Inducing apoptosis

Abstract

Provided are methods for inducing apoptosis of cells. The cells may be cancer cells (e.g., lymphoma cells). The cancer cells may be resistant to other known therapies, such as, for example, therapy with rituximab, a chimeric anti-CD20 monoclonal antibody. A method can include contacting the cells with a compound having the following structure: (MMRi36).

Description

Attorney Docket No.: 003551.01173 INDUCING APOPTOSIS CROSS REFERENCE TO RELATED APPLICATION

[0001] This application claims priority U.S. Provisional Patent Application No.63 / 656,481, filed June 5, 2024, the entire disclosure of which is incorporated herein by reference. STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH

[0002] This invention was made with government support under contract no.R01CA208352 awarded by the National Institutes of Health. The government has certain rights in the invention. SEQUENCE LISTING

[0003] The instant application contains a Sequence Listing, which has been submittedelectronically in XML format and is hereby incorporated by reference in its entirety. Said XML copy, created June 4, 2025, is named “003551_01173_ST26.xml”, and is 4,587 bytes in size. BACKGROUND OF THE DISCLOSURE

[0004] Combinations of rituximab, a chimeric anti-CD20 monoclonal antibody, withsystemic chemotherapeutics (R-CHOP regimen) has improved complete response rates in the treatment of B-cell lymphoma patients. Although R-CHOP is standard of care treatment for B-cell lymphoma, 60% of patients who initially respond to this therapy develop acquired resistance to rituximab. Acquired resistance to R-CHOP is a main barrier to further improvement of B-cell lymphoma patient outcomes. To better understand the mechanisms underlying rituximab resistance, rituximab resistant lymphoma cell lines (designated as RRCLs) were developed by exposing parental lymphoma cells to rituximab and complement provided by human serum. The phenotype of RRCLs faithfully simulates human patients since they are not only resistant to rituximab, but also resistant to other types of chemotherapies. Previous studies uncovered that RRCLs underwent transcriptional changes including downregulation of CD20 gene expression and post-transcriptional changes with global downregulation of protein expression. CD20 downregulation partially explains why RRCLs have diminished response to Rituximab. However, it does not explain their multi- drug resistance phenotype. Additional studies revealed that upregulated expression of survivin and livin at transcriptional level, and of XIAP at post-transcriptional level,contributes to this multi-drug resistance phenotype of RRCLs. Despite these findings, our knowledge on the molecular mechanisms underlying drug resistance in RRCLs is incomplete and development of effective therapeutic strategies for treating RRCLs is lacking.

[0005] TP53 mutation contributes significantly to poor therapy response andrecurrence in lymphoma patients. This is largely because most chemotherapies, including those in R-CHOP, activate p53 tumor suppressive functions. In Non-Hodgkin Lymphoma (NHL) patients, TP53 mutation is a well-established prognostic biomarker that correlates with a higher rate of drug resistance (56% vs 17%), shorter progression-free survival (2.1 vs 8.2 months), and shorter overall survival (11.7 vs 21.5 months) for patients receiving the EPOCH therapeutic regimen. Interestingly, only specific p53 mutations are linked to poor prognosis in patients treated with R-CHOP. RRCL cell line variants were derived initially from p53 mutant lymphoma cell lines. For example, Raji cells bear the p53R213Q mutation and RL cells have the p53A138P mutation. TP53 mutations are thus unlikely to explain acquired resistance in RRCLs. MDM2 (HDM2 for human MDM2) and MDM4 (MDMX, or HDM4 / HDMX for human MDMX) are key negative regulators of p53. However, MDM2 can promote lymphomagenesis through p53-independent mechanisms as shown in several genetically engineered mouse models. MDM4 also promotes lymphomagenesis and alters radiation responses in mice expressing mutant MDM4 with altered protein degradation. Both RING domains of MDM2 and MDM4 are critical in p53 regulation in vivo. Our E3-dead but RING-domain-intact Mdm2L466A mouse model further showed that the E3 ligase activity of MDM2-MDM4 heterodimers was not only required for p53 regulation in vivo but was also required for promoting G2 / M cell cycle progression and genome integrity in a p53- independent manner. Whether MDM2 / MDM4 contributes to the phenotype of RRCLs or is an actionable drug target in p53-mutant RRCLs has not been previously studied. BRIEF SUMMARY OF DISCLOSURE

[0006] In an aspect, the present disclosure provides methods for inducing apoptosis ofcells. The cells may be cancer cells (e.g., lymphoma cells). The cancer cells may be resistant to other known therapies, such as, for example, therapy with rituximab, a chimeric anti-CD20 monoclonal antibody.

