Compositions comprising chloroplast translation factor and methods of use thereof for increasing photosynthesis, biomass, and yield

By overexpressing EF-G in plants, the sluggish kinetics of RuBisCO are addressed, resulting in increased photosynthetic capacity and plant biomass, effectively addressing the stagnating crop productivity issue.

WO2025250982A1PCT designated stage Publication Date: 2025-12-04BOARD OF REGENTS FOR THE OKLAHOMA AGRI & MECHANICAL COLLEGE ACTING FOR & ON BEHALF OF OKLAHOMA STATE UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/031717
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-05-31
Filing Date
2025-05-30
Publication Date
2025-12-04

AI Technical Summary

Technical Problem

Current crop productivity increases at a stagnating annual rate of <2% per year, which cannot meet the increasing food and feed demand, and enhancing photosynthetic capacity in crop plants is crucial to address this challenge.

Method used

The use of chloroplastic translation elongation factor-G (EF-G) protein or active fragments thereof to increase plant biomass by enhancing photosynthetic CO2 assimilation, plant metabolism, and cellular metabolism through overexpression in plants.

Benefits of technology

EF-G overexpression increases RuBisCO protein levels, CO2 assimilation, starch synthesis, and whole cell metabolism, ultimately leading to enhanced plant biomass and yield.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025031717_04122025_PF_FP_ABST
    Figure US2025031717_04122025_PF_FP_ABST
Patent Text Reader

Abstract

A genetically modified plant comprising at least one modification from the natively occurring plant, wherein the at least one modification results in overexpression of at least one chloroplastic translation elongation factor-G (EF-G) protein or active fragment thereof. Methods of producing and using the genetically modified plants are also disclosed herein. The genetically modified plants exhibit increased plant biomass, increased yield, and / or increased photosynthetic capacity over a native, non-genetically modified plant.
Need to check novelty before this filing date? Find Prior Art

Description

Electronically Transmitted: May 30, 2025 PATENT COMPOSITIONS COMPRISING CHLOROPLAST TRANSLATION FACTOR AND METHODS OF USE THEREOF FOR INCREASING PHOTOSYNTHESIS, BIOMASS, AND YIELD CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] The subject application claims benefit under 35 USC § 119(e) of US Provisional Application No. 63 / 654,203, filed May 31, 2024. The entire contents of the above-referenced patent application(s) are hereby expressly incorporated herein by reference. BACKGROUND

[0002] Increasing global food and feed production to meet the demand for increasing world population and changing global diets is a current challenge. Food demand is predicted to rise by 58% to 98% by 2050. Depletion of fossil fuel reserves worldwide has necessitated the production of alternative energy sources processed from plant biomass. Rather than increasing agricultural land, enhancing food / feed yields is a top strategy to meet this challenge. Current crop productivity increases at a stagnating annual rate of <2% per year, and this stagnated increase cannot meet the increasing food and feed demand. Therefore, finding a solution to this threatening agricultural crisis will be one of our greatest scientific challenges in the coming decades. Rising atmospheric CO2is a major driver of global climate change. To meet this grand challenge of increasing food and feed production and curbing global climate change, it will be essential to increase productivity by increasing photosynthesis capacity in crop plants. In addition to increasing photosynthetic capacity, plant metabolism, cellular / developmental programs, and control of photosynthate allocation are crucial aspects to increase plant biomass and to fix atmospheric carbon.

[0003] Photosynthesis takes place in the chloroplast, which harbors approximately 3,000 proteins of which about 120 are encoded by the chloroplast, and the remaining proteins are nuclear encoded and post-translationally imported into the organelle. The chloroplast-encoded genes make components of photosynthetic machinery that include the large RuBisCO (ribulose- 1,5-bisphosphate carboxylase / oxygenase) subunit, photosystems I and II, cytochromes, ATP synthase and gene expression system that includes bacterial type RNA polymerase subunits, rRNAs, tRNAs and nearly one-third of the ribosomal proteins. Translational machinery in the chloroplast comprises bacterial-like 70S ribosomes. The majority of the plastid translationmachinery components including translation initiation factors IF2 and IF3; elongation factors (EF) EF-Tu, EF-G, and EF-Ts; termination factors; ribosome recycling factors; and tRNA synthetases are encoded by the nucleus except plastid encoded initiation factor IF1. Expression of elongation factors is regulated by environmental stimuli, indicating their involvement in the regulation of translation. RuBisCO catalyzes CO2assimilation by carboxylation of RuBP (ribulose-1,5- bisphosphate). Sluggish kinetics of RuBisCO requires a large amount of enzyme to support adequate photosynthesis.

[0004] As a rate limiting step in CO2fixation, improvement in RuBisCO performance has long been a target for improvements for increasing plant biomass and yield. Efforts to increase RuBisCO by overexpressing its subunit in rice resulted in 30% increase in RuBisCO content with no increase in CO2assimilation due its inactivation (Suzuki et al. (2007) Plant Cell Physiol, 48:626- 637). Another attempt to overexpress RuBisCO small subunit (RbcS) and / or large subunit (RbcL) in maize failed to increase the RuBisCO content (Wostrikoff et al. (2012) Plant physiology, 160:419-432). Overexpression of RuBisCO subunits with RuBisCO assembly factor (RAF1) led to increased RuBisCO content (Salesse-Smith et al. (2018) Nat Plants, 4:802-810). Recently, overexpression of RuBisCO and RuBisCO activase (RCA) in rice was shown to increase plant CO2assimilation and biomass under high temperature conditions (Qu et al. (2021) Plant, Cell & Environment, 44:2308-2320), suggesting that RuBisCO content and activity is a limiting factor for plant growth and biomass production. These studies suggested that only overexpression of RuBisCO is not sufficient to increase RuBisCO levels and its CO2fixation capacity. RuBisCO carboxylates RuBP into 3-carbon compounds which are used to synthesize starch. Many enzymes including starch synthases carry out the subsequent reactions to synthesize the starch. Starch synthesis is also not sufficient to increase plant biomass; rather, it also needs to be remobilized to generate sucrose which is finally transported into the sink organ to support the metabolism and translated into plant biomass.

[0005] To increase plant biomass, one needs to modify many enzymatic steps from CO2assimilation to biomass formation. However, genetic manipulation of many enzymes in the same plant is technically challenging, tedious, and cumbersome. Therefore, there is a need in the art for new and improved compositions, systems, kits, and methods of increasing plant biomass. BRIEF DESCRIPTION OF THE DRAWINGS

[0006] FIG.1 illustrates that EF-G is a positive regulator of plant growth. A. N. benthamiana plants three weeks after inoculation with TRV:GFP as control and TRV:5A09 which silenced theendogenous EF-G (Niben101Scf09387g03016). B. Five-week-old Arabidopsis WT-Col-0, ef-g-1 and ef-g-2, EF-G-OX- lines (2-1, 3-2 and 6-1) grown under short day (8:16 light-dark cycle, light intensity 230 µmol m–2s–1). C. Fresh weight of rosette in five-week-old plants. D. Nine-day old seedlings in1 / 2MS media plates grown vertically under short day (8:16 light-dark cycle, light intensity 100 µmol m–2s–1). E. Measurement of root length in 9-day old plants. Error bars in all graphs represent the standard error from six biological replicates representing six individual plants and experiment was repeated with similar results. Asterisks represent statistically significant difference with Student’s t-test (P-value ≤ 0.05) when compared to control (Col-0).

[0007] FIG. 2 illustrates the involvement of EF-G in regulation of ribosomal proteins, translation of photosynthetic proteins, ATPase and increasing CO2assimilation in chloroplast. A. Abundance of chloroplast encoded proteins in ef-g mutant and EF-G-OX and showing statistically significant difference compared to control (p-value ≤ 0.1) are shown as a fold changes. RuBisCO large subunit, RBCL; Photosystem II reaction center proteins, PSBH and PSBE; photosystem I chloroplast open reading frame YCF3; photosynthetic electron transporter, PETB: ATPase subunits, ATPF, ATPB, ATPE, ATPH, ATPA; ribosomal protein large subunits, RPLs; ribosomal protein small subunits, RPSs. B. Fold changes of the nuclear encoded RuBisCO small subunits (RBCS1A and RBCS1B), RuBisCO activase (RCA), and ATPase subunits (ATPC1, ATPD and ATPF0B) are shown. C. Western gel blot analysis showing RBCL in Col-0, ef-g-1 and EF-G-OX lines. Actin was used as loading control. Intensity of each band with respect to Actin was quantified using Image J software and is given above each band as a percentage to Col-0. D. CO2response curve showing the CO2assimilation rates measured at various CO2concentrations ranging from 0 to 1200 µmol mol⁻¹. ef-g-1 mutant was used in this experiment.

[0008] FIG. 3 illustrates that EF-G regulates cellular metabolism. A. Repertoire of primary metabolites altered in ef-g and EF-G-OX lines compared to Col-0 determined by GC-MS. B. Regulation of enzymes of carbohydrate metabolism (sucrose and starch synthesis, and starch degradation [gray box]) and photorespiration. Pathways were constructed based on plant metabolic network (Schlapfer et al., 2017), MapMan software (Thimm et al., 2004) and (Stitt and Zeeman, 2012). Fold changes of enzymes, which altered significantly (P-value ≤0.1), in ef-g mutant (2ndcolumn) and EF-G-OX (3rdcolumn) compared to Col-0 are shown. 3PGA, 3-P- glycerate; 1,3DPG, 3-phospho-glyceroyl-phosphate; GAP, Glyceraldehyde 3-P; DHAP, Dihydroxy- acetone-P; FBP, Fructose 1,6-bisphosphate; F6p, Fructose 6-phosphate; G6p, Glucose 6- phosphate; Glu, Glutamate; OG, 2-oxoglutarate; PGK, phosphoglycerate kinase; GAPB, Glyceraldehyde-3-phosphate dehydrogenase subunit B; PDTPI, plastidic triose phosphateisomerase; FBA, Fructose-bisphosphate aldolase; F2KP, fructose-2,6-bisphosphatase; cFBP, cytosolic fructose-1,6-bisphosphatase; PGM, phosphoglucomutase; ADG, ADP glucose pyrophosphorylase; SS, Starch synthase; GBSS1, Granulated starch synthase; SBE, Starch branching enzyme; SEX1, Starch excess 1; GWD, Glucan water dikinase; HXK2, Hexokinase 2; PHS2, α-glucan phosphorylase 2; PGLP1, Phosphoglycolate phosphatase; AOAT, Alanine:2- oxoglutarate aminotransferase; GLDP, glycine decarboxylase P-protein; SHMT1, Serine transhydroxymethyl transferase. C. Starch staining in leaves of Col-0, ef-g mutants and EF-G-OX lines.

[0009] FIG. 4 illustrates the regulation of tricarboxylic acid (TCA) cycle, mitochondrial electron transport chain and NAD. Pathway was constructed based on plant metabolic network (Schlapfer et al., 2017) and MapMan (Thimm et al., 2004). Fold changes of enzymes, which altered significantly (P-value ≤0.1), in ef-g mutant (2ndcolumn) and EF-G-OX (3rdcolumn) compared to Col-0 are shown. OAA, oxaloacetate, PDC, pyruvate dehydrogenase complex, CYS, citrate synthase, ACO, aconitase, IDH, isocitrate dehydrogenase, OGDHE, 2-oxoglutarate dehydrogenase E component, SCS-B, succinyl-CoA synthetase beta, SDH, succinate dehydrogenase, FUM, fumarase, mMDH, malate dehydrogenase. Mitochondrial electron transport chain consisting of complexes I-IV and ATPase. Complexes I-IV plays role in transporting electron and generating the proton gradient. B, C and D, Regulation of NAD+ (B), NADH (C), NAD+ / NADH (D) ratio in leaves of Col-0, ef-g mutant and EF-G-OX lines.

