Method and compositions for aptamer mediated delivery of therapeutics

Abstract

Compositions and methods for aptamer-mediated delivery of therapeutic agents. RNA aptamers identified via SELEX specifically bind and are internalized by cardiomyocytes or cardiac fibroblasts, delivering antisense oligonucleotides or other therapeutics intracellularly. This strategy offers a non-viral, targeted approach for treating cardiac diseases and may be extended to other tissues or therapeutic modalities.

Description

TITLEMETHOD AND COMPOSITIONS FOR APTAMER MEDIATED DELIVERY OF THERAPEUTICS

[0001] This application claims priority from U.S. Provisional Application No. 63 / 654,389, filed May 31, 2024, which is herein incorporated by reference.

[0002] This invention was made with government support under grant numbers HL164584, HL169432, HL147954 and HL132899, awarded by the National Institutes of Health. The government has certain rights in the invention.REFERENCE TO ELECTRONIC SEQUENCE LISTING

[0003] The application contains a Sequence Listing which has been submitted electronically in .XML format. Said .XML copy, created on May 8, 2025, is named “1134- 226 PCT. xml” and is 30,775 bytes in size. The sequence listing contained in this .XML file is part of the specification and is hereby incorporated by reference herein in its entirety.FIELD

[0004] This application relates to the field of medical treatment and, in particular, to aptamer-mediated intracellular delivery of therapeutics.BACKGROUND

[0005] RNA therapeutics pose a promising avenue for the treatment of diseases, like heart disease, that have limited treatments available by greatly expanding druggable targets. Despite the promise of RNA-based therapies, their application is hindered by delivery barriers due to their negative charge and susceptibility to degradation. Current delivery mechanisms include viral vectors and non-viral systems (i.e., RNA conjugates and lipid nanoparticles), but there are drawbacks to these approaches. Viral vectors cannot be used for long-term treatment due to immune response. RNA conjugates require knowledge of a receptor and its ligand, and the RNA molecule must be able to escape the endosome to assert its therapeutic effect. Lipid nanoparticles are difficult to scale and can require frequent high doses of the therapeutic. Further study into the delivery of RNA therapeutics is needed to access the wider range of targets that would create avenues for treatments of disease and conditions such as cardiac fibrosis and hypertrophy.SUMMARY

[0006] One aspect of the application relates to an oligonucleotide comprising an RNA aptamer covalently linked to, or conjugated to, a therapeutic agent, wherein the RNA aptamer binds specifically to a target that is a cell surface protein.

[0007] Another aspect of the application relates to a method of treating a disease or condition in a subject, comprising the steps of administering to the subject, an effective amount of an oligonucleotide as described herein. In some embodiments, the disease or condition is cardiac fibrosis or cardiac hypertrophy.

[0008] Another aspect of the application relates to a pharmaceutical composition. The pharmaceutical composition comprises the oligonucleotide of the present application and a pharmaceutically acceptable carrier.BRIEF DESCRIPTION OF THE DRAWINGS

[0009] FIGS. 1 A-1B. show an overview of the Systematic Evolution of Ligands By Exponential Enrichment (SELEX) workflow. FIG. 1 A shows schematic detailing the key procedural steps employed in the assay. Initially, aptamers are synthesized via in vitro transcription from a double-stranded DNA library, which comprises a T7 promoter, a 5’ adaptor sequence, a segment of 40 randomized nucleotides, and a 3' adaptor. The transcribed RNA is subsequently folded and incubated with cardiomyocytes or cardiac fibroblasts. Following incubation, the cells undergo rigorous washing steps to remove unbound RNA, after which the intracellular RNA is extracted and reverse-transcribed. Finally, the original library is regenerated through PCR, utilizing a forward primer to reintroduce the T7 promoter and a reverse primer targeting the 3' adaptor Beginning with initial RNA aptamer library preparation. This process is repeated over, generally, 8-10 rounds. After the last round, nextgeneration sequencing (NGS) is performed to identify candidate aptamers and begin characterization. FIG. IB also depicts the SELEX workflow but shows a more in-depth schematic of the aptamers structure, containing a T7 promoter in the forward region and a 40 nucleotide variable region.

[0010] FIGS. 2A-2B show analysis of NGS results of libraries from SELEX rounds 0-8 and monitoring enrichment throughout these rounds. Bar graphs depict the reduction in unique sequence diversity and enrichment of specific RNA populations, as indicated by the increased homogeneity in read counts. FIG. 2A. Cardiomyocyte-SELEX for rounds 0, 2, 4, 6, 7, and 8 were sent for next-generation Illumina sequencing. Library preparation was performed using the NEB Next Ultra II DNA Prep Kit. The library was sequenced at a depth of 750 million reads and analyzed using the AptaScreenf program. Outputs of theAptaScreen program show the enrichment throughout SELEX. FIG. 2B. Cardiac-fibroblast SELEX was sequenced at a depth of 750 million reads for rounds 0, 2, 3, 4, 5, 6, 7, and 8.

[0011] FIGS. 3A-3B. Longitudinal analysis of individual aptamers across successive SELEX rounds, featuring a top-performing aptamer as a representative example and contrasting it with the lOOOth-ranked aptamer as a control. RNA sequencing enables the early identification of enriched candidates. FIG 3 A shows cardiomyocyte-screens top 5 RNA aptamers enrichment throughout rounds 0-8 contrasting to the 1000th-ranked aptamer as a control. FIG 3B shows the cardiac fibroblast-screens top 5 RNA aptamers enrichment throughout rounds 0-8 compared to the 1000th-ranked aptamer as a control.

[0012] FIG. 4A shows: Treatment of primary mouse cardiomyocytes and cardiac fibroblasts with top enriched aptamers. RT-qPCR results of cardiomyocyte treatment with 100 nM of round 8 library, control low-ranked aptamer (#1000), and the top 10 RNA aptamers (100 nM). Aptamers 1, 2, and 3 were significantly enriched compared to the controls. FIG. 4B shows RT-qPCR results of cardiac fibroblast treatment with 100 nM of round 8 library, 100 nM of low-ranked aptamer control (#1000), and top 5 RNA aptamers from cardiac fibroblast SELEX.

[0013] FIG. 5 depicts a schematic for the mechanism of FIG. 6, showing the conjugation of aptamer (delivery vehicle) to an antisense oligonucleotide (ASO). Here, the aptamer binds to a receptor on the cell’s surface and is endocytosed, thus delivering the ASO for therapeutic applications.

[0014] FIG. 6 show efficient Internalization of Top RNA Aptamers Enhances Antisense Oligonucleotide Efficacy in Cardiomyocytes. Conjugation of RNA aptamer to ASO leads to knockdown of long noncoding RNA MALAT1. MALAT1 expression levels in cardiomyocytes are assessed relative to ACTB. Cells were incubated for 24 hours with 10 nM of either a control ASO or a MALAT1 -targeting ASO, either unaccompanied or fused with a control aptamer, Aptl, or Apt2. Data are presented as mean ± SD. Significance levels are denoted as * P < 0.05, ** P < 0.01, *** P < 0.001; Statistical validation was performed using 2-way ANOVA followed by a Holm-Sidak post-hoc test.

[0015] FIGS. 7A-7B. Z-stack Confocal microscopy images feature Cy3-labeled aptamers (shown in red), alpha-actinin as a CM marker, and DAPI staining for the nucleus. The internalization efficacy of the top-performing aptamers (Aptl and Apt2) is compared to a control aptamer ranked at 1,000. Arrows pinpoint Cy3 punctate, which potentially indicate successful aptamer internalization. Scale bar = 50 pm. FIG. 7B shows Z-stack confocal microscopy images of cardiomyocytes treated with 100 nM of Cy3 -conjugated aptamer(shown in red). The efficiency of top hit Apt-CM-01 is compared to a control (rank=l,000) aptamer. Scale bar=30 pm.

[0016] FIG. 8 Z-stack confocal microscopy images feature Cy3 -labeled aptamers (shown in red), F-actin as a cytoskeleton marker (shown in green), and DAPI (shown in blue) staining for the nucleus. The internalization efficiency of the top-performing aptamers (CF- Apt-01 and CF-Apt-02) is compared to a control aptamer ranked at 1,000. Boxe indicate zoomed area. Cells are treated with aptamer at 100 nM concentration. Scale bar = 30 pm.

[0017] FIGS. 9A-9D show inhibition of endocytosis results in decreased aptamer results. FIG. 9A. Confocal images at 60X focus of cy3 conjugates aptamers in cardiac fibroblasts untreated (top panels) or treated with chlorpromazine to inhibit clathrin-mediated endocytosis. FIG. 9B. Confocal images at 60X focus of cy3 conjugates aptamers in cardiomyocytes untreated (top panels) or treated with chlorpromazine to inhibit clathrin- mediated endocytosis. FIGS. 9C-9D. Bar graphs representing the average per cent of cy3 positive area across each image of the two groups (FIG. 9C. cardiac fibroblasts, FIG.9D. cardiomyocytes). Percent positive cy3 calculated with ImageJ by selecting red particles within cells. Scale bar = 30 pm.DETAILED DESCRIPTION

[0018] Reference will be made in detail to certain aspects and exemplary embodiments of the application, illustrating examples in the accompanying structures and figures. The aspects of the application will be described in conjunction with the exemplary embodiments, including methods, materials and examples, such description is non-limiting and the scope of the application is intended to encompass all equivalents, alternatives, and modifications, either generally known, or incorporated here. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. One of skill in the art will recognize many techniques and materials similar or equivalent to those described here, which could be used in the practice of the aspects and embodiments of the present application. The described aspects and embodiments of the application are not limited to the methods and materials described.

[0019] Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by a person of ordinary skill in the art. See, e.g., Singleton et al., DICTIONARY OF MICROBIOLOGY AND MOLECULAR BIOLOGY 2nd ed., J. Wiley & 20 Sons (New York, NY 1994); Sambrook et al., MOLECULAR CLONING, A LABORATORY MANUAL, Cold Springs Harbor Press (Cold SpringsHarbor, NY 1989). Any methods, devices and materials similar or equivalent to those described herein can be used in the practice of this invention. The following definitions are provided to facilitate understanding of certain terms used frequently herein and are not meant to limit the scope of the present disclosure.Overview

[0020] The present application uses the unbiased identification of RNA aptamers with cell-SELEX targeting the specific cell types associated with pathological remodeling of the heart that occurs in heart disease. The present application is based on the surprising discovery that ASO conjugates show significantly better therapeutic effects than the naked ASOs. Described herein are methods and compositions for delivering therapeutic agents into specific target cells, such as cardiomyocytes or cardiac fibroblasts, using conjugated RNA aptamers. In some embodiments, therapeutic agents include siRNAs, and small molecules. Embodiments include specific aptamer and ASO sequences, methods for conjugation, modes of administration, and mechanisms of uptake.

