite alternatives, it is understood that if dependent claims refer back to a plurality of preceding claims, any combination of subject-matter covered thereby is considered to be explicitly disclosed. For example, in case of an independent claim 1, a dependent claim 2 referring back to claim 1, and a dependent claim 3 referring back to both claims 2 and 1, it follows that the combination of the subject-matter of claims 3 and 1 is clearly and unambiguously disclosed as is the combination of the subject-matter of claims 3, 2 and 1. In case a further dependent claim 4 is present which refers to any one of claims 1 to3, it follows that the combination of the subject-matter of claims 4 and 1, of claims 4, 2 and 1, of claims4, 3 and 1, as well as of claims 4, 3, 2 and 1 is clearly and unambiguously disclosed.This also holds true for alternatives in different claims that depend from each other. Thus, if claim 1 recites three alternatives of the same category and claim 2 recites three alternatives of a different category as recited in claim 1, and refers back to claim 1, all combinations of the alternatives as recited in claims 1 and 2 are explicitly disclosed herein.The above considerations apply mutatis mutandis to all appended claims.The figures show.Figure 1. MMA accumulates during cGAS-STING activationA, Volcano plot of untargeted metabolomics analysis of BMDMs transfected with dsDNA (500 ng / ml) for 8 hrs. B, Volcano plot of untargeted metabolomics analysis of BMDMs infected with HSV-1 (MOI 1) for 8 hrs. C, Normalised ion intensity of methylmalonate accumulation in BMDMs transfected with dsDNA (500 ng / ml) for indicated times. D, Normalised ion intensity of methylmalonate accumulation in BMDMs infected with HSV-1 (MOI 1) for indicated times. E, Schematic depicting the propionate degradation pathway and associated methylmalonate accumulation. F, Methylmalonate quantification in BMDMs transfected with dsDNA (500 ng / ml) or treated with LPS (100 ng / ml) or R848 (1 pg / ml) for 8 hrs. G, Enriched metabolic pathways in metabolomics data from BMDMs transfectedwith dsDNA (500 ng / ml) for 8 hrs. H, Relative methylmalonate quantification in BMDMs treated with BCATi (100 pM) prior to dsDNA (500 ng / ml) transfection for 8 hrs.Figure 2. MMA suppresses type I IFN responsesA, Ifnbl mRNA expression in Pcca knockdown BMDMs transfected with dsDNA (500 ng / ml) for 8 hrs.B, Ifnbl mRNA expression in Mmab knockdown BMDMs transfected with dsDNA (500 ng / ml) for 8 hrs.C, Chemical structures of MMA the derivative compound MMA-AM2. D, Methylmalonate quantification in BMDMs treated with MMA-AM2(50 pM). E, Principal component analysis of RNA sequencing data from BMDMs treated with MMA-AM2(150 pM) for 3 hrs prior to dsDNA (500 ng / ml) transfection or R848 (1 pg / ml) stimulation for 4 hrs. F, Enriched pathways in RNA sequencing data from BMDMs treated with MMA-AM2(150 pM) for 3 hrs prior to dsDNA (500 ng / ml) transfection for 4 hrs. G, Enriched pathways in RNA sequencing data from BMDMs treated with MMA-AMj (150 pM) for 3 hrs prior to R848 (1 pg / ml) transfection for 4 hrs. H, Ifnbl mRNA expression in BMDMs treated with indicated concentrations of MMA-AM2for 3 hrs prior to transfection with dsDNA (500 ng / ml) or poly (l:C) (500 ng / ml) or treatment with LPS (100 ng / ml) or R848 (1 pg / ml) for 4 hrs. I, Uspl8 mRNA expression in BMDMs treated with indicated concentrations of MMA-AMj for 3 hrs prior to transfection with dsDNA (500 ng / ml) or poly (l:C) (500 ng / ml) or treatment with LPS (100 ng / ml) or R848 (1 pg / ml) for 4 hrs. J, Ifnbl and Uspl8 mRNA expression in BMDMs treated with MMA-AM2(150 pM) for 3 hrs prior to infection with HSV-1 (MOI 1) for 6 hrs.Figure 3. MMA-AM2reduces H3K27acA, Western blot analysis of H3K27ac, H3K14ac, H3K9ac, H3K9me2 and H3K27me3 levels in BMDMs treated with MMA-AM2(150 pM) for 3 hrs prior to transfection with dsDNA (500 ng / ml) for 4 hrs. B, ChlP-qPCR analysis of Rpl30 and Ifnbl promoter regions in chromatin samples pulled down using H3K27ac antibody, extracted from BMDMs treated with MMA-AM2(150 pM) for 3 hrs prior to dsDNA transfection (500 ng / ml) for 4 hrs. C, D, Volcano plots of CUT & Tag sequencing analysis in chromatin samples pulled down using H3K4me3 and H3K27ac antibodies, extracted from BMDMs treated with MMA-AM2(150 pM) for 3 hrs prior to dsDNA (500 ng / ml) transfection for 4 hrs. E, Enrichment analysis of significantly increased sites of H3K27ac in chromatin samples pulled down using H3K4me3 and H3K27ac antibodies, extracted from BMDMs treated with MMA-AM2(150 pM) for 3 hrs prior to dsDNA (500 ng / ml) transfection for 4 hrs. F, Heatmap depicting H3K27ac levels of members of the 'Leukocyte Activation' gene ontology geneset in chromatin samples pulled down using H3K4me3 and H3K27ac antibodies, extracted from BMDMs treated with MMA-AM2(150 pM) for 3 hrs prior to dsDNA (500 ng / ml) transfection for 4 hrs.Figure 4. MMA derivatives suppress type I IFN responsesA, Names and structures of MMA derivatives used in this study. B, Ifnbl mRNA expression in BMDMs treated with MMA derivatives (all 150 pM) for 3 hrs prior to dsDNA (500 ng / ml) transfection or R848 (1 pg / ml) stimulation for 4 hrs. C, Ifnbl mRNA expression in BMDMs treated with MMA derivatives (all 100 pM) for 3 hrs prior to dsDNA (500 ng / ml) transfection or R848 (1 pg / ml) stimulation for 4 hrs. D, Ifnbl mRNA expression in BMDMs treated with MMA derivatives (compound 1 at 150 pM, all other compounds at 500 pM) for 3 hrs prior to dsDNA (500 ng / ml) transfection for 4 hrs.Figure 5. MMA-AM2suppresses ISGs, but not Ifnbl, in human PBMCs and macrophagesA, IFNB1 mRNA expression in human PBMCs and macrophages treated with indicated concentrations of MMA-AMj for 3 hrs prior to stimulation with diABZI (2.5 pM) or R848 (1 pg / ml) for 4 hrs. B, ISG15 mRNA expression in human PBMCs and macrophages treated with indicated concentrations of MMA- AM2for 3 hrs prior to stimulation with diABZI (2.5 pM) or R848 (1 pg / ml) for 4 hrs. C, IFIT2 mRNA expression in human PBMCs and macrophages treated with indicated concentrations of MMA-AM2for 3 hrs prior to stimulation with diABZI (2.5 pM) or R848 (1 pg / ml) for 4 hrs. D, IFNB1, IFIT2 and ISG15 mRNA expression in human macrophages treated with MMA-AM2(100 pM) for 3 hrs prior to stimulation with dsDNA (500 ng / ml) for 4 hrs.Figure 6. MMA accumulates during cGAS-STING activationA, Volcano plot of untargeted metabolomics analysis of Cgas ' BMDMs transfected with dsDNA (500 ng / ml) for 8 hrs. B, Western blot analysis of MUT, PCCA, ACSF3, MMAB and MCEE in BMDMs transfected with dsDNA (500 ng / ml) for 8 hrs. C, Relative methylmalonate accumulation in BMDMs treated with TBKli (10 pM) for 1 hr prior to dsDNA (500 ng / ml) transfection for 4 hrs. D, Enriched metabolic pathways in metabolomics data from BMDMs infected with HSV-1 (MOI 1) for 8 hrs. E, Fold change in levels of C2, C3, C4, C5 and C6 acylcarnitines in WT and Cgos / _BMDMs transfected with dsDNA (500 ng / ml) for indicated times. F, Fold change in levels of C2, C3, C4, C5 and C6 acylcarnitines in BMDMs infected with HSV-1 (MOI 1).Figure 7. Endogenous MMA accumulation regulates type I IFN responsesA, Western blot analysis of PCCA in BMDMs transfected with Pcco-targeting siRNA. B, ELISA of IFN-p release into supernatant