[0010] FIG. 5 illustrates that EF-G is localized in the chloroplast and interacts with 170 proteins. A. Confocal imaging showing subcellular localization of EF-G-GFP. Images show the signals from green (GFP), red (chlorophyll autofluorescence) and bright channel. All channels were merged (bottom right panel) that shows the chloroplast localization of EF-G. B. Protein mass spectrometric analysis of immuno-precipitated EF-G-GFP protein complex identified EF-G interactors. Total protein was immuno-precipitated with anti-GFP antibody agarose conjugate. Free GFP expressing plant was used as a negative control. Venn diagram showing EF-G interactors classified into biological process using Mapman bins. C. Co-IP of EF-G with RAB8D. EF-G-GFP was transiently co-expressed with RAB8D-HA in N. benthamiana leaves using Agrobacterium. Total protein was immuno-precipitated with anti-GFP antibody agarose conjugate. Empty vector pMDC32 and free GFP expression were used as negative controls. Left half of the blot contains input samples with upper left showing the presence of EF-G-GFP with anti-GFP antibody and lower left shows presence of RAB8D with anti-HA antibody. Upper rightshows immunoprecipitated EF-G-GFP. Lower right shows RAB8D-HA co-immunoprecipitated with EF-G-GFP.

[0011] FIG. 6 illustrates that RAB8D controls plant growth and CO2assimilation. A. Relative expression of RAB8D transcript in Col-0 and two independent rab8D mutants rab8D-1 (SAIL_659_G09) and rab8D-2 (SALK_133413) by RT-qPCR. B. Four-week-old Arabidopsis Col-0, rab8D-1 and rab8D-2 grown in growth chamber under short day (8:16 light-dark cycle, light intensity 230 µmol m–2s–1). C. Rosette weight. Error bars represent the standard error from 12 biological replicates representing 12 individual plants and experiment was repeated with similar results. Asterisks represent statistically significant difference with Student’s t-test (P-value ≤ 0.05) when compared to Col-0. D. Western gel blot analysis showing RBCL in Col-0, rab8D-1 and rab8D-2 lines. Actin was used as loading control. Intensity of each band with respect to Actin was quantified using Image J software and is given above each band as a percentage to Col-0. E. CO2response curve showing the CO2assimilation rates measured at various CO2concentrations ranging from 0 to 1,200 µmol mol⁻¹.

[0012] FIG. 7 illustrates that EF-G regulates retrograde signaling. A. Proteins differentially expressed in ef-g or EF-G-OX compared to WT and known to be involved in retrograde signaling related to JA, ABA, HEME, chlorophyll degradation, PRR proteins, superoxide dismutases and proteins involved in signal transduction. B, C and D. Quantification of hormones, and E. Total chlorophyll.

[0013] FIG.8 illustrates EF-G expression analysis, chlorophyll content, and seed yield. A. Real- time RT-qPCR expression analysis showing downregulation of EF-G transcript in mutants (ef-g-1 and ef-g-2) and EF-G overexpressors (OX-2-1 and OX-3-1) compared to control wild-type Col-0. B and C. Quantification of chlorophyll a and chlorophyll b in control wild-type Col-0, mutants (ef- g-1 and ef-g-2), and EF-G overexpressors (OX-2-1 and OX-3- 1) in μg per cm2of the leaf. D. seed yield per plant in control wild-type Col-0, mutants (ef-g-1 and I), and EF-G overexpressors (OX-2- 1 and OX-3-1). Error bars indicate standard error of three biological replicates and asterisks represent statistically significant difference compared to control using Student’s t-test (p-value ≤ 0.05).

[0014] FIG. 9 illustrates analysis of nitrate assimilation pathway EF-G lines and chlorophyll content in rab8d mutant. Panel A: Analysis of nitrate assimilation pathway EF-G lines. Pathways were constructed based on plant metabolic network (Schlapfer et al., 2017), MapMan software (Thimm et al., 2004) and (Stitt and Zeeman, 2012). Fold changes of enzymes, which altered significantly (P-value ≤0.1), in ef-g mutant (2nd column) and EF-G-OX (3rd column) compared toCol-0 are shown. NIR1, Nitrite reductase 1; GLN2, Glutamine synthase 1; GLS1, Glutamate synthase ferredoxin dependent; GLT1, Glutamate synthase NADH dependent. Panel B: Quantification of chlorophyll a and chlorophyll b in control wild-type Col-0 and rab8D-1 mutant in μg per cm2of the leaf. DETAILED DESCRIPTION

[0015] Before explaining at least one embodiment of the inventive concept(s) in detail by way of exemplary language and results, it is to be understood that the inventive concept(s) is not limited in its application to the details of construction and the arrangement of the components set forth in the following description. The inventive concept(s) is capable of other embodiments or of being practiced or carried out in various ways. As such, the language used herein is intended to be given the broadest possible scope and meaning; and the embodiments are meant to be exemplary - not exhaustive. Also, it is to be understood that the phraseology and terminology employed herein is for the purpose of description and should not be regarded as limiting.

[0016] Unless otherwise defined herein, scientific and technical terms used in connection with the presently disclosed inventive concept(s) shall have the meanings that are commonly understood by those of ordinary skill in the art. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. The foregoing techniques and procedures are generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification. The nomenclatures utilized in connection with, and the laboratory procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well-known and commonly used in the art. Standard techniques are used for chemical syntheses and chemical analyses.

[0017] All patents, published patent applications, and non-patent publications mentioned in the specification are indicative of the level of skill of those skilled in the art to which this presently disclosed inventive concept(s) pertains. All patents, published patent applications, and non- patent publications referenced in any portion of this application are herein expressly incorporated by reference in their entirety to the same extent as if each individual patent or publication was specifically and individually indicated to be incorporated by reference.

[0018] All of the compositions and / or methods disclosed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions andmethods of the inventive concept(s) have been described in terms of particular embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and / or methods and in the steps or in the sequence of steps of the methods described herein without departing from the concept, spirit, and scope of the inventive concept(s). All such similar substitutions and modifications apparent to those skilled in the art are deemed to be within the spirit, scope, and concept of the inventive concept(s) as defined by the appended claims.

[0019] As utilized in accordance with the present disclosure, the following terms, unless otherwise indicated, shall be understood to have the following meanings:

[0020] The use of the term “a” or “an” when used in conjunction with the term “comprising” in the claims and / or the specification may mean “one,” but it is also consistent with the meaning of “one or more,” “at least one,” and “one or more than one.” As such, the terms “a,” “an,” and “the” include plural referents unless the context clearly indicates otherwise. Thus, for example, reference to “a compound” may refer to one or more compounds, two or more compounds, three or more compounds, four or more compounds, or greater numbers of compounds. The term “plurality” refers to “two or more.”

[0021] The use of the term “at least one” will be understood to include one as well as any quantity more than one, including but not limited to, 2, 3, 4, 5, 10, 15, 20, 30, 40, 50, 100, etc. The term “at least one” may extend up to 100 or 1000 or more, depending on the term to which it is attached; in addition, the quantities of 100 / 1000 are not to be considered limiting, as higher limits may also produce satisfactory results. In addition, the use of the term “at least one of X, Y, and Z” will be understood to include X alone, Y alone, and Z alone, as well as any combination of X, Y, and Z. The use of ordinal number terminology (i.e., “first,” “second,” “third,” “fourth,” etc.) is solely for the purpose of differentiating between two or more items and is not meant to imply any sequence or order or importance to one item over another or any order of addition, for example.

[0022] The use of the term “or” in the claims is used to mean an inclusive “and / or” unless explicitly indicated to refer to alternatives only or unless the alternatives are mutually exclusive. For example, a condition “A or B” is satisfied by any of the following: A is true (or present) and B is false (or not present), A is false (or not present) and B is true (or present), and both A and B are true (or present).

[0023] As used herein, any reference to “one embodiment,” “an embodiment,” “some embodiments,” “one example,” “for example,” or “an example” means that a particular element, feature, structure, or characteristic described in connection with the embodiment is included inat least one embodiment. The appearance of the phrase “in some embodiments” or “one example” in various places in the specification is not necessarily all referring to the same embodiment, for example. Further, all references to one or more embodiments or examples are to be construed as non-limiting to the claims.

[0024] Throughout this application, the term “about” is used to indicate that a value includes the inherent variation of error for a composition / apparatus / device, the method being employed to determine the value, or the variation that exists among the study subjects. For example, but not by way of limitation, when the term “about” is utilized, the designated value may vary by plus or minus twenty percent, or fifteen percent, or twelve percent, or eleven percent, or ten percent, or nine percent, or eight percent, or seven percent, or six percent, or five percent, or four percent, or three percent, or two percent, or one percent from the specified value, as such variations are appropriate to perform the disclosed methods and as understood by persons having ordinary skill in the art.

[0025] As used in this specification and claim(s), the words “comprising” (and any form of comprising, such as “comprise” and “comprises”), “having” (and any form of having, such as “have” and “has”), “including” (and any form of including, such as “includes” and “include”), or “containing” (and any form of containing, such as “contains” and “contain”) are inclusive or open-ended and do not exclude additional, unrecited elements or method steps.

[0026] The term “or combinations thereof” as used herein refers to all permutations and combinations of the listed items preceding the term. For example, “A, B, C, or combinations thereof” is intended to include at least one of: A, B, C, AB, AC, BC, or ABC, and if order is important in a particular context, also BA, CA, CB, CBA, BCA, ACB, BAC, or CAB. Continuing with this example, expressly included are combinations that contain repeats of one or more item or term, such as BB, AAA, AAB, BBC, AAABCCCC, CBBAAA, CABABB, and so forth. The skilled artisan will understand that typically there is no limit on the number of items or terms in any combination, unless otherwise apparent from the context.

[0027] As used herein, the term “substantially” means that the subsequently described event or circumstance completely occurs or that the subsequently described event or circumstance occurs to a great extent or degree. For example, when associated with a particular event or circumstance, the term "substantially" means that the subsequently described event or circumstance occurs at least 80% of the time, or at least 85% of the time, or at least 90% of the time, or at least 95% of the time. For example, the term "substantially adjacent" may mean that two items are 100% adjacent to one another, or that the two items are within close proximity toone another but not 100% adjacent to one another, or that a portion of one of the two items is not 100% adjacent to the other item but is within close proximity to the other item.

[0028] As used herein, the phrases “associated with” and “coupled to” include both direct association / binding of two moieties to one another as well as indirect association / binding of two moieties to one another.

[0029] As used herein, the terms “nucleic acid segment,” “nucleic acid sequence,” “nucleotide segment,” “nucleotide sequence,” “DNA sequence,” and “DNA segment” are used interchangeably and refer to a DNA molecule which has been isolated free of total genomic DNA of a particular species. Therefore, a “purified” or “isolated” nucleotide sequence as used herein refers to a DNA segment which contains a desired coding sequence yet is isolated away from, or purified free from, unrelated genomic DNA. Included within these terms are DNA segments and smaller fragments of such segments, and also recombinant vectors including, for example (but not by way of limitation), plasmids, cosmids, phage, viruses, and the like.

[0030] Similarly, a DNA segment comprising a desired gene refers to a DNA segment including coding sequences isolated substantially away from other naturally occurring genes or protein encoding sequences. In this respect, the term “gene” is used for simplicity to refer to a functional protein-, polypeptide-, or peptide-encoding unit. As will be understood by those in the art, this functional term includes genomic sequences, cDNA sequences, synthetic sequences, or combinations thereof. “Isolated substantially away from other coding sequences” means that the gene of interest forms the significant part of the coding region of the DNA segment, and that the DNA segment does not contain large portions of naturally-occurring coding DNA, such as large chromosomal fragments or other functional genes or DNA coding regions. Of course, this refers to the DNA segment as originally isolated, and does not exclude genes or coding regions later added to, or intentionally left in, the segment by the hand of man.

[0031] In certain embodiments, DNA sequences in accordance with the presently disclosed and claimed inventive concept(s) will further include genetic control regions which allow the expression of the sequence in a selected recombinant host. Of course, the nature of the control region employed will generally vary depending on the particular use (e.g., cloning host) envisioned.

[0032] The term “plant biomass” as used herein can refer to any plant-derived organic matter (woody or non-woody). Plant biomass can include, but is not limited to, agricultural or food crops (e.g., sugarcane, wheat including wheat flour, tubers, vegetables, lentils, kelp, legumes, soybeans, or corn), food waste valorization, seaweed, plankton (e.g., macroplankton,mesoplankton, microplankton, nanoplankton, picoplankton, and femptoplankton), phytoplankton, or an extract therefrom (e.g., sugar from sugarcane and corn starch from corn), agricultural crop wastes and residues such as corn stover, wheat straw, rice straw, sugar cane bagasse, and the like. Plant biomass further includes, but is not limited to, trees, woody energy crops, wood wastes and residues such as softwood forest matter, barky wastes, sawdust, paper and pulp industry waste streams, wood fiber, and the like. Additionally, grass crops, such as (but not limited to) switchgrass, sorghum, miscanthus, poplar, wheatgrass, fescue, bamboo, reed canary grass, hybrid willow, eastern cottonwood, and the like have potential to be produced on a large-scale as another plant biomass source.

