Double-stranded ribonucleic acid targeting pnpla3

Abstract

A double-stranded ribonucleic acid targeting PNPLA3. Specifically, provided is a double-stranded ribonucleic acid targeting a patatin-like phospholipase-domain-containing protein 3, a pharmaceutically acceptable salt thereof or a ligand conjugate thereof. Further provided are a pharmaceutical composition containing the double-stranded ribonucleic acid, the pharmaceutically acceptable salt thereof or the ligand conjugate thereof, and the use of the double-stranded ribonucleic acid, pharmaceutically acceptable salt thereof or ligand conjugate thereof in treatment.

Description

Double-stranded ribonucleic acid targeting PNPLA3

[0001] REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to and the benefit of Chinese Patent Application No. 202410720037.5, filed on June 04, 2024, in the State Intellectual Property Office of the People’s Republic of China, the entire contents of which are incorporated herein by reference in their entirety. TECHNICAL FIELD

[0003] The present application belongs to the field of biological medicine, and relates to a double-stranded ribonucleic acid (dsRNA) targeting PNPLA3, a pharmaceutically acceptable salt thereof, a ligand conjugate thereof, or a pharmaceutical composition thereof, which can be used for inhibiting PNPLA3. BACKGROUND

[0004] Nonalcoholic fatty liver disease (NAFLD) is a disease in which the liver fat content exceeds 5% and is excluded from alcohol and other special pathogen infections. With the in-depth of basic research, especially the recent discovery of human gene mutations, many new pathogenesis and targets have been provided for the research and development of new drugs for nonalcoholic steatohepatitis (NASH). NASH is highly related to genetic background, and the incidence rate has regional and ethnic differences. Genome-wide association study (GWAS) found that the gene mutation (I148M) of Patatin-like phospholipase domain protein 3 (PNPLA3) is common in populations with high incidence of fatty liver, and is the strongest gene mutation associated with NASH so far.

[0005] PNPLA3 is highly expressed in the liver, especially in hepatocytes, has the function of hydrolyzing retinoic acid esters, and mediates the rate-limiting step in the hydrolysis and metabolism of triglycerides. Free fatty acids are the core of the pathogenesis of NASH. Free fatty acids derived from the lipolysis of triglycerides in adipose tissue flow to the liver through the blood. Lipid droplet triglycerides release fatty acids back into the liver free fatty acid pool by regulating lipolysis. PNPLA3 is involved in this lipolysis process, and the single nucleotide mutant of PNPLA3 is closely related to the development of NASH, thus reflecting the importance of this lipolysis regulation. When the isoleucine at position 148 of PNPLA3 is mutated to methionine, it interferes with the entry of lipid substrates into its catalytic lipid hydrolysis domain, disrupting the lipid hydrolysis function of PNPLA3. When fatty acids are destroyed by oxidation or triglyceride formation, fatty acids can cause the formation of lipotoxic substances, leading to endoplasmic reticulum stress, oxidative stress, and activation of inflammasomes. These processes are related to the phenotypic changes of NASH, including hepatocyte damage, inflammation, activation of stellate cells, and progressive accumulation of excess extracellular matrix. According to research, about 50% of NASH patients have the I148M gene mutation phenotype of PNPLA3, and I148M patients are more likely to have liver cell fibrosis and higher mortality from liver disease. There is no drug targeting PNPLA3 on the market for the treatment of NASH, but there is an antisense oligonucleotide drug that is actively undergoing phase II clinical pharmacodynamic evaluation, and no serious adverse side effects have been reported, indicating that this target has good safety for the treatment of NASH. In summary, PNPLA3 may be an effective and low-toxicity drug target for NASH.

[0006] Small interfering RNA (siRNA) can inhibit or block the translation or transcription of target genes in a sequence-specific manner to inhibit target gene expression based on the RNA interference (RNAi) mechanism, and exert an inhibitory effect from the mRNA level, thereby achieving the purpose of treating diseases.

[0007] SUMMARY

[0008] In one aspect, the present application provides a double-stranded ribonucleic acid (dsRNA), a pharmaceutically acceptable salt thereof, or a ligand conjugate thereof, which targets PNPLA3 mRNA, the dsRNA comprising a sense strand and an antisense strand, the sense strand having a length of no more than 21 nucleotides, the antisense strand having a length of no more than 23 nucleotides, and any nucleotide of the sense strand or the antisense strand being optionally modified.

[0009] In one aspect, the present application provides a double-stranded ribonucleic acid (dsRNA), a pharmaceutically acceptable salt thereof, or a ligand conjugate thereof, the dsRNA comprising a sense strand and an antisense strand, the sense strand comprising at least 15 consecutive nucleotides of a nucleotide sequence as set forth in SEQ ID NO. 1, SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 7, SEQ ID NO. 9, SEQ ID NO. 11, SEQ ID NO. 25, SEQ ID NO. 29, SEQ ID NO. 33, or SEQ ID NO. 39 and the length of the sense strand is no more than 21 nucleotides, the antisense strand comprising at least 15 consecutive nucleotides of a nucleotide sequence as set forth in SEQ ID NO. 2, SEQ ID NO. 4, SEQ ID NO. 6, SEQ ID NO. 8, SEQ ID NO. 10, SEQ ID NO. 12, SEQ ID NO. 26, SEQ ID NO. 30, SEQ ID NO. 34, SEQ ID NO. 37, SEQ ID NO. 40, SEQ ID NO. 43, or SEQ ID NO. 45 and the length of the antisense strand is no more than 23 nucleotides:

[0010] sense strand: 5'-CUUGCUACCCAUUAGGAUX 1 -3' (SEQ ID NO. 29),

[0011] antisense strand: 5'-Y 1 AUCCUAAUGGGUAGCAAGY 2 Y 3 -3' (SEQ ID NO. 30);

[0012] sense strand: 5'-CCUUCAACUUAAGCAAGUU-3' (SEQ ID NO. 1),

[0013] antisense strand: 5'-AACUUGCUUAAGUUGAAGGAU-3' (SEQ ID NO. 2);

[0014] sense strand: 5'-CCACCAGCUCAUCUCCGGC-3' (SEQ ID NO. 3),

[0015] antisense strand: 5'-GCCGGAGAUGAGCUGGUGGAC-3' (SEQ ID NO. 4);

[0016] sense strand: 5'-CGAGGAUAUUUGGAUGCAU-3' (SEQ ID NO. 5),

[0017] Sense: 5 '-AUGCAUCCAAAUAUCCUCGAA- 3'(SEQ ID NO. 1);

[0018] Sense: 5 '-AUGCAUCCAAAUAUCCUCGAA- 3'(SEQ ID NO. 1),

[0019] Sense: 5 '-AUGCAUCCAAAUAUCCUCGAA- 3'(SEQ ID NO. 1);

[0020] Sense: 5 '-AUGCAUCCAAAUAUCCUCGAA- 3'(SEQ ID NO. 1),

[0021] Sense: 5 '-AUGCAUCCAAAUAUCCUCGAA- 3'(SEQ ID NO. 1);

[0022] Sense: 5 '-AUGCAUCCAAAUAUCCUCGAA- 3'(SEQ ID NO. 1),

[0023] Sense: 5 '-AUGCAUCCAAAUAUCCUCGAA- 3'(SEQ ID NO. 1);

[0024] Sense: 5 '-AUGCAUCCAAAUAUCCUCGAA- 3'(SEQ ID NO. 1),

[0025] Sense: 5 '-AUGCAUCCAAAUAUCCUCGAA- 3'(SEQ ID NO. 1);

[0026] Sense: 5 '-AUGCAUCCAAAUAUCCUCGAA- 3'(SEQ ID NO. 1),

[0027] Sense: 5 '-AUGCAUCCAAAUAUCCUCGAA- 3'(SEQ ID NO. 1);

[0028] Sense: 5 '-AUGCAUCCAAAUAUCCUCGAA- 3'(SEQ ID NO. 1),

[0029] Sense: 5 '-AUGCAUCCAAAUAUCCUCGAA- 3'(SEQ ID NO. 1);

[0030] Sense: 5 '-AUGCAUCCAAAUAUCCUCGAA- 3'(SEQ ID NO. 1),

[0031] Sense: 5 '-AAUCCUAAUGGGUAGCAAGAU- 3'(SEQ ID NO. 39),

[0032] Sense: 5 '-AAUCCUAAUGGGUAGCAAGAU- 3'(SEQ ID NO. 39),

[0033] Sense: 5 '-AAUCCUAAUGGGUAGCAAGAU- 3'(SEQ ID NO. 39),

[0034] Sense: 5 '-AAUCCUAAUGGGUAGCAAGAU- 3'(SEQ ID NO. 39),

[0035] Sense: 5 '-AAUCCUAAUGGGUAGCAAGAU- 3'(SEQ ID NO. 39),

[0036] the X 1 , Y 1 , Y 2 or Y 3 are each independently selected from A, U, C, or G,

[0037] the sense strand or the antisense strand is optionally modified.

[0038] In another aspect, the present application provides a pharmaceutical composition comprising the dsRNA, the pharmaceutically acceptable salt thereof, or the ligand conjugate thereof of the present application; and a pharmaceutically acceptable carrier or excipient.

[0039] In another aspect, the present application provides a kit for treating and / or preventing a PNPLA3-mediated disease, comprising the dsRNA, the pharmaceutically acceptable salt thereof, the ligand conjugate thereof, or the pharmaceutical composition thereof of the present application; and optionally an instruction for use.

[0040] In another aspect, the present application provides a method for treating and / or preventing a PNPLA3-mediated disease, comprising administering to a subject (hereinafter also referred to as a test subject) the dsRNA, the pharmaceutically acceptable salt thereof, the ligand conjugate thereof, or the pharmaceutical composition thereof of the present application.

[0041] In some embodiments, the method comprises administering to the subject an effective amount of a dsRNA of the application, or a pharmaceutically acceptable salt thereof, a ligand conjugate thereof, or a pharmaceutical composition thereof. In specific embodiments, the method comprises administering to the subject a therapeutically and / or prophylactically effective amount of a dsRNA of the application, or a pharmaceutically acceptable salt thereof, a ligand conjugate thereof, or a pharmaceutical composition thereof. In some embodiments, the method comprises administering to a subject in need thereof an effective amount of a dsRNA of the application, or a pharmaceutically acceptable salt thereof, a ligand conjugate thereof, or a pharmaceutical composition thereof. In specific embodiments, the method comprises administering to a subject in need thereof a therapeutically and / or prophylactically effective amount of a dsRNA of the application, or a pharmaceutically acceptable salt thereof, a ligand conjugate thereof, or a pharmaceutical composition thereof.

[0042] In another aspect, the application provides use of a dsRNA of the application, a pharmaceutically acceptable salt thereof, a ligand conjugate thereof, or a pharmaceutical composition thereof, in the manufacture of a medicament for treating and / or preventing a PNPLA3-mediated disease.

[0043] In another aspect, the application provides use of a dsRNA of the application, a pharmaceutically acceptable salt thereof, a ligand conjugate thereof, or a pharmaceutical composition thereof, in treating and / or preventing a PNPLA3-mediated disease.

[0044] In another aspect, the application provides a dsRNA of the application, a pharmaceutically acceptable salt thereof, a ligand conjugate thereof, or a pharmaceutical composition thereof, for use in treating and / or preventing a PNPLA3-mediated disease.

[0045] In some embodiments, the PNPLA3-mediated disease comprises nonalcoholic fatty liver disease.

[0046] In some embodiments, the PNPLA3-mediated disease comprises liver simple fatty liver (steatosis), nonalcoholic steatohepatitis, cirrhosis (irreversible late-stage scarring of the liver), or PNPLA3-related obesity.

[0047] In some embodiments, a dsRNA of the application, a pharmaceutically acceptable salt thereof, a ligand conjugate thereof, or a pharmaceutical composition thereof, is used as a monotherapy for treating and / or preventing a PNPLA3-mediated disease.

[0048] In some embodiments, a dsRNA of the application, a pharmaceutically acceptable salt thereof, a ligand conjugate thereof, or a pharmaceutical composition thereof, is used in combination with other therapeutic agents for treating and / or preventing a PNPLA3-mediated disease.

[0049] DETAILED DESCRIPTION

[0050] The exemplary embodiments of the present application will be described below, but those skilled in the art will understand that the scope of protection of the present application is not limited thereto, but various modifications, modifications or changes based on the spirit and concept of the present application can be made, and the contents after the modifications, modifications or changes still fall within the scope of the present application.

[0051] In an aspect, the present application provides a double-stranded ribonucleic acid (dsRNA), a pharmaceutically acceptable salt thereof or a ligand conjugate thereof, which targets PNPLA3 mRNA, the dsRNA comprising a sense strand and an antisense strand, the sense strand having a length of no more than 21 nucleotides, the antisense strand having a length of no more than 23 nucleotides, any nucleotide of the sense strand or the antisense strand being optionally modified.

[0052] The present application provides a double-stranded ribonucleic acid (dsRNA), a pharmaceutically acceptable salt thereof or a ligand conjugate thereof, the dsRNA comprising a sense strand and an antisense strand, the sense strand containing at least 15 consecutive nucleotides of a nucleotide sequence as set forth in SEQ ID NO. 1, SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 7, SEQ ID NO. 9, SEQ ID NO. 11, SEQ ID NO. 25, SEQ ID NO. 29, SEQ ID NO. 33 or SEQ ID NO. 39 and the sense strand having a length of no more than 21 nucleotides, the antisense strand containing at least 15 consecutive nucleotides of a nucleotide sequence as set forth in SEQ ID NO. 2, SEQ ID NO. 4, SEQ ID NO. 6, SEQ ID NO. 8, SEQ ID NO. 10, SEQ ID NO. 12, SEQ ID NO. 26, SEQ ID NO. 30, SEQ ID NO. 34, SEQ ID NO. 37, SEQ ID NO. 40, SEQ ID NO. 43 or SEQ ID NO. 45 and the antisense strand having a length of no more than 23 nucleotides:

[0053] sense strand: 5'-CUUGCUACCCAUUAGGAUX 1 -3' (SEQ ID NO. 29),

[0054] antisense strand: 5'-Y 1 AUCCUAAUGGGUAGCAAGY 2 Y 3 -3' (SEQ ID NO. 30);

[0055] sense strand: 5'-CCUUCAACUUAAGCAAGUU-3' (SEQ ID NO. 1),

[0056] Antisense chain: 5'-AACUUGCUUAAGUUGAAGGAU-3' (SEQ ID NO.2);

[0057] Chain of Justice: 5'-CCACCAGCUCAUCUCCGGC-3' (SEQ ID NO.3)

[0058] Antisense chain: 5'-GCCGGAGAUGAGCUGGUGGAC-3' (SEQ ID NO.4);

[0059] Chain of Justice: 5'-CGAGGAUAUUUGGAUGCAU-3' (SEQ ID NO.5)

[0060] Antisense chain: 5'-AUGCAUCCAAAUAUCCUCGAA-3' (SEQ ID NO.6);

[0061] Chain of Justice: 5'-AAGGGAUGGAUCCUGAGGU-3' (SEQ ID NO.7)

[0062] Antisense chain: 5'-ACCUCAGGAUCCAUCCCUUCU-3' (SEQ ID NO.8);

[0063] Chain of Justice: 5'-CUACAGCACUGAGUGAAGA-3' (SEQ ID NO.9)

[0064] Antisense chain: 5'-UCUUCACUCAGUGCUGUAGCG-3' (SEQ ID NO.10);

[0065] Chain of Justice: 5'-AGGUGGUCUGCAAAGAUGA-3' (SEQ ID NO.11)

[0066] Antisense chain: 5'-UCAUCUUUGCAGACCACCUGA-3' (SEQ ID NO.12);

[0067] Chain of Justice: 5'-UUUGCAACUUGCUACCCAU-3' (SEQ ID NO.25)

[0068] Antisense chain: 5'-AUGGGUAGCAAGUUGCAAAUC-3' (SEQ ID NO.26);

[0069] Chain of Justice: 5'-CUUGCUACCCAUUAGGAUA-3' (SEQ ID NO.33)

[0070] Sense: 5'- CUGCUACCCAUUAGGAUA -3' (SEQ ID NO. 33),

[0071] Sense: 5'- CUGCUACCCAUUAGGAUA -3' (SEQ ID NO. 33),

[0072] Sense: 5'- CUGCUACCCAUUAGGAUA -3' (SEQ ID NO. 33),

[0073] Sense: 5'- CUGCUACCCAUUAGGAUA -3' (SEQ ID NO. 33),

[0074] Sense: 5'- CUGCUACCCAUUAGGAUA -3' (SEQ ID NO. 33),

[0075] Sense: 5'- CUGCUACCCAUUAGGAUA -3' (SEQ ID NO. 33),

[0076] Sense: 5'- CUGCUACCCAUUAGGAUA -3' (SEQ ID NO. 33),

[0077] Sense: 5'- CUGCUACCCAUUAGGAUA -3' (SEQ ID NO. 33),

[0078] Sense: 5'- CUGCUACCCAUUAGGAUA -3' (SEQ ID NO. 33),

[0079] the X 1 , Y 1 , Y 2 or Y 3 are each independently selected from A, U, C, or G,

[0080] the sense or antisense strand is optionally modified.

[0081] In some embodiments, the sense strand contains at least 15 contiguous nucleotides from a nucleotide sequence as set forth in SEQ ID NO. 1, SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 7, SEQ ID NO. 9, SEQ ID NO. 11, SEQ ID NO. 25, SEQ ID NO. 29, SEQ ID NO. 33, or SEQ ID NO. 39 and the sense strand is no more than 21 nucleotides in length, wherein the at least 15 contiguous nucleotides can be selected from 15, 16, 17, 18, or 19 contiguous nucleotides.