[0007] In various examples, a method of the present disclosure comprising contactingthe cells with a compound having the following structure:). d neat or in a composition. In various examples, MMRi36 may be used with other known cancer therapies (e.g., chemotherapies (such as doxorubicin), radiation, or targeted therapies (such as BRAF inhibitors), and / or the like). For example, MMRi36 may be the component of a chemotherapeutic cocktail. For example, a method may further comprise contacting the cells or administering to an individual composition comprising MMRi36 and one or more other drugs. Examples of other drugs include doxorubicin and BRAF inhibitors.

[0008] In an aspect, the present disclosure provides methods of treating an individualwith cancer or suspected of having cancer.

[0009] In various examples, a method for treating an individual with cancercomprises administering to an individual in need of treatment MMRi36 and, optionally, one or more other drugs. Examples of other drugs include doxorubicin and BRAF inhibitors. In various examples, the individual is administered a therapeutic amount of MMRi36. When formulated as a composition, the composition comprising MMRi36 will have an MMRi36 concentration of about 1 nM to 1 mM, including all 0.1 nM values and ranges therebetween.

[0010] In an aspect, the present disclosure provides compositions comprisingMMRi36. The compositions may further comprise one or more pharmaceutically acceptable carrier(s). In various examples, the composition may comprise one or more drugs other than MMRi36. The one or more drugs may be chemotherapeutic agents (e.g., doxorubicin) or target therapies (e.g., BRAF inhibitors). BRIEF DESCRIPTION OF THE FIGURES

[0011] For a fuller understanding of the nature and objects of the disclosure, referenceshould be made to the following detailed description taken in conjunction with the accompanying figures.

[0012] FIG. 1. MDM4 and MDM2 play critical roles in proliferation of Rituximab-resistant cell lines (RRCL). (A) WB analysis of steady-state expression of MDM4, MDM2, p53 and Actin (loading control) proteins in parental and drug-resistant lymphoma cell lines. (B) qPCR analysis of MDM4 and MDM2 transcripts of the indicated cell lines. (C) Effect ofMDM4 knockdown on growth of RL4RH cells in vitro, upper, WB of indicated proteins in shcontrol (shc) and two shMDM4 clones (shM4-1, shM4-2), lower, growth curves in a 4-dayassay. (D) Effect of MDM2 knockdown on growth of Raji4RH cells in vitro. The same asdescribed in C except showing three shMDM2 clones.

[0013] FIG. 2. Identification of MMRi36 as potent apoptosis inducer in p53-mutantlymphoma and RRCL cells. (A) WB analysis of the indicated proteins in p53 (I254D)- mutant RAMOS-1 cells in a cell-based apoptosis inducer screen among analogs of primary hit MMRi3 of MDM2-MDM4 E3 ligase at 5 µM for 24h. aC3, activated caspase 3 and cleaved PARP (cPARP).C, non-treated control. (B) Chemical structure of MMRi36. (C) WB analysis of cPARP in RRCL cells after treatment with a panel of compounds at 5x IC50concentrations for 24h (1, MMRi36 (5 µM), 2. Taxol (5 µM), 3, Doxorubicin (2^µM), 4, Carfilzomib (10 nM), 5, Vincristine (200 nM), 6, Etoposide (5 µM), 7, 5-Fluorouracil (100 µM), 8, Cytarabine (1 µM), 9, Carboplatin (20 µM), 10, Cisplatin (5 µM), 11, Entinostat (5 µM), 12, Bortezomib (20 nM), 13, Daunorubicin (5 µM), 14, MMRi64 (5 µM). Actin served as protein loading control. (D) WB analysis of apoptotic PARP cleavage in parental (RL, Raji) and RRCLs. (E) growth inhibition curves of indicated 4 cell lines in the presence of etoposide (upper) and MMRi36 (lower) and respective IC50’s (right to the growth curves).

[0014] FIG. 3. MMRi36 binds to RING domain heterodimers and acts as an activatorof the heterodimer MDM2-MDM4 E3 ligase in vitro. (A) In vitro E3 ubiquitin ligase assay with MDM2, MDM4 and p53 showing MMRi36 (10 µM) an activator while the primary hit MMRi3 (10 µM) an inhibitor of ubiquitination of MDM2-mediated p53 ubiquitination and polyubiquitination process. (B) In vitro pulldown assay for MMRi36 effect on RING-RING interaction of MDM2 and MDM4 with recombinant FLAG-MDM2B and MDM4 proteins. WB analysis of the FLAG-MDM4-bound MDM2B protein was shown. (C) MST assay using purified recombinant RING heterodimers of MDM2 and MDM to measure binding affinity of MMRi36 to the RING heterodimers. (D) Thermofluor (TF) assay with RING heterodimers and MMRi36, MMRi62 and solvent control (DMSO) showing MMRi36 stabilizes the heterodimers while MMRi62 destabilizes them. (E) In vitro ubiquitination assay showing concentration dependent effect of MMRi36 on E3 ligase activity of MDM2B-MDM4 toward MDM4, MDM2B and p53, and polyubiquitinated proteins.