[0033] The term “starch” as used herein can refer to a polymer of glucose readily hydrolyzed by digestive enzymes, e.g., amylases. Starch is usually concentrated in specialized portions of plants, such as potatoes, corn kernels, rice grains, wheat grains, and sugar cane stems.

[0034] Turning now to the inventive concepts, the present disclosure is related to compositions, systems, kits, and methods of increasing plant biomass. These compositions, systems, kits, and methods employ a chloroplastic translation elongation factor-G (EF-G) protein or active fragment thereof to increase plant biomass, enhance photosynthetic CO2assimilation, increase plant metabolism, increase cell metabolism, increase RuBisCO protein levels, enhance biomass formation, and / or affect any other biochemical property of the plant disclosed or otherwise contemplated herein.

[0035] Increasing biomass and crop yield by enhancing photosynthetic CO2assimilation and increasing plant metabolism is a current challenge. However, to increase plant biomass, many enzymatic steps need to be modified, from CO2assimilation to biomass formation. In addition, genetic manipulation of many enzymes in the same plant is technically challenging, tedious, and cumbersome. Identification of regulatory factors that can potentially control the whole metabolic pathway starting from CO2fixation to starch synthesis and biomass formation will be one of the best strategies to increase plant biomass and yield.

[0036] The sluggish kinetics of ribulose-1,5-bisphosphate carboxylase / oxygenase (RuBisCO) is a rate limiting step, indicating that increasing RuBisCO protein levels is an elegant solution towards increasing CO2assimilation. Past attempts at increasing RuBisCO protein levels by simultaneously increasing multiple components were tedious and cumbersome. In addition, increasing photosynthesis is not a trivial task, and multiple genes have to be overexpressed at the same time in even an attempt to achieve this goal. This manipulation of multiple genes leads to more regulatory issues that have to be addressed.

[0037] Using a virus-induced gene silencing (VIGS)-based fast forward genetics screening approach, the present disclosure identified chloroplastic translation elongation factor-G (EF-G) as being involved in increasing plant biomass. EF-G is involved in regulation of RuBisCO and RuBisCO activase (RCA) levels, increasing CO2assimilation, starch synthesis and mobilization, and whole cell metabolism that ultimately increases plant biomass via its involvement in translation and retrograde signaling. EF-G interacts with more than 100 proteins, including (but not limited to) EF-Tu, which phenocopies EF-G. Beyond its role in regulating several chloroplast proteins, EF- G is also involved in retrograde signaling and regulates several nuclear encoded proteins targeted to cellular compartments, including chloroplast and mitochondria. Therefore, the present disclosure harnesses the power of EF-G as a master regulator of photosynthesis, wherein overexpression of this single gene increases photosynthesis and plant biomass via EF-G’s involvement in chloroplast protein translation, metabolism, and retrograde signaling.

[0038] Suitable methods for introduction / transformation of the EF-G protein into host plant cells include virtually any method by which DNA or RNA can be introduced into a cell (for example, where a recombinant DNA construct is stably integrated into a plant chromosome or where a recombinant DNA construct or an RNA is transiently provided to a plant cell) and are well known in the art.

[0039] Certain non-limiting embodiments of the present disclosure are directed to a genetically modified plant that includes at least one modification from the natively occurring plant, wherein the at least one modification results in overexpression of at least one chloroplastic translation elongation factor-G (EF-G) protein or a fragment thereof. The modification may involve the EF-G gene and / or a promoter for the EF-G gene. The plant may be genetically modified by any methods known in the art or otherwise contemplated herein for overexpression of a gene. Non-limiting examples of genetic modifications that can be utilized in accordance with the present disclosure include insertion of a vector that constitutively or inducibly overexpresses at least one EF-G protein or an active fragment thereof; modification to an EF-G promoter to make it overexpress EF-G, substantially constitutively express EF-G, or inducibly express EF-G; addition of at least one enhancer element; addition of multiple copies of the vector encoding EF-G protein or an active fragment thereof; addition of multiple genomic integrations of a gene encoding the EF-G protein or an active fragment thereof; CRISPR activation (CRISPRa); cisgenics or transgenics (where promoters and / or genes are swapped between species); and the like, as well as any combinations thereof.

[0040] Any EF-G proteins or fragments thereof known in the art or otherwise contemplated herein may be utilized in accordance with the present disclosure. The EF-G protein / fragment may be homogeneous or heterogeneous to the plant species. Non-limiting examples of DNA sequences encoding EF-G proteins or fragments thereof that can be utilized in accordance with the present disclosure are shown in Table 1 and assigned SEQ ID NOS: 2, 4, 7, 9, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, and 34. Non-limiting examples of EF-G proteins or fragments thereof that can be utilized in accordance with the present disclosure are shown in Table 1 and assigned SEQ ID NOS: 1, 3, 5, 6, 8, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, and 35.

[0041] In addition to the wild type sequences shown in Table 1, the EF-G protein or active fragment thereof may be an active variant of any of the sequences disclosed in Table 1. For example, in certain non-limiting embodiments, the EF-G protein or active fragment thereof includes variants having an amino acid sequence that has at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to a wild type EF-G protein or active fragment thereof such as, but not limited to, at least one of SEQ ID NOS: 1, 3, 5, 6, 8, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, and 35, or a wild type EF-G protein or active fragment thereof encoded by at least one of SEQ ID NOS: 2, 4, 7, 9, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, and 34.

[0042] As used herein, the term “sequence identity” refers to the percent identity of bases or amino acids determined by comparing a first polynucleotide or polypeptide to a second polynucleotide or polypeptide using algorithms having various weighting parameters. Sequence identity between two polypeptides or two polynucleotides can be determined using sequence alignment by various methods and computer programs (e.g., BLAST, FASTA, L-ALIGN, etc.), available through the worldwide web at sites including GENBANK (National Center for Biotechnology Information at the National Institutes of Health, Bethesda, MD) and EMBL-EBI (European Bioinformatics Institute, Wellcome Genome Campus, Hinxston, Cambridge, UK). Sequence identity between two polynucleotides or two polypeptide sequences is generally calculated using the standard default parameters of the various methods or computer programs.

[0043] Alternatively, the active EF-G variant may have an amino acid sequence that differs from one or more of SEQ ID NOS: 1, 3, 5, 6, 8, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, and 35 by less than about 25 amino acids, less than about 24 amino acids, less than about 23 aminoacids, less than about 22 amino acids, less than about 21 amino acids, less than about 20 amino acids, less than about 19 amino acids, less than about 18 amino acids, less than about 17 amino acids, less than about 16 amino acids, less than about 15 amino acids, less than about 14 amino acids, less than about 13 amino acids, less than about 12 amino acids, less than about 11 amino acids, less than about 10 amino acids, less than about 9 amino acids, less than about 8 amino acids, less than about 7 amino acids, less than about 6 amino acids, less than about 5 amino acids, less than about 4 amino acids, less than about 3 amino acids, less than about 2 amino acids, or less than about 1 amino acid.

[0044] The EF-G protein is well conserved across plant species, and as such, it is well within the purview of a person of ordinary skill in the art to determine which portions of EF-G protein can be modified to form a variant for use in accordance with the present disclosure. Therefore, no further description thereof is deemed necessary.

[0045] Particular (but non-limiting) embodiments of the present disclosure includes a recombinant plant, that comprises a vector that constitutively or inducibly overexpresses at least one chloroplastic translation elongation factor-G (EF-G) protein or an active fragment thereof. The vector includes a DNA sequence and at least one genetic control sequence; the DNA sequence encodes at least one chloroplastic translation elongation factor-G (EF-G) protein or an active fragment thereof, and the genetic control sequence allows for over-expression of the DNA sequence. In a particular (but non-limiting) embodiment, the at least one genetic control sequence of the vector allows for constitutive or inducible over-expression of the DNA sequence.

[0046] Any genetic control sequences known in the art or otherwise disclosed herein that are capable of functioning as described herein (i.e., providing overexpression of an EF-G protein or fragment thereof in a plant) may be utilized in accordance with the present disclosure. Non- limiting examples of genetic control sequences that can be utilized include CaMV355 promoter, ________________, and the like, as well as any combinations thereof. [What other promoters should be disclosed?]

[0047] Certain non-limiting embodiments of the present disclosure include a crop comprising a plurality of any of the plants disclosed or otherwise contemplated herein, wherein the plurality of plants is planted together in an agricultural field.

[0048] Certain non-limiting embodiments of the present disclosure include a commodity plant product comprising at least one modification from the natively occurring plant, wherein the at least one modification results in overexpression of at least one chloroplastic translationelongation factor-G (EF-G) protein or active fragment thereof (such as, but not limited to, any of the EF-G proteins or fragments thereof of Table 1).

[0049] The plants, crops, and products disclosed herein may be any type of plants known in the art or otherwise contemplated herein. Non-limiting examples of plants that may be utilized in accordance with the present disclosure include agricultural crop plant, such as (but not limited to) food crops (including, but not limited to, fruit, vegetables, grains, and tubers); feed crop plants; fiber crop plants (including, but not limited to, cotton); fuel crop plants; and the like, as well as combinations thereof. Non-limiting examples of food crop plants include sugarcane, wheat, tubers, vegetables, lentils, kelp, legumes, soybeans, rice, quinoa, potato, tomato, beans, spinach, lettuce, corn, oats, pea, turnip, maize, cassava, oil-palm fruit, sunflower, and sugar beet, and the like, as well as combinations thereof. Non-limiting examples of feed crop plants include corn, barley, wheat, oats, alfalfa, forages (grasses), hays, silages, and the like, as well as combinations thereof.

[0050] Certain non-limiting embodiments of the present disclosure are directed to methods of increasing plant biomass, plant yield, photosynthetic capacity, and / or at least one biochemical property of a plant (such as, but not limited to) photosynthetic CO2assimilation, plant metabolism, RuBisCO protein level, RuBisCO activase (RCA) level, starch synthesis and mobilization, cellular metabolism, and / or any other biochemical properties disclosed or otherwise contemplated herein). The method includes culturing any of the plants, crops, or products disclosed or otherwise contemplated herein under conditions that produce a mature plant with increased plant biomass, plant yield, photosynthetic capacity, and / or at least one biochemical property compared to a mature, native (i.e., non-recombinant, non-genetically modified) plant.

[0051] Certain non-limiting embodiments of the present disclosure are directed to a recombinant vector that includes a DNA sequence encoding at least one chloroplastic translation elongation factor-G (EF-G) protein or an active fragment thereof (such as, but not limited to, any of the DNA sequences disclosed in Table 1); and at least one of any of the genetic control sequences that allows for over-expression of the DNA sequence disclosed or otherwise contemplated herein.

[0052] Certain non-limiting embodiments of the present disclosure include methods of producing any of the recombinant plants disclosed herein. The method includes inserting any of the vectors disclosed or otherwise contemplated herein into at least one cell of any of the plants disclosed or otherwise contemplated herein to provide at least one recombinant plant cell.

[0053] Certain non-limiting embodiments of the present disclosure are directed to methods of increasing plant biomass, plant yield, photosynthetic capacity, and / or at least one biochemical property of a plant (such as, but not limited to) photosynthetic CO2assimilation, plant metabolism, RuBisCO protein level, RuBisCO activase (RCA) level, starch synthesis and mobilization, cellular metabolism, and / or any other biochemical properties disclosed or otherwise contemplated herein). The method includes inserting at least one of any of the vectors disclosed or otherwise contemplated herein into at least one plant cell of any of the plants disclosed or otherwise contemplated herein, and culturing the at least one plant cell under conditions that produce a mature plant with increased plant biomass, plant yield, photosynthetic capacity, and / or at least one biochemical property compared to a mature plant that does not contain the vector. EXAMPLES

[0054] Examples are provided hereinbelow. However, the present disclosure is to be understood to not be limited in its application to the specific experimentation, results, and laboratory procedures disclosed herein after. Rather, the Examples are simply provided as one of various embodiments and are meant to be exemplary, not exhaustive.