of Pcca knockdown BMDMs transfected with dsDNA (500 ng / ml) for 8 hrs. C, Western blot analysis of MMAB in BMDMs transfected with Mmob-targeting siRNA. D, ELISA of IFN- release into supernatant of Mmab knockdown BMDMs transfected with dsDNA (500 ng / ml) for 8 hrs. E, Western blot analysis of MUT in Mmut Ki / Wt and Ki / Ki BMDMs. F, Ifnbl and Uspl8 mRNA expression in Mmut Ki / WT and Ki / Ki BMDMs treated with R848 (1 pg / ml) for 8 hrs.Figure 8. MMA-AM2suppresses type I IFN responsesA, LDH release into supernatant of BMDMs treated with indicated concentrations of MMA-AMj for 3 hrs. B, OCR of BMDMs treated with indicated concentrations of MMA-AM2for 3 hrs. C, Maximal respiration, as measured by OCR, of BMDMs treated with indicated concentrations of MMA-AMj for 3 hrs. D, Volcano plot of RNA sequencing data depicting genes of the Hallmark IFN Alpha Response in BMDMs treated with MMA-AM2(150 pM) for 3 hrs prior to dsDNA (500 ng / ml) transfection for 4 hrs. E, Volcano plot of RNA sequencing data depicting genes of the Hallmark IFN Alpha Response in BMDMs treated with MMA-AM2(150 pM) for 3 hrs prior to R848 (1 pg / ml) treatment for 4 hrs. F, mRNA expression of Ifnbl and Uspl8 in BMDMs treated with MMA-AM2prior to treatment with CMA (250 pg / ml) for 4 hrs. G, mRNA expression of Ifnbl in BMDMs treated with 4-OHT (1 pM) for 24 hrs to induce CgasR241Eand subsequently treated with MMA-AM2(100 pM) for 3 hrs. H, mRNA expression of Uspl8 in BMDMs treated with 4-OHT (1 pM) for 24 hrs to induce CgasR241Eand subsequently treated with MMA-AM2(100 pM) for 3 hrs.Figure 9. MMA suppresses type I IFN responsesA, Absolute MMA quantification in BMDMs treated with the indicated concentrations of MMA for 24 hrs. B, LDH release into supernatant of BMDMs treated with indicated concentrations of MMA for 24 hrs. C, OCR of BMDMs treated with indicated concentrations of MMA for 24 hrs. D, Maximal respiration, as measured by OCR, of BMDMs treated with indicated concentrations of MMA for 24 hrs. E, mRNA expression of Ifnbl in BMDMs treated with indicated concentrations of MMA for 24 hrs prior to dsDNA (500 ng / ml) transfection for 4 hrs. F, mRNA expression of Uspl8 in BMDMs treated with indicated concentrations of MMA for 24 hrs prior to dsDNA (500 ng / ml) transfection for 4 hrs. G, mRNA expression of Ifnbl and Uspl8 in BMDMs treated with indicated concentrations of MMA for 24 hrs prior to HSV-1 (MOI 1) infection for 6 hrs.Figure 10. MMA-AM2does not affect upstream signalling eventsA, Western blot analysis of STING and phospho-STING in BMDMs treated with MMA-AM2(150 pM) prior to dsDNA (500 ng / ml) transfection for 3 hrs. B, Western blot analysis of TBK1, phospho-TBKl, IRF3 and phospho-IRF3 in BMDMs treated with MMA-AM2(150 pM) prior to dsDNA (500 ng / ml) transfection for 3 hrs. C, Western blot analysis of STAT1 and phospho-STATl in BMDMs treated with MMA-AM2(150 pM) prior to dsDNA (500 ng / ml) transfection for 3 hrs. D, mRNA expression of Isgl5 in BMDMs treated with MMA-AM2(150 pM) prior to IFN-p (220 ng / ml) treatment for 4 hrs. E, mRNA expression of Uspl8 in BMDMs treated with MMA-AM2(150 pM) prior to IFN- (220 ng / ml) treatment for 4 hrs. F, Western blot analysis of STAT1 and phospho-STATl in BMDMs treated with MMA-AM2(150 pM) prior to IFN-p (220 ng / ml) treatment for 4 hrs. G, ChlP-qPCR analysis of Rpl30 and Ifnblpromoter regions in chromatin samples pulled down using H3 and IgG antibodies, extracted fromBMDMs.The Examples illustrate the invention.Example 1 - ResultsTo capture the metabolite-specific changes occurring during cGAS-STING activation, an untargeted metabolomics analysis of double stranded DNA (dsDNA)-transfected bone marrow-derived macrophages (BMDMs) was performed (Fig. 1A). Methylmalonate (MMA) stood out as one of the most highly upregulated metabolites following dsDNA transfection for 8 hrs (Fig. 1A) and was similarly induced upon infection with the dsDNA virus herpes simplex virus-1 (HSV-1) for 8 hrs (Fig. IB). However, MMA did not accumulate in Cgas^ BMDMs transfected with dsDNA (Fig. 6A). MMA was completely undetected in unstimulated BMDMs and BMDMs transfected with dsDNA or infected with HSV-1 for 4 hrs (Fig. 1C, D), indicating that this metabolite arises during mid-phase macrophage activation.Next it was sought to investigate the pathway by which MMA accumulates following cGAS-STING activation. Although MMA accumulates as a by-product of the propionate degradation pathway, which may be fueled by cholesterol, odd chain fatty acids and branched chain amino acid (BCAA) degradation (Fig. IE), changes in the protein levels of the enzymes which function along this pathway were not observed, including MUT, PCCA, ACSF3, MMAB and MCEE (Fig. 6B). Given that MMA accumulation was also observed with LPS and R848 stimulation (Fig. IF), which drive TLR4 and TLR7 / 8 respectively, it was hypothesised that the accumulation of MMA may occur downstream of TBK1 / IRF3 signalling. However, inhibition of TBK1 did not affect the accumulation of MMA in response to dsDNA transfection (Fig. 6C). Enrichment analysis of our metabolomics datasets revealed an increase in BCAA degradation as a result of dsDNA transfection (Fig. 1G) or HSV-1 infection (Fig. 6D). Furthermore, the accumulation of MMA was accompanied by an accumulation of C3 and C5 acylcarnitines (Fig. 6E, F), indicative of increased BCAA degradation. Use of an inhibitor of branched chain amino acid transaminase (BCAT)(1), the enzyme responsible for converting BCAAs to a-keto acids, reduced the dsDNA-induced accumulation of MMA (Fig. 1H), confirming the requirement of BCAA degradation to MMA induction.In order to interrogate the role of endogenous MMA accumulation to the type I interferon (IFN) response, siRNA knockdowns of two enzymes which function along the propionate degradation pathway were performed. Knockdown of Pcca (Fig. 7A), which functions upstream of MMAaccumulation, increased dsDNA-induced Ifnbl mRNA expression (Fig. 2A) and IFN-p release (Fig. 7B), while knockdown of Mmab (Fig. 7C), which functions downstream of MMA accumulation, reduced Ifnbl mRNA expression (Fig. 2B) and IFN- release (Fig. 7D). Also BMDMs from transgenic Mmut Ki / Ki mice (2) were isolated, which harbour an unstable p.Met700Lys mutant form of MUT (Fig. 7E). R848 treatment of Mmut Ki / Ki BMDMs resulted in a mild, non-significant reduction in mRNA expression of Ifnbl and the interferon-stimulated gene (ISG) USP18 compared to wild-type controls (Fig. 7F). These results indicate that endogenous MMA functions to suppress IFN-p transcription and release.Given the effects observed with endogenous manipulation of MMA levels, it was sought to design a cell-permeable derivative of MMA which could effectively deliver exogenous MMA to cells. An acetoxymethyl ester derivative of MMA was designed, which was named MMA-AMj (Fig. 2C). MMA- AMj treatment of BMDMs caused a build-up of intracellular MMA (Fig. 2D), which did not cause cytotoxicity, as measured by lactate dehydrogenase (LDH) release (Fig. 8A), nor affect mitochondrial respiration, as measured by oxygen consumption rate (OCR) (Fig. 8B, C). In order to obtain an overview of the transcriptome of BMDMs treated with MMA-AMj, RNA sequencing on cells treated with MMA- AMj prior to cGAS-STING or TLR7 / 8 activation was performed. Principal