[0015] FIG. 4. MMRi36 induces MDM2 / MDM4 downregulation in cells and inducesp53-independent apoptosis in Caspase3 / 7-dependent manner. (A) WB analysis of indicatedproteins in RL and RL4RH cells treated with 0 (c), 0.625, 1.25, 2.5, 5 and 10 µM of MMRi36 for 24 h showing that MMRi36 downregulates MDM2 and MDM4 with activation of caspase 3 (AC3) and caspase 7 (AC7) and PARP cleavage (cPARP). The short isoform caspase 3 (sC3) band was shown. (B) WB analysis of apoptotic PARP cleavage in Raji4RH cells treated with 5mM MMRi36 in the presence or absence of caspase3 / 7 inhibitor (C3 / 7i). (C) WB analysis of indicated proteins in indicated cells treated with either doxorubicin (25 nM) or MMRi36 (5 µM) for 24h.

[0016] FIG. 5. MMRi36 downregulates XIAP by promoting XIAP polyubiquitinationand working model for MMRi36-induced anti-lymphoma effect. (A) WB analysis of XIAP protein expression in RL and RL4RH cells treated with increasing concentrations of MMRi36 (0.63, 1.25, 2.5, 5, 10 µM) for 24h. (B) WB analysis of XIAP, PARP cleavage and activation of caspse3 / 7 in Raji4RH and RAMOS with increasing concentrations of MMRi36 (1, 2, 4, 8 µM in RAMOS cells and 2, 4, 8, 16 µM in Raji4RH cells) for 24h. AC7 / AC3, activated caspase7 / 3. (C) WB analysis of XIAP protein expression in 293T cells transfected with XIAP alone or XIAP with MDM2B and MDM4 expression plasmids and treated with 5 µM MMRi62, MMRi67 or MMRi36 for 24h. (D) In vivo ubiquitination assay with the samples as in (C) in denatured His-ub pulldown followed by WB of XIAP showing increased polyubiquitinated XIAP after MMRi36 treatment. (E) Working model for MMRi36-induced anti-lymphoma effect.

[0017] FIG. 6. MMRi36 reduces lymphoma burden in vivo. Mice bearing Rajiluclymphoma were treated with either vehicle or MMRi36 at 36 mg / kg. MMRi36 treatment reduces lymphoma burden in Rajiluc mouse models. Upper. Dorsal and Ventral BLI images of lymphoma in vehicle-treated and MMRi36-treated groups on day 18 and day 20 are shown. Lower. Histograms of mean lymphoma burdens in mean total flux (photons / sec) in the two groups showing that MMRi36-treated group has reduced lymphoma burden as compared to vehicle-treated group.

[0018] FIG. 7. A proposed model for MMRi36 induction of p53-independentapoptosis. MMRi36 independently targets the RING domains of MDM2-MDM4 (left cascade) and XIAP (right cascade) which activates their intrinsicE3 ligase activity toward themselves. Consequently, MMRi36 increases ubiquitination of MDM2, MDM4 and XIAP and their ubiquitin-dependent degradation in 26S proteasomes. Although low concentrations of MMRi36 increase p53 levels via downregulation of MDM2 / MDM4, high concentrations MMRi36 promote ubiquitin-dependent degradation of p53. MMRi36-induced XIAP degradation is likely responsible for the p53-independent apoptosis induction by MMRi36.

[0019] FIG. 8. MMRi36 kills p53-mutant RAMOS cells preferentially by apoptosis.WB analysis of apoptotic PARP cleavage and activation of caspase 3(AC3) in RAMOS cells treated at equivalent IC50 doses of MMRi36 and Daunorubicin.

[0020] FIG. 9. MMRi36 induces p53-independent downregulation of MDM2 andp53-independent apoptosis in leukemic NALM6 and shp53NALM6 cells.

[0021] FIG. 10. MMRi36-induced apoptotic PARP cleavage in Raji4RH and RL4RHclones with knockdown of MDM2 or MDM4. MDM2 / MDM4 knockdown only partially reduced MMRi36-induced apoptosis in RRCL cells, suggesting involvement of other drug targets of MMRi36 in cells.