[0055] In order to identify the genes involved in plant growth, a virus-induced gene silencing (VIGS)-based forward genetics screening was performed (Senthil-Kumar and Mysore, 2014) in Nicotiana benthamiana and identified that silencing a cDNA clone NbTI05A09 led to the stunting with pale-green to albino leaves (FIG. 1, Panel A), indicating its role in plant growth and chlorophyll metabolism. A nucleotide BLAST search of NbTI05A09 cDNA sequence identified a full-length N. benthamiana gene (Niben101Scf09387g03016) and an Arabidopsis gene encoding elongation factor G (EF-G, AT1G62750), which is also known as snowy cotyledon 1 (SCO1; Albrecht et al., 2006). For functional characterization of EF-G, two independent Arabidopsis T- DNA insertion mutants, SALK_025112C (ef-g1) and SAIL_1144_C07 (ef-g2), were obtained. In the homozygous ef-g1 and ef-g2 mutants, EF-G was downregulated by 2 and 10-fold, respectively, when compared to wild-type Col-0 (Fig.8, Panel A). Constitutive over-expressor (OX) lines of EF- G were generated using CaMV35S promotor in the Arabidopsis ecotype Col-0. Quantitative RT- PCR (RT-qPCR) analysis showed 8- to 10-fold increase in EF-G transcripts in the EF-G-OX lines (Fig. 8, Panel A). The leaves of ef-g mutants (ef-g1 and ef-g2) were yellowish-green, with only 70-50% chlorophyll-a and 80-60% of chlorophyll-b compared to Col-0 (Fig. 8, Panels B and C), although sco1 was reported to affect the chlorophyll level of cotyledons but not true leaves. EF-G-OX lineshad similar chlorophyll levels as Col-0 (Fig.8, Panels B and C). Strikingly, the fresh rosette biomass measurements revealed that EF-G-OX lines had 30% more fresh weight, whereas ef-g mutants had approximately 50% less fresh weight compared to Col-0 (FIG. 1, Panels B and C). Furthermore, quantification of root length also showed that the ef-g mutant had smaller roots and EF-G-OX had longer roots compared to Col-0 (FIG.1, Panels D and E). In addition to this, the seed yield also increased in EF-G-OX lines (approximately 15%) and significantly decreased in ef- g mutants (approximately 50%) when compared to Col-0 (Fig. 8, Panel D). Overall, the results indicated a positive role of EF-G in increasing plant biomass and yield.

[0056] EF-G plays a role in translation of proteins involved in photosynthesis, ATPases, and ribosomal proteins

[0057] To decipher the function of EF-G at the molecular level, a quantitative proteomics (qProteomics) analysis was performed in chloroplast-enriched samples of Col-0, ef-g and EF-G- OX lines. This approach detected a total of 2,386 proteins in all three lines tested. Forty-nine (49) chloroplast encoded proteins were found, and these proteins were characterized based on their structural function. Chloroplast encoded RuBisCO large subunit (RBCL) was markedly decreased in the ef-g mutant and increased in EF-G-OX lines (FIG.2, Panel A). Photosystem II (PSB) reaction center protein H (PSBH) was increased in EF-G-OX. PSBE was decreased in EF-G-OX and ef-g lines. Photosystem I chloroplast open reading frame YCF3 was increased in EF-G-OX and decreased in the ef-g mutant compared to Col-0. ATPase subunit ATPF was increased in EF-G-OX lines, whereas ATPase subunit ATPA was decreased in EF-G-OX lines. ATPase subunits ATPB, ATPE, and ATPH were decreased in the ef-g mutant. This indicated a role of EF-G in translation of photosynthetic components and chloroplastic ATPases. Interestingly, a slight increase in the amount of ribosomal proteins was observed in the ef-g mutant. The majority of the ribosomal proteins (RPS) were unchanged in EF-G-OX lines, with the exception of RPS14 and RPS18. This indicates that EF-G negatively regulates ribosomal protein synthesis.

[0058] The quantity of nuclear encoded RuBisCO subunits was checked and, surprisingly, RuBisCO small subunit 1A (RBCS1A) and RBCS1B were found to be increased in EF-G-OX lines (FIG. 2, Panel B), demonstrating that the whole RuBisCO enzyme complex is present in higher amounts in EF-G-OX lines. Nuclear-encoded chloroplastic ATPase components were also positively regulated by EF-G (FIG. 2, Panel B). Increasing RuBisCO content is not sufficient for increasing CO2assimilation, and its activation state is also important (Suganami et al. (2018) Soil Science and Plant Nutrition, 64:352-359; and Suzuki et al. (2007) Plant Cell Physiol, 48:626-637).It was found that RCA was also increased on EF-G-OX lines (FIG.2, Panel B). The amount of RBCLwas further determined by western gel blot analysis, and a significant increase in RBCL was found in EF-G-OX along with a decrease in RBCL in the ef-g mutant compared to Col-0 (FIG.2, Panel C).

[0059] It was hypothesized that EF-G acts as a positive regulator of CO2assimilation via its regulation of RuBisCO and RCA production. To test this hypothesis, CO2assimilation was measured using LiCOR-Li6800 at various CO2concentrations from 0 to 1200 µmol mol⁻¹. CO2assimilation of the EF-G-OX lines was higher, and ef-g mutant was lower than the Col-0 (FIG.2, Panel D).

[0060] EF-G is involved in reprograming of cellular metabolism

[0061] Regulation of CO2assimilation by EF-G indicates a role of EF-G in regulation of plant metabolism. Primary metabolites were quantified in Col-0, efg-1, and EF-G-OX lines using GC- MS, the differentially accumulated metabolites in ef-g-1 and EF-G-OX compared to Col-0 were characterized into different groups using MapMan software. EF-G-OX line showed an increase in the components of carbohydrate metabolism, cell wall, amino acids, tricarboxylic acid (TCA) cycle, organic acids, nucleotide sugars, and lipids (FIG.3, Panel A) when compared to Col-0. These metabolites were either decreased or unaltered in the ef-g mutant. Alanine, proline, and glycine were increased in both EF-G-OX and the ef-g mutant when compared to Col-0. Overall, EF-G altered whole cell metabolism irrespective of its localization to the chloroplast.

[0062] To determine the broader picture of whole cell metabolic regulation by EF-G at the enzymatic level, the qProteomics identified proteins showing altered levels in EF-G-OX and ef-g- 1 lines compared to Col-0 were scrutinized and mapped into metabolic pathways. Starch and sucrose biosynthesis, starch degradation, and photorespiration pathways (FIG.3, Panel B) were constructed, and enzymes were mapped to the pathway. Analysis of enzymes of starch and sucrose biosynthesis identified that many enzymes of the starch biosynthesis including starch synthase 2 (SS2) were markedly increased in EF-G-OX, and these were decreased or unaltered in the ef-g mutant. Phosphoglycerate kinase (PGK), plastidic triose phosphate isomerase (PTPI) and ADP glucose pyrophosphorylase (ADG1 and ADG2) were decreased in the ef-g mutant. Granulated starch synthase 1 (GBSS1) and starch branching enzyme 2 (SBE2) that are involved in starch branching were increased in the ef-g mutant, indicating an alteration in starch granule structure. Increased SS2 and other enzymes of the pathway indicated an enhanced starch biosynthesis in EF-G-OX. To confirm this, the starch content was quantified, and it was found that starch was markedly increased in the EF-G-OX line and decreased in the ef-g mutant, which was consistent with the proteomics data (FIG.3, Panel C).

[0063] Analysis of sucrose biosynthesis pathway showed unaltered or slightly elevated levelof enzymes in EF-G-OX whereas these were increased in the ef-g mutant. This indicates that the ef-g mutant maintains the wild-type like sucrose level by increasing amount of cytosolic enzymes involved in sucrose biosynthesis though the enzymes involved in triose precursor metabolism in chloroplast were decreased in the ef-g mutant. This is evident by wild-type level of sucrose and glucose in the ef-g mutant (FIG. 3, Panel A). Analysis of starch degradation pathway enzymes showed that these were decreased in the ef-g mutant and increased in EF-G-OX. The α-glucan phosphorylase 2 (PHS2) involved in starch degradation and sucrose biosynthesis was increased by 10-fold in EF-G-OX. Overall, this indicated EF-G positively regulates the starch and sucrose biosynthesis, and enhanced starch degradation into sucrose. This is also consistent with increased amount of sucrose and glucose and starch in EF-G-OX.

[0064] RuBisCO also has oxygenase activity and altered RuBisCO level indicates an altered photorespiration. The enzymes and metabolites in photorespiration pathway were mapped. This showed that many enzymes of photorespiration pathway were increased in EF-G-OX and decreased / unaltered in the ef-g mutant. This is consistent with the observation of increased amount of the photorespiration pathway metabolites serine and glycine in EF-G-OX (FIG. 3, Panels A and B). Analysis of nitrate assimilation pathway showed increased levels of pathway enzymes in EF-G-OX and decreased / unaltered levels in the ef-g mutant, indicating a positive role of EF-G in regulation of nitrate assimilation (Fig.9, Panel A).

[0065] EF-G regulates mitochondrial metabolism

[0066] Observation of marked increase in metabolites of the tricarboxylic acid (TCA) cycle in EF-G-OX led us to analyze the pathway enzymes of TCA cycle and mitochondrial electron transport chain (FIG.4). Many enzyme isomers involved in the TCA cycle were in higher amount in EF-G-OX and were decreased or unaltered in the ef-g mutant (FIG. 4). Isocitrate dehydrogenase 1 (IDH1) and 2-oxoglutarate dehydrogenases (OGDHEs) that controls reducing power of NADH were markedly decreased in the ef-g mutant. This indicated that the ef-g mutant might be deficient in NADH level. The regulation of enzymes of the mitochondrial electron transport chain (ETC) were also mapped and analyzed. Majority of the ETC complex enzymes were increased in the ef-g mutant with an exception of few. Most ETC complex enzymes were increased, some were unaltered and the remaining were decreased in EF-G-OX, indicating a slightly altered structure / composition of mitochondrial ETC complexes due to altered EF-G level.

[0067] We also quantified NAD levels in leaves. It was found that NAD+was markedly increased in ef-g mutants (FIG.4, Panel B). NAD+level in EF-G-OX lines was significantly less than ef-g mutants but more than Col-0. Correlated with the enzyme levels involved in NADHproduction, NADH levels were approximately two-fold less in ef-g mutants (FIG. 4, Panel C). NADH level in EF-G-OX was more than ef-g mutants but less than Col-0. There was a drastic difference in the NAD+ / NADH ratio and it was 3.5-fold more in ef-g mutants compared to Col-0 (FIG. 4, Panel D). NAD+ / NADH ratio in EF-G-OX lines was ~ 2-fold more than Col-0 and was markedly less than ef-g mutant. Overall, the results showed that both ef-g and EF-G-OX lines were deficient in production of NADH from NAD+and the reduction was more severe in the ef-g mutant.

[0068] EF-G is localized in the chloroplast and interacts with 170 proteins including Rab GTPase Homolog 8D (RAB8D)

[0069] To visualize the subcellular localization of EF-G, the EF-G was fused with GFP at its C- terminal, and EF-G-GFP expressing Arabidopsis lines were generated. Confocal imaging of EF-G- GFP expressing plants revealed that EF-G is localized in the chloroplast (FIG.5, Panel A). To gain an insight about the role of EF-G in plant metabolism, EF-G interactors were identified using immunoprecipitation and mass-spectrometry approach. Arabidopsis plants expressing EF-G-GFP and free GFP (control) were generated and total protein was extracted from plants grown under normal condition. Protein was subjected to immunoprecipitation using anti-GFP agarose and analyzed using protein mass-spectrometry. Proteins identified in the control (free GFP immunoprecipitation) were subtracted from the list of EF-G interactors. This approach led to the identification of 170 putative interactors which are involved in 24 biological processes (FIG. 5, Panel B) including protein synthesis, amino acid metabolism, photosynthesis light reaction, photorespiration, Calvin cycle, tetrapyrrole synthesis, cell organization and jasmonate metabolism.