[0021] Both RNA therapeutics (e.g., ASOs, siRNA, etc.) and small molecule therapeutic compounds can be conjugated with the RNA aptamers for cell type-enriched or cell type-specific delivery. The RNA aptamers can be used as an approach to not only bind a specific cell but also to deliver therapeutics to cardiomyocytes and cardiac fibroblasts. Without being bound by theory, evidence supports that aptamer uptake is via receptor- mediated endocytosis, as shown by chlorpromazine inhibition experiments. Internalization results in punctate or nuclear localization, depending on concentration and aptamer sequence.

[0022] In some embodiments, these aptamers are used to deliver RNA therapeutics to treat fibrosis and hypertrophy. Examples of RNA therapeutics include, but are not limited to, RNA therapeutics targeting the mRNA of p38 (anti -hypertrophy), BRD4, IL-11, YBX1 (antifibrosis), INSR, PGC1A (anti-diabetic). Examples of small molecule therapeutic compounds include, but are not limited to, anti -fibrotic compounds such as JQ1, salinomycin and halofuginone (anti-fibrosis).Definitions

[0023] As used herein, "aptamer" refers to a short, single-stranded nucleic acid (DNA or RNA) molecule, typically ranging from about 20 to 100 nucleotides in length, that is capable of binding to a specific molecular target such as a protein, cell surface receptor, or small molecule with high affinity and specificity. Aptamers may adopt secondary and tertiary structures that facilitate such binding and may be selected or evolved in vitro using techniques, such as Systematic Evolution of Ligands by Exponential enrichment (SELEX).Aptamers may include chemical modifications to enhance their stability, binding affinity, or pharmacokinetics, including, but not limited to, 2'-Fluoro (2'-F), 2'-O-methyl, phosphorothioate backbones, locked nucleic acids (LNAs), and others.

[0024] As used herein, "SELEX" (Systematic Evolution of Ligands by Exponential enrichment) refers to a laboratory -based iterative selection process used to identify aptamers from a large randomized nucleic acid library. The process involves repeated cycles of binding, partitioning, amplification, and selection to enrich nucleic acid sequences that specifically bind a target of interest, including whole cells (cell-SELEX), isolated proteins, or cell surface molecules. In some embodiments, next-generation sequencing is used to monitor enrichment during the process.

[0025] As used herein, "cardiomyocyte" refers to a heart muscle cell responsible for the contractile function of the myocardium. Cardiomyocytes may be isolated from adult or embryonic mammals, including but not limited to, humans, mice, or rats. The term includes primary cardiomyocytes cultured ex vivo as well as cardiomyocyte-derived cell lines or cardiomyocytes differentiated from stem cells.

[0026] As used herein, "cardiac fibroblast" refers to a type of cell present in the heart responsible for extracellular matrix production, tissue remodeling, and fibrotic response during cardiac stress or injury. The term encompasses primary cells, immortalized fibroblast lines, or fibroblasts derived from pluripotent sources.

[0027] As used herein, a "therapeutic agent" refers to any molecule or compound that exerts a therapeutic, prophylactic, or diagnostic effect when delivered to a target cell or tissue. The term encompasses nucleic acid-based molecules including ASOs, small interfering RNAs (siRNAs), microRNAs, mRNAs, as well as small molecule drugs, peptides, proteins, and any combination thereof.

[0028] As used herein, an "antisense oligonucleotide" (ASO) is a short, synthetic, single-stranded DNA or RNA sequence that is complementary to a target RNA sequence and modulates gene expression, typically by inducing RNase H-mediated cleavage of the RNA or by sterically blocking RNA processing. ASOs may incorporate chemical modifications, such as phosphorothioate linkages, 2'-O-methyl modifications, and locked nucleic acids, to enhance nuclease resistance and binding affinity.

[0029] As used herein, "gapmer" refers to a chimeric ASO design in which a central block of DNA nucleotides is flanked by chemically modified RNA-like nucleotides (e.g., 2'- O-methyl, 2'-F, or LNA bases). This configuration permits RNase H cleavage of the RNAstrand in an RNA-DNA duplex while maintaining enhanced nuclease resistance and target affinity.

[0030] As used herein, a "conjugate" refers to a molecular construct in which an RNA aptamer is covalently linked to a therapeutic agent, such as an ASO, siRNA, or small molecule drug. The linkage may be via direct covalent bonds (e.g., phosphodiester, click chemistry), oligonucleotide linkers (e.g., poly-thymidine spacers), or bifunctional chemical groups. The conjugate is capable of entering target cells via aptamer-mediated mechanisms and delivering the therapeutic agent intracellularly.

[0031] As used herein, "endocytosis" refers to a cellular process by which substances are internalized into a cell through the invagination of the cell membrane to form vesicles. Receptor-mediated endocytosis is a subtype where internalization is initiated by the binding of a ligand, such as an aptamer, to a specific cell surface receptor. In some embodiments, this includes clathrin-dependent pathways, as evidenced by inhibition studies using chlorpromazine.

[0032] As used herein, a "target cell" refers to any cell type to which the aptamer is designed to bind and deliver its therapeutic cargo. In some embodiments of the present invention, the target cells include cardiomyocytes, cardiac fibroblasts, or other diseaserelevant cell types, including but not limited to cancer cells or inflammatory cells.

[0033] As used herein, "internalization" means the uptake of the aptamer or aptamer- therapeutic conjugate into the intracellular space of a cell, resulting in the delivery of the therapeutic agent into the cytoplasm, nucleus, or other subcellular compartments. Internalization may be measured by microscopy, flow cytometry, or biochemical assays (e.g., RT-qPCR, fluorescence imaging).

[0034] As used herein, "nuclease-resistant" refers to the structural modification of nucleic acid sequences to resist degradation by nucleases present in biological fluids or within cells. Examples include incorporation of 2'-F, 2'-O-methyl, phosphorothioate, or locked nucleic acid (LNA) modifications.

[0035] As used herein, a "linker" refers to a chemical or oligonucleotide-based bridge that connects the aptamer to the therapeutic agent. Linkers may be of variable length and composition, including but not limited to, short oligonucleotides (e.g., poly-T sequences), chemical spacers, or cleavable linkers designed to release the therapeutic cargo under intracellular conditions.

[0036] As used herein, "knockdown" refers to the reduction in expression of a target RNA or protein as a result of treatment with the aptamer-therapeutic conjugate. Thisreduction may be partial or complete, transient or sustained, and may be measured at the RNA or protein level.

[0037] As used herein, the term “sequence identity” refers to the extent to which two nucleic acid sequences are the same when aligned for maximum correspondence over a comparison window. Sequence identity is typically expressed as a percentage of identical nucleotides shared between two sequences. The “comparison window” may be all or part of the nucleic acid sequence, and the percentage of sequence identity is calculated by comparing the aligned positions, counting the number of identical matches, and dividing by the total number of positions in the window, then multiplying by 100. Unless otherwise stated, percent sequence identity is determined using the BLASTN algorithm (Basic Local Alignment Search Tool for Nucleotides) or the Needleman-Wunsch global alignment algorithm, with standard default parameters, comparing the nucleic acid sequence in question to a reference sequence. For the purposes of the present disclosure, a nucleic acid sequence is said to have at least X% sequence identity to a reference sequence if, when aligned using such algorithm(s), X percent or more of the nucleotides are identical over the full length of the reference sequence.RNA Aptamers

[0038] RNA aptamers are small polynucleotide molecules that can be designed to specifically bind a target through SELEX (FIG. 1). Here, primary mouse cardiomyocytes and cardiac fibroblasts isolated from healthy mice were used in cell-SELEX. The study performed cell-SELEX on primary mouse cardiomyocytes and cardiac fibroblast, followed by next-generation sequencing.

[0039] Next-generation sequencing results revealed that both SELEX experiments resulted in the enrichment of aptamers, with cardiac fibroblasts displaying earlier and higher enrichment compared to cardiomyocytes (FIG. 2A-B).

[0040] In some further embodiments, cardiac fibroblast aptamer target proteins are identified with RNA affinity purification followed by mass spectrometry. The mass spectrometry identified cardiomyocyte target proteins (e.g., KCNJ11) may be validated via surface plasmon resonance and fluorescence anisotropy.

[0041] In some further embodiments, RNA aptamers are localized in both cardiac fibroblasts and cardiomyocytes by confocal microscopy. In some further embodiments, potential receptor proteins for RNA aptamer binding and endosome marker proteins for aptamer trafficking are located / identified / located by immunostaining.

[0042] In some embodiments, RNA aptamers are conjugated to ASOs using the following protocol: For the conjugation of RNA aptamers to ASOs, a T4 RNA ligase reaction was prepared as follows: 25% PEG; 0.5 uL RNase inhibitor (40 U / uL); 1 mM ATP; IX T4 RNA Buffer; 100 pmol aptamer; 100 pmol ASO; 1 uL T4 RNA ligase; and water to 20 uL. As a negative control, a reaction without RNA aptamer and ASO was prepared. The reactions were incubated at 16 °C overnight. An RNA agarose gel was prepared by adding 1 g agarose to 72 mL ultrapure (double-distilled) water, heating until dissolved, cooling to 60 °C, adding 10 mL 10X MOPS running buffer (0.4 M MOPS, pH 7.0, 0.1 M sodium acetate, 0.01 M EDTA), and 18 mL 37% formaldehyde (12.3 M). IX Formaldehyde Load Dye was added to each sample. The samples were heat denatured at 65 °C for 5 minutes. The entire volume of each reaction was added to each well. Gel electrophoresis was performed at 120 V for approximately 45 minutes. Once the front dye neared the bottom of the gel, the gel was imaged with the BioRad Gel Documentation System. Using ultraviolet light, a band representing the -127 bp aptamer-ASO conjugate was excised with a fresh razor blade. The RNA was extracted from the gel using the RNA Clean & Concentrator kit from Zymo Research.

[0043] In specific embodiments, the functioning of aptamer conjugated to antisense oligonucleotides targeting mouse housekeeping Gapdh mRNA is tested in both primary mouse cardiomyocytes and cardiac fibroblasts.

[0044] In further specific embodiments, function of the aptamer / ASO conjugates is tested in vivo by injecting mice with the RNA aptamer-ASO conjugates and examining organ and cell type distributions and gene regulation effects.