[0022] FIG. 11. MMRi36 is well-tolerated by normal bone marrow cells. MMRi36effect on CFU-GM colony formation of mouse bone marrow cells was examined in softagar assays.400 µL of murine marrow mononuclear cells (2.0 X 105 / mL murine cells) in IMDM containing 20% FBS, 10 units / mL recombinant murine GM-CSF, 10% of a 10x drug solution or control solution (DMSO), and 0.3% agarose were pipetted into microwells containing a 0.4-mL underlayer of IMDM and 0.3% agarose. The cultures were allowed to gel at 4 °C for 15 min and incubated at 37 °C in a fully humidified atmosphere of 5% CO2 in air for 7 days. CFU-GM colonies (aggregates of ≥ 40 cells ) were counted with an inverted microscope using phase contrast. Percent survivals were calculated as % (the number of colonies in the drug-treated groups divided by the number of colonies in the vehicle control-treated group). IC50 values were determined. DETAILED DESCRIPTION OF THE DISCLOSURE

[0023] Although claimed subject matter will be described in terms of certainexamples, other examples, including examples that do not provide all of the benefits and features set forth herein, are also within the scope of this disclosure. Various structural, logical, process step, and electronic changes may be made without departing from the scope of the disclosure.

[0024] As used herein, unless otherwise indicated, “about”, “substantially”, or “the like”,when used in connection with a measurable variable (such as, for example, a parameter, an amount, a temporal duration, or the like) or a list of alternatives, is meant to encompass variations of and from the specified value including, but not limited to, those within experimental error (which can be determined by, e.g., a given data set, an art accepted standard, etc. and / or with, e.g., a given confidence interval (e.g.90%, 95%, or more confidence interval from the mean), such as, for example, variations of + / -10% or less, + / -5%or less, + / -1% or less, and + / -0.1% or less of and from the specified value), insofar such variations in a variable and / or variations in the alternatives are appropriate to perform in theinstant disclosure. As used herein, the term “about” may mean that the amount or value inquestion is the exact value or a value that provides equivalent results or effects as recited in the claims or taught herein. That is, it is understood that amounts, sizes, compositions, parameters, and other quantities and characteristics are not and need not be exact but may be approximate and / or larger or smaller, as desired, reflecting tolerances, conversion factors, rounding off, measurement error, or the like, or other factors known to those of skill in the art such that equivalent results or effects are obtained. In general, an amount, size, composition, parameter, or other quantity or characteristic, or alternative is “about” or “the like,” whether or not expressly stated to be such. It is understood that where “about,” is used before a quantitative value, the parameter also includes the specific quantitative value itself, unless specifically stated otherwise.

[0025] Ranges of values are disclosed herein. The ranges set out a lower limit valueand an upper limit value. Unless otherwise stated, the ranges include the lower limit value, the upper limit value, and all values between the lower limit value and the upper limit value, including, but not limited to, all values to the magnitude of the smallest value (either the lower limit value or the upper limit value) of a range. It is to be understood that such a range format is used for convenience and brevity, and thus, should be interpreted in a flexible manner to include not only the numerical values explicitly recited as the limits of the range, but also to include all the individual numerical values or sub-ranges encompassed within that range as if each numerical value and sub-range is explicitly recited. To illustrate, a numerical range of “0.1% to 5%” should be interpreted to include not only the explicitly recited values of 0.1% to 5%, but also, unless otherwise stated, include individual values (e.g., 1%, 2%, 3%, and 4%) and the sub-ranges (e.g., 0.5% to 1.1%; 0.5% to 2.4%; 0.5% to 3.2%, and 0.5% to 4.4%, and other possible sub-ranges) within the indicated range. It is also understood (as presented above) that there are a number of values disclosed herein, and that each value is also herein disclosed as “about” that particular value in addition to the value itself. For example, if the value “10” is disclosed, then “about 10” is also disclosed. Ranges can be expressed herein as from “about” one particular value, and / or to “about” another particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about, it will be understood that the particular value forms a further disclosure. For example, if the value “about 10” is disclosed, then “10” is also disclosed.

[0026] The articles “a” and “an” are used in this disclosure to refer to one or morethan one (i.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element.

[0027] As used herein, unless otherwise stated or indicated, “s” refers to second(s),“min” refers to minute(s), and “h” refers to hour(s).

[0028] The phrase “therapeutically effective amount” is used herein to mean anamount sufficient to reduce by at least about 15 percent, preferably by at least 50 percent, more preferably by at least 90 percent, and most preferably prevents oxidative stress in the individual. Alternatively, a therapeutically effective amount is sufficient to cause an improvement in a clinically significant condition in the individual.