[0070] One of the most prominent interactors of EF-G identified from immunoprecipitation / protein mass-spectrometry was Rab GTPase Homolog 8D (RAB8D), which is a nuclear encoded plastid translation elongation factor EF-Tu. To confirm the in planta interaction of EF-G with RAB8D, an in vivo co-immunoprecipitation (co-IP) assay was performed. HA tag was fused to RAB8D (RAB8D-HA) and transiently co-expressed along with EF-G-GFP in N. benthamiana leaves. EF-G-GFP was able to co-IP RAB8D-HA as evident by the detection of RAB8D-HA in immunoprecipitated sample (FIG.5, Panel C, Lane-8, lower panel), confirming the interaction of EF-G with RAB8D.

[0071] RAB8D controls plant growth and CO2assimilation

[0072] To elucidate the function of EF-G interactor RAB8D, two independent Arabidopsis T- DNA insertion lines rab8D-1 (SAIL_659_G09) and rab8D-2 (SALK_133413) were identified andconfirmed. RT-qPCR based expression profiling showed RAB8D transcript downregulation by 10 and two-fold in rab8D-1 and rab8D-2 mutants, respectively (FIG.6, Panel A). Plants were grown under short day condition for four weeks and showed that rosette weights of rab8D-1 and rab8D- 2 were 43% and 61% of Col-0, respectively (FIG.6, Panels B and C). Mutant plants were yellowish green with decreased chlorophyll level (FIG. 9, Panel B), indicating its role in chloroplast metabolism.

[0073] To gain an insight into the role of RAB8D into photosynthesis as its interactor EF-G, the level of RBCL was analyzed in the leaves of Col-0 and rab8D mutants by western gel blot analysis. RBCL was found to be decreased to 72% and 92% of Col-0 in rab8D-1 and rab8D-2 mutants, respectively (FIG. 6, Panel D). Decreased RuBisCO levels indicate the decreased CO2assimilation. Quantification of CO2assimilation using LiCOR-Li6800 at various CO2concentrations from 0 to 1,200 µmol mol⁻¹ showed that CO2assimilation was markedly decreased in both rab8D mutant lines compared to the Col-0 (FIG.6, Panel E).

[0074] EF-G regulates chloroplast retrograde signaling

[0075] Although EF-G is localized in chloroplast, based on our proteomics data, it regulated the abundance of several nuclear encoded proteins targeted to different cellular compartments. This indicates that EF-G could be involved in chloroplast retrograde signaling and therefore the role of EF-G in retrograde signaling was explored. Stress hormones ABA, JA, and SA are produced in chloroplasts and mediate the retrograde signaling (Phua et al., 2018), and EF-G was found to regulate the amount of ABA or JA related proteins (FIG. 7, Panel A). In addition, the phytohormones were quantified, and JA was found to be increased in EF-G-OX lines and decreased in the ef-g mutant. ABA and SA were increased in the ef-g mutant and decreased in EF-G-OX lines (FIG.7, Panels B, C, and D). Tetrapyrrole biosynthesis pathway compounds such as heme are known to be chloroplast retrograde signals (Shimizu and Masuda, 2021; Woodson et al., 2011). It was found that many enzymes related to heme including genome uncoupled (GUN2 and GUN4) and uroporphyrinogen III synthase (UROS) were differentially present in the ef-g and EF-G-OX lines when compared to Col-0 (FIG. 7, Panel A). UROS catalyzes the formation of uroporphyrinogen III, an important tetrapyrrole compound that feeds into chlorophyll, heme, and siroheme biosynthesis (Tan et al., 2008). A marked decrease in the UROS level is correlated with the decreased chlorophyll content in ef-g (FIG. 7, Panels A and E). Consistent with this, nuclear encoded chlorophyll degradation proteins such as RCR and CLD1 were also differentially accumulated in ef-g and EF-G-OX lines when compared to Col-0 (FIG. 7, Panel A). Pentatricopeptide repeat (PPR) proteins are involved in chloroplast retrograde signaling (Barkanand Small, 2014; Zhang and Lu, 2019), and several PRR proteins were found differentially accumulated ef-g and EF-G-OX lines, including the maturation of RBCL1 (MRL1) that was highly abundant in EF-G-OX lines when compared to Col-0 (FIG. 7, Panel A). Photosynthetic reactive oxygen species (ROS) also act as a chloroplast retrograde signal (Exposito-Rodriguez et al., 2017). Superoxide dismutases involved in scavenging ROS were found to be differentially present in ef- g and EF-G-OX lines when compared to Col-0 (FIG.7, Panel A). Many proteins involved in signal transduction are also involved in chloroplast retrograde signaling (Wang et al., 2020), and many of these proteins, including chloroplast RNA polymerase subunits RPOA and RPOC1, were found to be differentially present in ef-g and EF-G-OX lines when compared to Col-0 (FIG.7, Panel A). Sugars are produced from photosynthesis in chloroplast and are also known as retrograde signals (Hausler et al., 2014), and sugars were found to be increased in EF-G-OX lines (FIG.3, Panel A). Overall, these results indicate that EF-G is involved in retrograde signaling that can affect plant metabolism and biomass.

[0076] Methods

[0077] Creating plant materials

[0078] T-DNA insertion lines SALK_025112C (ef-g1), SAIL_1144_C07 (ef-g2), SAIL_659_G09 (rab8D-1) and SALK_133413 (rab8D-2) in Arabidopsis Col-0 ecotype background were obtained from Arabidopsis Biological Resource Center (https: / / abrc.osu.edu / ). Homozygous T-DNA insertion lines were identified using PCR and knock down / out of transcript was confirmed with quantitative RT-PCR (RT-qPCR). For overexpression, Arabidopsis EF-G coding sequence (CDS) was PCR amplified from Col-0, cloned into pDONR207 and sub-cloned into pMDC32 vector (Curtis and Grossniklaus, 2003) with 2 X CaMV 35S promoter using Gateway technology (Thermo Fisher Scientific, Waltham, MA USA) and transformed into Arabidopsis plants using floral dip method (Clough and Bent, 1998). For creating EF-G-GFP lines, coding sequence of EF-G without stop codon of gene was PCR amplified from Arabidopsis cDNA and fused to GFP to create EF-G-GFP using pMDC83 vector (Curtis and Grossniklaus, 2003). HA tag at 3’ end of RAB8D CDS without stop codons was incorporated by PCR and cloned into pMDC32 vector.

[0079] Virus-Induced Gene Silencing (VIGS)

[0080] VIGS-based forward genetics screening was performed as described (Pant et al., 2020; Senthil-Kumar et al., 2013). TRV2:NbTI05A09 and TRV1 in Agrobacterium tumefaciens strain GV2260 were grown at 28 °C in Luria-Bertani (LB) medium containing rifampicin (10 mg / L) and kanamycin (50 mg / L). Three-week-old N. benthamiana plants were co-infiltrated with A. tumefaciens strains containing TRV1 and either TRV2-NbTI05A09 (TRV2-EF-G) or controls TRV2-GFP. TRV2-PDS was used as a positive control for VIGS as PDS (Phytoene desaturase) silencing leads to photobleaching phenotype. Three weeks after infiltration, upper leaves of TRV2-PDS plants were completely white showing that gene silencing has worked. Silencing of EF-G was further confirmed with RT-qPCR.

[0081] Quantitative proteomics analysis

[0082] Rosettes of 21 days old plants were harvested in cold and chloroplasts enrichment was done (Pant et al., 2020). Proteins were extracted from chloroplast enriched samples by homogenization in SDS buffer with heating at 65 °C for 20 minutes. Samples were centrifuged at 14,000 g for 10 minutes, and the supernatant was precipitated with 4V of ice-cold 5% TCA (w / v) in 100% acetone and washed thrice with 80% cold acetone. Pellet was dried and dissolved in SDS buffer. After EZQ protein quantification, in-gel digestion was performed for equal amount proteins from each sample. The digested peptides were purified by C18 ziptip, and analyzed by Bruker timsTOF pro mass spectrometer with 70 min LC gradient (with the help of Charles W. Gehrke Proteomics Center, Research Core Facilities, University of Missouri). Raw data was searched using PEAKS (version X+) with TAIR11 protein database (Dahal et al., 2016). Spectral counts for each protein in each genotype were used to quantify the relative amount of a protein in each genotype.

[0083] Subcellular localization of protein

[0084] Subcellular localization of proteins was done by fusing GFP at their C-terminal. Transgenic Arabidopsis plants transformed with EF-G-GFP using pMDC83 vector were visualized with the help of Leica TCS SP8-X White Light Laser Confocal with FLIM & Digital Light Sheet (https: / / www.leica-microsystems.com).

[0085] Immunoprecipitation of EF-G protein complex and protein mass spectrometric analysis to identify EF-G interactors

[0086] Arabidopsis plants expressing EF-G-GFP or empty vector pMDC83 (control) were grown under 8 hours light photoperiod at 22 °C day and 20 °C night. Protein was extracted by homogenizing tissue in extraction buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 10mM MgCl2, 5 mM EDTA, 0.1% Triton X-100, 0.2% Nonidet P-40) containing a proteinase inhibitor cocktail (Roche, Indianapolis, IN). Homogenates were centrifuged (14,000 g) for 15 minutes at 4 °C. Protein extracts from EF-G-GFP and empty vector pMDC83 transformed control were incubated overnight with GFP-Trap Agarose (Chromotek) at 4 °C. Unbound proteins were removed and agarose was washed three times with wash buffer (10 mM Tris pH7.5, 150 mM NaCl, 0.5 mM EDTA, 0.1 % SDS). EF-G-GFP and its interacting proteins were eluted using 100 mM Glycine (pH2.5). The immuno-precipitate was tested for the presence of EF-G-GFP using anti-GFP antibody with western blot analysis. For protein-MS, samples were precipitated with acetone and pellets were re-suspended in urea buffer and digested with trypsin. Peptides were purified using C18 tips and data was acquired by LC-MS on the LTQ Orbitrap XL (Charles W. Gehrke Proteomics Center, Research Core Facilities, University of Missouri). Peptides identified were searched against Arabidopsis database and NCBI-Viridiplantae using Sorcerer-Sequest (SageN Research Products) (Dahal et al., 2016). Pull-down with control was used to identify false positives that may bind to GFP tag or GFP-Trap Agarose. From EF-G interactor list, all the proteins that appeared in the control were omitted. This excludes the proteins that non-specifically bound to GFP tag or GFP-Trap Agarose or other things during immuno-affinity pull down. Interactors were classified into biological categories with MapMan (Thimm et al., 2004).

[0087] Co-immunoprecipitation (co-IP) assay

[0088] Co-IP assays were performed to confirm the interaction between EF-G and RAB8D. A. tumefaciens strain GV2260 containing EF-G-GFP was co-infiltrated with another A. tumefaciens strain GV2260 containing RAB8D-HA for transient expression in N. benthamiana. As negative controls, empty vector pMDC32 and free GFP transformed A. tumefaciens strain GV2260 were co-infiltrated. Protein was extracted after 72 hours as mentioned above. Protein extracts from different combinations were incubated overnight with GFP-Trap Agarose (Chromotek) at 4 °C. Unbound proteins were removed and agarose was washed three times with wash buffer. GFP- Trap Agarose bound proteins were eluted using 100 mM Glycine (pH 2.5) or Laemmli sample buffer. The immuno-precipitate was analyzed for the presence of EF-G-GFP by western blot analysis using anti-GFP antibody and the presence of interactor with anti-HA antibody.

[0089] GC-MS metabolite profiling

[0090] Col-0, ef-g1, EF-G-OX-2-1 and EF-G-OX-3-2 were grown under 8 hours light photoperiod at 22 °C day and 20 °C night for three weeks. Equal amount of frozen pulverized rosette was extracted with methanol, chloroform and water. Polar extracts of four replicates per genotype were dried and derivatized with methoxyamine hydrochloride in pyridine followed by trimethylsilyl derivatization using N-methyl-N-trimethylsilyltrifluoroacetamide and analyzed as reported previously (Broeckling et al., 2005; Pant et al., 2015). Mass spectra deconvolution, metabolite identification and data processing were performed using MSDIAL software (Tsugawa et al., 2015) and a custom, in-house metabolite library. Normalization was performed as described above and analyzed using Microsoft Excel.