[0045] In a further embodiment, aptamers identified through cell -internalizing SELEX may be used to identify their cognate receptors via RNA pull-down assays followed by mass spectrometry. In this approach, the aptamer is biotinylated or otherwise tagged, used to pull down its binding partner from cell lysates, and subjected to proteomic analysis. This information may be used to validate targets, understand disease biology, or design improved delivery platforms. Composition

[0046] One aspect of the application is a composition comprising an RNA aptamer covalently linked to, or conjugated to, a therapeutic agent, wherein the RNA aptamer binds specifically to a target that is a cell surface protein. In some embodiments, the compositions of the present application comprise an aptamer and a therapeutic agent covalently or non- covalently linked together to form a targeted therapeutic construct.

[0047] In some embodiments, there is a composition comprising: (a) an RNA aptamer comprising a nucleotide variable region identified via SELEX for specific uptake by cardiomyocytes or cardiac fibroblasts, (b) a therapeutic agent selected from the group consisting of antisense oligonucleotides (ASOs), small interfering RNAs (siRNAs), and small molecule compounds, wherein the RNA aptamer is chemically conjugated to the therapeutic agent via a linker selected from phosphodiester bonds, oligonucleotide linkers, or click chemistry linkers, and wherein the composition mediates cellular uptake of the therapeutic in vitro or in vivo.

[0048] In some embodiments, the aptamer comprises chemical modifications to enhance nuclease resistance, including 2'-Fluoro (2'-F) pyrimidine residues.

[0049] In some embodiments, the therapeutic agent is a MALAT1, Gapdh, or BRD4 antisense oligonucleotide.

[0050] In some embodiments, the small molecule therapeutic is selected from JQ1, halofuginone, or salinomycin.

[0051] In some embodiments, the conjugate comprises a linker of six thymidine residues (6T DNA spacer) between the aptamer and the therapeutic moiety.

[0052] In some embodiments, the RNA aptamer is further extended or miniaturized to optimize pharmacokinetics and biodistribution.

[0053] An aspect of the application is an oligonucleotide molecule comprising: (a) a cardiomyocyte-penetrating RNA aptamer having the sequence: SEQ ID NO: 1 or SEQ ID NO:2, (b) a gapmer antisense oligonucleotide targeting the MALAT1 long non-coding RNA, wherein the antisense sequence comprises SEQ ID NO:5, and (c) a covalent linkage between the aptamer and ASO formed by T4 RNA ligase or click chemistry, wherein the oligonucleotide reduces MALAT1 expression in cardiomyocytes upon internalization.

[0054] In some embodiments, the aptamer and ASO are conjugated using a T4 RNA ligase in a reaction comprising PEG, ATP, T4 RNA ligase buffer, and RNase inhibitor.

[0055] In some embodiments, the aptamer and ASO are conjugated by copper-free click chemistry between azide- and alkyne-functionalized termini.

[0056] In some embodiments, expression of MALAT1 is decreased by at least 40% in cardiomyocytes within 24 hours after treatment.

[0057] In some embodiments, the therapeutic agent is an RNA therapeutic or a small molecule therapeutic agent. In some embodiments, the therapeutic agent is an RNA therapeutic. In some embodiments, the RNA therapeutic is an anti-sense oligonucleotide (ASO). In some embodiments, the RNA therapeutic is covalently attached to the RNAaptamer through a 5'-3 ' phosphodiester linkage. In some embodiments, the siRNA is covalently attached to the delivery aptamer through an oligonucleotide linker having a length of ten nucleotides or less (e.g., CA-rich repeats). In some embodiments, the RNA aptamer specifically targets cardiomyocytes and / or cardiac fibroblasts.

[0058] In some embodiments, the aptamer may be a single-stranded RNA molecule ranging from about 20 to 100 nucleotides in length, having been selected for specific and high-affinity binding to a cellular target using cell-internalizing SELEX. In some embodiments, the aptamer comprises a 40-nucleotide variable region flanked by constant regions suitable for amplification and transcription. Examples include, but are not limited to, those sequences described herein, which may include those sequences that specifically bind to and are internalized by cardiomyocytes.

[0059] In some embodiments, the therapeutic agent may be any molecule that, when internalized into the cell, elicits a biological effect. Examples include, but are not limited to, the following: antisense oligonucleotides (e.g., targeting MALAT1 , gapmer ASOs with locked nucleic acids and phosphorothioate backbones; small interfering RNAs (siRNAs); messenger RNAs (mRNAs); peptides or proteins (e.g., Cas9 nuclease); and small molecule drugs (e.g., anti-fibrotic compounds such as JQ1, salinomycin, halofuginone).

[0060] In some embodiments, the aptamer and therapeutic agent are typically linked via a covalent bond. The conjugation may occur through enzymatic ligation (e.g., T4 RNA ligase using a 6T spacer), chemical crosslinking (e.g., click chemistry between azide and alkyne groups), or oligonucleotide hybridization. The linker may be cleavable under intracellular conditions (e.g., disulfide bonds or acid-labile linkers) to promote drug release.

[0061] In some embodiments, the composition includes additional modifications such as 2'-fluoro pyrimidines, 2'-O-methyl nucleotides, or locked nucleic acids (LNAs) to improve serum stability, binding affinity, and cellular uptake.

[0062] The aptamer-therapeutic conjugates may be formulated into pharmaceutical compositions using pharmaceutically acceptable carriers or excipients. These may include saline, buffered solutions, liposomes, nanoparticles, or hydrogels depending on the desired route of administration.

[0063] In some embodiments, aptamer-drug complexes may be assembled via non- covalent interactions. Examples include biotin-streptavidin systems (where the aptamer and therapeutic cargo are each biotinylated or streptavidin-tagged), hybridization-mediated assembly (e.g., complementary overhangs on DNA / RNA strands), or the use of adapterproteins or nanocarriers. These approaches allow modular assembly of delivery systems and may facilitate high-throughput screening of cargo combinations.

[0064] In some embodiments, aptamers may be linked in tandem to form dualaptamer constructs that target two different cell surface receptors or two distinct epitopes on the same receptor, thereby enhancing binding affinity and specificity. Dual targeting is particularly useful in tissues with heterogeneous cell populations (e.g., tumors or fibrotic tissue) and may reduce off-target uptake. Multi -aptamer constructs can also be used to deliver multiple therapeutic agents in parallel.

[0065] In some embodiments, aptamer sequences may be truncated or modified to retain their binding and uptake functionality while reducing size, cost, or immunogenicity. This may include identifying minimal binding domains, engineering hairpin loops, or introducing stabilizing mutations. Such modifications can also improve tissue penetration or facilitate systemic circulation.

[0066] In some embodiments, the conjugates described herein may include linkers that are cleaved or activated in response to specific intracellular stimuli, such as low pH (e.g., in endosomes), redox gradients (e.g., glutathione concentration), or enzymatic activity (e.g., protease-cleavable peptides). These stimuli -responsive systems ensure release of the therapeutic only after internalization and trafficking to the correct intracellular compartment. Sequences

[0067] In some embodiments, primary mouse cardiomyocyte (CM)-penetrating RNA aptamers are eighty nucleotide full-length RNA aptamers for ASO conjugation and delivery; the full-length RNA aptamer has adaptor sequences in 5’ or 3’ end for PCR priming and amplification (the adaptor sequences can remain the same while the variable region in between them is changed). In some embodiments, CM-enriched forty variable RNA aptamer sequence is contained between the adaptor sequences. These RNA aptamers were produced by in vitro transcription using T7 RNA polymerase with the incorporation of nuclease- resistant 2'-Fluoro (2'-F) pyrimidines (2'F-CTP, 2'F-UTP). In some embodiments, a Top 1 CM-enriched forty variable RNA aptamer oligonucleotide comprises an aptamer sequence penetrating cardiomyocytes of the following SEQ ID NO: 1 :5 ’ -UGUAGGCCCUGGGGAGACGGUGGGGGUGGCGUGCGGUGGG-3 ’ .

[0068] In some embodiments, the nucleic acid sequence has at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to SEQ ID NO: 1.

[0069] In some embodiments, the aptamer RNA sequence of SEQ ID NO: 1, or sequence comprised within it, is comprise within a full-length RNA aptamer of at least 25, 30, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 45, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190 or 200 nucleotides in length, or within such ranges of length.

[0070] In some embodiments, a top 2 CM-enriched forty variable RNA aptamer oligonucleotide comprises an aptamer sequence penetrating cardiomyocytes of the following SEQ ID NO:2:5 ’ -UCCUAUUUC ACUACUGAUGGUGGUGGUUAUUUC AGCUUGG-3 ’ .

[0071] In some embodiments, the nucleic acid sequence has at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to SEQ ID NO:2.

[0072] In some embodiments, the aptamer RNA sequence of SEQ ID NO: 2, or sequence comprised within it, is comprise within a full-length RNA aptamer of at least 25, 30, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 45, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190 or 200 nucleotides in length, or within such ranges of length.

[0073] In some embodiments, primary mouse cardiac fibroblast (CF)-penetrating RNA aptamers are eighty nucleotide full-length RNA aptamers for ASO conjugation and delivery; the full-length RNA aptamer has adaptor sequences in 5’ or 3’ end for PCR priming and amplification (the adaptor sequences can remain the same while the variable region in between them is changed). In some embodiments, CF-enriched forty variable RNA aptamer sequence is contained between the adaptor sequences. In some embodiments, a Top 1 CF- enriched forty variable RNA aptamer oligonucleotide comprises an aptamer sequence penetrating cardiac fibroblasts of the following SEQ ID NO:3:5 ’ -C ACGAUGUGUCUGGCGAUGGGGUGGGUAGUGGCUGGGUGC-3 ’ .

[0074] In some embodiments, the nucleic acid sequence has at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to SEQ ID. NO:3.

[0075] In some embodiments, the aptamer RNA sequence of SEQ. ID. NO:3, or sequence comprised within it, is comprise within a full-length RNA aptamer of at least 25, 30, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 45, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80, 85, 90,95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190 or 200 nucleotides in length, or within such ranges of length.

[0076] In some embodiments, Top 2 CF-enriched forty variable RNA aptamer oligonucleotide comprises an aptamer sequence penetrating cardiac fibroblasts of the following SEQ ID NO. 4:5 ’ GC AAGGUUAUGC AGUGGGUGUGGGGUGGUUGGAGGGAGUG 3 ’ .

[0077] In some embodiments, the nucleic acid sequence has at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to SEQ ID NO:4.