[0029] In an aspect, the present disclosure provides methods for inducing apoptosis ofcells. The cells may be cancer cells (e.g., lymphoma cells). The cancer cells may be resistant to other known therapies, such as, for example, therapy with rituximab, a chimeric anti-CD20 monoclonal antibody.

[0030] In various examples, a method of the present disclosure comprising contactingthe cells with a compound having the following structure: .neat or in a composition / formulation. In various examples, MMRi36 may be used with other known cancer therapies (e.g., chemotherapies (such as doxorubicin), radiation, or targeted therapies (such as BRAF inhibitors), and / or the like). For example, MMRi36 may be the component of a chemotherapeutic cocktail. For example, a method may further comprise contacting the cells or administering to an individual composition comprising MMRi36 and one or more other drugs. Examples of other drugs include doxorubicin and BRAF inhibitors. Additional examples of drugs include, but are not limited to, MEK inhibitors (e.g., rametinib, Cobimetinib, Selumetinib, MEK162, Refametinib, Pimasertib, and the like); EGFR inhibitors (e.g., erlotinib, osimertinib, neratinib, cetuximab, gefitinib, and the like); FLT3 inhibitors (e.g., Midostaurin, Sorafenib, Quizartinib, Crenolanib, Gilteritinib, and the like); RASG12C (e.g., Sotorasib, Adagrasib, and the like); RASG12D inhibitors (e.g., MRTX1133 and the like), and any combination of any of the foregoing drugs.

[0031] In various examples, the cells are contacted with a therapeutic amount ofMMRi36. When formulated as a composition, the composition comprising MMRi36 will have an MMRi36 concentration of about 1 nM to 1 mM, including all 0.1 nM values and ranges therebetween. In various examples, composition has an MMRi36 concentration of 0.1 to 10 µM (e.g., 0.1 µM, 0.2 µM, 0.3 µM, 0.4 µM, 0.5 µM, 0.6 µM, 0.7 µM, 0.8 µM, 0.9 µM, 1.0 µM, 1.1 µM, 1.2 µM, 1.3 µM, 1.4 µM, 1.5 µM, 1.6 µM, 1.7 µM, 1.8 µM, 1.9 µM, 2.0 µM, 2.1 µM, 2.2 µM, 2.3 µM, 2.4 µM, 2.5 µM, 2.6 µM, 2.7 µM, 2.8 µM, 2.9 µM, 3.0 µM, 3.1 µM, 3.2 µM, 3.3 µM, 3.4 µM, 3.5 µM, 3.6 µM, 3.7 µM, 3.8 µM, 3.9 µM, 4.0 µM, 4.1 µM, 4.2 µM, 4.3 µM, 4.4 µM, 4.5 µM, 4.6 µM, 4.7 µM, 4.8 µM, 4.9 µM, 5.0 µM, 5.1 µM, 5.2 µM, 5.3 µM, 5.4 µM, 5.5 µM, 5.6 µM, 5.7 µM, 5.8 µM, 5.9 µM, 6.0 µM, 6.1 µM, 6.2 µM, 6.3 µM, 6.4 µM, 6.5 µM, 6.6 µM, 6.7 µM, 6.8 µM, 6.9 µM, 7.0 µM, 7.1 µM, 7.2 µM, 7.3 µM, 7.4 µM, 7.5 µM, 7.6 µM, 7.7 µM, 7.8 µM, 7.9 µM, 8.0 µM, 8.1 µM, 8.2 µM, 8.3 µM, 8.4 µM, 8.5 µM, 8.6 µM, 8.7 µM, 8.8 µM, 8.9 µM, 9.0 µM, 9.1 µM, 9.2 µM, 9.3 µM, 9.4 µM, 9.5 µM, 9.6 µM, 9.7 µM, 9.8 µM, 9.9 µM, or 10 µM).

[0032] The contacted cells may be cancer cells. For example, the cancer cells may belymphoma cells, leukemia cells, sarcoma cells, melanoma cells, and / or the like. In various examples, the lymphoma cells are resistant to rituximab. Without intending to be bound by any particular theory, it is considered that MMRi36 targets MDM2 / MDM4 / XIAP for degradation leading to p53-independent apoptosis in p53-mutant RRCLs and lymphoma cells. Thus, MMRi36 increases Mdm2-Mdm4 binding and activates the E3 ligase activity of RING heterodimers leading to increased ubiquitination of all p53, Mdm2, and Mdm4, and subsequent proteasomal degradation. That is, MMRi36 may act as a RING domain activator for destruction of a p53, Mdm2, Mdm4 ternary complex. Thus, in various examples, a method of the present disclosure comprising inducing p53-independent apoptosis. Various other examples of cancer and cancer types include, but are not limited to, lung, colon, rectum adenocarcinoma, breast, stomach and esophageal carcinoma, kidney, stomach, prostate, head and neck, liver and cholangiocarcinoma.