[0082] In some embodiments, the antisense strand contains at least 15 contiguous nucleotides from a nucleotide sequence as set forth in SEQ ID NO. 2, SEQ ID NO. 4, SEQ ID NO. 6, SEQ ID NO. 8, SEQ ID NO. 10, SEQ ID NO. 12, SEQ ID NO. 26, SEQ ID NO. 30, SEQ ID NO. 34, SEQ ID NO. 37, SEQ ID NO. 40, SEQ ID NO. 43, or SEQ ID NO. 45 and the antisense strand is no more than 23 nucleotides in length, wherein the at least 15 contiguous nucleotides can be selected from 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides.

[0083] In some embodiments, the sense strand contains at least 15 contiguous nucleotides from a nucleotide sequence as set forth in SEQ ID NO. 33 and the sense strand is no more than 21 nucleotides in length, wherein the at least 15 contiguous nucleotides can be selected from 15, 16, 17, 18, or 19 contiguous nucleotides.

[0084] In some embodiments, the antisense strand contains at least 15 contiguous nucleotides from a nucleotide sequence as set forth in SEQ ID NO. 34 and the antisense strand is no more than 23 nucleotides in length, wherein the at least 15 contiguous nucleotides can be selected from 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides.

[0085] In some embodiments, the present application provides a double stranded ribonucleic acid (dsRNA), a pharmaceutically acceptable salt thereof, or a ligand conjugate thereof, the dsRNA comprising a sense strand having a nucleotide sequence as set forth in SEQ ID NO. 1, SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 7, SEQ ID NO. 9, SEQ ID NO. 11, SEQ ID NO. 25, SEQ ID NO. 29, SEQ ID NO. 33, or SEQ ID NO. 39 and the sense strand has a length of no more than 21 nucleotides, and an antisense strand having a nucleotide sequence as set forth in SEQ ID NO. 2, SEQ ID NO. 4, SEQ ID NO. 6, SEQ ID NO. 8, SEQ ID NO. 10, SEQ ID NO. 12, SEQ ID NO. 26, SEQ ID NO. 30, SEQ ID NO. 34, SEQ ID NO. 37, SEQ ID NO. 40, SEQ ID NO. 43, or SEQ ID NO. 45 and the antisense strand has a length of no more than 23 nucleotides:

[0086] sense strand: 5'-CUUGCUACCCAUUAGGAUX 1 -3' (SEQ ID NO. 29),

[0087] antisense strand: 5'-Y 1 AUCCUAAUGGGUAGCAAGY 2 Y 3 -3' (SEQ ID NO. 30);

[0088] sense strand: 5'-CCUUCAACUUAAGCAAGUU-3' (SEQ ID NO. 1),

[0089] antisense strand: 5'-AACUUGCUUAAGUUGAAGGAU-3' (SEQ ID NO. 2);

[0090] sense strand: 5'-CCACCAGCUCAUCUCCGGC-3' (SEQ ID NO. 3),

[0091] antisense strand: 5'-GCCGGAGAUGAGCUGGUGGAC-3' (SEQ ID NO. 4);

[0092] sense strand: 5'-CGAGGAUAUUUGGAUGCAU-3' (SEQ ID NO. 5),

[0093] Sense: 5 '-AAAGAUGUUGUUGUUGCUUCU- 3'(SEQ ID NO. 1),

[0094] Sense: 5 '-AAAGAUGUUGUUGUUGCUUCU- 3'(SEQ ID NO. 1),

[0095] Sense: 5 '-AAAGAUGUUGUUGUUGCUUCU- 3'(SEQ ID NO. 1),

[0096] Sense: 5 '-AAAGAUGUUGUUGUUGCUUCU- 3'(SEQ ID NO. 1),

[0097] Sense: 5 '-AAAGAUGUUGUUGUUGCUUCU- 3'(SEQ ID NO. 1),

[0098] Sense: 5 '-AAAGAUGUUGUUGUUGCUUCU- 3'(SEQ ID NO. 1),

[0099] Sense: 5 '-AAAGAUGUUGUUGUUGCUUCU- 3'(SEQ ID NO. 1),

[0100] Sense: 5 '-AAAGAUGUUGUUGUUGCUUCU- 3'(SEQ ID NO. 1),

[0101] Sense: 5 '-AAAGAUGUUGUUGUUGCUUCU- 3'(SEQ ID NO. 1),

[0102] Sense: 5 '-AAAGAUGUUGUUGUUGCUUCU- 3'(SEQ ID NO. 1),

[0103] Sense: 5 '-AAAGAUGUUGUUGUUGCUUCU- 3'(SEQ ID NO. 1),

[0104] Sense: 5 '-AAAGAUGUUGUUGUUGCUUCU- 3'(SEQ ID NO. 1),

[0105] Sense: 5 '-AAAGAUGUUGUUGUUGCUUCU- 3'(SEQ ID NO. 1),

[0106] Sense: 5 '-AAAGAUGUUGUUGUUGCUUCU- 3'(SEQ ID NO. 1),

[0107] sense: 5 '-AAUCCUAAUGGGUAGCAAGAU- 3'(SEQ ID NO. 40);

[0108] sense: 5 '-CUUGCUACCCAUUAGGAUU- 3'(SEQ ID NO. 39),

[0109] antisense: 5 '-AAUCCUAAUGGGUAGCAAGCG- 3'(SEQ ID NO. 43);

[0110] sense: 5 '-CUUGCUACCCAUUAGGAUU- 3'(SEQ ID NO. 39),

[0111] antisense: 5 '-AAUCCUAAUGGGUAGCAAGUC- 3'(SEQ ID NO. 45);

[0112] the X 1 , Y 1 , Y 2 or Y 3 are each independently selected from A, U, C, or G,

[0113] the sense strand or the antisense strand is optionally modified.

[0114] In some embodiments, the present application provides a double-stranded ribonucleic acid (dsRNA), a pharmaceutically acceptable salt thereof, or a ligand conjugate thereof, comprising a sense strand and an antisense strand, the nucleotide sequence of the sense strand is a nucleotide sequence as set forth in SEQ ID NO. 1, SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 7, SEQ ID NO. 9, SEQ ID NO. 11, SEQ ID NO. 25, SEQ ID NO. 29, SEQ ID NO. 33, or SEQ ID NO. 39, the nucleotide sequence of the antisense strand is a nucleotide sequence as set forth in SEQ ID NO. 2, SEQ ID NO. 4, SEQ ID NO. 6, SEQ ID NO. 8, SEQ ID NO. 10, SEQ ID NO. 12, SEQ ID NO. 26, SEQ ID NO. 30, SEQ ID NO. 34, SEQ ID NO. 37, SEQ ID NO. 40, SEQ ID NO. 43, or SEQ ID NO. 45:

[0115] sense: 5 '-CUUGCUACCCAUUAGGAUX 1 -3'(SEQ ID NO. 29),

[0116] Sense: 5 '- 1 AUCCUAAUGGGUAGCAAGY 2 Y 3 -3'(SEQ ID NO. 30);

[0117] Sense: 5 '-

[0118] Antisense: 5 '-

[0119] Sense: 5 '-

[0120] Antisense: 5 '-

[0121] Sense: 5 '-

[0122] Antisense: 5 '-

[0123] Sense: 5 '-

[0124] Antisense: 5 '-

[0125] Sense: 5 '-

[0126] Antisense: 5 '-

[0127] Sense: 5 '-

[0128] Antisense: 5 '-

[0129] Sense: 5'- UUUGCAACUUGCUACCCAU -3' (SEQ ID NO. 25),

[0130] Antisense: 5'- AUGGGUAGCAAGUUGCAAAUC -3' (SEQ ID NO. 26);

[0131] Sense: 5'- CUUGCUACCCAUUAGGAUA -3' (SEQ ID NO. 33),

[0132] Antisense: 5'- UAUCCUAAUGGGUAGCAAGUU -3' (SEQ ID NO. 34);

[0133] Sense: 5'- CUUGCUACCCAUUAGGAUA -3' (SEQ ID NO. 33),

[0134] Antisense: 5'- UAUCCUAAUGGGUAGCAAGGG -3' (SEQ ID NO. 37);

[0135] Sense: 5'- CUUGCUACCCAUUAGGAUU -3' (SEQ ID NO. 39),

[0136] Antisense: 5'- AAUCCUAAUGGGUAGCAAGAU -3' (SEQ ID NO. 40);

[0137] Sense: 5'- CUUGCUACCCAUUAGGAUU -3' (SEQ ID NO. 39),

[0138] Antisense: 5'- AAUCCUAAUGGGUAGCAAGCG -3' (SEQ ID NO. 43);

[0139] Sense: 5'- CUUGCUACCCAUUAGGAUU -3' (SEQ ID NO. 39),

[0140] Antisense: 5'- AAUCCUAAUGGGUAGCAAGUC -3' (SEQ ID NO. 45);

[0141] the X 1 , Y 1 , Y 2 or Y 3 are each independently selected from A, U, C, or G,

[0142] the sense strand or the antisense strand is optionally modified.

[0143] In some embodiments, the present application provides a double-stranded ribonucleic acid (dsRNA), pharmaceutically acceptable salts thereof, or ligand conjugates thereof, comprising a sense strand comprising at least 15 consecutive nucleotides of a nucleotide sequence as set forth in SEQ ID NO. 29 and the sense strand is no more than 21 nucleotides in length, and an antisense strand comprising at least 15 consecutive nucleotides of a nucleotide sequence as set forth in SEQ ID NO. 30 and the antisense strand is no more than 23 nucleotides in length:

[0144] sense strand: 5'-CUUGCUACCCAUUAGGAUX 1 -3' (SEQ ID NO. 29),

[0145] antisense strand: 5'-Y 1 AUCCUAAUGGGUAGCAAGY 2 Y 3 -3' (SEQ ID NO. 30);

[0146] said X 1 , Y 1 , Y 2 or Y 3 is each independently selected from A, U, C, or G,

[0147] the sense strand or the antisense strand is optionally modified.

[0148] In some embodiments, the present application provides a double-stranded ribonucleic acid (dsRNA), pharmaceutically acceptable salts thereof, or ligand conjugates thereof, comprising a sense strand comprising a nucleotide sequence as set forth in SEQ ID NO. 29 and the sense strand is no more than 21 nucleotides in length, and an antisense strand comprising a nucleotide sequence as set forth in SEQ ID NO. 30 and the antisense strand is no more than 23 nucleotides in length:

[0149] sense strand: 5'-CUUGCUACCCAUUAGGAUX 1 -3' (SEQ ID NO. 29),

[0150] antisense strand: 5'-Y 1 AUCCUAAUGGGUAGCAAGY 2 Y 3 -3' (SEQ ID NO. 30);

[0151] said X 1 , Y 1 , Y 2 or Y 3 is each independently selected from A, U, C, or G,

[0152] the sense strand or the antisense strand is optionally modified.

[0153] In some embodiments, the present application provides a double-stranded ribonucleic acid (dsRNA), a pharmaceutically acceptable salt thereof, or a ligand conjugate thereof, comprising a sense strand and an antisense strand, the sense strand comprising a nucleotide sequence as set forth in SEQ ID NO. 29, and the antisense strand comprising a nucleotide sequence as set forth in SEQ ID NO. 30:

[0154] sense strand: 5 '-CUUGCUACCCAUUAGGAU 1 -3'(SEQ ID NO. 29),

[0155] antisense strand: 5 '-Y 1 AUCCUAAUGGGUAGCAAGY 2 Y 3 -3'(SEQ ID NO. 30);

[0156] the X 1 , Y 1 , Y 2 or Y 3 is each independently selected from A, U, C, or G,

[0157] the sense strand or the antisense strand is optionally modified.

[0158] The present application also provides a double-stranded ribonucleic acid (dsRNA), a pharmaceutically acceptable salt thereof, or a ligand conjugate thereof, comprising a sense strand and an antisense strand, the sense strand and the antisense strand having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity over the entire length of the nucleotide sequence of the sense strand and the antisense strand, respectively, as set forth in the above sense strand and antisense strand.

[0159] In some embodiments, the dsRNA, a pharmaceutically acceptable salt thereof, or a ligand conjugate thereof of the present application is an RNAi drug. In some embodiments, the present application provides a ligand conjugate of a double-stranded ribonucleic acid (dsRNA) comprising a double-stranded ribonucleic acid (dsRNA) described herein, a pharmaceutically acceptable salt thereof, and a ligand.

[0160] In some embodiments, the dsRNA, or a pharmaceutically acceptable salt thereof, or a ligand conjugate thereof of the present application is an siRNA.

[0161] In a specific embodiment, the dsRNA, or a pharmaceutically acceptable salt thereof, or a ligand conjugate thereof, has a double-stranded region consisting of complementary sense and antisense strands, and optionally, protrusions at the 5' and / or 3' ends of the sense and / or antisense strands. In a preferred embodiment, the dsRNA, or a pharmaceutically acceptable salt thereof, or a ligand conjugate thereof, has a double-stranded region consisting of complementary sense and antisense strands, and optionally, protrusions at the 5' and / or 3' ends of the sense and / or antisense strands. In a preferred embodiment, the dsRNA, or a pharmaceutically acceptable salt thereof, or a ligand conjugate thereof, has a double-stranded region consisting of complementary sense and antisense strands, and a protrusion at the 3' end of the antisense strand. In a preferred embodiment, the dsRNA, or a pharmaceutically acceptable salt thereof, or a ligand conjugate thereof, has a double-stranded region consisting of complementary sense and antisense strands, and a protrusion at the 3' end of the sense strand.

[0162] Dual-chain region

[0163] In some embodiments, the double-stranded region of the dsRNA has a length of 19-23 pairs of nucleotides, for example, the double-stranded region of the dsRNA has a length of 19, 20, 21, 22 or 23 pairs of nucleotides.

[0164] Protruding end

[0165] In some embodiments, the justice chain or antisense chain optionally includes a protruding end located at the 5' end and / or the 3' end.

[0166] In some embodiments, the protrusion contains 1, 2, 3, 4, or 5 nucleotides. In some embodiments, the protrusion contains 1 or 2 nucleotides.

[0167] In some embodiments, the positive strand optionally includes a 5' end and / or a 3' end. In some embodiments, the positive strand optionally includes a 1, 2, 3, 4, or 5 nucleotide apex located at the 5' end and / or the 3' end. In some embodiments, the positive strand optionally includes a 1 or 2 nucleotide apex located at the 5' end and / or the 3' end.

[0168] In some embodiments, the antisense strand optionally includes a 5' end and / or a 3' end. In some embodiments, the antisense strand optionally includes a 1, 2, 3, 4, or 5 nucleotide apex located at the 5' end and / or the 3' end. In some embodiments, the antisense strand optionally includes a 1 or 2 nucleotide apex located at the 5' end and / or the 3' end.

[0169] In some embodiments, the protruding end is selected from unmodified or modified A, G, C, U or T.

[0170] In particular embodiments, the overhang can be 1, 2, 3, 4, or 5 nucleotides, preferably 1 or 2 nucleotides, at the 5' end and / or 3' end of the sense strand or antisense strand. In particular embodiments, the dsRNA, or pharmaceutically acceptable salt thereof, or ligand conjugate thereof comprises an additional sequence as an overhang, which can comprise 1, 2, 3, 4, or 5 nucleotides, preferably 1 or 2 nucleotides, attached to the 5' end and / or 3' end of the sense strand or antisense strand.

[0171] As an example, in the case of ribonucleotides at the 5' end and / or 3' end of the sense strand or antisense strand as overhangs, when the sense strand is 21 nucleotides and the antisense strand is 23 nucleotides, when the 1st-21st of the sense strand is complementary to the 1st-21st of the antisense strand, then the 22nd-23rd nucleotides of the antisense strand constitute overhangs at the 3' end of the antisense strand, i.e., the 5' end of the sense strand is blunt or cohesive; when the sense strand is 21 nucleotides and the antisense strand is 21 nucleotides, when the 1st-20th of the sense strand is complementary to the 1st-20th of the antisense strand, then the 21st nucleotides of the sense and antisense strands constitute overhangs at the 3' end of the sense and antisense strands, respectively; when the sense strand is 21 nucleotides and the antisense strand is 23 nucleotides, when the 1st-21st of the sense strand is complementary to the 3rd-23rd of the antisense strand, then the 1st-2nd nucleotides of the antisense strand constitute overhangs at the 5' end of the antisense strand, i.e., the 5' end of the sense strand is blunt or cohesive.

[0172] In some embodiments, in the case of nucleotides at the 5' end and / or 3' end of the sense strand or antisense strand as overhangs, the antisense strand optionally comprises an overhang at the 5' end and / or 3' end selected from the group consisting of unmodified or modified ribonucleotide sequences GA, CA, AC, CG, UG, GG, UA, AU, AA, UU, or UC. In some embodiments, the antisense strand optionally comprises an overhang at the 3' end selected from the group consisting of unmodified or modified ribonucleotide sequences UU, GG, AU, CG, UC, AA, or UA.

[0173] In particular embodiments, the dsRNA, or pharmaceutically acceptable salt thereof, or ligand conjugate thereof comprises an additional sequence as an overhang at the 5' end and / or 3' end of the antisense strand or sense strand, which can comprise 1, 2, 3, 4, or 5 nucleotides, preferably 1 or 2 nucleotides, at the 5' end and / or 3' end.

[0174] In some embodiments, the overhang is an additional sequence optionally located at the 5' end and / or 3' end of the antisense strand, the overhang is selected from unmodified or modified GA, CA, AC, CG, UG, GG, UA, AU, AA, UU, or UC. In some embodiments, the overhang is an additional sequence located at the 3' end of the antisense strand, the overhang is selected from unmodified or modified UU, GG, AU, CG, UC, AA, or UA.

[0175] In some embodiments, the additional sequence as an overhang comprises unmodified or modified U or T.

[0176] In some embodiments, when the additional sequence as an overhang is 1 nucleotide, the overhang is selected from unmodified or modified U or T. In some embodiments, when the additional sequence as an overhang is 1 nucleotide, the overhang is selected from 2'-0-methyl modified U (hereinafter also referred to as u) or deoxythymidine nucleotide (hereinafter also referred to as dT).