[0091] CO2assimilation assay

[0092] CO2assimilation was measured using Li-6800 portable photosynthesis system (Li-Cor Inc. Lincoln, NE, USA) in fully expanded leaves of 4-week-old plants grown under 8-hour light. CO2assimilation rates were measured using CO2response program with loop over CO2values at CO2concentrations set at 400, 300, 200, 100, 50, 0, 400, 400, 600, 800, 1000 and 1200 µmol mol⁻¹. Other parameters were fan speed 10000rpm, light 1000umol m-2S-1, temperature 25°C, H2O relative humidity of air 50%. CO2assimilation rates were plotted against the internal CO2concentrations (Ci).

[0093] Chlorophyll quantification

[0094] Chlorophyll was extracted from leaf discs with 80% acetone by incubating at 22 °C to 25 °C for 24 hours. Absorbance of the supernatant was measured at wavelengths 645, 646, and 663 nm (A645, A646, and A663) with a Biotek Plate reader multimode (https: / / www.biotek.com). Chlorophyll concentrations were calculated based on the Lichtenthaler’s equations (Lichtenthaler and Wellburn, 1983). Chlorophylla (μg / mL) =−1.93A646+11.93A663. Chlorophyllb (μg / mL) =20.36A646−5.50A663.

[0095] Quantitative RT-PCR (RT-qPCR)

[0096] Plant samples were harvested in liquid nitrogen. Total RNA was isolated with RNeasy Mini Kit (Qiagen Inc, MD, USA) subjected to DNase I treatment using the TURBO DNA-free Kit (Thermo Fisher Scientific) and cDNA was synthesized using SuperScript III Reverse Transcriptase (Thermo Fisher Scientific) according to the manufacturer instructions. The cDNA quality was tested and expression of genes were quantified using a 7900HT Real-Time PCR System (Thermo Fisher Scientific). Expression levels were calculated as ΔΔCT(40-ΔCTof gene minus 40-ΔCTof no- cDNA control) on a log2scale. ΔCTis the difference between the CT(threshold cycle number) of a gene of interest and reference gene (Actin-2, AT3G18780).40 was taken as an integer as the RT-qPCR run stops after 40 cycles. Alternatively, fold change relative to control was calculated.

[0097] NADH / NAD+measurement assay

[0098] NADH / NAD+was measured using a colorimetric assay according to the manufacturer’s instructions (Abcam, ab221821). 20mg frozen pulverized plant material was extracted with 400ul extraction buffer. NAD+ was extracted with 0.5M perchloric acid for 30 minutes at 24 °C and neutralized with 0.55 M K2CO3neutralization buffer. NADH was extracted with 50mM NaOH containing 1mM EDTA at 60 °C for 30 minutes and neutralized with 0.3 M Potassium Phosphate Buffer (pH 7.4). Neutralized extracts were centrifuged, supernatant was taken and pH was adjusted with 7.5 to 8.5 using neutralization solutions. NADH standard solutions were prepared. Reactions were assembled in 96-well plate by adding samples, waterand NAD+ / NADH reaction mix. Output was measured at OD450 nm on a microplate reader. NAD+ / NADH concentration was calculated using NADH standard curve.

[0099] Quantification and statistical analysis

[0100] Statistical details of each experiment are given in figure legends. Student’s t-test values were calculated between the genotype or treatment compared to control using Microsoft Excel. The p-value ≤ 0.05 was considered statistically significant and has been represented with an Asterisk. NON-LIMITING ILLUSTRATIVE EMBODIMENTS

[0101] Illustrative Embodiment 1. A genetically modified plant comprising at least one modification from the natively occurring plant, wherein the at least one modification results in overexpression of at least one chloroplastic translation elongation factor-G (EF-G) protein.

[0102] Illustrative Embodiment 2. The genetically modified plant of Illustrative Embodiment 1, wherein the at least one modification is selected from the group consisting of insertion of a vector that constitutively or inducibly overexpresses at least one EF-G protein or an active fragment thereof; modification to an EF-G promoter to make it overexpress EF-G, substantially constitutively express EF-G, or inducibly express EF-G; addition of at least one enhancer element; addition of multiple copies of the vector encoding EF-G protein or an active fragment thereof; addition of multiple genomic integrations of a gene encoding the EF-G protein or an active fragment thereof; CRISPR activation (CRISPRa); cisgenics; transgenics; and combinations thereof.

[0103] Illustrative Embodiment 3. A recombinant plant, comprising: a vector that constitutively or inducibly overexpresses at least one chloroplastic translation elongation factor- G (EF-G) protein or an active fragment thereof, wherein the vector comprises: a DNA sequence encoding at least one chloroplastic translation elongation factor-G (EF-G) protein or an active fragment thereof; and at least one genetic control sequence that allows for over-expression of the DNA sequence.

[0104] Illustrative Embodiment 4. The recombinant plant of Illustrative Embodiment 3, wherein the at least one genetic control sequence of the vector allows for constitutive or inducible over-expression of the DNA sequence.

[0105] Illustrative Embodiment 5. The recombinant plant of Illustrative Embodiment 3 or 4, wherein the genetic control sequence comprises CaMV355 promoter.

[0106] Illustrative Embodiment 6. A genetically modified plant comprising at least one modification from the natively occurring plant, wherein the at least one modification results inoverexpression of at least one chloroplastic translation elongation factor-G (EF-G) protein.

[0107] Illustrative Embodiment 7. A crop comprising a plurality of the plants of any one of Illustrative Embodiments 1-6, planted together in an agricultural field.

[0108] Illustrative Embodiment 8. A commodity plant product comprising at least one modification from the natively occurring plant, wherein the at least one modification results in overexpression of at least one chloroplastic translation elongation factor-G (EF-G) protein.

[0109] Illustrative Embodiment 9. The plant, crop, or product of any of Illustrative Embodiments 1-18, wherein at least one of: the EF-G protein is selected from the group consisting of SEQ ID NOS: 1, 3, 5, 6, 8, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, and 35; the EF-G protein or active fragment thereof has at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity to at least one of SEQ ID NOS: 1, 3, 5, 6, 8, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, and 35 and / or a protein or active fragment encoded by at least one of SEQ ID NOS: 2, 4, 7, 9, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, and 34; and / or the EF-G protein or active fragment thereof has an amino acid sequence that differs from one or more of SEQ ID NOS: 1, 3, 5, 6, 8, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, and 35 by less than about 25 amino acids, less than about 24 amino acids, less than about 23 amino acids, less than about 22 amino acids, less than about 21 amino acids, less than about 20 amino acids, less than about 19 amino acids, less than about 18 amino acids, less than about 17 amino acids, less than about 16 amino acids, less than about 15 amino acids, less than about 14 amino acids, less than about 13 amino acids, less than about 12 amino acids, less than about 11 amino acids, less than about 10 amino acids, less than about 9 amino acids, less than about 8 amino acids, less than about 7 amino acids, less than about 6 amino acids, less than about 5 amino acids, less than about 4 amino acids, less than about 3 amino acids, less than about 2 amino acids, or less than about 1 amino acid.

[0110] Illustrative Embodiment 10. The plant, crop, or product of any of Illustrative Embodiments 1-9, wherein the plant comprises an agricultural crop plant.

[0111] Illustrative Embodiment 11. The plant, crop, or product of Illustrative Embodiment 10, wherein the agricultural crop plant comprises a food crop selected from the group consisting of fruit, vegetables, grains, and tubers.

[0112] Illustrative Embodiment 12. The plant, crop, or product of Illustrative Embodiment11, wherein the food crop plant is selected from the group consisting of sugarcane, wheat, tubers, vegetables, lentils, kelp, legumes, soybeans, rice, quinoa, potato, tomato, beans, spinach, lettuce, corn, oats, pea, turnip, maize, cassava, oil-palm fruit, sunflower, and sugar beet.

[0113] Illustrative Embodiment 13. The plant, crop, or product of any of Illustrative Embodiments 1-12, wherein the agricultural crop plant comprises a feed crop plant.

[0114] Illustrative Embodiment 14. The plant, crop, or product of Illustrative Embodiment 13, wherein the feed crop is selected from the group consisting of corn, barley, wheat, oats, alfalfa, forages (grasses), hays, silages, and combinations thereof.

[0115] Illustrative Embodiment 15. The plant, crop, or product of any of Illustrative Embodiments 1-14, wherein the agricultural crop plant comprises a fiber crop plant.

[0116] Illustrative Embodiment 15A. The plant, crop, or product of Illustrative Embodiment 15, wherein the fiber crop plant comprises cotton.

[0117] Illustrative Embodiment 16. The plant, crop, or product of any of Illustrative Embodiments 1-15, wherein the agricultural crop plant comprises a fuel crop plant.

[0118] Illustrative Embodiment 17. The plant, crop, or product of any of Illustrative Embodiments 1-16, wherein the agricultural crop plant comprises a grass selected from the group consisting of switchgrass, sorghum, miscanthus, poplar, wheatgrass, fescue, bamboo, reed canary grass, hybrid willow, and eastern cottonwood.

[0119] Illustrative Embodiment 18. The plant, crop, or product of any of Illustrative Embodiments 1-17, wherein the plant is selected from the group consisting of Arabidopsis thaliana, Nicotiana benthamiana, Oryza sativa, Triticum aestivum, Solanum lycopersicum, Solanum tuberosum, Beta vulgaris, Glycine max, Spinacia oleracea, Lactuca sativa, Helianthus annuus, Brassica rapa, Gossypium hirsutum, Manihot esculenta, Sorghum bicolor, Zea mays, Populus trichocarpa, Chenopodium quinoa, and Panicum virgatum.

[0120] Illustrative Embodiment 19. A method of increasing plant biomass and / or yield, comprising the step of: culturing the plant, crop, or product of any of Illustrative Embodiments 1-18 under conditions that produce a mature plant with increased biomass and / or yield compared to a mature, native (i.e., non-recombinant, non-genetically modified) plant.

[0121] Illustrative Embodiment 20. A method of increasing photosynthetic capacity, comprising the step of: culturing the plant, crop, or product of any of Illustrative Embodiments 1-18 under conditions that produce a mature plant with increased photosynthetic capacity compared to a mature, native (i.e., non-recombinant, non-genetically modified) plant.

[0122] Illustrative Embodiment 21. A method of increasing at least one biochemical propertyof a plant, comprising the step of: culturing the plant, crop, or product of any of claims 1-18 under conditions that produce a mature plant with at least one increased biochemical property compared to a mature, native (i.e., non-recombinant, non-genetically modified) plant; and wherein the at least one biochemical property is selected from the group consisting of photosynthetic CO2assimilation, plant metabolism, RuBisCO protein level, RuBisCO activase (RCA) level, starch synthesis and mobilization, cellular metabolism, any other biochemical properties disclosed or otherwise contemplated herein, and combinations thereof.

[0123] Illustrative Embodiment 22. A recombinant vector, comprising: a DNA sequence encoding at least one chloroplastic translation elongation factor-G (EF-G) protein or an active fragment thereof; and at least one genetic control sequence that allows for over-expression of the DNA sequence.

[0124] Illustrative Embodiment 23. The recombinant vector of Illustrative Embodiment 22, wherein at least one of: the EF-G protein is selected from the group consisting of SEQ ID NOS: 1, 3, 5, 6, 8, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, and 35; the EF-G protein or active fragment thereof has at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity to at least one of SEQ ID NOS: 1, 3, 5, 6, 8, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, and 35; the EF-G protein or active fragment thereof has an amino acid sequence that differs from one or more of SEQ ID NOS: 1, 3, 5, 6, 8, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, and 35 by less than about 25 amino acids, less than about 24 amino acids, less than about 23 amino acids, less than about 22 amino acids, less than about 21 amino acids, less than about 20 amino acids, less than about 19 amino acids, less than about 18 amino acids, less than about 17 amino acids, less than about 16 amino acids, less than about 15 amino acids, less than about 14 amino acids, less than about 13 amino acids, less than about 12 amino acids, less than about 11 amino acids, less than about 10 amino acids, less than about 9 amino acids, less than about 8 amino acids, less than about 7 amino acids, less than about 6 amino acids, less than about 5 amino acids, less than about 4 amino acids, less than about 3 amino acids, less than about 2 amino acids, or less than about 1 amino acid; the EF-G protein is encoded by a DNA sequence selected from the group consisting of SEQ ID NOS: 2, 4, 7, 9, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, and 34; and / or the EF-G protein or active fragment thereof is encoded by a DNA sequence that has at least about 80%, at least about 81%, at least about 82%,at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity to at least one of SEQ ID NOS: 2, 4, 7, 9, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, and 34.