component analysis (PCA) demonstrated that MMA-AMj-treated cells clustered separately to DMSO-treated cells (Fig. 2E), indicating profound transcriptional changes induced by MMA-AMj. Using gene set enrichment analysis (GSEA) it was observed that the 'Hallmark Interferon Gamma Response' and the 'Hallmark Interferon Alpha Response' were the most significantly suppressed transcriptional hallmarks (Fig. 2F, G). The vast majority of genes which form part of the Hallmark Interferon Alpha Response were suppressed by treatment with MMA-AMj (Fig. 8D, E). The suppression of Ifnbl and Uspl8 mRNA expression was concentration-dependent and consistent across the use of multiple pattern recognition receptor stimuli, including transfected dsDNA (cGAS-STING), transfected poly (l:C) (RIG-I / MDA5), LPS (TLR4) and R848 (TLR7 / 8) (Fig. 2H, I). MMA-AMj also suppressed type I IFN responses driven by HSV-1 infection (Fig. 2J), CMA (STING agonist) treatment (Fig. 8F) and gain-of-function CgasR241Emutation (Fig. 8G, H). BMDMs may also be treated with native methylmalonic acid, which enters cells following prolonged treatment with high concentrations (Fig. S4A). M MA treatment does not cause toxicity (Fig. S4B), nor does it affect mitochondrial respiration (Fig. 8C, D). While less potent than MMA-AMj, treatment of MMA prior to dsDNA transfection or HSV-1 infection similarly suppressed type I IFN responses (Fig. 9E, F, G).Having established the efficacy of MMA-AMj in suppressing type I IFN responses in BMDMs, it was sought to explore the mechanistic basis behind this inhibition, firstly by examining the signalling events occurring downstream of dsDNA recognition by cGAS. MMA-AMj did not affect dsDNA-inducedphosphorylation of STING (Fig. 10A), TBK1 or IRF3 (Fig. 10B), but completely suppressed phosphorylation of STAT1 (Fig. IOC), which takes place downstream of autocrine type I IFN binding to its receptor, IFNAR, likely due to depleted IFN-p release. In contrast, MMA-AMj was unable to inhibit IFN- -driven ISG expression (Fig. 10D, E) and STAT-1 phosphorylation (Fig. 10F). Given that signalling events upstream and downstream of Ifnbl are left intact, it was considered that the point of inhibition likely lies at the level of Ifnbl transcription. Previously characterised immunometabolites, including succinate, fumarate and itaconate, have been shown to influence the epigenetic landscape through a variety of mechanisms (3,4). It was therefore investigated whether MM A may induce similar epigenetic alterations. Western blot analysis of several epigenetic marks which are key to supporting macrophage activation revealed that MMA-AMj reduced acetylation of lysine 27 on histone 3 (H3K27ac), while leaving other marks intact (Fig. 3A, B). Subsequently ChlP-qPCR was performed using an H3K27ac antibody and found reduced H3K27ac at the Ifnbl promoter, but not at an unrelated control promoter (Fig. 3C, 10G). Genome-wide assessment of histone modifications by CUT & Tag revealed an overall increase in the presence of H3K27ac following MMA-AMj treatment (Fig. 3D), while H3K4me3 remained stable (Fig. 3E). However, when we performed enrichment analysis on the regions which where H3K27ac was significantly enriched upon MMA-AMj treatment, the top hit was the 'leukocyte activation' gene ontology geneset (Fig. 3F), which includes the Ifnbl gene (Fig. 3G). These results indicate that MMA-AMj treatment reduces H3K27ac at various sites, including at Ifnbl.Subsequently 17 further MMA derivatives were synthesised, in addition to the MMA-AMj in order to perform preliminary structure activity relationship (SAR) studies (Fig. 4A). BMDMs were treated with the derivatives at either 150 pM (Fig. 4B) or 100 pM (Fig. 4C) prior to dsDNA transfection or R848 treatment. At the 150 pM concentration, compounds 1-6 significantly reduced both dsDNA- and R848- induced Ifnbl mRNA expression, while at the 100 pM concentration, compounds 10-12 caused significant reductions. When we retested the compounds which had previously not shown any efficacy at the 100-150 pM concentrations, we found that compound 15 also reduced dsDNA-induced Ifnbl expression at a concentration of 500 pM. (Fig. 4D). Subsequently it was also sought to test our parent compound, MMA-AMj in human peripheral blood mononuclear cells (PBMCs) and monocyte-derived macrophages. While treatment with increasing concentrations of MMA-AMj did not significantly affect DiABZI (STING agonist) or R848-induced IFNB1 mRNA expression (Fig. 5A), it did still significantly reduce expression of ISGs, including ISG15 (Fig. 5B) and IFIT2 (Fig. 5C) in a concentration-dependent manner. These results were consistent across both cell types. However, when dsDNA was used as a stimulus, MMA-AMj treatment did significantly reduce IFNB1 mRNA expression, as well as expression of ISGs (Fig. 5D).Example 2 - Material & MethodsAnimal DetailsAll mice were on a C57BL / 6J background. Wild-type (WT) and cGAS°R241E_lox_R26CreERT2 (CgasR241E) mice were bred in-house. Vehicle (DMSO) treated CgasR241EBMDMs were used as controls. Treatment with 4-hydroxytamoxifen (4-OHT) results in ubiquitous expression of CgasR241E. Hind legs from Mmut Ki / Wt and Mmut Ki / Ki mice were generously donated by Dr Sean Froese (University Children's Hospital Zurich). In vitro experiments were performed with BMDMs isolated from 6-18-week-old female and male mice. All in vitro treatment groups were randomly assigned.Generation of Murine BMDMs6-18-week-old mice were euthanised and bone marrow was subsequently harvested from the tibia, femur and ilium. Cells were differentiated in DMEM containing L929 supernatant (20%), foetal calf serum (FCS) (10%), L-glutamine (1%) and penicillin / streptomycin (1%) for 6 days, after which cells were counted and plated at 0.5 x 106cells / ml unless otherwise stated. BMDMs were plated in 12-well or 24- well cell culture plates and left overnight to adhere.Isolation of Human PBMCs and differentiation to MDMsBuffy coats from healthy donors were collected from the Swiss Transfusion SRC. Blood samples were obtained anonymously and written informed consent for the use of blood for research purposes has been obtained from the donors. All the procedures involving experiments on human samples have been approved by the the Commission cantonale (VD) d'ethique de la recherche sur I'etre humain with the project ID 2023-01144. 