[0177] In some embodiments, when the additional sequence as an overhang is 2 nucleotides, the overhang is selected from unmodified or modified UU or TT. In some embodiments, when the additional sequence as an overhang is 2 nucleotides, the overhang is selected from uu or dTdT.

[0178] In some embodiments, the overhang is an additional sequence optionally located at the 5' end and / or 3' end of the antisense strand, the overhang is selected from uu or dTdT.

[0179] In some embodiments, the overhang is an additional sequence optionally located at the 5' end and / or 3' end of the antisense strand, the overhang is selected from uu or dTdT.

[0180] In some embodiments, the overhang is linked to its adjacent nucleotide by a phosphodiester or phosphorothioate linkage.

[0181] In some embodiments, one or more nucleotides in the overhang are linked by a phosphodiester or phosphorothioate linkage.

[0182] In some embodiments, one or more nucleotides in the overhang or the overhang and its adjacent nucleotide are linked by a phosphodiester or phosphorothioate linkage.

[0183] Modifications

[0184] In some embodiments, the sense strand or antisense strand is optionally modified.

[0185] In some embodiments, one or more nucleotides of the sense strand or antisense strand are modified.

[0186] In some embodiments, each nucleotide can be modified by the same or different modification, which can include one or both of unlinked phosphate oxygens and / or one or more alterations of linked phosphate oxygens; alterations of components of ribose (e.g., the 2' hydroxyl group on ribose); replacement of all phosphate moieties with "dephospho" linkages; modification of naturally occurring bases; and modification of the ribose-phosphate backbone.

[0187] In some embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides of the sense strand are modified; or a range formed by any of the foregoing values, e.g., 1-23, 1-22, 1-21, 1-20, 1-19, 1-18, 1-17, 1-16, 1-15, 1-14, 1-13, 1-12, 1-11, or 1-10 nucleotides are modified.

[0188] In some embodiments, more than 1, more than 2, more than 3, more than 4, more than 5, more than 6, more than 7, more than 8, more than 9, more than 10, more than 11, more than 12, more than 13, more than 14, more than 15, more than 16, more than 17, more than 18, more than 19, more than 20, more than 21, more than 22, or more than 23 nucleotides of the sense strand are modified; typically, more than 10, more than 11, more than 12, more than 13, more than 14, more than 15, more than 16, more than 17, more than 18, more than 19, more than 20, or more than 21 nucleotides of the sense strand are modified.

[0189] In some embodiments, all nucleotides of the sense strand are modified.

[0190] In some embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides of the antisense strand are modified; or a range formed by any of the foregoing, for example, 1-25, 1-24, 1-23, 1-22, 1-21, 1-20, 1-19, 1-18, 1-17, 1-16, 1-15, 1-14, 1-13, 1-12, 1-11, or 1-10 nucleotides are modified.

[0191] In some embodiments, more than 1, more than 2, more than 3, more than 4, more than 5, more than 6, more than 7, more than 8, more than 9, more than 10, more than 11, more than 12, more than 13, more than 14, more than 15, more than 16, more than 17, more than 18, more than 19, more than 20, more than 21, more than 22, more than 23, more than 24, or more than 25 nucleotides of the antisense strand are modified; typically, more than 10, more than 11, more than 12, more than 13, more than 14, more than 15, more than 16, more than 17, more than 18, more than 19, more than 20, more than 21, more than 22, or more than 23 nucleotides of the antisense strand are modified.

[0192] In some embodiments, all nucleotides of the antisense strand are modified.

[0193] In some embodiments, all nucleotides of the sense strand and all nucleotides of the antisense strand are modified.

[0194] In some embodiments, the modification is selected from a sugar modification of a nucleotide, a modification of a base, a modification of an internucleotide linkage, or a terminal modification. In some embodiments, the modification is selected from a sugar modification of a nucleotide, a modification of an internucleotide linkage, or a terminal modification.

[0195] In some embodiments, the sugar modification of a nucleotide is selected from dehydroxylation, fluorination, amination, alkylation, hydroxyalkylation, or hydroxyalkenylation.

[0196] In some embodiments, the sugar modification of a nucleotide occurs at the 2' position of the sugar group.

[0197] In some embodiments, the sugar modification is selected from 2'-dehydroxylation, 2'-fluoro, 2'-amino, 2'-alkyl, 2'-O-alkyl, 2'-O-ether, 2'-O-alkenyl. In some embodiments, the sugar modification is selected from 2'-dehydroxylation, 2'-fluoro, 2'-amino, 2'-methyl, 2'-ethyl, 2'-methyl-O-methyl, 2'-ethyl-O-methyl, 2'-O-methyl, 2'-O-ethyl, 2'-O-ethyl-O-methyl, or 2'-O-allyl.

[0198] In some embodiments, the internucleotide linkage modification is selected from phosphorothioate (PS), phosphorodithioate (PS2), methylphosphonate (MP), methoxypropylphosphonate (MOP), or aminophosphonate. In some embodiments, the internucleotide linkage modification is selected from phosphorothioate (PS). In some embodiments, the internucleotides are linked by phosphorodithioate bonds.

[0199] In some embodiments, the terminal modification is selected from a modification on a terminal phosphate group or a terminal hydroxyl group. In some embodiments, the terminal modification is selected from a 5'-terminal modification or a 3'-terminal modification. In some embodiments, the terminal modification is selected from a 5'-phosphate group, a 3'-phosphate group, a 5'-methylphosphonate (5'-MP), a 5'-phosphorothioate (5'-PS), a 3'-(E)-vinylphosphate, or a 5'-(E)-vinylphosphonate (5'-(E)-VP) on the ribose group of a terminal nucleotide. In some embodiments, the terminal modification is selected from a 5'-phosphate, a 5'-methylphosphonate (5'-MP), a 5'-phosphorothioate (5'-PS), or a 5'-(E)-vinylphosphonate (5'-(E)-VP) on the ribose group of a terminal nucleotide. In some embodiments, the terminal modification is selected from a 5'-phosphate group or a 5'-(E)-vinylphosphate on the ribose group of a terminal nucleotide.

[0200] In some embodiments, the modification is selected from 2'-dehydroxylation, 2'-fluoro, 2'-amino, 2'-methyl, 2'-ethyl, 2'-methyl-O-methyl, 2'-ethyl-O-methyl, 2'-O-methyl, 2'-O-ethyl, 2'-O-allyl, phosphorothioate, methylphosphonate, aminophosphonate, 5'-phosphate, 3'-phosphate, 5'-(E)-vinylphosphate, or 3'-(E)-vinylphosphate.

[0201] In some embodiments, the modification is selected from 2'-dehydroxylation, 2'-fluoro, 2'-O-methyl, 2'-O-ethyl, 2'-O-ethyl-O-methyl, 2'-O-allyl, phosphorothioate, or 5'-(E)-vinylphosphate.

[0202] In some embodiments, the modification is selected from 2'-fluoro, 2'-O-methyl, phosphorothioate, or 5'-(E)-vinylphosphonate.

[0203] As will be detailed below, when referring to the nth nucleotide of the sense strand and the antisense strand, counting is from the 5' end unless otherwise specified, beginning at the 3' end.

[0204] In some embodiments, phosphorothioate modifications are employed between the first two nucleotides and / or between the first three nucleotides of one or both ends of the two nucleic acid strands of the dsRNA, or a pharmaceutically acceptable salt thereof, or a ligand conjugate thereof. For example, using the sense strand as an example, phosphorothioate modifications are employed between the first and second nucleotides of the sense strand and / or between the second and third nucleotides of the sense strand and / or between the first and second nucleotides and between the second and third nucleotides of the sense strand.

[0205] In some embodiments, for the case where there is no additional sequence as an overhang, phosphorothioate modifications are employed between the first and second nucleotides of the sense strand and / or between the second and third nucleotides of the sense strand.

[0206] In some embodiments, for the case where there is no additional sequence as an overhang, phosphorothioate modifications are employed between the first and second nucleotides of the antisense strand, between the second and third nucleotides of the antisense strand, between the 19th and 20th nucleotides of the antisense strand, and / or between the 20th and 21st nucleotides of the antisense strand.

[0207] In some embodiments, for the case where there is an additional sequence as an overhang, phosphorothioate modifications can be employed between nucleotides in the additional sequence.

[0208] In some embodiments, the 5 '-end of the antisense strand is modified with a 5'-(E)-vinylphosphonate.

[0209] In some embodiments, the sense strand has 2, 3, 4, or 5 nucleotides with 2'-fluoro modifications. In some embodiments, the sense strand has 14, 15, 16, 17, 18, or 19 nucleotides with 2'-O-methyl modifications. In some embodiments, the sense strand has 3 or 4 nucleotides with 2'-fluoro modifications. In some embodiments, the sense strand has 15, 16, 17, or 18 nucleotides with 2'-O-methyl modifications. In some embodiments, the sense strand has 3 or 4 nucleotides with 2'-fluoro modifications. In some embodiments, the sense strand has 15 or 16 nucleotides with 2'-O-methyl modifications. In some embodiments, the sense strand has 3 nucleotides with 2'-fluoro modifications. In some embodiments, the sense strand has 16 nucleotides with 2'-O-methyl modifications.

[0210] In some embodiments, the sense strand has 0, 1, or 2 nucleotides with 2'-fluoro modifications in the first 6 nucleotides.

[0211] In some embodiments, the sense strand has 4, 5, or 6 nucleotides with 2'-O-methyl modifications in the first 6 nucleotides.

[0212] In some embodiments, the sense strand has 2 or 3 nucleotides with 2'-fluoro modifications in the 7th to 9th nucleotides.

[0213] In some embodiments, the sense strand has 0 or 1 nucleotides with 2'-O-methyl modifications in the 7th to 9th nucleotides.

[0214] In some embodiments, the sense strand has 0 or 1 nucleotides with 2'-fluoro modifications in the 10th to 19th nucleotides.

[0215] In some embodiments, the sense strand has 8, 9, or 10 nucleotides with 2'-O-methyl modifications in the 10th to 19th nucleotides.

[0216] In some embodiments, the 7th, 8th, and 9thnucleotides of the sense strand are 2'-fluoro modified, and 0, 1, or 2 of the nucleotides from 1stto 6thand / or 10thto 19thnucleotides of the sense strand are also 2'-fluoro modified. In some embodiments, the 7th, 8th, and 9thnucleotides of the sense strand are 2'-fluoro modified, and 0, 1, or 2 of the nucleotides from 1stto 6thand 10thto 19thnucleotides of the sense strand are also 2'-fluoro modified. In some embodiments, the 7th, 8th, and 9thnucleotides of the sense strand are 2'-fluoro modified, and 0 of the nucleotides from 1stto 6thand 10thto 19thnucleotides of the sense strand are 2'-fluoro modified.

[0217] In some embodiments, 2, 3, 4, 5, 6, or 7 of the nucleotides of the antisense strand are 2'-fluoro modified.

[0218] In some embodiments, 14, 15, 16, 17, 18, 19, 20, or 21 of the nucleotides of the antisense strand are 2'-O-methyl modified.

[0219] In some embodiments, 3, 4, 5, or 6 of the 2nd, 6th, 8th, 9th, 14th, 16thnucleotides of the antisense strand are 2'-fluoro modified. In some embodiments, 3 or 4 of the 2nd, 6th, 14th, 16thnucleotides of the antisense strand are 2'-fluoro modified. In some embodiments, 4 of the 2nd, 6th, 14th, 16thnucleotides of the antisense strand are 2'-fluoro modified. 6 of the 2nd, 6th, 8th, 9th, 14th, 16thnucleotides of the antisense strand are 2'-fluoro modified.

[0220] In some embodiments, the 2nd, 6th, 14th, and 16thnucleotides of the antisense strand are 2'-fluoro modified, and any one or two of the 1st, 3rdto 5th, 7thto 13th, 15th, and / or 17thto 21st, and / or 17thto 23rdnucleotides of the antisense strand are also 2'-fluoro modified. In some embodiments, the 2nd, 6th, 14th, and 16thnucleotides of the antisense strand are 2'-fluoro modified, and any one or two of the 1st, 3rdto 5th, 7th, 10thto 13th, 15th, and 17thto 21stnucleotides of the antisense strand are also 2'-fluoro modified.

[0221] In some embodiments, 14, 15, 16, 17, 18, or 19 of the 1st, 3rdto 5th, 7th, 10thto 13th, 15th, and / or 17thto 21st, and / or 17thto 23rdnucleotides of the antisense strand are 2'-O-methyl modified.

[0222] In a specific embodiment, nucleotides 7, 8, and 9 of the sense strand are 2'- fluoro-modified, nucleotide 5 of the sense strand is 2'-fluoro-modified or 2'-O- methyl-modified, and other nucleotides of the sense strand are 2'-O-methyl- modified; and nucleotides 2, 6, 14, and 16 of the antisense strand are 2'-fluoro- modified, nucleotides 8 and 9 of the antisense strand are 2'-fluoro-modified or 2'-O-methyl-modified, and other nucleotides of the antisense strand are 2'-O- methyl-modified.

[0223] In a specific embodiment, nucleotides 5, 7, 8, and 9 of the sense strand are 2'- fluoro-modified, and other nucleotides of the sense strand are 2'-O-methyl- modified; and nucleotides 2, 6, 14, and 16 of the antisense strand are 2'-fluoro- modified, nucleotides 8 and 9 of the antisense strand are 2'-fluoro-modified or 2'-O-methyl-modified, and other nucleotides of the antisense strand are 2'-O- methyl-modified.

[0224] In a specific embodiment, nucleotides 5, 7, 8, and 9 of the sense strand are 2'- fluoro-modified, and other nucleotides of the sense strand are 2'-O-methyl- modified; and nucleotides 2, 6, 14, and 16 of the antisense strand are 2'-fluoro- modified, nucleotides 8 and 9 of the antisense strand are 2'-fluoro-modified or 2'-O-methyl-modified, and other nucleotides of the antisense strand are 2'-O- methyl-modified.

[0225] In a specific embodiment, nucleotides 5, 7, 8, and 9 of the sense strand are 2'- fluoro-modified, and other nucleotides of the sense strand are 2'-O-methyl- modified; and nucleotides 2, 6, 14, and 16 of the antisense strand are 2'-fluoro- modified, nucleotides 8 and 9 of the antisense strand are 2'-fluoro-modified or 2'-O-methyl-modified, and other nucleotides of the antisense strand are 2'-O- methyl-modified.

[0226] In a specific embodiment, nucleotides 7, 8, and 9 of the sense strand are 2'- fluoro-modified, and other nucleotides of the sense strand are 2'-O-methyl- modified; and nucleotides 2, 6, 14, and 16 of the antisense strand are 2'-fluoro- modified, nucleotides 8 and 9 of the antisense strand are 2'-fluoro-modified or 2'-O-methyl-modified, and other nucleotides of the antisense strand are 2'-O- methyl-modified.

[0227] In a specific embodiment, nucleotides 7, 8, and 9 of the sense strand are 2'- fluoro-modified, and other nucleotides of the sense strand are 2'-O-methyl- modified; and nucleotides 2, 6, 14, and 16 of the antisense strand are 2'-fluoro- modified, nucleotides 8 and 9 of the antisense strand are 2'-fluoro-modified or 2'-O-methyl-modified, and other nucleotides of the antisense strand are 2'-O- methyl-modified.

[0228] In a specific embodiment, nucleotides 7, 8, and 9 of the sense strand have 2'- fluoro modifications, the other nucleotides of the sense strand have 2'-O-methyl modifications, and nucleotides 2, 6, 14, and 16 of the antisense strand have 2'-fluoro modifications, the other nucleotides of the antisense strand have 2'-O-methyl modifications.

[0229] In a specific embodiment, nucleotides 7, 8, and 9 of the sense strand have 2'- fluoro modifications, nucleotide 5 of the sense strand has a 2'-fluoro modification or a 2'-O-methyl modification, the other nucleotides of the sense strand have 2'-O-methyl modifications; and nucleotides 2, 6, 14, and 16 of the antisense strand have 2'-fluoro modifications, nucleotides 8 and 9 of the antisense strand have a 2'-fluoro modification or a 2'-O-methyl modification, the other nucleotides of the antisense strand have 2'-O-methyl modifications, and the internucleotide linkage between nucleotides 1, 2 of the sense strand, between nucleotides 2, 3 of the sense strand, between nucleotides 1, 2 of the antisense strand, between nucleotides 2, 3 of the antisense strand, between nucleotides 19, 20 of the antisense strand, and / or between nucleotides 20, 21 of the antisense strand is a phosphorothioate linkage. Optionally, the 5'-terminus of the antisense strand has a 5'-(E)-vinylphosphonate modification.

[0230] In a specific embodiment, nucleotides 5, 7, 8, and 9 of the sense strand have 2'- fluoro modifications, the other nucleotides of the sense strand have 2'-O-methyl modifications, and nucleotides 2, 6, 8, 9, 14, and 16 of the antisense strand have 2'-fluoro modifications, the other nucleotides of the antisense strand have 2'-O-methyl modifications, and the internucleotide linkage between nucleotides 1, 2 of the sense strand, between nucleotides 2, 3 of the sense strand, between nucleotides 1, 2 of the antisense strand, between nucleotides 2, 3 of the antisense strand, between nucleotides 19, 20 of the antisense strand, and / or between nucleotides 20, 21 of the antisense strand is a phosphorothioate linkage. Optionally, the 5'-terminus of the antisense strand has a 5'-(E)-vinylphosphonate modification.

[0231] In a specific embodiment, positions 5, 7, 8, and 9 of the sense strand are 2'- fluoro-modified, the remaining nucleotides of the sense strand are 2'-0-methyl-modified, positions 2, 6, 14, and 16 of the antisense strand are 2'-fluoro-modified, the remaining nucleotides of the antisense strand are 2'-0-methyl-modified, and the internucleotide linkage between positions 1, 2 of the sense strand, between positions 2, 3 of the sense strand, between positions 1, 2 of the antisense strand, between positions 2, 3 of the antisense strand, between positions 19, 20 of the antisense strand, and / or between positions 20, 21 of the antisense strand are phosphorothioate linkages. Optionally, the 5 '-terminus of the antisense strand is 5 '-(E)-vinylphosphonate modified.