[0078] In some embodiments, the aptamer RNA sequence of SEQ ID NO:3, or sequence comprised within it, is comprise within a full-length RNA aptamer of at least 25, 30, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 45, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190 or 200 nucleotides in length, or within such ranges of length.

[0079] In some embodiments, the oligonucleotide comprises an ASO sequence (targeting MALAT1; RNase Hl-dependent 5-10-5 gapmer PS / MOE ASOs are linked with phosphorothioate backbones, with 10 deoxynucleotides in the center and the RNA nucleotides at both ends modified with 2’-O-methyl and phosphorothioate (PS) linkage (underlined) of the following SEQ ID NO:5 (Mouse Malatl Gapmer ASO): 5’- GCATTCTAATAGCAGC -3’.

[0080] In some embodiments, the oligonucleotide comprises an ASO sequence (control sequence) of the following SEQ ID NO: 6 (Control Gapmer ASO):5 ’ -ACAATGTAACAGCGGU-3 ’ .

[0081] In some embodiments, the oligonucleotide composition comprises an RNA aptamer with a forty -nucleotide region identified through SELEX, and a therapeutic agent (e.g., ASO) covalently conjugated to the aptamer via ligation or chemical linkage. In specific embodiments, the composition includes optional linkers or spacers in the sequences to optimize binding and release of the oligonucleotides.

[0082] In some embodiments, the preferred full-length RNA aptamer is CM- Apt-01 sequence (RNA aptamer produced by in vitro transcription using T7 RNA polymerase with the incorporation of nuclease-resistant 2'-Fluoro (2'-F) pyrimidines (2'F-CTP, 2'F-UTP)) as follows SEQ ID NO:7 (underline is the variable RNA aptamer sequence):5 ’ -GGGAGGACGAUGCGGUGUAGGCCCUGGGGAGACGGUGGGGGUGGCGUGCGGUGGGCAGACGACUCGCUGAGGAUCCGAGA-3’

[0083] Variants of CM- Apt-01 may retain binding specificity and functional activity despite modifications in sequence length or composition. In one embodiment, CM- Apt-01 may be shortened or lengthened by up to 10 nucleotides at either the 5’ or 3’ end, provided that the core binding region remains intact. In another embodiment, truncated variants comprising between 60 and 84 nucleotides are contemplated, particularly those encompassing the central stem-loop or pseudoknot structures critical to binding affinity.

[0084] In yet another embodiment, CM- Apt-01 may include sequence variants exhibiting at least 70%, 80%, 85%, 90%, 95%, 98%, or 99% sequence identity to the full- length reference sequence. Such variants may arise through conservative or semiconservative substitutions, deletions, or insertions that do not significantly impair target binding. Mutational analysis and high-throughput screening may be used to identify such functional homologs. The invention further encompasses aptamers with modified or chemically stabilized backbones (e.g., 2’-O-methyl, 2’-fluoro, locked nucleic acids) derived from CM-Apt-01, provided they exhibit comparable structural folding and binding properties.

[0085] In some embodiments, the preferred full-length RNA aptamer is CM-Apt-02 sequence (RNA aptamer produced by in vitro transcription using T7 RNA polymerase with the incorporation of nuclease-resistant 2'-Fluoro (2'-F) pyrimidines (2'F-CTP, 2'F-UTP)) as follows SEQ ID NO:8:5'-GGGAGGACGAUGCGGUCCUAUUUCACUACUGAUGGUGGUGGUUAUUUCAGCUUGGCAGACGACUCGCUGAGGAUCCGAGA-3’

[0086] The sequence designated CM-Apt-02 (SEQ ID NO:8) is a synthetic RNA aptamer composed of 84 nucleotides with a distinct sequence from CM-Apt-01, optimized for binding to a separate or related molecular target. Functional analogs of CM-Apt-02 may include sequences between 60 and 90 nucleotides in length, optionally with added flanking sequences for enhanced stability or conjugation. The invention includes aptamer variants wherein up to 10 contiguous nucleotides may be deleted, replaced, or inserted without eliminating function, as demonstrated by comparable binding affinity in vitro or in vivo.

[0087] Additionally, CM-Apt-02 variants having at least 70%, 80%, 85%, 90%, 95%, or 99% sequence identity to the reference aptamer are within the scope of the invention. Such homologs may differ in non-conserved loop regions while preserving the secondary and tertiary structure required for target recognition. Modified nucleotides such as phosphorothioates, 2’ -modified riboses, or locked nucleic acid analogs may be incorporated to enhance nuclease resistance or pharmacokinetics, provided that the aptamer retains bindingcapability comparable to that of CM-Apt-02. Computational modeling and in vitro evolution techniques (e.g., SELEX) may be employed to generate and validate such variants.

[0088] In some embodiments, the preferred full-length RNA aptamer is Top 1 full- length CF aptamer as follows SEQ ID NO.: 14:5 ’ -GGGAGGACGAUGCGGCACGAUGUGUCUGGCGAUGGGGUGGGUAGUGGCUGGGUGCCAGACGACUCGCUGAGGAUCCGAGA-3’

[0089] In some embodiments, the preferred full-length RNA aptamer is Top 2 full- length CF aptamer as follows SEQ ID NO: 15:5 ’ -GGGAGGACGAUGCGGGCAAGGUUAUGCAGUGGGUGUGGGGUGGUU GGAGGGAGUGCAGACGACUCGCUGAGGAUCCGAGA-3’

[0090] In some embodiments, RNase Hl -dependent 5-10-5 gapmer PS / MOE ASOs are linked with phosphorothioate backbones, with 10 deoxynucleotides in the center and the RNA nucleotides at both ends modified with 2’-O-methyl and phosphorothioate (PS) linkage. The 2’-O-methyl modified nucleotides with PS linkage are underlined. In some embodiments, the preferred ASO comprises sequences targeting Gapdh gapmer as follows SEQ ID NO:9:5'-Mouse Gapdh Gapmer ASO5’ - +A*+A*+A*+G*+T*T*G*T*C*A*T*G*G*A*T*+G*+A*+C*+C*+T -3’* = Phosphorothioate bonds+ = Affinity Plus (locked nucleic acid base)

[0091] In addition, a control gapmer sequence as follows SEQ ID NO: 10:Control Gapmer ASO5’- +T*+A*+G*+T*+G*C*G*G*A*C*C*T*A*C*C*+C*+A*+C*+G*+A -3’* = Phosphorothioate bonds+ = Affinity Plus (locked nucleic acid base)Modifications

[0092] The ribonucleic acid compounds described herein may contain chemical modifications, e.g. as defined herein, to enhance their functional characteristics, such as nuclease resistance or binding affinity. The modifications may be present in a ribonucleic acid compound, a RNA sequence and / or in a nucleotide-based compound moiety or compound, e.g. a saRNA, siRNA, miRNA, mRNA.

[0093] In some embodiments, modifications may be made to the base, sugar ring, or phosphate group of one or more nucleotides.

[0094] In some embodiments, the ribonucleic acid compounds described herein comprise one or more modified nucleobases. In some cases, the nucleobases are modified at the 2' position, the 3' position, the 5' position or the 6' position. For example, the ribonucleic acid compounds may comprise one or more rib o / deoxy ribo nucleobases modified at the 2' position with a fluoro (F), amino (NH.sub.2) or O-methyl (OMe) group. In some cases, the ribonucleic acid compounds may comprise one or more 2'-aminopyrimidines, 2'- fluoropyrimidines, 2'-O-methyl nucleotides and / or ‘locked’ nucleotides (LNA) (see e.g. Lin, Y et al., Nucleic Acids Res. 1994 22, 5229-5234 (1994); Ruckman, J. et al.. J. Biol. Chem. 1998 273, 20556-20567; Burmeister, P E et al., Chem. Biol. 2005 12, 25-33; Kuwahara, M. & Obika, S. Artif. DNA PNA XNA 2013 4, 39-48; Veedu, R. N. & Wengel, J. Mol. Biosyst. 2009 5,787-792). In some cases, the ribonucleic acid compounds comprise one or more L-form nucleic acids (see e.g. Maasch, C et al., Nucleic Acids Symp. Ser. (Oxf.) 2008 52, 61-62). Other suitable nucleic acid modifications will be apparent to those skilled in the art (see, e.g. Ni S et al., Int. J. Mol. Sci 2017 18, 1683, hereby incorporated by reference in its entirety). A modified version of SEQ ID NO: 1 is SEQ ID NO:40. An unmodified amino acid may be denoted by a preceding “r”, for example “C(F)G(OMe)rA” indicates a 2'fluorpyrimidine modified C residue, a 2'-O-methyl modified G residue, and an unmodified A residue.

[0095] In some embodiments, the ribonucleic acid compounds comprise one or more rib o / deoxy ribo nucleobases with a phosphorothioate (PS) backbone modification. This may be denoted in a sequence as described herein with an asterisk (“*”) between two residues (e.g. AG*CU, indicating a PS modification between G and C). A PS modification may be combined with further modifications, for example a 2' substitution.

[0197] In some embodiments, a ribonucleic acid compound as described herein may comprise one or more 2' modification relative to the sequence provided herein, the modification selected from 2'(F) and 2'(OMe). In some embodiments, a ribonucleic acid compound as described herein may comprise at least two, three, four, five, six, seven, eight, nine, ten or more 2' modifications relative to an unmodified sequence provided herein, the modifications independently selected from 2'(F) and 2'(OMe). In some embodiments, a ribonucleic acid compound as described herein may comprise at least one, two, three, four, five, six, seven, eight, nine, ten or more 2'(F) modifications and / or at least one, two, three, four, five, six, seven, eight, nine, ten or more 2'(OMe) modifications relative to an unmodified sequence provided herein. In other embodiments, a ribonucleic acid compound as described herein may comprise at least one, two, three, four, five, six, seven, eight, nine, tenor more fewer 2'(F) modifications and / or at least one, two, three, four, five, six, seven, eight, nine, ten or more fewer 2'(0Me) modifications than a modified sequence provided herein.

[0096] In some embodiments, a sense and / or antisense strand of a nucleotide compound moiety, e.g., mRNA, miRNA, siRNA or saRNA, may comprise a nucleotide overhang. For example, said overhang may be a 2-nucleotide (UU) overhang. Said overhang may be on the 3' end of one or both strands. An overhang may favour Dicer recognition of the nucleotide compound moiety.