25 ml whole blood was layered on 20 ml Lymphoprep (StemCell), followed by centrifugation for 30 mins at 800 x g with the brake off, after which the upper plasma layer was removed and discarded. The layer of mononuclear cells at the plasma-density gradient medium interface was retained, and diluted to 50 ml with PBS. Cells were centrifuged for 8 mins at 350 x g and the resulting supernatant was removed and discarded. The remaining pellet of mononuclear cells was resuspended in 1 ml PBS, then diluted to 50 ml with PBS. Cells were again centrifuged at 350 x g for 8 mins and the resulting supernatant was removed and discarded. The remaining pellet of cells was resuspended in 3 ml ACK lysing buffer (Life Technologies) for 3 mins, after which 7 ml RPMI supplemented with FCS (10%), L-glutamine (1%) and penicillin / streptomycin (1%) was added. Cells were again centrifuged for 3 mins at 350 x g and the resulting supernatant was removed and discarded. Cells were resuspended in medium, counted, and plated at 1 x 106cells / ml for experiments. Alternatively, cells were plated in 10 cm dishes at a density of 2 x 106cells / ml and treated with 50 ng / ml recombinant human M-CSF (Gibco) for 6 days. After the 6-day differentiation, cells were washedtwice with PBS, scraped into 10 ml PBS, pelleted and counted. MDMs were then plated for experiments at a density of 0.5 x 106cells / ml.ReagentsLPS from Escherichia coli, serotype EH100 (ALX-581-010-L001), was purchased from Enzo Life Sciences. High molecular weight poly (l:C) (tlrl-pic) and R848 (tlrl-r848) were purchased from Invivogen. Recombinant mouse IFN-pi (8499-IF-010 / CF) was purchased from Biotechne. BCATc inhibitor 2 (CAY- 9002002-5) was ordered from Cayman. The TBK1 inhibitor GSK8612 (MCE-HY-111941) was purchased from MedChem Express. Methylmalonic acid (M54058) was purchased from Sigma. HSV-1 KOS strain was used for infections. dsDNA was prepared by annealing a 90mer with the following sequences:Forward:TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACATACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACAReverse:TGTAGATCATGTACAGATCAGTCATAGATCACTAGTAGATCTGTATGTAGATCATGTACAGATCAGTCATAGATCACTAGTAGATCTGTAChemical SynthesisAll chemical reagents and anhydrous solvents for synthesis were purchased from commercial suppliers (Sigma-Aldrich, Fluka, Acros, ...) and were used without further purification or distillation. The composition of mixed solvents is given by the volume ratio (v / v).1H nuclear magnetic resonance (NMR) spectra were recorded on a Bruker DPX 400 (400 M Hz for1H) with chemical shifts (6) reported in ppm relative to the solvent residual signals of CDCU (7.26 ppm for1H). Coupling constants are reported in Hz.General method to synthesize AM ester derivatives:Dicarboxylic acid (2.0 mmol, 1.0 eq), was dissolved in MeCN (2ml). DIPEA (0.86 ml, 5.0 mmol, 2.5 eq) was added followed by bromomethyl acetate (0.42 ml, 4.3 mmol, 2.15 eq). The reaction was stirred at room temperature for 3h. The solvents were evaporated under reduced pressure. The residue was purified by FC (12g SiO2, AcOEt / Hexane 1:9 to 4:6) and the solvents evaporated under reduced pressure.Compound 1From 2-methylmalonic acid (80% yield) of colorless oil were obtained.1H NMR (400 MHz, CDCU) 65.76(q, J = 5.7 Hz, 4H), 3.53 (q, J = 7.3 Hz, 1H), 2.12 (d, J = 1.3 Hz, 6H), 1.46 (d, J = 7.3 Hz, 3H).Compound 2From malonic acid. (72% yield) of colorless oil were obtained.TH NMR (400 MHz, CDCU) 6 5.77 (s, 4H), 3.48 (s, 2H), 2.12 (s, 6H).Compound 3From ethylmalonic acid. (75% yield) of colorless oil were obtained.XH NMR (400 MHz, CDCI3) 65.74 (q, J = 5.7 Hz, 4H), 3.35 (t, J = 7.4 Hz, 1H), 2.10 (s, 6H), 1.94 (p, J = 7.4 Hz, 2H), 0.96 (t, J = 7.5 Hz, 3H).Compound 4From dimethylmalonic acid. (68% yield) of colorless oil were obtained.XH NMR (400 MHz, CDCI3) 6 5.73 (s, 4H), 2.11 (s, 6H), 1.46 (s, 6H).Compound 5From isopropylmalonic acid. (71% yield) of colorless oil were obtained.TH NMR (400 MHz, CDCI3) 6 5.80 - 5.71 (m, 4H), 3.24 (dd, J = 8.0, 1.4 Hz, 1H), 2.48 - 2.35 (m, 1H), 2.11 (d, J = 1.5 Hz, 6H), 1.02 (dd, J = 6.8, 1.5 Hz, 6H).Compound 6From propylmalonic (76% yield) of colorless oil were obtained.XH NMR (400 MHz, CDCI3) 6 5.74 (q, J = 5.7 Hz, 4H), 3.43 (t, J = 7.5 Hz, 1H), 2.10 (s, 6H), 1.94 - 1.84 (m, 2H), 1.42 - 1.28 (m, 2H), 0.92 (t, J = 7.4 Hz, 3H).Compound 10From benzylmalonic (62% yield) of colorless oil were obtained.TH NMR (400 MHz, CDCI3) 6 7.36 - 7.19 (m, 5H), 5.76 (s, 4H), 3.81 (t, J = 7.9 Hz, 1H), 3.28 (d, J = 7.9 Hz, 2H), 2.11 (s, 6H).Compound 11From R-2-methylsuccinic acid (76% yield) of colorless oil were obtained.TH NMR (400 MHz, CDCI3) 6 5.80 - 5.68 (m, 4H), 3.02 - 2.89 (m, 1H), 2.78 (dd, J = 17.0, 8.2 Hz, 1H), 2.49 (dd, J = 17.0, 5.8 Hz, 1H), 2.11 (s, 6H), 1.24 (d, J = 7.2 Hz, 3H).Compound 12From cyclobutylmalonic acid (72% yield) of colorless oil were obtained.1H NMR (400 MHz, CDCh) 65.75 (s, 4H), 2.56 (t, J = 8.1 Hz, 4H), 2.11 (s, 6H), 2.08 - 1.96 (m, 2H).Compound 14From S-2-methylsuccinic acid (76% yield) of colorless oil were obtained.TH NMR (400 MHz, CDCI3) 6 5.79 - 5.68 (m, 4H), 3.02 - 2.89 (m, 1H), 2.78 (dd, J = 16.9, 8.2 Hz, 1H), 2.49 (dd, J = 17.0, 5.8 Hz, 1H), 2.11 (s, 6H), 1.24 (d, J = 7.2 Hz, 3H).Compound 15From 2-methylmalonic acid (56% yield) of colorless oil were obtained.XH NMR (400 MHz, CDCI3) 66.91 - 6.81 (m, 2H), 3.42 (qd, J = 7.3, 3.3 Hz, 1H), 2.09 - 2.03 (m, 6H), 1.47 (d, J = 5.5 Hz, 6H), 1.41 (d, J = 7.3 Hz, 3H).AntibodiesWorking dilutions of antibodies were 1 / 1000 unless otherwise stated. Anti-Acetyl-Histone H3 (Lys27) (8173), Acetyl-Histone H3 (Lysl4) (7227), Acetyl-Histone H3 (Lys9) (9649), Di-Methyl-Histone H3 (Lys9) (4658), Tri-Methyl-Histone H3 (Lys27) (9733), GAPDH (2118), p-STING (72971), STING (13647), p-TBKl (D52C2), TBK1 (3504), IRF3 (4302), p-l RF3 (4947), STAT1 (14994), p-STATl (7649) were purchased from Cell Signaling. Anti-MUT (abl34956) and PCCA (abl87686) were purchased from Abeam. Anti-ACSF3 (16864055) was purchased from Fisher Scientific. Anti-MMAB (sc-271424) was purchased from Santa Cruz. Anti-MCEE (16816154) was purchased from Proteintech. Anti-p-actin (MAB8929) (1 / 5000) was purchased from Biotechne. Peroxidase AffiniPure™ F(ab')zFragment Donkey Anti-Rabbit IgG (H+L) (711-036-152) and Donkey Anti-Mouse IgG (H+L) (715-036-151) were purchased from Jackson Immunoresearch.RT-qPCRCells were lysed in Buffer RLT (Qiagen) and mixed with an equal volume of 70% ethanol. RNA extraction from cells was carried out using a NucleoSpin Plasmid EasyPure columns (Macherey-Nagel), buffer RW1 and buffer RPE (both Qiagen). Isolated RNA was quantified using a NanoDrop spectrophotometer (Thermo Fisher), and RNA concentration was normalised to the lowest concentration across all samples with RNAse-free water. If necessary, samples were DNAse-treated after quantification using DNAse I (Thermo Fisher) according to the manufacturer's instructions. Isolated RNA samples were normalised and converted into cDNA using the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher) according to manufacturer's instructions. Real-time quantitative PCR was performed on the cDNA generated in the previous step, using primers designed in-house and ordered from Microsynth,as detailed below. The reaction was performed in a 384-well qPCR plate by a Quantstudio 7 real-time PCR system (Thermo Fisher). Relative expression (2-AACT) was calculated from the CT values for each sample and gene of interest.RNA Interference (RNAi)Pre-designed silencer select siRNAs for Mmab (assay ID s95147), Pcca (assay ID s99888) and negative control (4390847) were ordered from Thermo Fisher. siRNA sequences are given below. Cells were transfected with 50 nM siRNA using 5 pl lipofectamine RNAiMAX according to manufacturer's instructions (Thermo Fisher). Cells were transfected in medium without serum and antibiotics which was replaced with complete medium 8 hours later. Cells were subsequently left for at least a further 12 hours prior to treatment.ChlP-qPCRBMDMs were plated in 1 x 10 cm dish per condition at a density of 0.5 x 106cells / ml. Cells were treated as required and immunoprecipitation was performed using the SimpleChIP Plus Enzymatic Chromatin IP Kit (Cell Signalling) according to manufacturer's instructions. Separate samples were pulled down using anti-Acetyl-Histone H3 (Lys27) (8173), anti-histone H3 (4620) and Normal Rabbit IgG (2729). qPCR was performed using supplied primers for Rpl30 as control. Analysis was performed by calculating the % enrichment of pulldown samples vs input samples.Cleavage under targets and tagmentation (CUT&Tag)Cleavage under targets and tagmentation (CUT&Tag) was performed as described in Kaya-Okur et al., 2019, Nat Commun 10, 1930. 