[0232] In a specific embodiment, positions 7, 8, and 9 of the sense strand are 2'- fluoro-modified, the remaining nucleotides of the sense strand are 2'-0-methyl-modified, positions 2, 6, 14, and 16 of the antisense strand are 2'-fluoro-modified, the remaining nucleotides of the antisense strand are 2'-0-methyl-modified, and the internucleotide linkage between positions 1, 2 of the sense strand, between positions 2, 3 of the sense strand, between positions 1, 2 of the antisense strand, between positions 2, 3 of the antisense strand, between positions 19, 20 of the antisense strand, and / or between positions 20, 21 of the antisense strand are phosphorothioate linkages. Optionally, the 5 '-terminus of the antisense strand is 5 '-(E)-vinylphosphonate modified.

[0233] Ligand

[0234] In some embodiments, the ligand comprises a branching group and a linking group.

[0235] In some embodiments, the ligand is linked to the dsRNA via the linking group. Herein, the dsRNA to which the ligand is linked is referred to as a dsRNA-ligand conjugate.

[0236] In some embodiments, the ligand links one or more targeting groups via the branching group. In some embodiments, the branching group comprises a targeting group.

[0237] In some embodiments, the ligand contains at least one targeting group. In some embodiments, the ligand contains one, two, three, four, or five targeting groups. In some embodiments, the ligand contains two, three, or four targeting groups. In some embodiments, the ligand contains three targeting groups.

[0238] In some embodiments, the targeting group is selected from a GalNAc group.

[0239] In some embodiments, the ligand contains one, two, three, four, or five GalNAc groups. In some embodiments, the ligand contains two, three, or four GalNAc groups. In some embodiments, the ligand contains three GalNAc groups.

[0240] In some embodiments, the branching group is selected from:

[0241] In some embodiments, the linking group is selected from:

[0242] In some embodiments, the ligand is selected from:

[0243] In some embodiments, the ligand is attached to the sense strand or the antisense strand. In some embodiments, the ligand is attached to the 5' or 3' end of the sense strand or the antisense strand. In some embodiments, the ligand is attached to the 5' or 3' end of the sense strand. In some embodiments, the ligand is attached to the 3' end of the sense strand.

[0244] In some embodiments, the ligand is attached to the sense strand or the antisense strand of the dsRNA via a phosphodiester or phosphorothioate linkage. In some embodiments, the ligand is attached to the sense strand via a phosphodiester or phosphorothioate linkage. In some embodiments, the ligand is attached to the 3' end of the sense strand via a phosphodiester or phosphorothioate linkage.

[0245] In some embodiments, the dsRNA ligand conjugate is represented as follows:

[0246] In some embodiments, the dsRNA ligand conjugate is selected from:

[0247] wherein the double helix structure represents a dsRNA.

[0248] In some embodiments, the dsRNA ligand conjugate is selected from:

[0249] wherein the double helix structure represents a dsRNA.

[0250] In some embodiments, the present application provides a double-stranded ribonucleic acid (dsRNA), a pharmaceutically acceptable salt thereof, or a ligand conjugate thereof, the dsRNA comprising a sense strand and an antisense strand, the nucleotide sequence of the sense strand being a nucleotide sequence as set forth in SEQ ID NO. 29, and the nucleotide sequence of the antisense strand being a nucleotide sequence as set forth in SEQ ID NO. 30:

[0251] sense strand: 5'-CUUGCUACCCAUUAGGAUX 1 -3'(SEQ ID NO. 29),

[0252] antisense strand: 5'-Y 1 AUCCUAAUGGGUAGCAAGY 2 Y 3 -3'(SEQ ID NO. 30);

[0253] the X 1 is selected from A or U,

[0254] the Y 1 is selected from A or U,

[0255] the Y 2 is selected from A, U, C, or G,

[0256] the Y 3 is selected from U, C, or G,

[0257] the sense strand or the antisense strand is optionally modified.

[0258] In some embodiments, the present application provides a double-stranded ribonucleic acid (dsRNA) ligand conjugate, the dsRNA comprising a sense strand and an antisense strand, the nucleotide sequence of the sense strand being a nucleotide sequence as set forth in SEQ ID NO. 29, the nucleotide sequence of the antisense strand being a nucleotide sequence as set forth in SEQ ID NO. 30:

[0259] sense strand: 5'-CUUGCUACCCAUUAGGAUX 1 (SEQ ID NO. 29)-L-3 ',

[0260] antisense strand: 5'-Y 1 AUCCUAAUGGGUAGCAAGY 2 Y 3 -3'(SEQ ID NO. 30);

[0261] the X 1 is selected from A or U,

[0262] the Y 1 is selected from A or U,

[0263] the Y 2 is selected from A, U, C, or G,

[0264] the Y 3 is selected from U, C, or G,

[0265] L is selected from L01 or L02,

[0266] The sense strand or the antisense strand is optionally modified.

[0267] In some embodiments, the present application provides a double-stranded ribonucleic acid (dsRNA), pharmaceutically acceptable salts thereof or ligand conjugates thereof, said dsRNA comprising a sense strand and an antisense strand, the nucleotide sequence of the sense strand is the nucleotide sequence as set forth in SEQ ID NO. 31, and the nucleotide sequence of the antisense strand is the nucleotide sequence as set forth in SEQ ID NO. 32:

[0268] sense strand: 5'-csusugcuAfCfCfcauuaggauX a1 -3' (SEQ ID NO. 31),

[0269] antisense strand: 5'-Y a1 sAfsuccUfaauggguAfgCfaagsY a2 Y a3 -3' (SEQ ID NO. 32);

[0270] X is selected from a or u, a1

[0271] Y is selected from a or u, a1

[0272] Y is selected from a or u, a2

[0273] Y is selected from u, c or g, a3

[0274] The sense strand or the antisense strand is optionally modified.

[0275] In some embodiments, the present application provides a double-stranded ribonucleic acid (dsRNA) ligand conjugate, said dsRNA comprising a sense strand and an antisense strand, the nucleotide sequence of the sense strand is the nucleotide sequence as set forth in SEQ ID NO. 31, and the nucleotide sequence of the antisense strand is the nucleotide sequence as set forth in SEQ ID NO. 32:

[0276] sense strand: 5'-csusugcuAfCfCfcauuaggauX a1 (SEQ ID NO. 31)-L-3',

[0277] antisense strand: 5'-Y a1 sAfsuccUfaauggguAfgCfaagsY a2 Y a3 ​​​​-3' (SEQ ID NO. 32);

[0278] the X a1 is selected from a or u,

[0279] the Y a1 is selected from a or u,

[0280] the Y a2 is selected from as, us, cs or gs,

[0281] the Y a3 is selected from u, c or g,

[0282] the L is selected from L01 or L02,

[0283] the sense strand or the antisense strand is modified.

[0284] In some embodiments, the X 1 is selected from A, Y 1 is selected from U.

[0285] In some embodiments, the X 1 is selected from U, Y 1 is selected from A.

[0286] In some embodiments, the Y 2 Y 3 is selected from UU.

[0287] In some embodiments, the Y 2 Y 3 is selected from GG.

[0288] In some embodiments, the Y 2 Y 3 is selected from AU.

[0289] In some embodiments, the Y 2 Y 3 is selected from CG.

[0290] In some embodiments, the Y 2 Y 3 is selected from UC.

[0291] In some embodiments, the X a1 is selected from a, Y a1 is selected from u.

[0292] In some embodiments, the X a1 is selected from u, Y a1 is selected from a.

[0293] In some embodiments, the Y a2 Ya3 selected from usu.

[0294] In some embodiments, the Y a2 Y a3 selected from gsg.

[0295] In some embodiments, the Y a2 Y a3 selected from asu.

[0296] In some embodiments, the Y a2 Y a3 selected from csg.

[0297] In some embodiments, the Y a2 Y a3 selected from usc.

[0298] In some embodiments, the L is selected from L01.

[0299] In some embodiments, the unmodified sense strand of the dsRNA is selected from:

[0300] Table 1. Unmodified sense strands

[0301] In some embodiments, the unmodified antisense strand of the dsRNA is selected from:

[0302] Table 2. Unmodified antisense strands

[0303] In some embodiments, the modified sense strand of the dsRNA is selected from:

[0304] Table 3. Modified sense strands

[0305] In some embodiments, the modified antisense strand of the dsRNA is selected from:

[0306] Table 4. Modified antisense strands

[0307] The dsRNAs of the present application can be formed by including any of the above sense strands and any of the above antisense strands.

[0308] For example, the dsRNA comprises any one of the following sense strands: SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 39, or SEQ ID NO: 41; and the dsRNA comprises any one of the following antisense strands: SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, or SEQ ID NO: 46.

[0309] In some embodiments, the dsRNA (e.g., siRNA, unmodified) is selected from the group consisting of:

[0310] Table 5. siRNAs (unmodified)

[0311] In some embodiments, the dsRNA (modified) is selected from the group consisting of:

[0312] Table 6. dsRNAs (modified)

[0313] In some embodiments, the unmodified or modified dsRNA (e.g., siRNA) ligand conjugate is selected from the group consisting of:

[0314] Table 7. dsRNA ligand conjugates

[0315] wherein L represents a ligand, the ligand is as described above; in some embodiments, the ligand is selected from the group consisting of L01 ligand or L02 ligand. Wherein the sequence ID number of the sense strand refers to the sequence ID number of the nucleic acid sequence in the sense strand. L at the 3' end of the sense strand sequence of the dsRNA ligand conjugate sequence number refers to the ligand linked at the 3' end of the sense strand sequence in the dsRNA ligand conjugate.

[0316] pharmaceutically acceptable salt

[0317] In some embodiments, the salt as described above is selected from the group consisting of base addition salt, acid addition salt, and combinations thereof.

[0318] In some embodiments, the base addition salt is selected from the group consisting of sodium, potassium, calcium, ammonium, organic amine, magnesium salt, and combinations thereof, and the acid addition salt is selected from the group consisting of inorganic acid salt, organic acid salt, and combinations thereof.

[0319] In some embodiments, the inorganic acid is selected from the group consisting of hydrochloric acid, hydrobromic acid, nitric acid, carbonic acid, bicarbonate, phosphoric acid, monohydrogen phosphate, dihydrogen phosphate, sulfuric acid, hydrogen sulfate, hydroiodic acid, phosphorous acid, and combinations thereof, and the organic acid is selected from the group consisting of acetic acid, propionic acid, isobutyric acid, maleic acid, malonic acid, benzoic acid, succinic acid, suberic acid, fumaric acid, lactic acid, mandelic acid, phthalic acid, benzene sulfonic acid, p-toluene sulfonic acid, citric acid, tartaric acid, methanesulfonic acid, and combinations thereof. beneficial effects

[0320] The double-stranded ribonucleic acid, the pharmaceutically acceptable salt thereof, or the ligand conjugate thereof of the present application has good PNPLA3 inhibitory activity, can reduce the expression of PNPLA3 mRNA in hepatocytes, and has good stability in the liver.

[0321] definitions and descriptions

[0322] Unless otherwise indicated, the following terms and phrases as used herein are intended to have the following meanings. A particular term or phrase should not be construed as undefined or unclear unless specifically defined, but should be interpreted as understood by one of ordinary skill in the art. When a trade name appears herein, it is intended to refer to its corresponding product or active ingredient thereof.

[0323] In the present application, unless otherwise specified, the term "comprising, including and containing" or the equivalent is an open-ended expression that means that other unspecified elements, components or steps can be included in addition to the listed elements, components or steps.

[0324] When any variable occurs more than one time in a compound, nucleotide, single or double stranded structure, its definition on each occurrence is independent of its definition at every other occurrence. For example, modifications described herein are independent events, i.e., a modification to a sense strand does not affect a modification to an antisense strand, a modification to one nucleotide does not affect a modification to another nucleotide, a modification to a sugar group of one nucleotide does not affect a modification to another sugar group of the same nucleotide, unless otherwise indicated. The effect includes whether modified or not, and includes what type of modification.

[0325] The PNPLA3 gene sequences of the present application can be obtained from the public databases, such as Genbank, etc. The transcript NM_025225.3 of human PNPLA3 gene and the transcript XM_005567051.3 of cynomolgus monkey PNPLA3 gene are used as target genes for siRNA design. All the siRNA sequences have 100% identity or 1-3 mismatches with the human transcript, or have 100% identity or 1-3 mismatches with the cynomolgus monkey transcript, or have 100% identity or 1 mismatch with the mouse transcript NM_001408340.1.

[0326] As known in the art, the term "interfering RNA" or "RNAi" or "interfering RNA sequence" refers to a single-stranded RNA (e.g., a mature miRNA) or a double-stranded RNA (e.g., a duplex RNA such as an siRNA, aiRNA, or pre-miRNA) that is capable of reducing or inhibiting the expression of a target gene or sequence (e.g., by mediating the degradation of or inhibiting the translation or transcription of mRNA that is complementary to the interfering RNA sequence) when the interfering RNA is in the same cell as the target gene or sequence. The interfering RNA can have substantial or complete identity to the target gene or sequence, or can include a mismatch region (i.e., a mismatch sequence).

[0327] The double-stranded ribonucleic acids of the present application function as interfering RNAs. Hereinafter, the double-stranded ribonucleic acids of the present application are sometimes referred to as siRNAs.

[0328] As known in the art, the term "mismatch region" or "mismatch sequence" refers to a portion of an interfering RNA (e.g., an siRNA, aiRNA, miRNA) sequence that does not have 100% complementarity to its target sequence. An interfering RNA (e.g., an siRNA, aiRNA, miRNA) can have at least 1, 2, 3, 4, 5, 6, or more mismatch regions. The mismatch regions can be contiguous or can be separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more nucleotides. The mismatch regions can include a single nucleotide or can include 2, 3, 4, 5, 6, or more nucleotides.

[0329] The term "identity" refers to the similarity between two nucleotide sequences or between two amino acid sequences. Identity of sequences preferably relates to the percentage of nucleotides or amino acids in the sequences that have the same position in two or more sequences of the same length. Specifically, the "% identity" of two amino acid sequences or of two nucleotide sequences can be determined by aligning the sequences for optimal comparison (e.g., gaps can be introduced in either sequence for optimal alignment) and the comparison of the amino acids or nucleotides at corresponding positions. Gaps generally are considered to be non-identical positions, regardless of their actual position in the alignment. The "optimal alignment" generally is the alignment of two sequences that results in the highest percentage of identity. The percentage of identity is determined by the number of identical nucleotides in the compared sequences (i.e., % identity = number of identical positions / total number of positions x 100). The sequence identity of the present application is at least 80%, 85%, 90%, or 95%, preferably at least 90%, non-limiting examples include: 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%. The determination of the percentage of identity between two sequences can be accomplished using mathematical algorithms known to those skilled in the art.

[0330] As known in the art, interfering RNAs include "small interfering RNAs (siRNAs)" which are, for example, about 15-60, 15-50, 15-40, 15-30, 15-25, 19-25, 19-23, or 19-21 nucleotides in length. The double-stranded ribonucleic acids of the present application can function as such siRNAs and can have corresponding lengths.

[0331] As used herein, the position of a nucleotide of the sense strand or the antisense strand is counted from the 5' end. For a dsRNA with a 19-nucleotide sense strand and a 21-nucleotide antisense strand, for example, the 1stposition is C and the 19thposition is U for 5'-CCUUCAACUUAAGCAAGUU-3' (SEQ ID NO: 1), and the 1stposition is A and the 21stposition is U for 5'- AACUUGCUUAAGUUGAAGGAU-3' (SEQ ID NO: 2). For a dsRNA with a sense strand of more than 19 nucleotides and an antisense strand of more than 21 nucleotides, for example, a sense strand with additional nucleotides at the end of SEQ ID NO: 1 and an antisense strand with additional nucleotides at the end of SEQ ID NO: 2, the counting of the positions of the nucleotides of the sense strand or the antisense strand does not change, i.e., the 1stposition of the sense strand is still the 1stposition of SEQ ID NO: 1 and the 1stposition of the antisense strand is still the 1stposition of SEQ ID NO: 2.

[0332] As known in the art, and unless otherwise specified, the term "complementary" when used to describe the relationship of a first nucleic acid sequence and a second nucleic acid sequence refers to the ability of an oligonucleotide or polynucleotide containing the first nucleic acid sequence to hybridize to and form a double-stranded structure with an oligonucleotide or polynucleotide containing the second nucleic acid sequence under specified conditions. As described herein, "complementary" sequences can also include double-stranded structures formed by base pairing that are not Watson-Crick base pairing and / or are not formed by natural or unmodified nucleotides, or can be double-stranded structures formed entirely by base pairing that are not Watson-Crick base pairing and / or are not formed by natural or unmodified nucleotides, as long as the above requirements with respect to their ability to hybridize are met.

[0333] As known in the art, a "fully complementary" sequence includes base pairing between an oligonucleotide or polynucleotide containing a first nucleic acid sequence and an oligonucleotide or polynucleotide containing a second nucleic acid sequence over the entire length of the first nucleic acid sequence and the second nucleic acid sequence. As known in the art, "substantially complementary" means that the two nucleic acid sequences are fully complementary or that at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) of the overlapping nucleotides between the two nucleic acid sequences are complementary.

[0334] The terms "complementary," "fully complementary," and "substantially complementary" of the present application can be used according to base pairing between the sense strand and the antisense strand of a dsRNA, or between the antisense strand of a dsRNA and a target sequence, as can be understood from their use.