[0097] In some embodiments, the ribonucleic acid compounds described herein comprise an inverted thymidine cap on the 3' end, or comprise 3 '-biotin. In some cases, the phosphodiester linkage in the ribonucleic acid compounds in replaced with methylphosphonate or phosphorothioate analogue, or triazole linkages (see Ni S et al., supra).

[0098] In some embodiments, the ribonucleic acid compounds described herein comprise one or more copies of the C3 spacer phosphoramite. Spacers may be incorporated internally, e.g. between an RNA sequence and a siRNA, or at the 5' or 3' end of the nucleotide sequence to attach e.g. imaging moieties. In some cases, the ribonucleic acid compounds described herein comprise modifications to increase half-life and / or resist renal clearance. For example, the compounds may be modified to include cholesterol, dialkyl lipids, proteins, liposomes, organic or inorganic nanomaterials, nanoparticles, inert antibodies or polyethylene glycol (PEG) e.g. 20 kDa PEG, 40 kDa PEG. Such modifications may be at the 5 '-end of the compounds. In some cases, the modification comprises a molecule with a mass above the cut-off threshold for the renal glomerulus (~30-50 kDa). In some cases, the nucleic compounds may be formulated with pluronic gel. For examples of suitable modifications and formulations see e.g. Ni et al, supra, and Zhou and Rossi, Nat Rev Drug Disc 2017, 16 181-202; both hereby incorporated by reference in their entirety.

[0099] In some embodiments, the ribonucleic acid compounds described herein may comprise a tag, such as an albumin tag. An albumin tag may be attached to the ribonucleic acid compound at the RNA sequence or at a moiety. A tag, such as an albumin tag, may be attached via a linker sequence, for example a poly-uridine (poly-U) linker. A poly-U linker may be about 20, about 19, about 18, about 17, about 16, about 15, about 14, about 13, about 12, about 11, about 10, about 9, about 8, about 7, about 6 or about 5 residues in length. A poly-U linker may be between 1 and 20, between 5 and 15, or between 8 and 12 residues in length. Other tags may include: poly(His) tag, chitin binding protein (CBP), maltose binding protein (MBP), Strep-tag and glutathione-S-transferase (GST). The compounds may comprise an nucleic acid affinity tag, as described in, for example, Srisawat C and Engelke DR, Methods. 2002 26(2): 156-161 and Walker et al., Methods Mol Biol. 2008; 488: 23-40, hereby incorporated by reference in their entirety. Other suitable tags will be readily apparent to one skilled in the art.

[0100] In some embodiments, the ribonucleic acid compounds described herein may comprise spacer or linker sequences between the nucleic acid portion and a compound moiety and / or tag. Suitable spacer or linker sequences will be readily apparent to one skilled in the art.Pharmaceutical composition

[0101] Another aspect of the present application relates to a pharmaceutical composition. The pharmaceutical composition comprises the oligonucleotide of the present application and a pharmaceutically acceptable carrier.

[0102] The term “pharmaceutical composition” is intended to include the combination of an active agent, such as the oligonucleotide of the present application, with a pharmaceutically acceptable carrier in a sterile composition suitable for diagnostic or therapeutic use in vitro, in vivo or ex vivo. In one aspect, the pharmaceutical composition is substantially free of endotoxins or is non-toxic to recipients at the dosage or concentration employed.

[0103] The pharmaceutical composition of the present application can be formulated in any pharmaceutically acceptable carrier(s) or excipient(s). As used herein, the term “pharmaceutically acceptable carrier” includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible. Exemplary pharmaceutically acceptable carriers include one or more of water, saline, phosphate buffered saline, dextrose, glycerol, ethanol and the like, as well as combinations thereof. In many cases it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the composition. Pharmaceutically acceptable carriers can further comprise minor amounts of auxiliary substances such as wetting or emulsifying agents, preservatives or buffers, which enhance the shelf life or effectiveness of the therapeutic agents.

[0104] The pharmaceutical composition of the present application can be lyophilized and stored as sterile powders, preferably under vacuum, and then reconstituted in bacteriostatic water (containing, for example, benzyl alcohol preservative) or in sterile water prior to injection.Methods of Treatment

[0105] An aspect of the application relates to a method of treating a disease or condition in a subject, comprising the steps of administering to the subject, an effective amount of an oligonucleotide as described herein. In some embodiments, the disease or condition is cardiac fibrosis or cardiac hypertrophy.

[0106] In some embodiments, the application discloses methods of treating cardiac diseases (e.g., hypertrophy, fibrosis) by administering an effective amount of the compositions herein to a subject. Administration may be via intravenous, intraperitoneal, or subcutaneous injection.

[0107] In some embodiments, the method comprises the steps of: identifying a target cell population (e.g., cardiomyocytes or cardiac fibroblasts) that is implicated in the disease; selecting or generating an aptamer that specifically binds to a surface molecule expressed on the target cell; conjugating the aptamer to a therapeutic agent using a covalent or non- covalent method as described herein; administering the aptamer-therapeutic conjugate to the subject via systemic or localized delivery; and allowing time for the conjugate to bind, internalize into the target cells via endocytosis, and release the therapeutic cargo intracellularly.

[0108] In some embodiments, the RNA aptamers are folded using magnesium-rich buffer, incubated with cardiomyocytes or cardiac fibroblasts, and shown to internalize via confocal microscopy and RT-qPCR. In a specific embodiment, knockdown oiMALATl confirms functional intracellular delivery.

[0109] In an alternative embodiment, the aptamers described herein can be customized through SELEX or related methods to selectively bind other cell types beyond cardiomyocytes and cardiac fibroblasts. These may include endothelial cells, immune cells (e.g., macrophages, dendritic cells), epithelial cells, hepatocytes, or various tumor cell types. By modifying the selection pressure during SELEX (e.g., using a specific target cell type or tumor biopsy sample), aptamers can be evolved for selective uptake into these alternative cell types. Once identified, such aptamers can be conjugated to therapeutic agents as disclosed herein, enabling cell-specific intracellular delivery of drugs for treating a range of conditions, including cancer, inflammatory diseases, and metabolic disorders.

[0110] In addition to antisense oligonucleotides (ASOs), in other embodiments, the aptamers may be conjugated to other RNA-based therapeutics, such as small interfering RNAs (siRNAs), microRNAs, and messenger RNAs (mRNAs), to achieve gene silencing or protein expression in target cells. The aptamers may also be coupled to CRISPR / Cascomponents (e.g., guide RNAs, Cas mRNA or protein) for genome editing applications. Furthermore, aptamers may deliver small molecule drugs, peptide therapeutics, or immunomodulatory compounds. Chemical conjugation can be achieved through linkers or cleavable bonds responsive to intracellular conditions (e.g., redox or pH-sensitive linkers).[OHl] In an alternative embodiment, aptamer-therapeutic conjugates can be used to deliver immune modulators (e.g., siRNA targeting pro-inflammatory cytokines or signaling molecules) to immune cells such as macrophages or dendritic cells. In cardiac injury, this could reduce maladaptive inflammation and improve tissue remodeling. Aptamers could be screened for uptake into activated immune cell subtypes or used to deliver checkpoint inhibitors in cancer.

[0112] Dosing regimens may vary depending on the target cell type, route of administration, half-life of the conjugate, and nature of the disease. For example, administration may be once daily, once weekly, or continuously via pump infusion. Dosages may range from picomolar to micromolar concentrations, with in vitro studies showing effective knockdown of MALAT1 at 10 nM.

[0113] In vivo studies may involve animal models of heart disease, where the aptamer-therapeutic conjugate is administered intravenously, intraperitoneally, or subcutaneously, and therapeutic effects assessed by histology, gene expression, or physiological measurements (e.g., echocardiography).

[0114] The method is suitable for both acute and chronic treatment regimens and may be adapted to treat other diseases involving specific cell populations by selecting an appropriate aptamer and therapeutic agent.

[0115] The following examples serve to illustrate certain embodiments of the invention and are not limiting.EXAMPLESExample 1: Materials and Methods Aptamer library generation

[0116] A single-stranded DNA pool (IDT), featuring the sequence 5'- GGGGGAATTCTAATACGACTCACTATAGGGAGGACGATGCGG(N40)CAGACGAC TCGCTGAGGATCCGAGA-3' (SEQ ID NO: 16), where N40 denotes 40 random nucleotides, underwent PCR amplification. For this, the study employed both a forward primer with the sequence 5'- GGGGGAATTCTAATACGACTCACTATAGGGAGGACGATGCGG-3' (SEQ ID NO: 17) and a reverse primer with the sequence 5'-TCTCGGATCCTCAGCGAGTCGTC-3' (SEQ IDNO: 18) The study incorporated a T7 promoter sequence (underscored) into the 5' end of the primers utilized. The study used Sybr Green dye in the initial reaction to keep track of the amplification during each cycle. The Ct value came out to be around 12 cycles. To amplify the library, the study carried out 12 cycles of amplification with the specified primers, adhering to the cycling conditions of 30 seconds at 95°C, 30 seconds at 61°C, and 30 seconds at 72 °C. Agarose electrophoresis and a Bioanalyzer (Agilent) verified that the expected PCR product size was 107 bp prior to sequencing. The PCR outcome was subsequently purified using a Qiagen kit and subjected to in vitro transcription using a T7 Polymerase (BIOSEARCH TECHNOLOGIES). The study also incorporated 2'-Fluoro (2'-F) pyrimidines (2'F-CTP, 2'F-UTP) to yield RNA that was nuclease-resistant and suitable for both cellular and future in vivo applications. In contrast to the manufacturer's advised 3 -hour incubation period, I discovered that a 16-hour incubation at 37 °C resulted in optimal yield, which was then purified following an established protocol. The anticipated size for the aptamer was 80 bp.Aptamer screen

[0117] The isolated RNA pellet is reconstituted in 0.5x TE buffer (Tris-EDTA; comprising 5 mM Tris-Cl at pH 8.0 and 0.5 mM EDTA at pH 8.0) to protect the RNA from potential salt-related degradation during a heat treatment at 95 °C, followed by rapid cooling on ice for 60 seconds. The RNA is then refolded using a magnesium-rich buffer (refer to RNA SHAPE in Chapter 3). In brief, 100 pl of RNA is blended with 50 pl of a 3.3x folding buffer (containing 333 mM HEPES at pH 8.0, 20 mM MgC12, and 333 mM NaCl) and left to incubate at 37 °C for a duration of 20 min. Concurrently, newly isolated cardiomyocytes (CM) are treated with 0.1 mg / mL of yeast tRNA in their culture medium. After the RNA folding is complete, the culture medium is swapped for a new batch that contains the aptamer library at a concentration of 100 pM along with 0.1 mg / mL yeast tRNA. This mixture is then left to incubate for an additional 30 min.