10.1038 / s41467-019-09982-5 with slight modifications. For each epigenetic mark, 1 x 106cells were used per sample using anti-H3K4me3 (C42D8, Cell signalling, 1:50) and anti-H3K27Ac (C15410196, Diagenode, 1:50) primary antibodies. A homemade recombinant pA- Tn5 protein (3XFIag-pA-Tn5-FI, Addgene #124601) was produced and coupled with MEDS Oligos by the Protein Production and Purification of EPFL. The purified recombinant protein was used at a final concentration of 700 ng / pL (1:250 dilution from homemade stock). Libraries were sequenced with 75 bp paired-end on the NextSeq 500 (Illumina). Reads were aligned to the mmlO mouse genome, using bowtie2. Only read pairs with MAPQ>10 were kept. CUT&Tag peaks were called using SEACR vl.3 on "stringent" mode and numeric threshold 0.01 for both marks. Bedtools multicov was used to count mapped reads over filtered peaks, and differential peak analysis was performed using Voom after library size correction (using the total number of aligned reads as a size factor) performed using the TMM method. P-values were corrected for multiple testing using the Benjamini and Hochberg method. The cutoff for significant changes was FC > 2 and padj < 0.05.Liquid-Chromatography-Mass Spectrometry (LC-MS)Untargeted metabolomicsBMDMs (3 independent mice) were plated at 0.5 x 106cells / well in 12-well plates in technical triplicate per condition, treated as indicated, snap frozen and stored at -80°C. Metabolite extraction solution (MES) (methanol / acetonitrile / water, 50:30:20 v / v / v) was added (0.5 mL per 1 x 106cells) and samples were incubated for 15 min on dry ice. The resulting suspension was transferred to ice-cold microcentrifuge tubes. Samples were agitated for 20 min at 4°C in a thermomixer and then incubated at -20°C for 1 h. Samples were centrifuged at maximum speed for 10 min at 4°C. The supernatant was transferred into a new tube and centrifuged again at maximum speed for 10 min at 4°C. The supernatant was transferred to autosampler vials and stored at -80°C prior to analysis by LC-MS.HI LIC chromatographic separation of metabolites was achieved using a Millipore Sequant ZIC-pH ILIC analytical column (5 pm, 2.1 x 150 mm) equipped with a 2.1 x 20 mm guard column (both 5 mm particle size) with a binary solvent system. Solvent A was 20 mM ammonium carbonate, 0.05% ammonium hydroxide; Solvent B was acetonitrile. The column oven and autosampler tray were held at 40°C and 4°C, respectively. The chromatographic gradient was run at a flow rate of 0.200 mL / min as follows: 0- 2 min: 80% B; 2-17 min: linear gradient from 80% B to 20% B; 17-17.1 min: linear gradient from 20% B to 80% B; 17.1-22.5 min: hold at 80% B. Samples were randomized and analysed with LC-MS in a blinded manner and the injection volume was 5 pl. Pooled samples were generated from an equal mixture of all individual samples and analysed interspersed at regular intervals within sample sequenceas a quality control. Metabolites were measured with a Thermo Scientific Q Exactive Hybrid Quadrupole-Orbitrap Mass spectrometer (HRMS) coupled to a Dionex Ultimate 3000 UHPLC or with Vanquish Horizon UHPLC coupled to an Orbitrap Exploris 240 mass spectrometer (both Thermo Fisher Scientific) via a heated electrospray ionization source.For Thermo Scientific Q Exactive Hybrid Quadrupole-Orbitrap Mass spectrometer (HRMS) coupled to a Dionex Ultimate 3000 UHPLC, the mass spectrometer was operated in full-scan, polarity-switching mode, with the spray voltage set to +4.5 kV / -3.5 kV, the heated capillary held at 280°C and the heated electrospray ionization probe held at 320°C. The sheath gas flow was set to 40 units, the auxiliary gas flow was set to 15 units, and the sweep gas flow was set to 0 unit. HRMS data acquisition was performed in a range of m / z = 70-900, with the resolution set at 70,000, the AGC target at 1 x 106, and the maximum injection time (Max IT) at 120 ms. Metabolite identities were confirmed using two parameters: (1) precursor ion m / z was matched within 5 ppm of theoretical mass predicted by the chemical formula; (2) the retention time of metabolites was within 5% of the retention time of a purified standard run with the same chromatographic method. Chromatogram review and peak area integration were performed using the Thermo Fisher software XCalibur Qual Browser, XCalibur Quan Browser software and Tracefinder 5.0 and the peak area for each detected metabolite was normalized against the total ion count (TIC) of that sample to correct any variations introduced from sample handling through instrument analysis.For the Orbitrap Exploris 240 mass spectrometer, MSI scans, mass range was set to m / z=70-900, AGC target set to standard and maximum injection time (IT) set to auto. Data acquisition for experimental samples used full scan mode with polarity switching at an Orbitrap resolution of 120000. Data acquisition for untargeted metabolite identification was performed using the AcquireX Deep Scan workflow, an iterative data-dependent acquisition (DDA) strategy using multiple injections of the pooled sample. In brief, sample was first injected in full scan-only mode in single polarity to create an automated inclusion list. MS2 acquisition was then carried out in triplicate, where ions on the inclusion list were prioritized for fragmentation in each run, after which both the exclusion and inclusion lists were updated in a manner where fragmented ions from the inclusion list were moved to exclusion list for the next run. DDA full scan-ddMS2 method for AcquireX workflow used the following parameters: full scan resolution was set to 60000, fragmentation resolution to 30000, fragmentation intensity threshold to 5.0e3. Dynamic exclusion was enabled after 1 time and exclusion duration was 10s. Mass tolerance was set to 5ppm. Isolation window was set to 1.2 m / z. Normalized HCD collision energies were set to stepped mode with values at 30, 50, 150. Fragmentation scan range was set to auto, AGC target at standard and max IT at auto. Xcalibur AcquireX method modification was on. Mild trapping was enabled.Metabolite identification was performed in the Compound Discoverer software (v 3.2, Thermo Fisher Scientific). Metabolites were annotated at the MS2 level using both an in-house mzVault spectral database curated from 1051 authentic compound standards and the online spectral library mzCloud. The precursor mass tolerance was set to 5 ppm and fragment mass tolerance set to 10 ppm. Only metabolites with mzVault or mzCloud best match score above 50% and 75%, respectively, and RT tolerance within 0.5 min to that of a purified standard run with the same chromatographic method were exported to generate a list including compound names, molecular formula and RT. The curated list was then used for further processing in the Tracefinder software (v 