[0335] In the art, "G," "C," "A," "T," and "U" generally represent the bases guanine, cytosine, adenine, thymine, and uracil, respectively, but it is also generally known in the art that "G," "C," "A," "T," and "U" each also generally represent nucleotides containing guanine, cytosine, adenine, thymine, and uracil, respectively, as bases, which is a common way of representing deoxyribonucleic acid sequences and / or ribonucleic acid sequences, and thus the meaning of "G," "C," "A," "T," "U" in the context of the present disclosure includes each of the various possibilities described above. However, it is to be understood that the term "ribonucleotide" or "nucleotide" can also refer to a modified nucleotide (as further detailed elsewhere herein) or to a nucleotide having an alternative substitution moiety, as one skilled in the art will recognize that guanine, cytosine, adenine, and uracil can be replaced by other moieties without substantially altering the base pairing properties of an oligonucleotide including a nucleotide having such a substitution moiety. For example, and without limitation, a nucleotide including inosine as its base can base pair with a nucleotide including adenine, cytosine, or uracil. Thus, a nucleotide containing uracil, guanine, or adenine can be replaced by a nucleotide containing, for example, inosine in the nucleotide sequence of a dsRNA characterized herein.

[0336] As known in the art, the terms "double-stranded ribonucleic acid," "double-stranded RNA," or "dsRNA" are used interchangeably. The term "dsRNA" comprises two antiparallel and complementary nucleic acid strands, having a "sense" or "antisense" orientation with respect to a target RNA (e.g., a PD-L1 gene). In the examples herein, a dsRNA can degrade a target RNA (e.g., an mRNA) via the RNA interference (RNAi) mechanism.

[0337] A double-stranded ribonucleic acid of the present disclosure contains a sense strand and an antisense strand. The term "sense strand" or "plus strand" refers to the single strand of a dsRNA duplex that is substantially complementary to a region of the antisense strand. The term "antisense strand" refers to the single strand of a dsRNA duplex that is substantially complementary to a region of the target sequence. If the sense strand is not completely complementary to the antisense strand, mismatches can occur within the interior or at the terminal regions of the molecule. Generally, the most tolerated mismatches are within the terminal regions. If the antisense strand is not completely complementary to the target sequence, mismatches can occur within the interior or at the terminal regions of the molecule. Generally, the most tolerated mismatches are within the terminal regions.

[0338] As known in the art, the duplex of a dsRNA can have the same or different numbers of nucleotides. The length of the duplex region formed by complementarity can be any length that permits degradation of a target RNA, and can range from about 9 to 36 pairs of nucleotides, such as 15 to 30 pairs, 16 to 28 pairs, 19 to 21 pairs, and the like.

[0339] As known in the art, outside of the double-stranded region, the dsRNA can include one or more nucleotide overhangs, which refers to at least one unpaired nucleotide / nucleoside analog. For example, there is an overhang when the 3' end of one strand of the dsRNA overhangs the 5' end of the other strand (or vice versa). The nucleotides in the "overhang" can include 0-5 nucleotides, where "0" means no "overhang" and "5" means 5 extra (i.e., unpaired) nucleotides on the single strand of the dsRNA double strand. These optional "overhangs" can be at the 5' and / or 3' end of either single strand of the dsRNA. In some embodiments, the "overhang" includes 0-5 nucleotides. In some embodiments, the "overhang" includes 0-2 nucleotides. In some embodiments, the "overhang" at the 3' and / or 5' end of the sense strand of the dsRNA has 0-2 nucleotides. In some embodiments, the "overhang" at the 3' and / or 5' end of the antisense strand of the dsRNA has 0-2 nucleotides. The nucleotides forming the "overhang" can be A, G, C, U, or T or a modified version thereof. The nucleotides forming the "overhang" can be U, T, or dT or a modified version thereof. In some embodiments, the "overhang" includes, but is not limited to, "TT", "dTdT", "UU", or a corresponding modified version thereof, such as 2' methoxy-modified UU, i.e., uu. In some embodiments, the "overhang" at the 3' and / or 5' end of the antisense strand of the dsRNA is substantially complementary to the target RNA. In some embodiments, the "overhang" at the 3' and / or 5' end of the antisense strand of the dsRNA is fully complementary to the target RNA. In some embodiments, the "overhang" at the 3' end of the antisense strand of the dsRNA is fully complementary to the target RNA. The term "blunt end", "blunt" or "blunt end" refers to the absence of unpaired nucleotides at the end of the dsRNA, i.e., no nucleotide overhang. The dsRNA with both ends being "blunt" or "blunt end" is the one with full-length double-stranded region, i.e., no nucleotide overhang at either end of the molecule.

[0340] In this application, the dsRNA or either single strand thereof is optionally modified, whether it is unmodified or modified ribonucleic acid is within the protection scope of this application. The modification does not cause the function of the dsRNA to inhibit the expression of the PD-L1 gene to be significantly weakened or lost. The modification of the dsRNA or either single strand thereof can be at the 5' end and / or 3' end terminal, nucleotide or inter-nucleotide linkage. Synthesis or modification can be carried out by methods known in the art.

[0341] In the present application, the modification of the nucleotide includes, but is not limited to, the modification on the sugar group of the nucleotide, including one or more substituted or removed sugar moiety group, such as removal of the hydroxyl group on the carbonyl group, or fluorination, amination, alkylation, hydroxyalkylation or hydroxyalkenylation. The modification on the sugar group can occur at each position on the sugar ring. Exemplarily, the modification on the sugar group of the nucleotide includes, but is not limited to, 2'-dehydroxylation, 2'-fluorination, 2'-amino, 2'-methyl, 2'-ethyl, 2'-methyl-O-methyl, 2'-ethyl-O-methyl, 2'-O-methyl, 2'-O-ethyl, 2'-O-ethyl-O-methyl or 2'-O-allyl, and the modified nucleoside structure can be shown as follows:

[0342] wherein Base represents a base.

[0343] In the present application, the modification of the linkage between the nucleotides includes the substitution or replacement of the atoms or functional groups of the phosphate group, such as phosphorothioate (PS), phosphorodithioate (PS2), methylphosphonate (MP), methoxypropylphosphonate (MOP) or aminophosphonate.

[0344] In the present application, the capital letters G, C, A, U or T each generally represent a nucleotide containing guanine, cytosine, adenine, uracil, thymine as a base, respectively, wherein the letter combination dT represents a deoxyribonucleotide with thymine as a base. The lower case letters g, c, a, u represent the ribose group of the nucleotide represented by its corresponding capital letter being modified by 2'-methoxy, i.e. g, c, a, u represent 2'-O-methyl G, 2'-O-methyl C, 2'-O-methyl A, 2'-O-methyl U, respectively. The capital letter plus the lower case letter f on its right side represents the ribose group of the nucleotide represented by its corresponding capital letter being modified by 2'-fluoro, i.e. Gf, Cf, Af, Uf represent 2'-fluoro G, 2'-fluoro C, 2'-fluoro A, 2'-fluoro U, respectively. The lower case letter s represents a phosphorothioate linkage between the two nucleotide residues adjacent to s on its left and right sides, for example, "csu" represents a phosphorothioate linkage between the c and u residues. VP- represents that the nucleotide on the right side of the hyphen is an (E)-vinyl phosphate modified nucleotide, for example, "VP-u" represents a (E)-vinyl phosphate modified 2'-O-methyl U.

[0345] In the present application, the 5' end and / or 3' end modification refers to a modification occurring at the 5' end and / or 3' end of either single strand of the dsRNA or either single strand, such as phosphorylation, conjugation or reverse linkage, etc. Taking the 5' end as an example, it includes but is not limited to 5'-phosphate, 5'-methylphosphonate (5'-MP), 5'-phosphorothioate (5'-PS) or 5'-(E)-vinylphosphonate (5'-(E)-VP), the modification mode and the structure of the modified nucleotide can be shown as follows:

[0346] wherein Base represents a base, and X is selected from hydroxyl or 2' modification on the sugar group.

[0347] In the present application, the ligand is a group connected to the dsRNA, which includes a branched group and a linker, and the dsRNA, the linker and the branched group are connected in turn (for example, as shown in formula 104). The branched group contains at least one (for example, one, two, three, four or five) pharmaceutically acceptable targeting group, which targets the dsRNA to a specific tissue or enhances cellular uptake. The targeting group is, for example but not limited to, a GalNAc (N-Acetylgalactosamine, for example, as shown in formula 105) group. The plurality of the targeting groups are connected in series or in parallel through the branched group. Among them, the GalNAc group can be monovalent, divalent, trivalent or tetravalent. Herein, monovalent, divalent, trivalent and tetravalent respectively refer to the molar ratio of the dsRNA molecule to the GalNAc molecule in the dsRNA-ligand conjugate after the dsRNA molecule in the present application is conjugated with the ligand containing GalNAc, which is 1:1, 1:2, 1:3 and 1:4. In some embodiments, when the dsRNA of the present application is conjugated with the ligand containing GalNAc, the GalNAc molecule is trivalent or tetravalent. In some embodiments, when the dsRNA of the present application is conjugated with the ligand containing GalNAc, the GalNAc molecule is trivalent.

[0348] In the present application, the ligand can be connected to the phosphate group of the nucleotide, the 2'-hydroxyl group, the 3'-hydroxyl group or the base. The ligand can be connected to any nucleotide of the dsRNA, including but not limited to the 5' or 3' terminal nucleotide of the sense strand or the antisense strand or the non-terminal intermediate position nucleotide. When the ligand is connected to the terminal of the dsRNA strand, the ligand can be connected to the phosphate group of the nucleotide; when the ligand is connected to the intermediate position nucleotide of the dsRNA, the ligand can be connected to the sugar ring or the base of the nucleotide.

[0349] In the present application, the kind or preparation method of the ligand can refer to the method known in the art, including but not limited to the ligand and its preparation method described in WO2009082607, WO2014025805, WO2015006740, WO2021249484, the entire disclosure of which is incorporated herein by reference. Exemplary ligands include but are not limited to L01 or L02 described above.

[0350] In the present application, unless otherwise specified, “conjugation” refers to the connection between two or more chemical moieties each having a specific function in a non-covalent connection or a covalent connection; accordingly, “conjugate” refers to the compound formed by the non-covalent connection or the covalent connection between the respective chemical moieties. In the present application, it is preferred to use the conjugate connected to each other in a covalent connection.

[0351] In the present application, the ligand is connected to the 5' or 3' end of the sense strand or the antisense strand. Preferably, the ligand is connected to the 5' or 3' end of the sense strand. More preferably, the ligand is connected to the 3' end of the sense strand. Exemplarily, the dsRNA connected with the ligand to form a dsRNA-ligand conjugate is shown in the following formula 102 or formula 103:

[0352] wherein the double helix structure represents the dsRNA.

[0353] The compounds of the present application (e.g., the double-stranded ribonucleic acids of the present application, the pharmaceutically acceptable salts thereof, the ligand conjugates thereof) can exist in particular geometric or stereoisomeric forms. All such geometric or stereoisomeric forms are within the scope of the present application. The present application contemplates all such compounds, including (R)- and (S)-enantiomeric, diastereomeric, and racemic mixtures thereof, and enriched mixtures of enantiomeric or diastereomeric forms, all of which are within the scope of the present application. Additional asymmetric carbon atoms can be present in a substituent group. All of these isomers, as well as mixtures thereof, are encompassed within the scope of the present application.

[0354] The term “enantiomer” or “optical isomer” means a stereoisomer whose mirror image is not superimposable.

[0355] The term “diastereomer” means a stereoisomer whose molecules have two or more chiral centers and whose molecules are not mirror images of one another.

[0356] Unless otherwise indicated, a wedge-shaped solid line bond and a wedge-shaped dashed line bond straight solid line bond and a straight dashed line bond wavy line crescent solid line bond or a crescent dashed line bond or a wavy line straight solid line bond and / or a straight dashed line bond

[0357] The term "enriched in one isomer," "isomerically enriched," "enriched in one enantiomer," or "enantiomerically enriched," unless otherwise indicated, means that the content of one isomer or enantiomer is less than 100% and the content of the isomer or enantiomer is greater than or equal to 60%, or greater than or equal to 70%, or greater than or equal to 80%, or greater than or equal to 90%, or greater than or equal to 95%, or greater than or equal to 96%, or greater than or equal to 97%, or greater than or equal to 98%, or greater than or equal to 99%, or greater than or equal to 99.5%, or greater than or equal to 99.6%, or greater than or equal to 99.7%, or greater than or equal to 99.8%, or greater than or equal to 99.9%.

[0358] The term "excess of isomer" or "excess of enantiomer," unless otherwise indicated, means the difference between the relative percentages of the two isomers or the two enantiomers. For example, where one isomer or enantiomer is present in 90% and the other isomer or enantiomer is present in 10%, the excess of isomer or enantiomer (the ee value) is 80%.

[0359] Optically active (R)- and (S)-isomers and D and L isomers can be prepared by chiral synthesis or chiral reagents or other conventional techniques. If one enantiomer of a compound of the application is desired, it can be prepared by asymmetric synthesis or derivatization with a chiral auxiliary, separation of the resulting diastereomeric mixture, and cleavage of the auxiliary to provide the pure desired enantiomer. Alternatively, when a basic functional group (such as an amino group) or an acidic functional group (such as a carboxyl group) is present in the molecule, diastereomeric salts with appropriate optically active acids or bases can be formed and the diastereomeric salt separated by conventional means, and the pure enantiomer recovered by treating with base or acid, as appropriate. In addition, separation of the enantiomers and diastereomers is often accomplished by chromatography using a chiral stationary phase, optionally in combination with chemical derivatization (e.g., formation of carbamates from amines). The compounds of the application can contain unnatural proportions of atomic isotopes at one or more atoms, for example, tritium ( 3 H), iodine-125 ( 125 I), or C-14.14 C). For example, deuterium can be substituted for hydrogen to form deuterium- containing drugs that are used in the same way as the non-deuterium-containing drugs. Deuterium can be incorporated into compounds of the application at its natural abundance level or in an enriched amount. All isotopically enriched forms of the compounds of the application, whether or not they are radioactive, are included within the scope of the application.

[0360] The term "treatment" means the administration of a compound or formulation described herein (e.g., a double-stranded ribonucleic acid of the application, a pharmaceutically acceptable salt thereof, a ligand conjugate thereof, or a pharmaceutical composition) to improve or eliminate a disease or one or more symptoms associated with the disease, and includes: (i) inhibiting the disease or condition, i.e., arresting its development; and (ii) relieving the disease or condition, i.e., causing regression of the disease or condition.

[0361] The term "prevention" means the administration of a compound or formulation described herein (e.g., a double-stranded ribonucleic acid of the application, a pharmaceutically acceptable salt thereof, a ligand conjugate thereof, or a pharmaceutical composition) to prevent a disease or one or more symptoms associated with the disease, and includes: preventing the onset of the disease or condition in a subject, particularly when such a subject is predisposed to the condition but has not yet been diagnosed as having it.

[0362] The terms "subject," "patient," or "object" are used interchangeably herein and refer to an animal that has been the object of treatment, observation or experiment. In some embodiments, the subject is a mammal, preferably a primate, and more preferably a human.

[0363] The term "therapeutically effective amount" means an amount of a compound of the application (e.g., a double-stranded ribonucleic acid of the application, a pharmaceutically acceptable salt thereof, or a ligand conjugate thereof) that (i) treats or prevents the particular disease, condition, or disorder, (ii) attenuates, ameliorates, or eliminates one or more symptoms of the particular disease, condition, or disorder, or (iii) prevents or delays the onset of one or more symptoms of the particular disease, condition, or disorder described herein. The amount that will constitute a "therapeutically effective amount" will vary depending on the compound, the disease state and its severity, the manner of administration, and the age of the subject to be treated, but can be routinely determined by the skilled practitioner according to his own knowledge and experience and according to the contents of this application.

[0364] The therapeutic dosage of the compounds of the present application can be determined by, for example, the particular use for which the treatment is made, the manner of administration of the compound, the health and condition of the patient, and the judgment of the prescribing physician. The proportion or concentration of a compound of the present application in a pharmaceutical composition can vary depending upon a number of factors, including dosage of the compound, chemical properties (e.g., hydrophobicity) and the route of administration. For example, a composition for parenteral administration can contain from about 0.1 to 10% w / v of the compound. Certain typical dose ranges are from about 1 μg / kg to about 1 g / kg body weight / day. In certain embodiments, the dose range is from about 0.01 mg / kg to about 100 mg / kg body weight / day. The dosage will likely depend on such variables as the kind and extent of the progression of the disease or disorder, the general health and age of the particular patient, the relative biological efficacy of the compound selected, the formulation of excipient and the route of administration. Effective doses can be extrapolated from dose-response curves derived from in vitro or animal model test systems.

[0365] The term "pharmaceutically acceptable" refers to those compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and other animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.

[0366] As the pharmaceutically acceptable salt, for example, a metal salt, an ammonium salt, a salt with an organic base, a salt with an inorganic acid, a salt with an organic acid, a salt with a basic or acidic amino acid, and the like can be mentioned.

[0367] The term "pharmaceutical composition" refers to a mixture of one or more compounds of the present application (e.g., a double-stranded ribonucleic acid of the present application, a pharmaceutically acceptable salt thereof, or a ligand conjugate thereof) with a pharmaceutically acceptable carrier, adjuvant, or vehicle. The object of a pharmaceutical composition is to facilitate administration of a compound of the present application to an organism. The terms "pharmaceutical composition" and "formulation" have the same meaning herein and are used interchangeably. The carriers, adjuvants or vehicles used in the pharmaceutical compositions herein include any and all solvents, diluents, or other liquid vehicles, dispersion or suspension aids, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, solid binders, lubricants and the like, as suited to the particular dosage form desired. The various adjuvants, excipients or vehicles used in the formulations of the pharmaceutical compositions of the present application and methods of manufacture thereof are known in the art. Except insofar as any conventional carrier medium is incompatible with a compound of the present application (e.g., by producing any undesirable biological effect or by interacting in a deleterious manner with any other component(s) of the pharmaceutical composition), its use is contemplated in the present application. In some embodiments, the carriers, adjuvants or vehicles used herein are those conventional in the art for the formulation of dsRNA for administration to a subject.