[0118] Subsequent to the incubation period, the medium is removed and the cells are rinsed twice using PBS (phosphate buffered saline). Cells are then resuspended using 10 mL of 0.5 M NaCl, followed by a quick centrifugation at 100 x g for 1 min (note: CM are dense and pellet readily). Another round of washing with PBS occurs before another centrifugation at the same speed. The final cell pellet is stored at -80 °C until further use. RNA extraction is performed as previously detailed in Chapter 3. For reverse transcription, a high-fidelity enzyme (Superscript III from Thermofisher), effective on GC-rich sequences, is used to minimize experimental discrepancies. Around 100 ng of the extracted RNA is annealed to areverse PCR primer at a concentration of 0.5 pM, and subsequently subjected to incubation with 5 units of Superscript III at a temperature of 52 °C for one hour. Another round of aptamer screen can be performed carried out by performing the original PCR primers and conditions are replicated.Next generation sequencing

[0119] Sequencing library was constructed by NEBNext Ultra II FS DNA Library Prep according to manufacturer’s manual. Libraries were sequenced by NovaSeq SP-100 (650M reads; SERlOObp) with. > 60M reads per library.Data analysis

[0120] Reads were demultiplexed using bcl2fastq / v2.19.0. A home-made script was used for data analysis. Briefly, the sequencing generated reads from either forward strand (aptamer sequence) or reverse strand (complementary to aptamer sequence). These reads were separated by the presence of 5’ or 3’ adapters. Quality filtering and adapter removal were performed using cutadapt / bl20 with the following setting: — max-n 0 —times 1 -e 0.1 -O 1 -quality-cutoff 5 —length 40 — trimmed-only. Only the 40 nucleotide-long aptamer sequence were preserved. After trimming, reverse reads were converted into reverse complementary sequence to match the forward reads. FASTAptamer / vl.0.321 was used to identify unique sequences, count the number of reads mapped to each sequence, and rank the sequences by counts. Tables containing the counts of the top 10000 sequences for each library were generated and subsequently merged together in an R / 4.2.2 environment (www.R-project.org).Conjugation of RNA aptamers to ASOs

[0121] For the conjugation of RNA aptamers to ASOs, a T4 RNA ligase reaction was prepared as follows: 25% PEG; 0.5 uL RNase inhibitor (40 U / uL); 1 mM ATP; lx T4 RNA Buffer; 100 pmol aptamer; 100 pmol ASO; 1 uL T4 RNA ligase; and water to 20 uL. A 6x T stretches DNA sequence was added to the 3' end of the ASO sequence as a linker and spacer upstream of the RNA aptamer. As a negative control, a reaction without RNA aptamer and ASO was prepared. The reactions were incubated at 16 °C overnight. An RNA agarose gel was prepared by adding 1 g agarose to 72 mL ultrapure (double-distilled) water, heating until dissolved, cooling to 60 °C, adding 10 mL 10X MOPS running buffer (0.4 M MOPS, pH 7.0, 0.1 M sodium acetate, 0.01 M EDTA), and 18 mL 37% formaldehyde (12.3 M). IX Formaldehyde Load Dye was added to each sample. The samples were heat denatured at 65 °C for 5 min. The entire volume of each reaction was added to each well. Gel electrophoresis was performed at 120 V for approximately 45 min. Once the front dye neared the bottom ofthe gel, the gel was imaged with the BioRad Gel Documentation System. Using ultraviolet light, a band representing the -127 bp aptamer-ASO conjugate was excised with a fresh razor blade. The RNA was extracted from the gel using the RNA Clean & Concentrator kit from Zymo Research. Alternative RNA purification method: TBE-urea PAGE was used with run the NEB Low Range ssRNA Ladder (N0324S) to compare the RNA sizes. SYBR Safe (or SYBR gold) was mixed in running buffer at the recommended concentration and incubated the gel for 30 min at room temperature to stain the gel.

[0122] As a future alternative fusion strategy, RNA aptamer can be extended with a 6x T stretches DNA sequence followed by ligation of a downstream ASO. The study assume that both ASO-aptamer and aptamer-ASO can be functional. An alternative conjugation method: The synthetic ASO from IDT contains this chemical group: ASO-azide (on the 3' or 5' end). The RNA aptamer can be modified to have a terminal nucleotide alkyne (on the 3' or 5' end) using T4 RNA ligase or polyA polymerase: ASO-azide + alkyne-RNA aptamer or RNA aptamer-alkyne + azide-ASO can be conjugated using click chemistry following standard protocols.Adult primary mouse cardiomyocyte and cardiac fibroblast isolation

[0123] Adult primary mouse cardiomyocytes (CMs) were isolated from 2-4 months old male or female mice using a Langendorff perfusion system. Mice were fully anesthetized via intraperitoneal injection of ketamine / xylazine. Once losing pedal reflex, the mouse was secured in a supine position. The heart was excised and fastened onto the CM perfusion apparatus and perfusion was initiated in the Langendorff mode. The Langendorff perfusion and digestion consisted of three steps at 37°C: 4 min with perfusion buffer (0.6 mM KH2PO4, 0.6 mM Na2HPO4, 10 mM HEPES, 14.7 mM KC1, 1.2 mM MgSO4, 120.3 mM NaCl, 4.6 mM NaHCO3, 30 mM taurine, 5.5 mM glucose, and 10 mM 2,3- butanedione monoxime), then switched to digestion buffer (300 U / ml collagenase II [Worthington] in perfusion buffer) for 3 min, and finally perfused with digestion buffer supplemented with 40 pM CaC12 for 8 min. After perfusion, the ventricle was placed in sterile 35 mm dish with 2.5 ml digestion buffer and shredded into several pieces with forceps. 5 ml stopping buffer (10% FBS, 12.5 pM CaC12 in perfusion buffer) was added and pipetted several times until tissues disperse readily, and solution turned cloudy. The cell solution was passed through 100 pm strainer. CMs were settled by incubating the cell suspension at 37°C for 30 min. The CMs were resuspended in 10 ml stopping buffer and subjected to several steps of calcium ramping: 100 pM CaC12, 2 min; 500 pM CaC12, 4 min; 1.4 mM CaC12, 7 min. Then the CMs were seeded onto a glass bottom dish (Nest Biotechnology) pre-coated with laminin. Plates werecentrifuged for 5 min at 1,000 g at 4°C to increase the adherence, cultured at 37°C for ~1 hour, and then switched to adult CM culture medium (MEM [Corning] with 0.2% BSA, 10 mM HEPES, 4 mM NaHCO3, mM creatine monohydrate, 1% penicillin / streptomycin, 0.5% insulin-selenium -transferrin, and 10 mM blebbistatin for cell culture and downstream assays.

[0124] Adult primary mouse cardiac fibroblasts (CFs) were isolated from 2-4 months old male or female mice. The heart tissue from post-weaned mice up to week 6 was finely minced and washed with lx PBS on ice. The minced heart tissue was then enzymatically dissociated in a digestion buffer (3-5 ml) containing 2% FBS, 20 mM 2,3 -Butanedione monoxime (Sigma, Cat #B0753), 3 mg / ml collagenase type 2 (Worthington, Cat #LS004177) and lx PBS. The mixture was gently agitated at 37oC in an incubator (Fisher Biotech) for no more than 60 min to completely dissociate the heart. Next, it was neutralized with 1 volume of DMEM (Coming, Cat #10-013-CV) complete medium containing 10% FBS and 1% Penicillin-Streptomycin before passing through a 70 mm cell strainer. The resulting nonmyocyte cell fraction was centrifuged at 600 g for 5 min at room temperature and resuspended in DMEM before adhering for 2 hours. After three gentle washes with lx PBS to remove any cell debris or non-adherent cells, the attached PMCFs were cultured for 2 days before any further experiments were conducted.RNA purification and RT-qPCR

[0125] Media was aspirated from adherent cells and washed twice with chilled PBS. The cells were lysed by adding 1000 pl of Trizol directly to the cells, which were mixed with 200 pl of chloroform and incubated for 5 min on ice. The mixture was centrifuged at 16,000 g for 10 min. RNA was precipitated from the aqueous layer by adding two volumes of isopropanol and centrifuged at 16,000 g for 10 min. The pellet was washed twice with 70% ethanol, left to dry, and resuspended in nuclease-free water. To quantify mRNA levels, cDNAs were prepared using i Script master mix RT Kit and qPCR-amplified using SYBR Primer Assay kits. Notably, when a primer set was first used, the identity of the resulting PCR product was confirmed by cloning and sequencing. The quantitative nature of each primer was also assessed by performing a standard curve of varying cDNA amounts. Once confirmed, melting curves were used in each subsequent PCR to verify that each primer set reproducibly and specifically generates the same PCR product.Immunofluorescence and confocal microscopy

[0126] Immunostaining of cells grown on coverglass or chambered slides: Cardiomyocyte cells were grown on the coverslips for 24 hours at 37°C before being fixed for 10 min with 4% paraformaldehyde in PBS. Cells were washed with PBS for 3x 5 min andpermeabilized using ice-cold 0.5% Triton X-100 in PBS for 5 min. After blocking with 1% BSA in PBS, the coverslips were incubated with indicated primary antibodies (anti-a- actinin: 1 : 1000; anti-NKX2-5: 1 :500; anti-b-actin: 1 :2000) in the blocking solution (2% BSA in PBS) for 1 hour at RT and then washed with PBS for 3x 5 min. The coverslips were incubated with the Alex Fluor-488 conjugated secondary antibodies (1 : 1000) in PBS and washed with PBS for 3x 5 min. Coverslips were air-dried and placed on slides with an antifade mounting medium (containing DAPI). The slides were imaged using an Olympus F VI 000 confocal microscope.Statistics

[0127] All quantitative data were presented as mean ± SD and analyzed using GraphPad Prism 8.3.0 software (GraphPad). For a comparison between two groups, an unpaired two-tailed Student t-test for normally distributed data was performed. For a comparison between more than two groups, ANOVA followed by the Holm-Sidak post hoc test was used to determine the statistical significance among groups. Two-sided P values < 0.05 were considered to indicate statistical significance. Specific statistical methods and post hoc tests were described in the figure legends.Identification of RNA Aptamers

[0128] Within the top-enriched cardiac fibroblast RNA aptamers, representative consensus sequences are present in all the significantly enriched sequences (Table 1). The top enriched sequences were uploaded to a MEME suite to discover consensus motifs. Consensus motifs from the top enriched aptamers may indicate sequence features that are important for binding to the respective cell type. One motif was discovered for the top 20 sequences of the cardiac fibroblast SELEX screen.Table 1 : Consensus sequences* of significantly enriched RNA Aptamers*In these RNA aptamer sequences, the non-standard letters represent degenerate nucleotide codes used to indicate ambiguity or variability at specific positions. These codes follow the IUPAC nucleotide code, which is commonly used in sequencing data when a position may represent more than one possible base. These consensus sequences are derived from enrichedpools of aptamers (from SELEX experiments) and represent motifs or families of related sequences. Each degenerate code signifies positions of variability observed across multiple aptamer sequences that showed significant binding affinity, hence highlighting regions under selection and regions of conservation.IUPAC CodesCode Represents Possible NucleotidesA Adenine AC Cytosine CG Guanine GT Thymine (or U for RNA) T (or U)R puRine A or GY pYrimidine C or TS Strong G or CW Weak A or TK Keto G or TM aMino A or CB not A (B comes after A) C or G or TD not C (D comes after C) A or G or TH not G (H comes after G) A or C or TV not T (V comes after T) A or C or GN aNy A or C or G or T

[0129] In an exemplary embodiment, SEQ ID NO: 115 ’ -KBGKGSKKGWGGGRTKGGTKGWGGGWGGK-3 ’. K = G or T• B = C, G, or T. S = G or C. W = A or T• R = A or G• etc.