[0125] Illustrative Embodiment 24. The recombinant vector of Illustrative Embodiment 22 or 23, wherein the genetic control sequence comprises CaMV355 promoter.

[0126] Illustrative Embodiment 25. A method, comprising the steps of: inserting the vector of any of Illustrative Embodiments 22-24 into at least one plant cell to provide at least one recombinant plant cell.

[0127] Illustrative Embodiment 26. A method of increasing plant biomass and / or yield, comprising the steps of: inserting the vector of any of Illustrative Embodiments 22-24 into at least one plant cell; and culturing the at least one plant cell under conditions that produce a mature plant with increased biomass and / or yield compared to a mature plant that does not contain the vector.

[0128] Illustrative Embodiment 27. A method of increasing photosynthetic capacity, comprising the steps of: inserting the vector of any of Illustrative Embodiments 22-24 into at least one plant cell; and culturing the at least one plant cell under conditions that produce a mature plant with increased photosynthetic capacity compared to a mature plant that does not contain the vector.

[0129] Illustrative Embodiment 28. A method of increasing at least one biochemical property of a plant, comprising the steps of: inserting the vector of any of Illustrative Embodiments 22-24 into at least one plant cell; and culturing the at least one plant cell under conditions that produce a mature plant with increased biomass compared to a mature plant that does not contain the vector.

[0130] Illustrative Embodiment 29. The method of Illustrative Embodiment 28, wherein the at least one biochemical property is selected from the group consisting of photosynthetic CO2assimilation, plant metabolism, RuBisCO protein level, RuBisCO small subunit 1A (RBCS1A) level, RuBisCO small subunit 1B (RBCS1B) level, RuBisCO activase (RCA) level, Photosystem II (PSB) reaction center protein H level, ATPase subunit ATPF level, starch synthesis and mobilization, cellular metabolism, any other biochemical properties disclosed or otherwise contemplated herein, and combinations thereof.

[0131] Illustrative Embodiment 30. A method, comprising: genetically modifying a plant cellso that the plant cell comprises at least one modification from a natively occurring plant cell, wherein the at least one modification results in overexpression of at least one chloroplastic translation elongation factor-G (EF-G) protein.

[0132] Illustrative Embodiment 31. A method of increasing plant biomass and / or yield, comprising the steps of: genetically modifying a plant cell so that the plant cell comprises at least one modification from a natively occurring plant cell, wherein the at least one modification results in overexpression of at least one chloroplastic translation elongation factor-G (EF-G) protein; and culturing the at least one plant cell under conditions that produce a mature plant with increased biomass and / or yield compared to a mature plant that has not been genetically modified.

[0133] Illustrative Embodiment 32. A method of increasing photosynthetic capacity, comprising the steps of: genetically modifying a plant cell so that the plant cell comprises at least one modification from a natively occurring plant cell, wherein the at least one modification results in overexpression of at least one chloroplastic translation elongation factor-G (EF-G) protein; and culturing the at least one plant cell under conditions that produce a mature plant with increased photosynthetic capacity compared to a mature plant that has not been genetically modified.

[0134] Illustrative Embodiment 33. A method of increasing at least one biochemical property of a plant, comprising the steps of: genetically modifying a plant cell so that the plant cell comprises at least one modification from a natively occurring plant cell, wherein the at least one modification results in overexpression of at least one chloroplastic translation elongation factor- G (EF-G) protein; and culturing the at least one plant cell under conditions that produce a mature plant with increased biomass compared to a mature plant that has not been genetically modified.

[0135] Illustrative Embodiment 34. The method of Illustrative Embodiment 33, wherein the at least one biochemical property is selected from the group consisting of photosynthetic CO2assimilation, plant metabolism, RuBisCO protein level, RuBisCO small subunit 1A (RBCS1A) level, RuBisCO small subunit 1B (RBCS1B) level, RuBisCO activase (RCA) level, Photosystem II (PSB) reaction center protein H level, ATPase subunit ATPF level, starch synthesis and mobilization, cellular metabolism, any other biochemical properties disclosed or otherwise contemplated herein, and combinations thereof.

[0136] Illustrative Embodiment 35. The method of any of Illustrative Embodiments 25-34, wherein the plant comprises an agricultural crop plant.

[0137] Illustrative Embodiment 36. The method of Illustrative Embodiment 35, wherein the agricultural crop plant comprises a food crop selected from the group consisting of fruit, vegetables, grains, and tubers.

[0138] Illustrative Embodiment 37. The method of Illustrative Embodiment 36, wherein the food crop plant is selected from the group consisting of sugarcane, wheat, tubers, vegetables, lentils, kelp, legumes, soybeans, rice, quinoa, potato, tomato, beans, spinach, lettuce, corn, oats, pea, turnip, maize, cassava, oil-palm fruit, sunflower, and sugar beet.

[0139] Illustrative Embodiment 38. The method of any of Illustrative Embodiments 25-37, wherein the agricultural crop plant comprises a feed crop plant.

[0140] Illustrative Embodiment 39. The method of Illustrative Embodiment 38, wherein the feed crop is selected from the group consisting of corn, barley, wheat, oats, alfalfa, forages (grasses), hays, silages, and combinations thereof.

[0141] Illustrative Embodiment 40. The method of any of Illustrative Embodiments 25-39, wherein the agricultural crop plant comprises a fiber crop plant.

[0142] Illustrative Embodiment 41. The method of any of Illustrative Embodiments 25-40, wherein the agricultural crop plant comprises a fuel crop plant.

[0143] Illustrative Embodiment 42. The method of any of Illustrative Embodiments 25-41, wherein the agricultural crop plant comprises a grass selected from the group consisting of switchgrass, sorghum, miscanthus, poplar, wheatgrass, fescue, bamboo, reed canary grass, hybrid willow, and eastern cottonwood.

[0144] Illustrative Embodiment 43. The method of any of Illustrative Embodiments 25-42, wherein the plant is Arabidopsis thaliana, Nicotiana benthamiana, Oryza sativa, Triticum aestivum, Solanum lycopersicum, Solanum tuberosum, Beta vulgaris, Glycine max, Spinacia oleracea, Lactuca sativa, Helianthus annuus, Brassica rapa, Gossypium hirsutum, Manihot esculenta, Sorghum bicolor, Zea mays, Populus trichocarpa, Chenopodium quinoa, and Panicum virgatum.

[0145] Thus, in accordance with the present disclosure, there have been provided devices, kits, and assemblies, as well as methods of producing and using same, which fully satisfy the objectives and advantages set forth herein. Although the present disclosure has been described in conjunction with the specific drawings, experimentation, results, and language set forth hereinabove, it is evident that many alternatives, modifications, and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications, and variations that fall within the spirit and broad scope of the present disclosure.REFERENCES