[0368] The pharmaceutical composition of the present application can be prepared by combining a compound of the present application with a suitable pharmaceutically acceptable carrier, adjuvant or excipient, and can be formulated into preparations in solid, semi-solid, liquid or gaseous forms, such as tablets, pills, capsules, powders, granules, ointments, emulsions, suspensions, suppositories, injections, inhalers, gels, microspheres, aerosols and the like.

[0369] Typical routes of administering the compounds of the present application or a pharmaceutical composition thereof include, but are not limited to, oral, rectal, topical, inhalation, parenteral, sublingual, intravaginal, intranasal, intraocular, intraperitoneal, intramuscular, subcutaneous, intravenous administration.

[0370] The pharmaceutical composition of the present application can be manufactured using methods well known in the art, such as conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, freeze-drying or lyophilizing processes.

[0371] In the kit of the present application, it comprises the double-stranded ribonucleic acid of the present application, its pharmaceutically acceptable salt, its ligand conjugate, or pharmaceutical composition thereof; and optionally the instructions for using the double-stranded ribonucleic acid of the present application, its pharmaceutically acceptable salt, its ligand conjugate, or pharmaceutical composition thereof to treat and / or prevent PNPLA3-mediated diseases.

[0372] The solvents used in the present application can be commercially available.

[0373] The solvent ratio used in the column chromatography and preparative thin layer silica gel chromatography of the present application is volume ratio, unless otherwise specified.

[0374] It is known in the art that modified nucleotide groups can be introduced into the dsRNA described in the present application by using nucleoside monomers with corresponding modifications. The preparation methods of nucleoside monomers with corresponding modifications and the methods of introducing modified nucleotide groups into dsRNA can be known to those skilled in the art from the prior art. All modified nucleoside monomers can be obtained from commercial channels or prepared by known methods.

[0375] As known in the art, the desired ribonucleic acid can be obtained by a conventional ribonucleic acid preparation method in the art, such as solid-phase synthesis and liquid-phase synthesis, for example, the desired ribonucleic acid can be synthesized by a phosphoramidite solid-phase synthesis technique. The method for preparing the double-stranded ribonucleic acid, the pharmaceutically acceptable salt thereof, or the ligand conjugate thereof of the present application comprises the following steps: sequentially connecting nucleotide monomers in the 3' to 5' direction according to the nucleotide species or sequence of the sense strand or the antisense strand of the double-stranded ribonucleic acid to synthesize the sense strand and the antisense strand. The connection of each nucleotide monomer includes a four-step reaction of deprotection, coupling, capping, oxidation or sulfurization. The skilled person in the art can use conventional reaction conditions, species and amounts of reagents, or adjust them according to the test situation to achieve the deprotection, coupling, capping, oxidation or sulfurization reaction.

[0376] In some embodiments, for the synthesis of the ribonucleic acid containing ligand, the ligand can be connected to the ribonucleic acid by a coupling reaction during the synthesis of the oligoribonucleotide or after the completion of the synthesis, or the ligand can be first connected to a solid-phase carrier, and then the nucleoside monomers are sequentially connected to the ligand-solid-phase carrier in the 3' to 5' direction.

[0377] The methods for purification and desalting are well known to those skilled in the art. For example, the purification of the ribonucleic acid can be completed by a preparative ion chromatography method. For another example, the desalting of the ribonucleic acid can be completed by a reverse phase chromatography purification method or an ultrafiltration centrifugation method.

[0378] The method for annealing is well known to those skilled in the art. For example, the sense strand and the antisense strand can be mixed in a 1:1 molar amount, heated to 70-95°C, and then reduced to room temperature to form a double-stranded structure.

[0379] During the synthesis, the concentration of the ribonucleic acid can be detected by, for example, ion exchange chromatography, or the molecular weight can be determined by liquid chromatography-mass spectrometry, or the concentration can be determined by a microspectrophotometer to control the synthesis quality, and such detection methods are well known to those skilled in the art.

[0380] Unless specifically stated otherwise, the singular term "a" or "an" means "at least one" or "one or more." Unless specifically stated otherwise, the use of the term "or" means "and / or." The term "comprising" means "including, but not limited to."

[0381] All patents, patent applications, and other publications identified are expressly incorporated herein by reference for the purposes of describing and disclosing, inter alia, the experiments described in such publications, and the publications in their entirety. Such publication is provided solely for their disclosure prior to the filing date of the present application. Nothing in this regard should be construed as a DETAILED DESCRIPTION

[0382] The present application is described in detail by the following examples, but it does not mean any unfavorable limitation to the present application. The compounds of the present application can be prepared by various synthetic methods well known to those skilled in the art, including the specific embodiments listed below, the embodiments formed by the combination of the specific embodiments with other chemical synthetic methods, and the equivalent replacement well known to those skilled in the art, and the preferred embodiments include but are not limited to the examples of the present application. It will be obvious to those skilled in the art that various changes and modifications can be made to the specific embodiments of the present application without departing from the spirit and scope of the present application.

[0383] It can be confirmed by detection methods such as mass spectrometry that the double-stranded ribonucleic acid, the pharmaceutically acceptable salt thereof, or the ligand conjugate thereof prepared is the target product.

[0384] Reagents and materials

[0385] Commercially available monomers used for synthesis

[0386] Reagents used for synthesis

[0387] The following abbreviations are used in the present application:

[0388] DIC represents N,N'-diisopropylcarbodiimide; DMAP represents 4-dimethylaminopyridine; DCM represents dichloromethane; ACN represents acetonitrile; DMT represents di-p-methoxytrityl; MEM represents 2-methoxyethoxymethyl.

[0389] siRNA sequence design and specificity analysis

[0390] The siRNA design was performed with the transcript NM_025225.3 of the human PNPLA3 gene and the transcript XM_005567051.3 of the cynomolgus monkey PNPLA3 gene as target genes. All siRNA sequences have 100% identity or 1-3 mismatches to the human transcript or 100% identity or 1-3 mismatches to the cynomolgus transcript or 100% identity or 1 mismatch to the mouse transcript NM_001408340.1.

[0391] Preparation Example 1 linking of GalNAc ligand (ligand containing GalNAc group as targeting group) to solid support

[0392] Amino-CPG 1.0 g (amino loading: 30-40 pmol / g) was weighed, 5 mL of decapping agent DBK was added, and the reaction was allowed to proceed for 1 min. The reagent was drained, and the above operation was repeated for 4 cycles. Based on the loading of 35 pmol, 2 eq of GalNAc ligand / acetonitrile solution was added, and 2.5 eq of condensation reagent composed of DIC and DMAP was added. The reaction was allowed to proceed at 25-30°C for 24 h. After completion, the solvent was filtered off, and anhydrous acetonitrile was used for washing. The GalNAc ligand and the condensation reagent were added in the above amounts, and the reaction was allowed to proceed for another 24 h. After completion of the reaction, the solid support was washed with anhydrous acetonitrile, 4 mL of a 1:1 mixture of Capping A and Capping B reagent was added, and the reaction was allowed to proceed for 2 min. After draining, 4 mL of the mixed reagent was added, and the reaction was allowed to proceed for 2 min. After draining, anhydrous acetonitrile was used for washing, and the solid support was dried under vacuum at 30°C for 1 h. The GalNAc ligand used in this example was L01 (or L02) ligand.

[0393] Preparation Example 2 preparation of double-stranded ribonucleic acid

[0394] 2.1.1 synthesis of GalNAc ligand-ssRNA (sense strand)

[0395] On the K&A nucleic acid synthesizer, the above GalNAc ligand-solid support was placed in the synthesis column, and ssRNA was synthesized according to the standard phosphoramidite technique. The specific steps included:

[0396] 1) DMT removal (deoxidation): The resin was washed with acetonitrile twice, and the DMT on the resin was removed with 3% trichloroacetic acid / DCM. The resin was washed with acetonitrile 4-5 times.

[0397] 2) condensation (coupling): The monomer was added to the synthesis column, and the condensation reagent was added. The condensation was allowed to proceed at room temperature for 10 min. The resin was washed with acetonitrile 4-5 times.

[0398] 3) blocking (capping): The unreacted hydroxyl group was blocked with Capping A first, and then with Capping B. The resin was washed with acetonitrile 4-5 times.

[0399] 4) Oxidation: Add oxidation reagent, oxidation time 2 min, then wash with acetonitrile 4-5 times.

[0400] Repeat steps 1) - 4) until all sequences are synthesized, then remove DMT with decapping reagent DBK, and wash with acetonitrile 4-5 times.

[0401] Thio-phosphodiester bond formation: replace oxidation reagent with thio-reagent, set thio time to 10 min, and complete thio-phosphodiester bond formation.

[0402] 2.1.2 Synthesis of ssRNA (ligand-free sense strand)

[0403] On a K&A nucleic acid synthesizer, place the universal CPG solid support into a synthesis column and synthesize ssRNA according to standard phosphoramidite technology. The specific steps include:

[0404] 1) DMT removal (deoxidation): Wash the resin with acetonitrile twice, remove DMT on the resin with 3% trichloroacetic acid / DCM, and wash with acetonitrile 4-5 times.

[0405] 2) Condensation (coupling): Add monomer to the synthesis column, add condensation reagent (2.5 eq DIC, 2.5 eq DMAP), and condense at room temperature for 10 min. Wash with acetonitrile 4-5 times.

[0406] 3) Blocking (capping): Block unreacted hydroxyl groups with Capping A, then with Capping B. Wash with acetonitrile 4-5 times.

[0407] 4) Oxidation: Add oxidation reagent, oxidation time 2 min, then wash with acetonitrile 4-5 times.

[0408] Repeat steps 1) - 4) until all sequences are synthesized, then remove DMT with decapping reagent, and wash with acetonitrile 4-5 times.

[0409] Thio-phosphodiester bond formation: replace oxidation reagent with thio-reagent, set thio time to 10 min, and complete thio-phosphodiester bond formation.

[0410] 2.2 Synthesis of asRNA (ligand-free antisense strand)

[0411] On a K&A nucleic acid synthesizer, place the above CPG solid support into a synthesis column and synthesize according to the method described in 2.1.1 or 2.1.2.

[0412] 2.3 Separation of ssRNA or asRNA from solid support

[0413] The cleavage reagent is ammonia: ethanol = 3: 1, 5 mL of the cleavage reagent is added to 100 mg of CPG solid carrier, and the reaction is stirred at 65-70°C for 3 h. After the reaction is completed, it is placed at room temperature, precipitated with ice n-butanol, and placed in a -20°C refrigerator for 30 min. Centrifugation obtains a precipitate, which is washed with n-butanol and repeated 2 times. Finally, the precipitate is washed with acetone, centrifuged to obtain a precipitate, vacuum dried, and a crude product is obtained, which is subjected to mass spectrometry detection.

[0414] The LC-MS (negative ion mode) conditions are as follows:

[0415] Chromatographic column: HILIC chromatographic column

[0416] Mobile phase A: 20 mm ammonium formate, pH 6.2

[0417] Mobile phase B: 20 mm ammonium formate + 95% ACN

[0418] Column temperature: 45°C

[0419] Flow rate: 1 mL / min.

[0420] 2.4 Annealing to form siRNA (dsRNA)

[0421] The single-stranded RNA crude product obtained in step 2.3 is dissolved with water, and the carrier is removed by membrane filtration. The concentrations of the sense strand and the antisense strand are determined by a microspectrophotometer, and the sense strand and the antisense strand are added (so that the molar content ratio is 1: 1), mixed, the denaturation temperature is 94°C, and maintained for 4 min; the annealing temperature is naturally cooled to room temperature.

[0422] 2.5 Purification of siRNA (dsRNA)

[0423] Purification is performed by applying a DNAPac RP 10*150mm 4μm chromatographic column, mobile phase A is 0.1 mol / L triethylamine, pH 8.0, mobile phase B is 0.1 mol / L triethylamine, pH 8.0 + 50% ACN; detection wavelength 215 nm, 260 nm. The main peak is collected, and most of the solvent is removed by rotary evaporation to obtain the target product.

[0424] 2.6 Desalination and content calibration

[0425] Ultrafiltration concentration and desalination are performed using a 3K ultrafiltration centrifuge tube, 12000xg, centrifugation time 12 min; after the liquid is concentrated by rotary evaporation, water is added for replacement, and the above steps are repeated 5 times or more.

[0426] Concentration determination: the concentrated sample is subjected to concentration determination by a microspectrophotometer.

[0427] The double-stranded ribonucleic acid or its ligand conjugate is as follows:

[0428] Table 8. Double-stranded ribonucleic acid or ligand conjugate thereof

[0429] wherein, capital letters G, C, A, or U each generally represent a nucleotide containing guanine, cytosine, adenine, or uracil as the base, respectively; lower case letters g, c, a, u represent the ribose group of the nucleotide represented by their corresponding capital letters being modified by 2'-methoxy, i.e., g, c, a, u represent 2'-O-methyl G, 2'-O-methyl C, 2'-O-methyl A, 2'-O-methyl U, respectively; capital letter plus lower case letter f on the right side thereof represent the ribose group of the nucleotide represented by their corresponding capital letter being modified by 2'-fluoro, i.e., Gf, Cf, Af, Uf represent 2'-fluoro G, 2'-fluoro C, 2'-fluoro A, 2'-fluoro U, respectively; lower case letter s indicates a phosphorothioate linkage between the two nucleotide residues adjacent to s on the left and right sides, e.g., "csu" indicates a phosphorothioate linkage between the c and u residues, L represents a ligand, e.g., the structure of L01 ligand and L02 ligand are shown below:

[0430] The double-stranded ribonucleic acid, pharmaceutically acceptable salt thereof, or ligand conjugate thereof (the ligand L is selected from L01 ligand or L02 ligand) described above can be prepared according to the method described in the present application or known in the art.

[0431] The mass spectrometry detection data of the double-stranded ribonucleic acid, pharmaceutically acceptable salt thereof, or ligand conjugate thereof of the present application are consistent with expectations, and it can be confirmed that the target product is obtained.

[0432] Test Example 1 A cell culture and siRNA-mediated in vitro gene silencing A

[0433] Human cells Hep3B (hepatoma) were purchased from Shanghai Cell Bank. The cells were cultured at 37°C in a 5% carbon dioxide concentration and using the MEM (Gibco, 11095-080) culture medium specified by ATCC.

[0434] The day before transfection, Hep3B cells were counted and seeded in a 96-well plate (Costa, 3610) and cultured overnight. The next day, different concentrations of siRNA were added to OPTI-MEM containing RNAiMAX and mixed, and then added to the 96-well plate after standing at room temperature for 5 min, and cultured at 37°C, 5% CO2 for 48 h, and then QuantiGene RNA (Thermo Fisher, QS0013) was used to detect the mRNA expression analysis for PNPLA3.

[0435] Add the lysis mixture to the 96-well plate containing the cells, and incubate the cells at 50-55°C; after the incubation, mix well. Perform the QuantiGene hybridization experiment. Mix the prepared probe working solution quickly by vortexing, and add 10 μL / well to the capture plate. Add the above diluted sample to the capture plate containing the probe at 40 μL / well, add 40 μL / well of the diluted lysis solution to the blank control well, seal the capture plate with sealing film, and incubate at 55±1°C for 16-20 h.

[0436] After the incubation, wash three times, add 50 μL of Amplifier Solution to each well, seal the capture plate with sealing film, and incubate at 55±1°C for 60 min. After the incubation, wash, add 50 μL of Label Probe working solution to each well, seal the capture plate with sealing film, and incubate at 50±1°C for 60 min. After the incubation, wash the plate twice, add 50 μL of colorimetric luminescent substrate to each well, seal with sealing film, incubate at room temperature in the dark for 5 min, tear off the sealing film, and detect the chemiluminescence value (RLU) by chemiluminescence within 15 min (the detection interval is 0.2 s). The silencing efficiency calculation formula is as follows: siRNA silencing efficiency (%) = (1- (RLU sample group-RLU blank group) / (RLU control group-RLU blank group)) x 100%. The siRNA silencing efficiency is shown in the following table.

[0437] Table 9A1. Determination of siRNA silencing efficiency in Hep3B cells

[0438] Table 9A2. Determination of siRNA silencing efficiency in Hep3B cells

[0439] Test Example 1B Cell culture and siRNA-mediated in vitro gene silencing

[0440] The human cells Hep3B (liver cancer) were purchased from Shanghai Cell Bank. The cells were cultured at 37°C in a 5% carbon dioxide concentration and using the ATCC-specified MEM (Gibco, 11095-080) culture medium. The day before transfection, the Hep3B cells were counted and seeded in a 96-well plate (Costa, 3610) and cultured overnight. The next day, different concentrations of siRNA were added to the OPTI-MEM containing RNAiMAX, mixed, and incubated at room temperature for 5 min, and then added to the 96-well plate, which was cultured at 37°C in 5% CO2 for 48 h for subsequent experiments.

[0441] The cell RNA was extracted by using a full-automatic nucleic acid extractor (ALLSHENG, Auto-Pure96) and a magnetic bead method universal RNA extraction kit (ONREW, RNC643-03H). An appropriate amount of 200 μL of lysis buffer PLB was added to the cultured cells, and the cells were vortexed or dispersed with a pipette gun. After standing at room temperature for five minutes, the program was started, and the sample or reagent 96-well plate was placed in the corresponding card slot of the KingFisher Flex nucleic acid extraction instrument according to the prompts.

[0442] After the extraction was completed, the extracted mRNA was subjected to reverse transcription operation, 5x PrimeScript Master Mix (TAKARA, RR036A-1) was used, and the experimental operation was performed according to the manufacturer's instructions. The reverse transcription reaction was performed: after gentle mixing, the reverse transcription reaction was performed, and the conditions were as follows: 37°C for 15 min (reverse transcription reaction), 85°C for 5 sec (reverse transcriptase inactivation reaction), and 4°C for incubation.