[0130] This means that each position in the sequence is not a fixed nucleotide but could be one of a defined set, allowing for sequence diversity while maintaining the core aptamer function. One of ordinary skill will understand that all such sequence variants of SEQ ID. NOS. 11, 12 or 13 are encompassed by the present application.

[0131] Primary mouse cardiomyocytes or cardiac fibroblasts were treated with the top 3 enriched aptamers and, following a similar trend to the sequencing data, aptamers 1 and 2 show the highest uptake for cardiomyocytes (FIG. 3 A). Results from the cardiac fibroblast experiment show that the first top aptamer undergoes the highest uptake, and the second aptamer undergoes the second highest uptake, with the third aptamer showing an insignificantuptake (FIG. 3B). The top 2 cardiomyocyte-targeting RNA aptamers deliver Gapmer ASOs to degrade MALAT1 IncRNA in primary mouse cardiomyocytes (FIG. 4). Confocal microscopy reveals the cardiomyocyte-targeting RNA aptamers form puncta within cardiomyocytes (FIG. 5). Together, these data display the identification of cardiomyocyte and cardiac fibroblast-targeting RNA aptamers identified through in vitro SELEX.Example 2: Screening for RNA aptamers that are taken up by cardiomyocytes

[0132] Effective delivery of RNA molecules into cardiomyocytes (CM) remains a challenging endeavor with no established methods available. In this study, the study employed a high-throughput assay known as SELEX (systematic evolution of ligands by exponential enrichment) to identify RNA sequences known as aptamers capable of penetrating CM. Utilizing next-generation sequencing technology, the study were able to closely monitor the evolutionary trajectory of RNA populations and their incremental enrichment throughout the SELEX process. The study identified and validated the top 10 enriched aptamers for their effectiveness in being uptaken into CM through both RT-qPCR and confocal microscopy analyses. Further emphasizing the practical utility of these aptamers, the study fused the two most promising ones with antisense oligonucleotides (ASOs) to achieve a potent knockdown of MALAT1 RNA within CM. This study not only establishes an approach for RNA delivery into cardiomyocytes, but also unveils a versatile strategy that could be adapted for other cardiac cell types.

[0133] This study demonstrates that the established techniques used for targeted RNA delivery can be effectively adapted for use in cardiomyocytes (CM). The study initiated the experiment by screening a library composed of 40-nucleotide random sequences against cardiomyocytes. This allowed the study to identify promising aptamers that were internalized by the cells, while less effective ones remained in the culture medium. To refine the selection, the study continuously repeated this process, utilizing next-generation sequencing to monitor the evolution and performance of individual aptamers. Through this iterative approach, the study successfully identified a cohort of aptamers with high promise for cellular uptake. Furthermore, the study fused two of the top performing aptamers to MALAT1 (metastasis associated lung adenocarcinoma transcript l)-targeting antisense oligonucleotide (ASO), which leads to mRNA degradation. The study observed effective MALAT1 inhibition without requiring any additional transfection reagents.Example 5: Evolution and functional validation of cardiomyocyte-targeting aptamers

[0134] The study designed an assay that adopts the RNA SELEX concept to evolve aptamers that will enter cardiomyocytes. The aptamer contains a T7 promoter to allow invitro transcription. It also contains 5’ and 3’ adaptors that will allow the study to determine the directionality while sequencing; additionally, they will allow the amplification following each SELEX round. The aptamers are generated via in vitro transcription to contain 2’F cytosine and guanosine to protect from degradation in the cell. The RNA is then purified and folded (see RNA SHAPE protocol) to adopt RNA structure. Fresh CM isolated via the Langendorff method are prepared and plated. The folded aptamer is then incubated with the myocytes. The myocytes are washed rigorously (see methods) to remove the non-uptaken aptamers. The library is then reverse transcribed and amplified again to regenerate the dsDNA (double-stranded DNA) library (FIG. 6).

[0135] Rounds 0 (corresponding to the initial library), 2, 4, 6, 7, and 8 were sent for next-generation sequencing and each sequenced at a depth of -100M reads. Reads that contain the 40 nucleotides flanked by the two adaptors were deemed usable reads. The percentage of usable reads was >90% in all samples, suggesting that the assay was not overpopulated with artifacts. In the initial library, the study found it to be virtually random with 0.07% corresponding to the top 1000 unique sequences, while starting at round 6, it increased to 0.77%, to 2.99% in round 7, and 5.29% in round 8 (corresponding to -5.7M reads), suggesting a progressive evolution.

[0136] Table 2. Tracking RNA Sequence Enrichment Across SELEX Rounds. This table presents the number of reads in the libraries generated from individual SELEX rounds, all of which were sequenced collectively to a depth of approximately 650 million reads. The top 1,000 unique sequences display progressive enrichment throughout the rounds, indicating successful selection of aptamers.

[0137] By examining the distribution of aptamers in the various samples, in round 0, the sample showed a high degree of heterogeneity with 61.3M reads corresponding to unique reads, while 23.0 M reads corresponded to reads of 2-9 reads out of a total of 84.3 M reads. On the other hand, at round 8, populations for unique reads dropped to 20.0 M reads (out of 108.3 M reads) and other populations of more enriched reads increased (FIG. 7 A). The study was also able to monitor the progress of individual aptamers. For example, the top enriched aptamer started occupying a substantial percentage of reads relative to others, corresponding to 0.18%, 1.23%, and 2.4% of all reads in rounds 6, 7, and 8 respectively. This is compared to the 1000th aptamer, which occupied 0.00006%, 0.000119%, and 0.00014% for rounds 6, 7, and 8 (FIG. 7B).

[0138] The individual top 10 aptamers were then synthesized and individually tested in this assay and compared to either the round 8 library or the 1000th ranked aptamer. Surprisingly, the aptamers were similar to what the study found in the sequencing. The top 2 aptamers remained the top ones; however, they appeared to produce a similar amount of enrichment, approximately 17-fold the control. While the 3rd to 8th produced approximately 5-13 fold enrichment (FIG. 7C). Given the superiority of the top 2 aptamers, they were used in the next experiments.Example 3: Functional uptake and efficacy of SELEX-enriched aptamers in cardiomyocytes

[0099] The study synthesized the top two aptamers (Aptl and Apt2) and a control, each fluorescently conjugated with Cy3 (Integrated DNA technologies; IDT). After folding, these aptamers were incubated with a fresh batch of CM as previously described. Contrary to the original expectation of seeing a diffuse fluorescence signal, CM displayed distinct, red- colored puncta that appear on the same plane as the nucleus, suggesting their intracellular location. These red puncta were not observed with the control, indicating that they are likely due to the aptamers. However, the reason for their punctate form is unclear. Interestingly, these puncta did not co-localize with alpha-actinin (FIG. 8A). The study followed this with a functional assay, where the antisense oligonucleotide (ASO) was conjugated to a MALAT1- specific ASO (IDT). The study chose MALAT1 because it is ubiquitously expressed in all cells, allowing for future comparisons with non-CM cells and other studies. In the assay, the study tested a control ASO alone or fused to one of the aptamers (Aptl, Apt2, or control). The study found that MALAT1 levels dropped to 74% and 54% for Aptl-MALATl ASO and Apt2-MALAT1 ASO, respectively. It's important to note that the assay was conducted at 10nM, which is considered on the lower end even when using a transfection reagent. The study included a 'spike-in' group, where the control or MALAT1 ASO was added to a reverse transcription (RT) reaction of isolated CM RNA, to rule out any effects unrelated to the biological activity of the ASOs (FIG. 8B).

[0100] This study introduces a novel approach to enhance the delivery of RNA drugs to cardiomyocytes. The study developed an assay that screens RNA aptamers for uptake into cardiomyocytes (FIG. 6) and identified 10 aptamers that were successfully internalized (FIG. 7). Both imaging and functional assays suggested their successful internalization (FIG. 8).

[0101] In further embodiments, the study further investigates the immunofluorescence results presented above (figure 8A). The observed punctate formations in the cardiomyocytes raise questions about their origin. Without being bound by theory, endosomes formed after the internalization of the RNA aptamers. To confirm this, the study co-stains these myocytes with an endosome marker, such as Rab5 or Rab716. The study also measures the concentration of aptamers within these punctate formations compared to the cytosol. For this, the study isolates the endosomal fractions from the cardiomyocytes and compares aptamer enrichment between them.

[0102] In further embodiments, the study examines these effects on different mouse cell types to discern any cell-type specificity. It is important to further investigate whether these findings will remain true from human CM as well. Following this work, the study tests the pharmacokinetics of these aptamers in a mouse model following various administration routes, such as tail vein, subcutaneous, or intraperitoneal injections.

[0103] To fully realize the functional potential of these aptamers, it might be interesting to explore the effects of various RNA modifications modification, potentially miniaturizing these aptamers making them even more efficient and adaptable to specific therapeutic applications. Additionally, understanding how these aptamers interact with cellular stress responses, such as the PKR response to viral dsRNA, will be crucial for ensuring their safety and efficacy in clinical settings.