[0033] In an aspect, the present disclosure provides methods of treating an individualwith cancer or suspected of having cancer.

[0034] In various examples, a method for treating an individual with cancercomprises administering to an individual in need of treatment MMRi36 and, optionally, one or more other drugs. Examples of other drugs include doxorubicin and BRAF inhibitors. In various examples, the individual is administered a therapeutic amount of MMRi36. Whenformulated as a composition, the composition comprising MMRi36 will have an MMRi36 concentration of about 1 nM to 1 mM, including all 0.1 nM values and ranges therebetween. In various examples, composition has an MMRi36 concentration of 0.1 to 10 µM (e.g., 0.1 µM, 0.2 µM, 0.3 µM, 0.4 µM, 0.5 µM, 0.6 µM, 0.7 µM, 0.8 µM, 0.9 µM, 1.0 µM, 1.1 µM, 1.2 µM, 1.3 µM, 1.4 µM, 1.5 µM, 1.6 µM, 1.7 µM, 1.8 µM, 1.9 µM, 2.0 µM, 2.1 µM, 2.2 µM, 2.3 µM, 2.4 µM, 2.5 µM, 2.6 µM, 2.7 µM, 2.8 µM, 2.9 µM, 3.0 µM, 3.1 µM, 3.2 µM, 3.3 µM, 3.4 µM, 3.5 µM, 3.6 µM, 3.7 µM, 3.8 µM, 3.9 µM, 4.0 µM, 4.1 µM, 4.2 µM, 4.3 µM, 4.4 µM, 4.5 µM, 4.6 µM, 4.7 µM, 4.8 µM, 4.9 µM, 5.0 µM, 5.1 µM, 5.2 µM, 5.3 µM, 5.4 µM, 5.5 µM, 5.6 µM, 5.7 µM, 5.8 µM, 5.9 µM, 6.0 µM, 6.1 µM, 6.2 µM, 6.3 µM, 6.4 µM, 6.5 µM, 6.6 µM, 6.7 µM, 6.8 µM, 6.9 µM, 7.0 µM, 7.1 µM, 7.2 µM, 7.3 µM, 7.4 µM, 7.5 µM, 7.6 µM, 7.7 µM, 7.8 µM, 7.9 µM, 8.0 µM, 8.1 µM, 8.2 µM, 8.3 µM, 8.4 µM, 8.5 µM, 8.6 µM, 8.7 µM, 8.8 µM, 8.9 µM, 9.0 µM, 9.1 µM, 9.2 µM, 9.3 µM, 9.4 µM, 9.5 µM, 9.6 µM, 9.7 µM, 9.8 µM, 9.9 µM, or 10 µM). Examples of BRAF inhibitors include, but are not limited to, Vemurafenib, Dabrafenib, Encorafenib, and the like. Without intending to be bound by any particular theory, administration of MMRi36 following administration of one or more BRAF inhibitors may yield better results.

[0035] The method may be used to treat various cancers in an individual. Forexample, the cancer may be a leukemia, a sarcoma, a melanoma, or the like. In various other examples, the method may be used for treating people having or suspected of having MDM4 high expression cancers using MDM4 high expression as a biomarker. These cancer types include, but are not limited to, Lung adenocarcinoma (LUAD): Overexpression of MDM4 in LUAD has been noted; Colon adenocarcinoma (COAD): MDM4 is significantly overexpressed in COAD; Rectum adenocarcinoma (READ): High levels of MDM4 expression are found in READ; Breast invasive carcinoma (BRCA): MDM4 is overexpressed in BRCA; Stomach and Esophageal carcinoma (STES): Overexpression of MDM4 is seen in STES; Kidney renal papillary cell carcinoma (KIRP): MDM4 is significantly overexpressed in KIRP; Pan-kidney cohort (KIPAN): MDM4 expression is elevated in this cohort; Stomach adenocarcinoma (STAD): Overexpression of MDM4 is observed in STAD; Prostate adenocarcinoma (PRAD): MDM4 is overexpressed in PRAD; Head and Neck squamous cell carcinoma (HNSC): MDM4 is significantly overexpressed in HNSC; Kidney renal clear cell carcinoma (KIRC): Elevated MDM4 expression is found in KIRC; Lung squamous cell carcinoma (LUSC): Overexpression of MDM4 is noted in LUSC; Liver hepatocellular carcinoma (LIHC): MDM4 is overexpressed in LIHC; Cholangiocarcinoma (CHOL): Elevated MDM4 expression is observed in CHOL.