[0443] Next, the qPCR experiment was performed, 2x ChamQ SYBR qpcr kit (Vazyme, Q331-02-AA) was used, after the reagents in the kit were completely melted, mixed and centrifuged, Roche lightcycle-480 fluorescence quantitative PCR instrument was used for qPCR detection.

[0444] The primer sequences used in the PCR process are as follows:

[0445] Human PNPLA3-Foward: 5'-CCTTGGTATGTTCCTGCTTCA-3' (SEQ ID NO. 47)

[0446] Human PNPLA3-Reverse: 5'-ACACGGTGATGGTTGTTTTGG-3' (SEQ ID NO. 48)

[0447] Human GAPDH-Foward: 5'-GGTCGGAGTCAACGGATTT-3' (SEQ ID NO. 49)

[0448] Human GAPDH-Reverse: 5'-CCAGCATCGCCCCACTTGA-3' (SEQ ID NO. 50).

[0449] The difference between the Ct value of the gene to be tested and the Ct value of the internal reference gene, i.e. △Ct, represents the expression intensity of the gene to be tested relative to the internal reference gene. △(△Ct) = (expression amount of PNPLA3 mRNA in the experimental group - expression amount of GAPDH mRNA in the experimental group) - (expression amount of PNPLA3 mRNA in the control group - expression amount of GAPDH mRNA in the control group). The PNPLA3 mRNA inhibition rate calculation formula: (1-2^-(△(△Ct))) x 100%, and the EC50 value is obtained by fitting the inhibition rate curve of different concentrations of siRNA. The EC50 value and the maximum inhibition rate of siRNA calculated according to the above method are shown in the following table.

[0450] Table 9B. Determination of siRNA silencing efficiency in Hep3B cells

[0451] Table 9C. Determination of siRNA silencing efficiency in Hep3B cells

[0452] Test Example 2: RT-qPCR determination of the in vitro silencing efficiency of modified siRNA molecules

[0453] Hep3B cells (PNPLA3 wild type) were selected, and the siRNA inhibition activity on PNPLA3 mRNA was detected by RNA extraction method, and the EC50 was analyzed. Hep3B cells were inoculated in a 96-well plate, and after overnight culture, different concentrations of siRNA were transfected using RNAiMAX, and after 48 hours of culture, subsequent experiments were performed.

[0454] The cell RNA was extracted by using a full-automatic nucleic acid extractor (ALLSHENG, Auto-Pure96) and a magnetic bead method universal RNA extraction kit (ONREW, RNC643-03H). An appropriate amount of 200 μL of lysis Buffer PLB was added to the cultured cells, and the cells were vortexed or dispersed with a pipette gun. After standing at room temperature for five minutes, the program was started, and the 96-well plate of samples or reagents was placed in the corresponding card slot of the KingFisher Flex nucleic acid extraction instrument according to the prompts.

[0455] After extraction, the extracted mRNA was subjected to reverse transcription operation, 5x PrimeScript Master Mix (TAKARA, RR036A-1) was used, and the experimental operation was performed according to the manufacturer's instructions. The reverse transcription reaction was as follows: gentle mixing, reverse transcription reaction at 37°C for 15 min, reverse transcriptase inactivation reaction at 85°C for 5 sec, and 4°C incubation.

[0456] Next, qPCR experiments were performed using a 2x ChamQ SYBR qpcr kit (Vazyme, Q331-02-AA). After the reagents in the kit were completely melted, they were mixed and centrifuged. A Roche lightcycle-480 fluorescence quantitative PCR instrument was used for qPCR detection.

[0457] The primer sequences used in the PCR process are as follows:

[0458] Human PNPLA3-Foward: 5'-CCTTGGTATGTTCCTGCTTCA-3' (SEQ ID NO. 47)

[0459] Human PNPLA3-Reverse: 5'-ACACGGTGATGGTTGTTTTGG-3' (SEQ ID NO. 48)

[0460] Human GAPDH-Foward: 5'-GGTCGGAGTCAACGGATTT-3' (SEQ ID NO. 49)

[0461] Human GAPDH-Reverse: 5'-CCAGCATCGCCCCACTTGA-3' (SEQ ID NO. 50).

[0462] The difference between the Ct value of the gene to be tested and the Ct value of the reference gene, i.e., △Ct, represents the expression intensity of the gene to be tested relative to the reference gene. △(△Ct) = (expression amount of PNPLA3 mRNA in the experimental group - expression amount of GAPDH mRNA in the experimental group) - (expression amount of PNPLA3 mRNA in the control group - expression amount of GAPDH mRNA in the control group). The PNPLA3 mRNA inhibition rate calculation formula is: (1-2^-(△(△Ct)))x100%, and the EC50 value is obtained by fitting the inhibition rate curve of different concentrations of siRNA. The EC50 value and the maximum inhibition rate of siRNA calculated according to the above method are shown in the following table.

[0463] Table 10. Determination of EC50 and silencing efficiency of siRNA in Hep3B cells

[0464] Since the population with the genotype PNPLA3-I148M mutant is susceptible to NASH, qPCR experiments were also performed on the HepG2 cell line containing the PNPLA3-I148M mutant, and the experimental methods and primers used were the same as those described above. The measured EC50 value and the maximum inhibition rate of siRNA are shown in the following table.

[0465] Table 11A. Determination of EC50 and silencing efficiency of siRNA in HepG2 cells

[0466] In addition, Quantigene experiments were performed on HepG2 cell lines containing PNPLA3-I148M mutants, and the experimental methods were the same as those in Test Example 1A. The measured EC50 values and maximum inhibition rates of siRNA are shown in the following table.

[0467] Table 11B. Determination of EC50 and silencing efficiency of siRNA in HepG2 cells

[0468] Test Example 3A siRNA-mediated in vitro gene silencing in mouse liver primary cells A

[0469] AAV-PNPLA3 (Vitravene) was prepared into a solution with a concentration of 1 x 10 11 vg / mL with sterile PBS in advance before injection. Each 4-6 week old C57BL / 6 mouse was injected with 200 μL via the tail vein, i.e., each mouse was injected with 2 x 10 10 vg of AAV-CTM-PNPLA3 (Vitravene) virus. Subcutaneous injection (SC) was used for administration at 21 days after infection, and the administration volume was 10 mL / kg of mouse body weight. The first administration day was set as day 0 after administration. Liver tissues were obtained from each group at 7 days and 14 days after administration for detection of hPNPLA3 mRNA expression levels.

[0470] The inhibitory effect of siRNA on PNPLA3 mRNA expression in mouse liver is shown in the following table.

[0471] Table 12A. Inhibitory effect of siRNA on PNPLA3 mRNA expression in mouse liver

[0472] Test Example 3B siRNA-mediated in vitro gene silencing in mouse liver primary cells B

[0473] 4-6 week old SPF C57BL / 6 mice were purchased from Shanghai Slac Animal Limited Liability Company, and injected with 1 x 10 11In mice infected with AAV-CTM-PNPLA3-I148M virus (vg), liver perfusion was performed 14 days later using Virbac 50 (8V8KA) anesthetized mice. The perfusion fluid was purchased from Liver Biotechnolog. After perfusion, the liver capsule was torn open with forceps, and the hepatocytes were gently shaken out to obtain a milky suspension. The suspension was filtered through a 70µm (200 mesh) sterile sieve and centrifuged twice. The extracted primary mouse hepatocytes were selected and pre-coated with 0.25 mL / well collagen (Corning, 354236) in 48-well plates (Corning, 354236). After 5 minutes, the collagen was removed, and the cell suspension was diluted to 4 × 10⁻⁶. 5 Cell density of cells / mL, at 1×10 5 Seed 0.25 mL of the prepared siRNA into a 48-well plate. Add 5 μL of the prepared siRNA to each well of the cell-containing culture plate and incubate at 37°C for 48 h. Extract cellular RNA using an automated nucleic acid extractor (ALLSHENG, Auto-Pure96) and a universal RNA extraction kit using magnetic beads (ONREW, RNC643-03H). Add 200 μL of lysis buffer PLB to the cultured cells, vortex or pipette to disperse the cells, incubate at room temperature for five minutes, then start the program. Follow the prompts to place the sample or reagent into the corresponding slot of the KingFisher Flex nucleic acid extractor.

[0474] After extraction, the extracted mRNA was reverse transcribed using 5×PrimeScript Master Mix (TAKARA, RR036A-1) and the experimental procedure was performed according to the manufacturer's instructions. The reverse transcription reaction was carried out by gently mixing the mixture under the following conditions: 37℃ for 15 min (reverse transcription reaction), 85℃ for 5 sec (reverse transcriptase inactivation reaction), and incubation at 4℃.

[0475] Next, qPCR experiments were performed using the 2×ChamQ SYBR qPCR kit (Vazyme, Q331-02-AA). After the reagents in the kit were completely melted, the mixture was stirred and then centrifuged briefly. qPCR detection was then performed using a Roche Lightcycle-480 real-time PCR instrument.

[0476] The calculated maximum inhibition rate of siRNA is shown in the table below.

[0477] Table 12B. Determination of siRNA silencing efficiency in mouse primary liver cells

[0478] Experiment 4: Stability test of siRNA in mouse liver homogenate

[0479] According to the proportion of 1 mL tissue lysate added per 200 mg liver tissue (C57BL / 6 mice), the tissue grinder was ground at -30°C, the grinding liquid was collected, the siRNA to be tested was incubated with mouse liver homogenate at 37°C for 48 h, then LC-MS / MS was used for sample concentration detection, zero was used as a control, the remaining percentage was calculated using the analyte peak area, the remaining amount of siRNA in mouse liver homogenate was analyzed, and the stability of siRNA in liver homogenate was reacted.

[0480] The remaining amount of siRNA in mouse liver homogenate is shown in the following table.

[0481] Table 13 Stability of siRNA in mouse liver homogenate

Claims

1. A double-stranded ribonucleic acid (dsRNA), a pharmaceutically acceptable salt thereof, or a ligand conjugate thereof, the dsRNA comprising a sense strand and an antisense strand, the sense strand comprising at least 15 contiguous nucleotides of a nucleotide sequence as set forth in SEQ ID NO. 1, SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 7, SEQ ID NO. 9, SEQ ID NO. 11, SEQ ID NO. 25, SEQ ID NO. 29, SEQ ID NO. 33, or SEQ ID NO. 39 and the sense strand is no more than 21 nucleotides in length, the antisense strand comprising at least 15 contiguous nucleotides of a nucleotide sequence as set forth in SEQ ID NO. 2, SEQ ID NO. 4, SEQ ID NO. 6, SEQ ID NO. 8, SEQ ID NO. 10, SEQ ID NO. 12, SEQ ID NO. 26, SEQ ID NO. 30, SEQ ID NO. 34, SEQ ID NO. 37, SEQ ID NO. 40, SEQ ID NO. 43, or SEQ ID NO. 45 and the sense strand is no more than 23 nucleotides in length: sense strand: 5'-CCUUCAACUUAAGCAAGUU-3' (SEQ ID NO. 1), antisense strand: 5'-AACUUGCUUAAGUUGAAGGAU-3' (SEQ ID NO. 2); sense strand: 5'-CCACCAGCUCAUCUCCGGC-3' (SEQ ID NO. 3), antisense strand: 5'-GCCGGAGAUGAGCUGGUGGAC-3' (SEQ ID NO. 4); sense strand: 5'-CGAGGAUAUUUGGAUGCAU-3' (SEQ ID NO. 5), antisense strand: 5'-AUGCAUCCAAAUAUCCUCGAA-3' (SEQ ID NO. 6); sense strand: 5'-AAGGGAUGGAUCCUGAGGU-3' (SEQ ID NO. 7), antisense strand: 5'-ACCUCAGGAUCCAUCCCUUCU-3' (SEQ ID NO. 8); sense strand: 5'-CUACAGCACUGAGUGAAGA-3' (SEQ ID NO. 9), antisense strand: 5'-UCUUCACUCAGUGCUGUAGCG-3' (SEQ ID NO. 10); sense strand: 5'-AGGUGGUCUGCAAAGAUGA-3' (SEQ ID NO. 11), antisense strand: 5'-UCAUCUUUGCAGACCACCUGA-3' (SEQ ID NO. 12); Sense: 5 '-CUUGCUACCCAUUAGGAUG 1 -3' (SEQ ID NO. 29), Antisense: 5'- 1 AUCCUAAUGGGUAGCAAGY 2 Y 3 -3' (SEQ ID NO. 30); ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ Sense: 5 '-UUUGCAACUUGCUACCCAU-3'(SEQ ID NO. 25), Antisense: 5 '-AUGGGUAGCAAGUUGCAAAUC-3'(SEQ ID NO. 26); Sense: 5 '-CUUGCUACCCAUUAGGAUA-3'(SEQ ID NO. 33), Antisense: 5 '-UAUCCUAAUGGGUAGCAAGUU-3'(SEQ ID NO. 34); Sense: 5 '-CUUGCUACCCAUUAGGAUA-3'(SEQ ID NO. 33), Antisense: 5 '-UAUCCUAAUGGGUAGCAAGGG-3'(SEQ ID NO. 37); Sense: 5 '-CUUGCUACCCAUUAGGAUU-3'(SEQ ID NO. 39), Antisense: 5 '-AAUCCUAAUGGGUAGCAAGAU-3'(SEQ ID NO. 40); Sense: 5 '-CUUGCUACCCAUUAGGAUU-3'(SEQ ID NO. 39), Antisense: 5 '-AAUCCUAAUGGGUAGCAAGCG-3'(SEQ ID NO. 43); Sense: 5 '-CUUGCUACCCAUUAGGAUU-3'(SEQ ID NO. 39), Antisense: 5 '-AAUCCUAAUGGGUAGCAAGUC-3'(SEQ ID NO. 45); said X 1 , Y 1 , Y 2 or Y 3 are each independently selected from A, U, C or G, the sense strand or the antisense strand is optionally modified.

2. The double-stranded ribonucleic acid, a pharmaceutically acceptable salt thereof, or a ligand conjugate thereof of claim 1, wherein, the sense strand contains a nucleotide sequence as set forth in SEQ ID NO. 1, SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 7, SEQ ID NO. 9, SEQ ID NO. 11, SEQ ID NO. 25, SEQ ID NO. 29, SEQ ID NO. 33, or SEQ ID NO. 39 and the length of the sense strand is no more than 21 nucleotides, and the antisense strand contains a nucleotide sequence as set forth in SEQ ID NO. 2, SEQ ID NO. 4, SEQ ID NO. 6, SEQ ID NO. 8, SEQ ID NO. 10, SEQ ID NO. 12, SEQ ID NO. 26, SEQ ID NO. 30, SEQ ID NO. 34, SEQ ID NO. 37, SEQ ID NO. 40, SEQ ID NO. 43, or SEQ ID NO. 45 and the length of the antisense strand is no more than 23 nucleotides.

3. The double-stranded ribonucleic acid, a pharmaceutically acceptable salt thereof, or a ligand conjugate thereof of claim 1, wherein, the nucleotide sequence of the antisense strand is a nucleotide sequence as set forth in SEQ ID NO. 2, SEQ ID NO. 4, SEQ ID NO. 6, SEQ ID NO. 8, SEQ ID NO. 10, SEQ ID NO. 12, SEQ ID NO. 26, SEQ ID NO. 30, SEQ ID NO. 34, SEQ ID NO. 37, SEQ ID NO. 40, SEQ ID NO. 43, or SEQ ID NO.

45.

4. The double-stranded ribonucleic acid, pharmaceutically acceptable salt thereof, or ligand conjugate thereof of any of claims 1-3, wherein, the sense strand or the antisense strand optionally comprises an overhang at the 5' end and / or the 3' end.

5. The double-stranded ribonucleic acid, a pharmaceutically acceptable salt thereof, or a ligand conjugate thereof of claim 4, wherein, the overhang contains 1, 2, 3, 4, or 5 nucleotides; or the overhang contains 1 or 2 nucleotides; or the overhang is 1, 2, 3, 4, or 5 nucleotides at the 5' end and / or the 3' end of the sense strand or the antisense strand; or the dsRNA, the pharmaceutically acceptable salt thereof, or the ligand conjugate thereof comprises an additional sequence as an overhang.

6. The double-stranded ribonucleic acid, a pharmaceutically acceptable salt thereof, or a ligand conjugate thereof of claim 4 or 5, wherein, the overhang is selected from unmodified or modified A, G, C, U, or T; or is selected from unmodified or modified U or T; or when the additional sequence as an overhang is 1 nucleotide, the overhang is selected from u or dT; or when the additional sequence as an overhang is 2 nucleotides, the overhang is selected from uu or dTdT.

7. The double-stranded ribonucleic acid of any one of claims 4 to 6, a pharmaceutically acceptable salt thereof, or a ligand conjugate thereof, wherein, the additional sequence as an overhang is connected to its adjacent nucleotide(s) by a phosphodiester group or a phosphorothioate group; or one or more nucleotides in the additional sequence as an overhang are connected by a phosphodiester group or a phosphorothioate group.

8. The double-stranded ribonucleic acid, pharmaceutically acceptable salt thereof, or ligand conjugate thereof of any one of claims 1 to 7, wherein, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 nucleotides of the sense strand are modified, or the nucleotides within any range formed by the aforementioned any values are modified; or more than 1, more than 2, more than 3, more than 4, more than 5, more than 6, more than 7, more than 8, more than 9, more than 10, more than 11, more than 12, more than 13, more than 14, more than 15, more than 16, more than 17, more than 18, more than 19, more than 20, or more than 21 nucleotides of the sense strand are modified; or all nucleotides of the sense strand are modified; and / or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 nucleotides of the antisense strand are modified, or the nucleotides within any range formed by the aforementioned any values are modified; or more than 1, more than 2, more than 3, more than 4, more than 5, more than 6, more than 7, more than 8, more than 9, more than 10, more than 11, more than 12, more than 13, more than 14, more than 15, more than 16, more than 17, more than 18, more than 19, more than 20, or more than 21 nucleotides of the antisense strand are modified; or all nucleotides of the antisense strand are modified. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides of the antisense strand are modified, or the nucleotides within any range formed by any of the foregoing values are modified; or more than 1, more than 2, more than 3, more than 4, more than 5, more than 6, more than 7, more than 8, more than 9, more than 10, more than 11, more than 12, more than 13, more than 14, more than 15, more than 16, more than 17, more than 18, more than 19, more than 20, more than 21, more than 22, or more than 23 nucleotides of the antisense strand are modified; or all of the nucleotides of the antisense strand are modified.