[0104] Another way this study could prove useful is that this unbiased screen of aptamers can shed light on the most effective ways to target drugs via endocytosis. In further embodiments, the study conjugates the aptamers to biotin, pull down the interacting proteins, and analyze their composition via mass spectrometry. Even if the RNA aptamer approach proves infeasible, identifying a target could offer alternative ways to utilize this pathway for drug delivery.

[0105] In conclusion, this study pioneers a fresh approach to drug delivery into cardiomyocytes, traditionally a challenging cell type for RNA delivery, which often necessitated the use of complex and costly viral delivery methods.Example 4: Identification of primary adult mouse cardiomyocytes and cardiac fibroblasts entering aptamers using cell-internalizing SELEX and RNA aptamer-seq

[0106] ,The study performed primary adult mouse cardiomyocyte-intemalizing SELEX (Systematic Evolution of Ligands by Exponential enrichment), and conducted primary adult mouse cardiac fibroblast SELEX. The libraries from rounds 0, 2, 4, 6, 7, and 8 of the cardiomyocyte screens, as well as rounds 0, 2, 3, 4, 5, 6, 7, and 8 of the cardiac fibroblast screens, were subject to next-generation sequencing at a depth of 650 or 750 million reads, respectively.

[0107] To analyze the data from next-generation sequencing, the study used the AptaScreen program. This program outputs a table that illustrates the evolution of the library throughout the nine rounds of SELEX (FIG. 9A, B). The study found the initial library to be random, containing almost entirely unique reads; 0.07% of reads correspond to the top 1,000 reads in cardiomyocytes from the initial library, while 0.012% correspond to the top 1,000 reads for cardiac fibroblasts. Throughout the rounds, there is an increase in sequences with 1,000 or more duplicate reads, starting in round 6 for cardiomyocytes (FIG. 9A) and in round 3 for CFs (FIG. 9B), indicating successful enrichment during the SELEX rounds. Furthermore, the percentage of the library comprising the top 1000 sequences rises from 0.77% to 2.99% between rounds 6 and 7 for cardiomyocytes; the top 1000 sequences begin to increase steadily from round 5 in CFs, going from 2.85% to 8.90%, suggesting progressive evolution of the library. Additionally, using data from the outputs of the AptaScreen program, the study plotted the enrichment of the top 5 sequences from each screen. The top enriched sequence (Apt-01) demonstrates exponential enrichment, typical during SELEX (FIG. 9C, D). In the cardiomyocyte SELEX, the exponential enrichment of Apt-01 aligns with the emergence of the population of sequences with 100-1000 duplicates in round 6 (FIG. 9 A). For the cardiac fibroblast SELEX, the exponential enrichment of Apt-01 begins in round 6 (FIG. 9B). In summary, this data suggests that the cardiomyocyte and cardiac-fibroblast SELEX successfully enricher sequences that should enter cardiomyocytes or cardiac fibroblasts.Example 5: Validating aptamer entry into primary adult mouse cardiomyocytes or cardiac fibroblasts

[0108] The next step was to confirm that the enriched sequences could enter primary adult mouse cardiomyocytes or cardiac fibroblasts isolated from wild-type mice. To confirm RNA aptamer uptake, the study performed RT-qPCR and fluorescent confocal microscopy. The internalization experiments involved in vitro transcribing the top five aptamer sequences, folding the RNA, incubating with the target cell type (primary mouse cardiomyocytes or cardiac fibroblasts) for four hours, performing three wash steps (1. PBS; 2. 0.5 M NaCl; 3. PBS), and isolating RNA with TriZol. RT-qPCR results aligned with the trends observed in the next-generation sequencing results (FIG. 9C, D), indicating that the top two enriched aptamer sequences were the most internalized (FIG. 10 A, B). In FIG. 10B, the third enriched RNA aptamer shows low internalization, which may result from PCR amplification bias, an intrinsic limitation of the SELEX protocol. Moving forward, the study will not pursue the CF-Apt-03 sequence, underscoring the importance of validation following SELEX screens.

[0109] To complement the RT-qPCR, the study performed fluorescent confocal microscopy to visualize the internalization of the top two enriched RNA aptamer sequences from each screen. Cy3 -conjugated aptamers were ordered from Integrated DNA Technologies (IDT). The study treated primary adult mouse cardiac fibroblasts with 100 nM of the top enriched sequence from SELEX (CF-Apt-01) and the second-most enriched sequence (CF-Apt-02). In cardiac fibroblasts, the study observed a diffuse signal spread throughout the cell (FIG. 10C). The study treated primary adult mouse cardiomyocytes with 10 nM of the top enriched sequence from the cardiomyocyte SELEX (CM-Apt-01) and the second-most enriched sequence (CM-Apt-02). The study noted the formation of puncta within the cardiomyocytes by CM-Apt-01 and CM-Apt-02 (FIG. 10D). The study then assessed whether increasing the concentration of CM-Apt-01 to 100 nM would yield a diffuse signal similar to that of the cardiac fibroblast aptamers.

[0110] Interestingly, upon increasing the concentration of CM-Apt-01, the study observed localization to the nucleus of the cardiomyocytes (FIG. 10E). It is possible that the aptamers are shuttled to the nucleus by endosomes or that the potential CM-Apt-01 - interacting plasma membrane-localized receptor protein can translocate from the cellular surface to the nucleus.Example 6: inhibition of endocytosis results in decreased RNA aptamer uptake[OHl] The study hypothesize that the aptamers bind to a target receptor protein on the cell surface, which is subsequently endocytosed. To assess the mechanism of RNAaptamer uptake, the study inhibited clathrin-mediated endocytosis by treating primary adult mouse cardiac fibroblasts and primary adult mouse cardiomyocytes with 30 pM chlorpromazine. Chlorpromazine prevents the assembly of clathrin-coated pits at the inner surface of the plasma membrane by anchoring the clathrin and adaptor protein 2 complex to endosomes. After chlorpromazine treatment, both primary cardiac fibroblasts and primary cardiomyocytes demonstrated decreased uptake of the Cy3-labeled aptamers (FIG. 11 A, B). In the cardiomyocyte images, the study observed the aptamers accumulating outside the cardiomyocytes, possibly due to the inhibited endocytosis (FIG. 1 IB). These data support the hypothesis that the mechanism of action (MoA) of aptamer uptake is through the binding to a target receptor protein on the plasma membrane surface, followed by endocytosis into the cells.Example 7: conjugation of CM-Apt-01 to a MALATl-targeting ASO leads to decreased MALAT1 expression

[0112] The long non-coding RNA (IncRNA) MALAT1, known as metastasis- associated lung adenocarcinoma transcript 1, is involved in cancer development and progression and is a potential anti-cancer therapeutic target. Using the top enriched aptamers identified through cell internalizing- SELEX in cardiomyocytes (CM-Apt-01 and CM- Apt- 02), the study successfully delivered a MALATl-targeting ASO to cardiomyocytes and observed a significant knockdown in MALAT1 RNA levels (FIG. 12). The study conjugated CM-Apt-01 and CM-Apt-02 to an ASO targeting MALAT1 IncRNA using T4 RNA ligase. MALAT1 is widely expressed in the cardiac cells of mammalian hearts. This data suggests that the RNA aptamers are successfully uptaken by cardiomyocytes and can deliver an ASO that exerts a functional effect and supports the feasibility of using aptamers to deliver RNA therapeutics, such as ASO, siRNA, mRNA, and small chemical compounds for pre-clinical and clinical applications.

[0113] While various embodiments have been described above, it should be understood that such disclosures have been presented by way of example only and are not limiting. Thus, the breadth and scope of the subject compositions and methods should not be limited by any of the above-described exemplary embodiments, but should be defined only in accordance with the following claims and their equivalents.

[0114] The above description is for the purpose of teaching the person of ordinary skill in the art how to practice the present invention, and it is not intended to detail all those obvious modifications and variations of it which will become apparent to the skilled worker upon reading the description. It is intended, however, that all such obvious modifications andvariations be included within the scope of the present invention, which is defined by the following claims. The claims are intended to cover the components and steps in any sequence which is effective to meet the objectives there intended, unless the context specifically indicates the contrary.

Claims

WHAT IS CLAIMED IS:

1. An oligonucleotide comprising an RNA aptamer covalently linked to, or conjugated to, a therapeutic agent, wherein the RNA aptamer binds specifically to a target that is a cell surface protein.

2. The oligonucleotide of Claim 1, wherein the therapeutic agent is an RNA therapeutic or a small molecule therapeutic agent.

3. The oligonucleotide of Claim 1 or 2, wherein the therapeutic agent is an RNA therapeutic.

4. The oligonucleotide of any one of Claims 1-3, wherein the RNA therapeutic is an anti-sense oligonucleotide (ASO).

5. The oligonucleotide of any one of Claims 1-4, wherein the RNA therapeutic is covalently attached to the RNA aptamer through a 5'-3 ' phosphodiester linkage.

6. The oligonucleotide of any one of Claims 1-5, wherein the siRNA is covalently attached to the delivery aptamer through an oligonucleotide linker having a length of ten nucleotides or less (e.g., CA-rich repeats).

7. The oligonucleotide of any one of Claims 1-6, wherein the RNA aptamer specifically targets cardiomyocytes and / or cardiac fibroblasts.

8. The oligonucleotide of any one of Claims 1-7, wherein the oligonucleotide comprises an aptamer sequence of SEQ ID NO: 1.

9. The oligonucleotide of any one of Claims 1-7, wherein the oligonucleotide comprises an aptamer sequence of SEQ ID NO:2.

10. The oligonucleotide of any one of Claims 1-7, wherein the oligonucleotide comprises an aptamer sequence of SEQ ID NO:3.

11. The oligonucleotide of any one of Claims 1-7, wherein the oligonucleotide comprises an aptamer sequence of SEQ ID NO:4.

12. The oligonucleotide of any one of Claims 1-7, wherein the oligonucleotide comprises an ASO sequence of SEQ ID NO:5.

13. The oligonucleotide of any one of Claims 1-7, wherein the oligonucleotide comprises an ASO sequence of SEQ ID NO:9.

14. A method of treating a disease or condition in a subject, comprising the steps of: administering to the subject, an effective amount of an oligonucleotide of any one ofClaims 1-13.

15. The method of Claim 14, wherein the disease or condition is fibrosis or hypertrophy.

16. The method of Claim 14, wherein the disease or condition is cardiac fibrosis or cardiac hypertrophy.

17. A pharmaceutical composition, comprising: the oligonucleotide of any one of Claims 1-13; and a pharmaceutically acceptable carrier.

Images