5.0, Thermo Fisher Scientific), where extracted ion chromatographs for all compounds were examined and manually integrated if necessary. False positive, noise or chromatographically unresolved compounds were removed. The peak area for each detected metabolite was then normalized against the total ion count (TIC) of that sample to correct any variations introduced from sample handling through instrument analysis. The normalized areas were used as variables for further statistical data analysis. Statistical analysis and enrichment analysis was performed using MetaboAnalyst.Targeted metabolomicsCells were pre-extracted and homogenized by the addition of 250 pL of MeOH:H2O (4:1), in the Cryolys Precellys 24 sample Homogenizer (2 x 20 seconds at 10000 rpm, Bertin Technologies, Rockville, MD , US) with ceramic beads. The bead beater was air-cooled down at a flow rate of 110 L / min at 6 bar. Homogenized extracts were centrifuged for 15 minutes at 4000 g at 4°C (Hermle, Gosheim, Germany). The resulting supernatant was collected and evaporated to dryness in a vacuum concentrator (LabConco, Missouri, US). Dried sample extracts were resuspended in 100 pl MeOH / HjO (4:1, v / v) containing the internal standards. Calibration curves were generated following the same procedure as for the samples; by addition of 80 pL of IS mixture to each pre-prepared calibrator (20 pL of mixture of malate, fumarate, itaconate, methylmalonate and succinate), containing the increasing amount of each standard).Extracted samples were analysed by Liquid Chromatography -Tandem Mass Spectrometry in negative ionization mode operating in selected reaction monitoring (SRM) mode using a TSQ. Altis triple quadrupole instrument (Thermo Fisher Scientific). Chromatographic separation was carried out in an Acquity HSS-T3 (1.7 pm, 100 mm x 2.1 mm LD.) column (Waters, Massachusetts, US). Mobile phase was composed of 0.2% formic acid in water (A) and 0.2% formic acid in MeOH (B) and flow rate was set to 0.35 ml / min.The protein pellets were evaporated and lysed in 20 mM Tris-HCI (pH 7.5), 4M guanidine hydrochloride, 150 mM NaCI, 1 mM Na2EDTA, 1 mM EGTA, 1% Triton, 2.5 mM sodium pyrophosphate, 1 mM beta-glycerophosphate, 1 mM Na3VO4, 1 pg / ml leupeptin using the Cryolys Precellys 24 sampleHomogenizer (2 x 20 seconds at 10000 rpm, Bertin Technologies, Rockville, MD , US) with ceramic beads. BCA Protein Assay Kit (Thermo Scientific, Masschusetts, US) was used to measure (A562nm) total protein concentration (Hidex, Turku, Finland).RNA SequencingBMDMs (3 independent mice) were treated as indicated and RNA was extracted using a RNeasy Plus Mini Kit (Qiagen). RNA was further processed for sequencing by the Gene Expression Core Facility (GECF) at EPFL. RNA quality was profiled using a Tapestation 4200 (Agilent). mRNA-seq libraries were prepared Illumina stranded mRNA ligation. The samples were sequenced using the NovaSeq 6000 system (Illumina). GSEA analysis of RNAseq was performed using the Broad Institutes GSEA.Seahorse XF Mito Stress TestCells were plated at 100,000 cells / well in 100 pl and were left overnight to adhere. Protocol was carried out according to manufacturer's instructions (Agilent). In brief, cells were treated as required, after which medium was replaced with Seahorse medium containing glutamine (2 mM), glucose (10 mM) and pyruvate (1 mM). Cells were then placed in a CO2-free incubator for 1 hour. Mito stress test was subsequently performed using a Seahorse XFe96 Analyzer (Agilent) with the following injections: A- Oligomycin (1 pM)B- FCCP (l pM)C- Rotenone (500 nM)Analysis was performed using Seahorse Wave Software (Agilent). Data shown are representative experiments containing at least 3 pooled biological replicates.Western BlottingSupernatant was removed from cells following stimulation and lysates were harvested in 30-50 pl lysis buffer (0.125 M Tris pH 6.8, 10% glycerol, 0.02% SDS, 5% DTT). Lysates were subsequently heated to 959C for 5 mins to denature proteins. SDS-PAGE was used to resolve proteins by molecular weight. Samples were boiled at 959C for 5 mins prior to loading into a 5% stacking gel. The percentage resolving gel depended on the molecular weight of the given protein. The Bio-Rad gel running system was used to resolve proteins and the Bio-Rad Trans-Blot Turbo system was used for the electrophoretic transfer of proteins onto nitrocellulose membrane (Immobilon). Following transfer, the membrane was incubated in milk powder (5% in PBST) for 1 hr and subsequently incubated in primary antibody rolling overnight at 49C. Primary antibodies targeting phospho-proteins were diluted in BSA (5% in PBST) as opposed to milk. The membrane was incubated for 1 hr with secondary antibody (diluted in 5% milk powder) at room temperature. Prior to visualisation, the membrane was immersed in WesternBrightECL Spray (Advansta) or SuperSignal West Femto substrate solution (Thermo Fisher). Protein visualisation took place on a ChemiDoc MPTM Imaging System (Bio-Rad), and both chemiluminescent and white light images were taken. Images were analysed using Image Lab (Bio-Rad).ELISADuoSet ELISA kits for IFN-p (DY8234-05) were purchased from R&D Systems and were carried out according to the manufacturer's instructions with appropriately diluted cell supernatants added to each plate in duplicate or triplicate. Absorbance at 450 nm was quantified using a Tecan plate reader. Corrected absorbance values were calculated by subtracting the background absorbance, and cytokine concentrations were subsequently obtained by extrapolation from a standard curve plotted on GraphPad Prism.LDH release assayThe CytoTox 96 Non-Radioactive Cytotoxicity Assay (Promega) was used to quantify lactate dehydrogenase (LDH) release from cells as a measure of cytotoxicity in BMDMs. Freshly harvested supernatants were used in this assay. 50 pL of each supernatant was added to 50 pL Cytotox 96 Reagent and incubated in the dark at room temperature for 30 min. 50 pL acetic acid was added to stop the reaction, and the absorbance at 492 nm was measured using a Tecan plate reader. Medium alone was also used to correct for background absorbance, and LDH release was calculated relative to vehicle-treated cells.Quantification and Statistical AnalysesData are expressed as mean ± standard error of the mean (SEM) except OCR data which are mean ± standard deviation (SD). Representative western blots are shown. GSEA analysis of RNAseq was performed using the Broad Institutes GSEA 4.1.070. Graphpad Prism 9.2.0 was used to calculate statistics in bar plots using appropriate statistical tests depending on the data including one-way ANOVA, two-tailed unpaired t test and multiple t tests. Adjusted p values were assessed using appropriate correction methods, such as Tukey, Kruskal-Wallis, and Holm-Sidak tests. Sample sizes were determined based on previous experiments using similar methodologies. All depicted data points are biological replicates taken from distinct samples, except OCR data which depicts technical replicates from a single experiment. Each figure consists of a minimum of 3 independent experiments from multiple biological replicates. For metabolomics and RNA sequencing analyses, samples were processed in random order and experimenters were blinded to experimental conditions.