9. The double-stranded ribonucleic acid of any of claims 1 to 8, a pharmaceutically acceptable salt thereof, or a ligand conjugate thereof, wherein, The modification is selected from a sugar modification of a nucleotide, a linkage modification between nucleotides, or a terminal modification.

10. The double-stranded ribonucleic acid, pharmaceutically acceptable salt thereof, or ligand conjugate thereof of any one of claims 1 to 9, wherein, The sugar modification of a nucleotide is selected from 2'-dehydroxylation, 2'-fluoro, 2'-amino, 2'-alkyl, 2'-O-alkyl, 2'-O-ether, 2'-O-alkenyl; or the sugar modification of a nucleotide is selected from 2'-dehydroxylation, 2'-fluoro, 2'-amino, 2'-methyl, 2'-ethyl, 2'-methyl-O-methyl, 2'-ethyl-O-methyl, 2'-O-methyl, 2'-O-ethyl, 2'-O-ethyl-O-methyl, or 2'-O-allyl; The linkage modification between nucleotides is selected from phosphorothioate (PS), phosphorodithioate (PS2), methylphosphonate (MP), methoxypropylphosphonate (MOP), or aminophosphonate; or the linkage modification between nucleotides is selected from phosphorothioate (PS); and / or The terminal modification is selected from a 5'-terminal modification or a 3'-terminal modification; or the terminal modification is selected from 5'-phosphate, 5'-methylphosphonate (5'-MP), 5'-phosphorothioate (5'-PS), or 5'-(E)-vinylphosphonate (5'-(E)-VP).

11. The double-stranded ribonucleic acid of any one of claims 1 to 10, a pharmaceutically acceptable salt thereof, or a ligand conjugate thereof, wherein, The first and / or second internucleotide linkage of the sense strand is a phosphorothioate linkage, and / or the first, second, nineteenth, and / or twentieth internucleotide linkage of the antisense strand is a phosphorothioate linkage.

12. The double-stranded ribonucleic acid of any one of claims 1 to 11, a pharmaceutically acceptable salt thereof, or a ligand conjugate thereof, wherein, The sense strand has 2, 3, 4, or 5 nucleotides with 2'-fluoro modification, and the sense strand has 14, 15, 16, 17, 18, or 19 nucleotides with 2'-O-methyl modification; and / or The antisense strand has 2, 3, 4, 5, 6, or 7 nucleotides with 2'-fluoro modification, and the antisense strand has 14, 15, 16, 17, 18, 19, 20, or 21 nucleotides with 2'-O-methyl modification.

13. The double-stranded ribonucleic acid of any one of claims 1 to 12, a pharmaceutically acceptable salt thereof, or a ligand conjugate thereof, wherein, zero, one or two of the nucleotides at positions 1-6 of the sense strand are 2'-fluoro modified, four, five or six of the nucleotides at positions 1-6 of the sense strand are 2'-0-methyl modified, two or three of the nucleotides at positions 7-9 of the sense strand are 2'-fluoro modified, zero or one of the nucleotides at positions 7-9 of the sense strand are 2'-0-methyl modified, zero or one of the nucleotides at positions 10-19 of the sense strand are 2'-fluoro modified, eight, nine or ten of the nucleotides at positions 10-19 of the sense strand are 2'-0-methyl modified; or the nucleotides at positions 7, 8 and 9 of the sense strand are 2'-fluoro modified and zero, one or two of the nucleotides at positions 1-6 and / or 10-19 of the sense strand are also 2'-fluoro modified; or the nucleotides at positions 7, 8 and 9 of the sense strand are 2'-fluoro modified and zero, one or two of the nucleotides at positions 1-6 and / or 10-19 of the sense strand are also 2'-fluoro modified.

14. The double-stranded ribonucleic acid of any of claims 1 to 13, a pharmaceutically acceptable salt thereof, or a ligand conjugate thereof, wherein, three or four of the nucleotides at positions 2, 6, 14, 16 of the antisense strand are 2'-fluoro modified; or three, four, five or six of the nucleotides at positions 2, 6, 8, 9, 14, 16 of the antisense strand are 2'-fluoro modified; or the nucleotides at positions 2, 6, 14 and 16 of the antisense strand are 2'-fluoro modified and any one or two of the nucleotides at positions 1, 3-5, 7-13, 15, 17-21 and / or 17-23 of the antisense strand are also 2'-fluoro modified; or fourteen, fifteen, sixteen, seventeen, eighteen or nineteen of the nucleotides at positions 1, 3-5, 7, 10-13, 15, 17-21, and / or 17-23 of the antisense strand are 2'-0-methyl modified.

15. The double-stranded ribonucleic acid of any one of claims 1 to 14, a pharmaceutically acceptable salt thereof, or a ligand conjugate thereof, wherein, the ligand in the ligand conjugate comprises at least one targeting group; or the ligand comprises one, two, three, four or five targeting groups.

16. The double-stranded ribonucleic acid of claim 15, a pharmaceutically acceptable salt thereof, or a ligand conjugate thereof, wherein, the targeting group is a GalNAc group.

17. The double-stranded ribonucleic acid, pharmaceutically acceptable salt thereof, or ligand conjugate thereof of any one of claims 1 to 16, wherein the ligand in the ligand conjugate comprises a branched moiety:

18. The double-stranded ribonucleic acid of any one of claims 1 to 17, a pharmaceutically acceptable salt thereof, or a ligand conjugate thereof, wherein, The ligand in the ligand conjugate is selected from:

19. The double-stranded ribonucleic acid of any one of claims 1 to 18, a pharmaceutically acceptable salt thereof, or a ligand conjugate thereof, wherein, the ligand in the ligand conjugate is attached to the 5' or 3' end of the sense strand; or the ligand is attached to the 5' or 3' end of the sense strand; or the ligand is attached to the 3' end of the sense strand.

20. The double-stranded ribonucleic acid of any one of claims 1 to 19, a pharmaceutically acceptable salt thereof, or a ligand conjugate thereof, wherein, the double stranded ribonucleic acid comprises any one of the following sense strands: SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 33, SEQ ID NO: 39, SEQ ID NO: 27, SEQ ID NO: 35, or SEQ ID NO: 41; and the double stranded ribonucleic acid comprises any one of the following antisense strands: SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 34, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 28, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 42, SEQ ID NO: 44, or SEQ ID NO:

46.

21. The double-stranded ribonucleic acid of any one of claims 1 to 20, a pharmaceutically acceptable salt thereof, or a ligand conjugate thereof, wherein, The double-stranded ribonucleic acid comprises the following sequence pairs of sense and antisense strands: SEQ ID NO: 1 / SEQ ID NO: 2, SEQ ID NO: 3 / SEQ ID NO: 4, SEQ ID NO: 5 / SEQ ID NO: 6, SEQ ID NO: 7 / SEQ ID NO: 8, SEQ ID NO: 9 / SEQ ID NO: 10, SEQ ID NO: 11 / SEQ ID NO: 12, SEQ ID NO: 13 / SEQ ID NO: 14, SEQ ID NO: 15 / SEQ ID NO: 16, SEQ ID NO: 17 / SEQ ID NO: 18, SEQ ID NO: 19 / SEQ ID NO: 20, SEQ ID NO: 21 / SEQ ID NO: 22, SEQ ID NO: 23 / SEQ ID NO: 24, SEQ ID NO: 25 / SEQ ID NO: 26, SEQ ID NO: 33 / SEQ ID NO: 34, SEQ ID NO: 33 / SEQ ID NO: 37, SEQ ID NO: 39 / SEQ ID NO: 40, SEQ ID NO: 39 / SEQ ID NO: 43, SEQ ID NO: 39 / SEQ ID NO: 45, SEQ ID NO: 27 / SEQ ID NO: 28, SEQ ID NO: 35 / SEQ ID NO: 36, SEQ ID NO: 35 / SEQ ID NO: 38, SEQ ID NO: 41 / SEQ ID NO: 42, SEQ ID NO: 41 / SEQ ID NO: 44, or SEQ ID NO: 41 / SEQ ID NO:

46.

22. The double-stranded ribonucleic acid of any one of claims 1 to 20, a pharmaceutically acceptable salt thereof, or a ligand conjugate thereof, wherein, The ligand conjugate is selected from any one of the following: The sense strand comprises 5'-cscsuucaAfCfUfuaagcaaguu (SEQ ID NO: 13)-L-3' and the antisense strand comprises 5'-asAfscuuGfcuuaaguUfgAfaggsasu-3' (SEQ ID NO: 14); The sense strand comprises 5'-cscsaccaGfCfUfcaucuccggc (SEQ ID NO: 15)-L-3' and the antisense strand comprises 5'-gsCfscggAfgaugagcUfgGfuggsasc-3' (SEQ ID NO: 16); The sense strand comprises 5'-csgsaggaUfAfUfuuggaugcau (SEQ ID NO: 17)-L-3' and the antisense strand comprises 5'-asUfsgcaUfccaaauaUfcCfucgsasa-3' (SEQ ID NO: 18); the antisense strand comprises 5'- usCfsuucAfcucagugCfuGfuagscsg -3' (SEQ ID NO: 22); the antisense strand comprises 5'- usCfsuucAfcucagugCfuGfuagscsg -3' (SEQ ID NO: 22); the antisense strand comprises 5'- usCfsuucAfcucagugCfuGfuagscsg -3' (SEQ ID NO: 22); the antisense strand comprises 5'- usCfsuucAfcucagugCfuGfuagscsg -3' (SEQ ID NO: 22); the antisense strand comprises 5'- usCfsuucAfcucagugCfuGfuagscsg -3' (SEQ ID NO: 22); the antisense strand comprises 5'- usCfsuucAfcucagugCfuGfuagscsg -3' (SEQ ID NO: 22); the antisense strand comprises 5'- usCfsuucAfcucagugCfuGfuagscsg -3' (SEQ ID NO: 22); the antisense strand comprises 5'- usCfsuucAfcucagugCfuGfuagscsg -3' (SEQ ID NO: 22); the antisense strand comprises 5'- usCfsuucAfcucagugCfuGfuagscsg -3' (SEQ ID NO: 22); the antisense strand comprises 5'- usCfsuucAfcucagugCfuGfuagscsg -3' (SEQ ID NO: 22); the L is a ligand; or optionally, wherein: a1) the sense strand comprises 5' -cscsuucaAfCfUfuaagcaaguu (SEQ ID NO: 13) -L01-3' and the antisense strand comprises 5' -asAfscuuGfcuuaaguUfgAfaggsasu -3' (SEQ ID NO: 14); a2) the sense strand comprises 5' -cscsuucaAfCfUfuaagcaaguu (SEQ ID NO: 13) -L02-3' and the antisense strand comprises 5' -asAfscuuGfcuuaaguUfgAfaggsasu -3' (SEQ ID NO: 14); b1) the sense strand comprises 5' -cscsaccaGfCfUfcaucuccggc (SEQ ID NO: 15) -L01-3' and the antisense strand comprises 5' -gsCfscggAfgaugagcUfgGfuggsasc -3' (SEQ ID NO: 16); b2) the sense strand comprises 5' -cscsaccaGfCfUfcaucuccggc (SEQ ID NO: 15) -L02-3' and the antisense strand comprises 5' -gsCfscggAfgaugagcUfgGfuggsasc -3' (SEQ ID NO: 16); c1) the sense strand comprises 5' -csgsaggaUfAfUfuuggaugcau (SEQ ID NO: 17) -L01-3' and the antisense strand comprises 5' -asUfsgcaUfccaaauaUfcCfucgsasa -3' (SEQ ID NO: 18); c2) the sense strand comprises 5' -csgsaggaUfAfUfuuggaugcau (SEQ ID NO: 17) -L02-3' and the antisense strand comprises 5' -asUfsgcaUfccaaauaUfcCfucgsasa -3' (SEQ ID NO: 18); d1) the sense strand comprises 5' -asasgggaUfGfGfauccugaggu (SEQ ID NO: 19) -L01-3' and the antisense strand comprises 5' -asCfscucAfggauccaUfcCfcuuscsu -3' (SEQ ID NO: 20); d2) the sense strand comprises 5' -asasgggaUfGfGfauccugaggu (SEQ ID NO: 19) -L02-3' and the antisense strand comprises 5' -asCfscucAfggauccaUfcCfcuuscsu -3' (SEQ ID NO: 20); e1) the sense strand comprises 5' -csusacagCfAfCfugagugaaga (SEQ ID NO:21) -L01-3' and the antisense strand comprises 5' -usCfsuucAfcucagugCfuGfuagscsg -3' (SEQ ID NO:22); e2) the sense strand comprises 5' -csusacagCfAfCfugagugaaga (SEQ ID NO:21) -L02-3' and the antisense strand comprises 5' -usCfsuucAfcucagugCfuGfuagscsg -3' (SEQ ID NO:22); f1) the sense strand comprises 5' -asgsguggUfCfUfgcaaagauga (SEQ ID NO:23) -L01-3' and the antisense strand comprises 5' -usCfsaucUfuugcagaCfcAfccusgsa -3' (SEQ ID NO:24); f2) the sense strand comprises 5' -asgsguggUfCfUfgcaaagauga (SEQ ID NO:23) -L02-3' and the antisense strand comprises 5' -usCfsaucUfuugcagaCfcAfccusgsa -3' (SEQ ID NO:24); g1) the sense strand comprises 5' -ususugcaAfCfUfugcuacccau (SEQ ID NO:27) -L01-3' and the antisense strand comprises 5' -asUfsgggUfagcaaguUfgCfaaasusc -3' (SEQ ID NO:28); g2) the sense strand comprises 5' -ususugcaAfCfUfugcuacccau (SEQ ID NO:27) -L02-3' and the antisense strand comprises 5' -asUfsgggUfagcaaguUfgCfaaasusc -3' (SEQ ID NO:28); h1) the sense strand comprises 5' -csusugcuAfCfCfcauuaggaua (SEQ ID NO:35) -L01-3' and the antisense strand comprises 5' -usAfsuccUfaauggguAfgCfaagsusu -3' (SEQ ID NO:36); h2) the sense strand comprises 5' -csusugcuAfCfCfcauuaggaua (SEQ ID NO:35) -L02-3' and the antisense strand comprises 5' -usAfsuccUfaauggguAfgCfaagsusu -3' (SEQ ID NO:36); i1) the sense strand comprises 5' -csusugcuAfCfCfcauuaggaua (SEQ ID NO:35) -L01-3' and the antisense strand comprises 5' -usAfsuccUfaauggguAfgCfaagsgsg -3' (SEQ ID NO:38); i2) the sense strand comprises 5' -csusugcuAfCfCfcauuaggaua (SEQ ID NO:35) -L02-3' and the antisense strand comprises 5' -usAfsuccUfaauggguAfgCfaagsgsg -3' (SEQ ID NO:38); j1) the sense strand comprises 5' -csusugcuAfCfCfcauuaggauu (SEQ ID NO:41) -L01-3' and the antisense strand comprises 5' -asAfsuccUfaauggguAfgCfaagsasu -3' (SEQ ID NO:42); j2) the sense strand comprises 5' -csusugcuAfCfCfcauuaggauu (SEQ ID NO:41) -L02-3' and the antisense strand comprises 5' -asAfsuccUfaauggguAfgCfaagsasu -3' (SEQ ID NO:42); k1) the sense strand comprises 5' -csusugcuAfCfCfcauuaggauu (SEQ ID NO:41) -L01-3' and the antisense strand comprises 5' -asAfsuccUfaauggguAfgCfaagscsg -3' (SEQ ID NO:44); k2) the sense strand comprises 5' -csusugcuAfCfCfcauuaggauu (SEQ ID NO:41) -L02-3' and the antisense strand comprises 5' -asAfsuccUfaauggguAfgCfaagscsg -3' (SEQ ID NO:44); l1) the sense strand comprises 5' -csusugcuAfCfCfcauuaggauu (SEQ ID NO:41) -L01-3' and the antisense strand comprises 5' -asAfsuccUfaauggguAfgCfaagsusc -3' (SEQ ID NO:46); l2) the sense strand comprises 5' -csusugcuAfCfCfcauuaggauu (SEQ ID NO:41) -L02-3' and the antisense strand comprises 5' -asAfsuccUfaauggguAfgCfaagsusc -3' (SEQ ID NO:46).

23. A pharmaceutical composition comprising the double-stranded ribonucleic acid, a pharmaceutically acceptable salt thereof, or a ligand conjugate thereof according to any one of claims 1-22; optionally comprising a pharmaceutically acceptable carrier or excipient.

24. Use of the double-stranded ribonucleic acid, a pharmaceutically acceptable salt thereof, or a ligand conjugate thereof according to any one of claims 1-22 or the pharmaceutical composition of claim 23 in the manufacture of a medicament for the treatment and / or prevention of a PNPLA3-mediated disease; optionally, the PNPLA3-mediated disease comprises non-alcoholic fatty liver disease; optionally the PNPLA3-mediated disease comprises liver simple fatty liver (steatosis), non-alcoholic steatohepatitis, cirrhosis (irreversible late-stage scarring of the liver), or PNPLA3-associated obesity.

25. The use of claim 24, wherein, The double-stranded ribonucleic acid, a pharmaceutically acceptable salt thereof, or a ligand conjugate thereof, or the pharmaceutical composition is used in conjunction with other therapeutic agents.

Images