[0146] The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference. In addition, the following is not intended to be an Information Disclosure Statement; rather, an Information Disclosure Statement in accordance with the provisions of 37 CFR § 1.97 will be submitted separately. Albrecht, V., Ingenfeld, A., and Apel, K. (2006). Characterization of the snowy cotyledon 1 mutant of Arabidopsis thaliana: the impact of chloroplast elongation factor G on chloroplast development and plant vitality. Plant Mol Biol 60, 507-518.10.1007 / s11103-005-4921-0. Barkan, A., and Small, I. (2014). Pentatricopeptide Repeat Proteins in Plants. Annual review of plant biology 65, 415-442.10.1146 / annurev-arplant-050213-040159. Broeckling, C.D., Huhman, D.V., Farag, M.A., Smith, J.T., May, G.D., Mendes, P., Dixon, R.A., and Sumner, L.W. (2005). Metabolic profiling of Medicago truncatula cell cultures reveals the effects of biotic and abiotic elicitors on metabolism. J Exp Bot 56, 323-336. 10.1093 / jxb / eri058. Clough, S.J., and Bent, A.F. (1998). Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16, 735-743. Curtis, M.D., and Grossniklaus, U. (2003). A gateway cloning vector set for high-throughput functional analysis of genes in planta. Plant Physiol 133, 462-469.10.1104 / pp.103.027979. Dahal, D., Newton, K.J., and Mooney, B.P. (2016). Quantitative Proteomics of Zea mays Hybrids Exhibiting Different Levels of Heterosis. J Proteome Res 15, 2445-2454. 10.1021 / acs.jproteome.5b01120. Exposito-Rodriguez, M., Laissue, P.P., Yvon-Durocher, G., Smirnoff, N., and Mullineaux, P.M. (2017). Photosynthesis-dependent H2O2 transfer from chloroplasts to nuclei provides a high-light signalling mechanism. Nat Commun 8, 49.10.1038 / s41467-017-00074-w. Hausler, R.E., Heinrichs, L., Schmitz, J., and Flugge, U.I. (2014). How sugars might coordinate chloroplast and nuclear gene expression during acclimation to high light intensities. Mol Plant 7, 1121-1137.10.1093 / mp / ssu064. Lichtenthaler, H.K., and Wellburn, A.R. (1983). Determinations of total carotenoids and chlorophylls a and b of leaf extracts in different solvents. Biochemical Society Transactions 11, 591-592.10.1042 / bst0110591.Pant, B.D., Oh, S., Lee, H.K., Nandety, R.S., and Mysore, K.S. (2020). Antagonistic Regulation by CPN60A and CLPC1 of TRXL1 that Regulates MDH Activity Leading to Plant Disease Resistance and Thermotolerance. Cell Rep 33, 108512.10.1016 / j.celrep.2020.108512. Pant, B.D., Pant, P., Erban, A., Huhman, D., Kopka, J., and Scheible, W.R. (2015). Identification of primary and secondary metabolites with phosphorus status-dependent abundance in Arabidopsis, and of the transcription factor PHR1 as a major regulator of metabolic changes during phosphorus limitation. Plant Cell Environ 38, 172-187.10.1111 / pce.12378. Phua, S.Y., Yan, D., Chan, K.X., Estavillo, G.M., Nambara, E., and Pogson, B.J. (2018). The Arabidopsis SAL1-PAP Pathway: A Case Study for Integrating Chloroplast Retrograde, Light and Hormonal Signaling in Modulating Plant Growth and Development? Front Plant Sci 9, 1171.10.3389 / fpls.2018.01171. Schlapfer, P., Zhang, P., Wang, C., Kim, T., Banf, M., Chae, L., Dreher, K., Chavali, A.K., Nilo- Poyanco, R., Bernard, T., et al. (2017). Genome-Wide Prediction of Metabolic Enzymes, Pathways, and Gene Clusters in Plants. Plant Physiol 173, 2041-2059. 10.1104 / pp.16.01942. Senthil-Kumar, M., and Mysore, K.S. (2014). Tobacco rattle virus-based virus-induced gene silencing in Nicotiana benthamiana. Nat Protoc 9, 1549-1562.10.1038 / nprot.2014.092. Shimizu, T., and Masuda, T. (2021). The Role of Tetrapyrrole- and GUN1-Dependent Signaling on Chloroplast Biogenesis. Plants (Basel) 10.10.3390 / plants10020196. Stitt, M., and Zeeman, S.C. (2012). Starch turnover: pathways, regulation and role in growth. Curr Opin Plant Biol 15, 282-292.10.1016 / j.pbi.2012.03.016. Suganami, M., Suzuki, Y., Sato, T., and Makino, A. (2018). Relationship between Rubisco activase and Rubisco contents in transgenic rice plants with overproduced or decreased Rubisco content. Soil Science and Plant Nutrition 64, 352-359.10.1080 / 00380768.2018.1433455. Suzuki, Y., Ohkubo, M., Hatakeyama, H., Ohashi, K., Yoshizawa, R., Kojima, S., Hayakawa, T., Yamaya, T., Mae, T., and Makino, A. (2007). Increased Rubisco content in transgenic rice transformed with the 'sense' rbcS gene. Plant Cell Physiol 48, 626-637. 10.1093 / pcp / pcm035. Tan, F.C., Cheng, Q., Saha, K., Heinemann, I.U., Jahn, M., Jahn, D., and Smith, A.G. (2008). Identification and characterization of the Arabidopsis gene encoding the tetrapyrrole biosynthesis enzyme uroporphyrinogen III synthase. Biochem J 410, 291-299. 10.1042 / bj20070770.Thimm, O., Blasing, O., Gibon, Y., Nagel, A., Meyer, S., Kruger, P., Selbig, J., Muller, L.A., Rhee, S.Y., and Stitt, M. (2004). MAPMAN: a user-driven tool to display genomics data sets onto diagrams of metabolic pathways and other biological processes. Plant J 37, 914-939. Tsugawa, H., Cajka, T., Kind, T., Ma, Y., Higgins, B., Ikeda, K., Kanazawa, M., VanderGheynst, J., Fiehn, O., and Arita, M. (2015). MS-DIAL: data-independent MS / MS deconvolution for comprehensive metabolome analysis. Nat Methods 12, 523-526.10.1038 / nmeth.3393. Wang, Y., Selinski, J., Mao, C., Zhu, Y., Berkowitz, O., and Whelan, J. (2020). Linking mitochondrial and chloroplast retrograde signalling in plants. Philos Trans R Soc Lond B Biol Sci 375, 20190410.10.1098 / rstb.2019.0410. Woodson, J.D., Perez-Ruiz, J.M., and Chory, J. (2011). Heme synthesis by plastid ferrochelatase I regulates nuclear gene expression in plants. Curr Biol 21, 897-903. 10.1016 / j.cub.2011.04.004. Zhang, Y., and Lu, C. (2019). The Enigmatic Roles of PPR-SMR Proteins in Plants. Adv Sci (Weinh) 6, 1900361.10.1002 / advs.201900361.TABLE 1 SpecAccessArabido AT1G62 Rice, Or sativa / LOC_Os 490.1CAAGTTCGACGTCGTCCCACAGCACATCCAGAACGAGCTCTCTGCGGCGAAACAGGAGGAAGCTAGTACTGCTTAASpe Access O. sativ LOC_Os 490.1 Triticum aestivu Traes_2 7BCD21 T. aesti Traes_27BCD21C.1 EGYLEGKEPDEATVKRLIRKGTIGASFVPILCGSAFKNKGVQPLLDAVVDYLPSPLDLPPMKGTDPDDPELILERRPSDDEPFSGLAFKIMTDPYVGSLTFVRIYSGKLIAGSYVLNSNKSpe Access Tomato Solyc08 80.2.1 Solanu lycoper S. lycoper ITAG2.4 08g079AAGAATATATCCCTGGTGTTATGAAGGGATTAGAAGAATGCATGAGTAACGGAGTACTGGCAGGCTTTCCAGTTGTTGATGTTCGTGCTGTGCTAGTAGATGGATCTTACSpe Access Potato: Solanu tuberos v4.03, PGSC00 P40000 S. tuber v4.03, PGSC00 T40001CAAAAGAATATATTCCAGGTGTTATGAAGGGATTAGAAGAATGCATGAGTAACGGGGTACTGGCAGGCTTTCCCGTTGTTGATGTTCGTGCTGTGCTAGTAGATGGCTCTSpe Access Beet: B vulgaris EL10_1 Ac5g13 B. vulga EL10_1Ac5g13000.1 MIVTNLGAKPLVLQLPIGAEDSFKGVIDLVKMKAIVWSGEELGAKFNYEDIPEDLQELAADYRAQMIETIVEIDDEAMENYLEGNEPDEATIKKLIRKGTISASFVPVMCGSAFKNKSpe Access Soybea Glycine Wm82. Glyma. 500.1 G. max Wm82.. MIVTNLGAKPLVIQLPIGSEDNFKGVIDLVRNKAIVWSGEELGAKFDIVDVPEDLQEQAQEYRAQMIETIVEFDDQAMENYLEGIEPDEETIKKLIRKGTISASFVPVMCGSAFKNKSpe Access Glyma. 500.1.p Spinach Spinaci olerace Spov3| chr2.00 S. olera Spov3|chr2.00040 MIITNLGAKPCVIQLPIGSEENFKGIIDLVKMRAVVWSGEELGAKFNYEDIPADLQELAADYRAQLIETIVEIDDAAMENYLEGIEPDEETIKKLIRKGTISASFVPVMCGSAFKNKGVSpe Access Lettuce Lactuca V8|Lsat _gn_6_ 1 L. sativ V8|Lsat_ _ NLGAKPLVLQLPIGAEDVFKGVIDLVRMKAIVWGGEELGAKFSYEDIPSDLQELSEEYRALLVENIVELDDVVMEAYLEGVEPDEDTIKKLIRKGTIGGSFVPVLCGSAFKNKGVQPLSpe Access _gn_6_ 1 Sunflow Heliant annuus r1.2|Ha hr03g0 H. annu r1.2|Hahr03g0087971 NLGAKPLVLQLPIGAEDVFKGVIDLVRMKAIVWSGEELGAKFAYEDIPADLQELAEEYRALMLETIVELDDEVMEGYLEGVEPDEATVKRLIRKGTIGGSFVPVLCGSAFKNKGVQPSpe Access Turnip: Brassic FPsc v1.3|Br 431.1 B. rapa v1.3|Br431.1.p LGAKPLVLQIPIGAEDSFKGVVDLVRMKAIVWSGEELGAKFNYEDIPADLEELAQEYRAAMMELIVDLDDEVMENYLEGVEPDEATVKRLVRKGTITGKFVPILCGSAFKNKGVQPSpe Access Cotton: Gossypi hirsutu v2.1|G 1G0199 G. hirsu v2.1|G1G019900.1.p RDMIVTNLGAKPLVIQLPVGAEDNFKGVIDLVKMKAVLWSGEELGAKFEYADIPADLQELAEEYRSQMIETIVELDDQAMENYLEGVEPDEETIKKLIRKGTIGISFVPVLCGSAFKSpe Access Cassava Maniho esculen v6.1|M 2G0350 M. escu v6.1|M2G035000.1.p NFFRTRDMIVTNLGAKPLVIQLPVGSEDNFQGVIDIVKMKAILWSGEELGAKFEYADIPAELEELAQEYRALLIENIVELDDDVMEKYLEGVEPDEETIKQLIRKGTIASSFVPVLCGSSpe Access Sorghu Sorghu bicolor v3.1.1| 06G161 S. bicol v3.1.1|. MIVANLGAKPLVIQLPIGSEDNFQGVIDLVRMKAIVWTGEELGAKFEYKDIPDDLQELAQDYRVQMLETIIELDDEVMENYLEGTEPDEETVKKLIRKGTISASFVPVLCGSAFKNKSpe Access 06G161 p Maize: mays RefGen m0000 48_T00 Z. mays RefGen m000048_P001 AVVDYLPSPLDLPPMKGTDPEDPEILLERQPSDDEPFSGLAFKIMTDPFVGSLTFVRIYSGKLIAGSYVLNANKDKKERIGRLLEMHANSKEDIPVAVTGDIVALAGLKDTITGETLCDSpe Access Poplar: Populus trichoc v3.0|Po G11350 P. trich v3.0|Po G11350. VQPLLDAVIDYLPSPIDLPAMQGSDPENPEVTIERAATDDEPFAGLAFKIMTDSFVGSLTFVRVYSGKLSAGSYVMNANKGKKERIGRLLEMHANSREDVKVALTGDIVALAGLKDSpe Access Quinoa Chenop quinoa v1.0|A 7465-R C. quin v1.0|A 7465-RGVQPLLDAVVDYLPSPLELPPMKGSDPENPELEIEREPSDDAPFSGLAFKIMSDPFVGSLTFVRVYSGKLAAGSYVLNANKGKKERIGRLLEMHANSREDIKVALTGDIVALAGLKDSpe Access Switchg Panicu virgatu v5.1|Pa G25030 P. virga v5.1|Pa G25030. . LDAVVDYLPSPLDLPAMKGTDPEDPEVILERHPSDDEPFSGLAFKIMTDPFVGSLTFVRIYSGKLVAGSYVLNANKDKKERIGRLLEMHANSKEDITVAVTGDIVALAGLKDTITGETSpe Access

Claims

CLAIMS 1. A genetically modified plant comprising at least one modification from the natively occurring plant, wherein the at least one modification results in overexpression of at least one chloroplastic translation elongation factor-G (EF-G) protein.

2. A recombinant plant, comprising: a vector that constitutively or inducibly overexpresses at least one chloroplastic translation elongation factor-G (EF-G) protein or an active fragment thereof, wherein the vector comprises: a DNA sequence encoding at least one chloroplastic translation elongation factor- G (EF-G) protein or an active fragment thereof; and at least one genetic control sequence that allows for over-expression of the DNA sequence.

3. The plant of claim 2, wherein the at least one genetic control sequence of the vector allows for constitutive or inducible over-expression of the DNA sequence.

4. The plant of claim 2, wherein the genetic control sequence comprises CaMV355 promoter.

5. The plant of claim 1 or 2, wherein at least one of: the EF-G protein or active fragment thereof is selected from the group consisting of SEQ ID NOS: 1, 3, 5, 6, 8, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, and 35; the EF-G protein or active fragment thereof has at least about 85% identity to at least one of SEQ ID NOS: 1, 3, 5, 6, 8, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, and 35; the EF-G protein or active fragment thereof has an amino acid sequence that differs from one or more of SEQ ID NOS: 1, 3, 5, 6, 8, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, and 35 by less than about 25 amino acids.; the EF-G protein is encoded by a DNA sequence selected from the group consisting of SEQ ID NOS: 2, 4, 7, 9, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, and 34; and / orthe EF-G protein or active fragment thereof is encoded by a DNA sequence that has at least about 85% identity to at least one of SEQ ID NOS: 2, 4, 7, 9, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, and 34.

6. The plant of claim 1 or 2, wherein the plant comprises an agricultural crop plant.

7. The plant of claim 6, wherein the agricultural crop plant comprises a food crop selected from the group consisting of fruit, vegetables, grains, and tubers.

8. The plant of claim 7, wherein the food crop plant is selected from the group consisting of sugarcane, wheat, tubers, vegetables, lentils, kelp, legumes, soybeans, rice, quinoa, potato, corn, oats, pea, maize, cassava, oil-palm fruit, and sugar beet.

9. The plant of claim 1 or 2, wherein the agricultural crop plant comprises a feed crop plant.

10. The plant of claim 9, wherein the feed crop is selected from the group consisting of corn, barley, wheat, oats, alfalfa, forages (grasses), hays, silages, and combinations thereof.

11. The plant of claim 1 or 2, wherein the agricultural crop plant comprises a fiber crop plant.

12. The plant of claim 1 or 2, wherein the agricultural crop plant comprises a fuel crop plant.

13. The plant of claim 1 or 2, wherein the agricultural crop plant comprises a grass crop plant.

14. The plant of claim 13, wherein the grass crop plant is selected from the group consisting of switchgrass, sorghum, miscanthus, poplar, wheatgrass, fescue, bamboo, reed canary grass, hybrid willow, and eastern cottonwood.

15. A crop comprising a plurality of the plants of any one of claims 1-14, planted together in an agricultural field.

16. A commodity plant product comprising at least one modification from the natively occurring plant, wherein the at least one modification results in overexpression of a chloroplastic translation elongation factor-G (EF-G) protein.

17. A method of increasing plant biomass and / or yield, comprising the step of: culturing the plant of any one of claims 1-16 under conditions that produce a mature plant with increased biomass and / or yield compared to a mature, non- recombinant plant.

18. A method of increasing photosynthetic capacity, comprising the step of: culturing the plant of any one of claims 1-16 under conditions that produce a mature plant with increased photosynthetic capacity compared to a mature, non- recombinant plant.

19. A method of increasing at least one biochemical property of a plant, comprising the step of: culturing the plant of any one of claims 1-16 under conditions that produce a mature plant with at least one increased biochemical property compared to a mature, non-recombinant plant; and wherein the at least one biochemical property is selected from the group consisting of photosynthetic CO2assimilation, plant metabolism, RuBisCO protein level, RuBisCO activase (RCA) level, starch synthesis and mobilization, cellular metabolism, any other biochemical properties disclosed or otherwise contemplated herein, and combinations thereof.

Citation Information

Patent Citations

  • Isolated polynucleotides and polypeptides and methods of using same for increasing plant yield, biomass, growth rate, vigor, oil content, abiotic stress tolerance of plants and nitrogen use efficiency

    WO2012150598A2

  • Controlling citrus huanglongbing (HLB) by mitigating cell death of the phloem tissues caused by candidatus liberibacter asiaticus (CLAS) by suppressing reactive oxygen species (ROS)

    WO2023081782A2