Claims

CLAIMS1. Compound of formula (I)wherein n is 0 or 1; each Q is independently OH, SH, SR, OR or formula (II), wherein R is a Ci-Cg linear or branched alkyl containing 0, 1 or 2 unsaturation(s) or a Cg-Cg cycloalkyl, wherein the linear or branched alkyl containing 0, 1 or 2 unsaturation(s) or the Cg-Cg cycloalkyl is optionally substituted with F, Cl, Br, I, OH, OR, NHj, NHR, NRj, SH; SR, COOH; COOR, COHN2; CONHR; CONR2, wherein R is methyl, ethyl, propyl, butyl, isopropyl, tertbutyl, cyclopropyl, cyclobutyl, cyclopentyl or cyclohexyl, wherein formula (II) iswhereinRg is H, methyl or ethyl; andR4is methyl, ethyl, propyl, isopropyl, tert-butyl or cyclopropyl;Z is O or S;Ri is H or methyl; andR2 is a Ci-Cg linear or branched alkyl containing 0, 1 or 2 unsaturation(s), a Cg-Cg cycloalkyl, a Ci- Cg linear or branched alkyl substituted with one or more of: F, Cl, Br, I, OH, OR, NH2, NHR, NR2, SH, SR, COOH, COOR, COHN2, CONHR, CONR2, SO2NH2, SO2NHR, SO2NR2, CN or C(O)R, wherein R is methyl, ethyl, propyl, butyl, isopropyl, tertbutyl, cyclopropyl, cyclobutyl, cyclopentyl or cyclohexyl, substituted or unsubstituted phenyl or substituted and unsubstituted benzyl,wherein the substituents of substituted phenyl or substituted benzyl are selected from F, Cl, Br, I, OH, O- Ci-C6alkyl, NH2, NH- Ci-C6alkyl, N- (Ci-C6alkyl)2, SH, S- Ci-C6alkyl, COOH, COOR, CONH2, CONHR, CONR2, SO2NH2, SO2NHR; SO2NR2, CN, CI-C6alkyl, Ci-C6alkenyl, C3-C6cycloalkyl ethynyl, C(O)R, phenyl or a 5- or 6-membered ring heteroaryl, wherein R is methyl, ethyl, propyl, butyl, isopropyl, tertbutyl, cyclopropyl, cyclobutyl, cyclopentyl or cyclohexyl, or Ri and R2form together a four to six membered ring, preferably cyclobutyl; or a pharmaceutically acceptable salt of a compound of formula (I) for use in treating an inflammatory disease.