[0036] The individual to be treated by the method of the disclosure may be human ornon-human (e.g., mammal). Non-human animals include ungulates such as bovines. Additional on-limiting examples of non-human mammals include pigs, mice, rats, rabbits, cats, dogs, or other agricultural mammals, pet, or service animals, and the like.

[0037] In an aspect, the present disclosure provides compositions comprisingMMRi36. The compositions may further comprise one or more pharmaceutically acceptable carrier(s). In various examples, the composition may comprise one or more drugs other than MMRi36. The one or more drugs may be chemotherapeutic agents (e.g., doxorubicin) or target therapies (e.g., BRAF inhibitors).

[0038] The compositions may include one or more pharmaceutically acceptablecarrier(s). Non-limiting examples of compositions include solutions, suspensions, emulsions, solid injectable compositions that are dissolved or suspended in a solvent before use, and the like. Injections may be prepared by dissolving, suspending, or emulsifying one or more of the active ingredient(s) in a diluent. Non-limiting examples of diluents include distilled water (e.g., for injection), physiological saline, vegetable oil, alcohol, and the like, and combinations thereof. Injections may contain, for example, stabilizers, solubilizers, suspending agents, emulsifiers, soothing agents, buffers, preservatives, and the like, and combinations thereof. Injections may be sterilized in the final formulation step or prepared by sterile procedure. A pharmaceutical composition of the disclosure may also be formulated into a sterile solid preparation, for example, by freeze-drying, and may be used after sterilized or dissolved in sterile injectable water or other sterile diluent(s) immediately before use. Additional examples of pharmaceutically acceptable carriers include, but are not limited to, sugars, such as, for example, lactose, glucose, and sucrose; starches, such as, for example, corn starch and potato starch; cellulose, such as, for example, sodium carboxymethyl cellulose, ethyl cellulose, and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients, such as, for example, cocoa butter and suppository waxes; oils, such as, for example, peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; glycols, such as, for example, propylene glycol; polyols, such as, for example, glycerin, sorbitol, mannitol, and polyethylene glycol; esters, such as, for example, ethyl oleate and ethyl laurate; agar; buffering agents, such as, for example, magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer’s solution; ethyl alcohol; phosphate buffer solutions; other non-toxic compatible substances employed in pharmaceutical formulations, and the like, and combinations thereof. Non-limiting examplesof pharmaceutically acceptable carriers are found in: Remington: The Science and Practice of Pharmacy (2012) 22nd Edition, Philadelphia, PA. Lippincott Williams & Wilkins.

[0039] Compositions of the disclosure can comprise more than one pharmaceuticalagent. For example, a first composition comprising a compound of the disclosure, and a first pharmaceutical agent can be separately prepared from a composition which comprises the same compound of the disclosure and a second pharmaceutical agent, and such preparations can be mixed to provide a two-pronged (or more) approach to achieving the desired prophylaxis or therapy in an individual. Further, compositions of the disclosure can be prepared using mixed preparations of any of the compounds disclosed herein.

[0040] Wetting agents, emulsifiers and lubricants, such as sodium lauryl sulfate andmagnesium stearate, as well as coloring agents, release agents, coating agents, sweetening, flavoring and perfuming agents, preservatives and antioxidants can also be present in the compositions.

[0041] Various antioxidants may be used. Examples of antioxidants include: (1) watersoluble antioxidants, such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite and the like; (2) oil-soluble antioxidants, such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, alpha-tocopherol, and the like; and (3) metal chelating agents, such as citric acid, ethylenediamine tetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, and the like.

[0042] Compositions of the disclosure suitable for oral administration may be in theform of capsules, cachets, pills, tablets, lozenges (using a flavored basis, usually sucrose and acacia or tragacanth), powders, granules, or as a solution or a suspension in an aqueous or non-aqueous liquid, or as an oil-in-water or water-in-oil liquid emulsion, or as an elixir or syrup, or as pastilles (using an inert base, such as gelatin and glycerin, or sucrose and acacia) and / or as mouth washes and the like, each containing a predetermined amount of a compound of the present disclosure as an active ingredient. A compound of the present disclosure may also be administered as a bolus, electuary or paste.