2. Compound for use of claim 1, wherein the inflammatory disease is an IFN-mediated inflammatory disease or a disease being associated with an undesirable IFN response.

3. Compound for use of claim 1 of 1, wherein the inflammatory disease is an autoimmune disease.

4. Compound for use of any one of claims 1 to 3, wherein the inflammatory disease is selected from systemic lupus erythematosus (SLE), rheumatoid arthritis (RA), periodontitis, inflammatory bowel disease (IBD) (including Crohn's and ulcerative colitis), psoriatic arthritis (PsA), psoriasis, ankylosing spondylitis, hidrosadenitis suppurativa, sarcoidosis, atopic dermatitis (AD), connective tissue disorders, asthma, and multiple sclerosis (MS), a neurodegenerative disease (such as amyotrophe lateral sclerosis, Parkinson's disease, and Alzheimer's disease), a monogenic interferonopathy (such as Aircardi-Goutieres syndrome, stimulator-of-interferon- genes-associated vasculopathy with onset in infancy (SAVI), proteasome associated autoinflammatory syndromes, and familial chilblain lupus).

5. Compound for use of any one of claims 1 to 4, wherein the compound is a compound of Formula(la), Formula (lb), or Formula (Ic)Formula (la) Formula (lb) Formula (Ic) whereinn is 0 or 1; each Q is independently OH, SH, SR, OR or formula (II), wherein R is a Ci-Cg linear or branched alkyl containing 0, 1 or 2 unsaturation(s) or Ca-Cg cycloalkyl, wherein the linear or branched alkyl containing 0, 1 or 2 unsaturation(s) or the Ca-Cg cycloalkyl is optionally substituted with F, Cl, Br, I, OH, OR, NH2, NHR, NR2, SH; SR, COOH; COOR, COHN2; CONHR; CONR2, wherein R is methyl, ethyl, propyl, butyl, isopropyl, tertbutyl, cyclopropyl, cyclobutyl, cyclopentyl or cyclohexyl, wherein formula (II) iswhereinRs is H, methyl or ethyl; andR4is methyl, ethyl, propyl, isopropyl, tert-butyl or cyclopropyl;Z is O or S;Y is H or methyl; andX is F, Cl, Br, I, OH, O-alkyl; NH2, NH-alkyl, N-alkyh, SH; S-alkyl, COOH, COOR, CONH2, CONHR; CONR2, SO2NH2, SO2NHR; SO2NR2, CN, C1-C6 alkyl, C1-C6 alkenyl, C3-C6 cycloalkyl ethynyl, C(O)R, substituted or unsubstituted phenyl, or a 5- or 6-membered ring or heteroaryl, wherein R is methyl, ethyl, propyl, butyl, isopropyl, tertbutyl, cyclopropyl, cyclobutyl, cyclopentyl or cyclohexyl, wherein the substituents of substituted phenyl are selected from F, Cl, Br, I, OH, O- Ci-Cgalkyl, NH2, NH- Ci-C6alkyl, N- Ci-C6alkyl2, SH, S- Ci-C6alkyl, COOH, COOR, COHN2, CONHR, CONR2, SO2NH2, SO2NHR; SO2NR2, CN, Ci-Cg alkyl, Ci-Cg alkenyl, Ca-Cg cycloalkyl ethynyl, C(O)R, phenyl, or a 5- or 6-membered ring heteroaryl, wherein R is methyl, ethyl, propyl, butyl, isopropyl, tertbutyl, cyclopropyl, cyclobutyl, cyclopentyl or cyclohexyl.

6. Compound for use of any one of claims 1 to 4, wherein the compound is a compound of formulan is 0 or 1; each Q is independently OH, SH, SR, OR or formula (II), wherein R is a Ci-Cg is a linear or branched alkyl containing 0, 1 or 2 unsaturation(s) or Cg-Cg cycloalkyl, wherein the linear or branched alkyl containing 0, 1 or 2 unsaturation(s) or the Cg-Cg cycloalkyl is optionally substituted with F, Cl, Br, I, OH, OR, NHz, NHR, NRz, SH; SR, COOH; COOR, CONHz; CONHR; CONRz, wherein R is methyl, ethyl, propyl, butyl, isopropyl, tertbutyl, cyclopropyl, cyclobutyl, cyclopentyl or cyclohexyl, wherein formula (II) iswhereinRs is H or methyl; andR4is methyl, ethyl, propyl, isopropyl, tert-butyl or cyclopropyl;Z is O or S;Y is H or methyl; andR is a 6-membered aromatic ring with one to three N, O and / or S heteroatom(s), an indole or a 5-membered aromatic ring with one to three N, O and / or S heteroatom(s), wherein the 6-membered aromatic ring, indole or 5-membered aromatic ring is optionally substituted with methyl, ethyl, propyl, CN, =0; =S; NHz; OH, F, Cl, Br, or I.

7. Compound for use of any one of claims 1 to 4, wherein each Q is independently OH or O- acetooxymethyl, and preferably both Q are OH or O-acetooxymethyl.

8. Compound for use of any one of claims 1 to 4, wherein R1of formula (I) is H and R2of formula (I) is methyl, ethyl, propyl, isopropyl or benzyl.

9. Compound for use of any one of claims 1 to 4, wherein R3of formula (II) is H and R4of formula (II) is methyl, ethyl, propyl, isopropyl or benzyl.

10. Compound for use of any one of claims 1 to 9, wherein the compound is(i) methylmalonic acid, malonic acid, ethylmalonic acid, dimethylmalonic acid, isopropylmalonic acid, 2-propylmalonic acid, benzylmalonic acid, cylobutylmalonic acid, (R or S-)2-methylsuccinic acid or a pharmaceutically acceptable salt thereof, or(ii) a diacetoxymethyl ester of any one of the acids of (i).

11. Compound for use of any one of claims 1 to 10, wherein the pharmaceutically acceptable salt is a sodium or potassium salt, preferably a disodium or dipotassium salt.

12. Compound for use of any one of claims 1 to 10, wherein the compound is formulated as a pharmaceutical composition, wherein the pharmaceutical composition preferably comprises the compound and at least one pharmaceutically acceptable carrier, excipient or diluent.

13. Compound for use of any one of claims 1 to 12, wherein the compound is conjugated to a heterologous compound, preferably a pharmaceutically or diagnostically active compound.

14. Compound for use of claim 12, wherein the compound is conjugated to the heterologous compound via click chemistry.

15. Compound for use of claim 13 or 14, wherein the heterologous compound is an antibody or an antibody mimetic, wherein the antibody mimetic is preferably selected from the group consisting of Anticalins, Affibodies, Adnectins, DARPins, Avimers, Nanofitins, Affilinss, - Wrapins, ADAPT, Monobodies, Raslns, FingRs, Pronectins, Centyrins, Affimers, Adhirons, Affitins, aReps, Repebodies, i-bodies, Fynomers and Kunitz domain proteins.

Citation Information

Patent Citations

  • Specific and high affinity binding proteins comprising modified SH3 domains of FYN kinase

    WO2008022759A2

  • Membrane active molecules

    US20180303821A1

  • Methods and compositions for the treatment of diseases associated with cancer, inflammation, or immune response

    US20200375929A1