[0043] In solid dosage forms of the disclosure for oral administration (capsules,tablets, pills, dragees, powders, granules and the like), the active ingredient is mixed with one or more pharmaceutically-acceptable carriers, such as sodium citrate or dicalcium phosphate, and / or any of the following: (1) fillers or extenders, such as starches, lactose, sucrose, glucose, mannitol, and / or silicic acid; (2) binders, such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinyl pyrrolidone, sucrose and / or acacia; (3)humectants, such as glycerol; (4) disintegrating agents, such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate; (5) solution retarding agents, such as paraffin; (6) absorption accelerators, such as quaternary ammonium compounds; (7) wetting agents, such as, for example, acetyl alcohol and glycerol monostearate; (8) absorbents, such as kaolin and bentonite clay; (9) lubricants, such a talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, and mixtures thereof; and (10) coloring agents. In the case of capsules, tablets and pills, the pharmaceutical compositions may also comprise buffering agents. Solid compositions of a similar type may also be employed as fillers in soft and hard-filled gelatin capsules using such excipients as lactose or milk sugars, as well as high molecular weight polyethylene glycols and the like.

[0044] A tablet may be made by compression or molding, optionally with one ormore accessory ingredients. Compressed tablets may be prepared using binder (for example, gelatin or hydroxypropylmethyl cellulose), lubricant, inert diluent, preservative, disintegrant (for example, sodium starch glycolate or cross-linked sodium carboxymethyl cellulose), surface-active or dispersing agent. Molded tablets may be made by molding in a suitable machine a mixture of the powdered active ingredient moistened with an inert liquid diluent.

[0045] The tablets, and other solid dosage forms of the pharmaceutical compositionsof the present disclosure, such as dragees, capsules, pills and granules, may optionally be scored or prepared with coatings and shells, such as enteric coatings and other coatings well known in the pharmaceutical-formulating art. They may also be formulated to provide slow or controlled release of the active ingredient therein using, for example, hydroxypropylmethyl cellulose in varying proportions to provide the desired release profile, other polymer matrices, liposomes and / or microspheres. They may be sterilized by, for example, filtration through a bacteria-retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved in sterile water, or some other sterile injectable medium immediately before use. These compositions may also optionally contain opacifying agents and may be of a composition that they release the active ingredient(s) only, or preferentially, in a certain portion of the gastrointestinal tract, optionally, in a delayed manner. Examples of embedding compositions which can be used include polymeric substances and waxes. The active ingredient can also be in micro- encapsulated form, if appropriate, with one or more of the above-described excipients.

[0046] Liquid dosage forms for oral administration of a compound of the presentdisclosure include pharmaceutically acceptable emulsions, microemulsions, solutions,suspensions, syrups and elixirs. In addition to the active ingredient, the liquid dosage forms may contain inert diluents commonly used in the art, such as, for example, water or other solvents, solubilizing agents and emulsifiers, such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, oils (in particular, cottonseed, groundnut, corn, germ, olive, castor and sesame oils), glycerol, tetrahydrofuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof.

[0047] In addition to inert diluents, the oral compositions can include adjuvants suchas wetting agents, emulsifying and suspending agents, sweetening, flavoring, coloring, perfuming and preservative agents.

[0048] Suspensions, in addition to a compound of the disclosure, the compositionmay contain suspending agents as, for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth, and mixtures thereof.

[0049] The composition may be for administration to an individual in need oftreatment.

[0050] The compounds of the present disclosure can be therapeutically administeredas the neat chemical, but it is preferred to administer a compound of the present disclosure as a pharmaceutical composition or formulation. Thus, the present disclosure provides a pharmaceutical composition comprising a compound of the present disclosure together with a pharmaceutically acceptable diluent or carrier therefor. Also provided is a process of preparing a pharmaceutical composition comprising admixing a compound of the present disclosure with a pharmaceutically acceptable diluent or carrier therefor.

[0051] In one example, the pharmaceutically acceptable formulation is such that itprovides sustained delivery of a compound of the present disclosure to an individual for at least 12 hours, 24 hours, 36 hours, 48 hours, one week, two weeks, three weeks, or four weeks after the pharmaceutically acceptable formulation is administered to the individual.

[0052] In certain examples, these pharmaceutical compositions are suitable for oraladministration to an individual. In other examples, as described in detail below, the pharmaceutical compositions of the present disclosure may be specially formulated for administration in solid or liquid form, including those adapted for the following: oral administration, for example, drenches (aqueous or non-aqueous solutions or suspensions), tablets, boluses, powders, granules, and pastes.

[0053] The compositions may conveniently be presented in unit dosage form and maybe prepared by any methods well known in the art of pharmacy. The amount of active ingredient which can be combined with a carrier material to produce a single dosage form will vary depending upon the individual being treated, the particular mode of administration. The amount of active ingredient which can be combined with a carrier material to produce a single dosage form will generally be that amount of a compound of the present disclosure which produces a therapeutic effect. Generally, out of one hundred per cent, this amount will range from about 1 per cent to about ninety-nine percent of active ingredient, preferably from about 5 per cent to about 70 per cent, more preferably from about 10 per cent to about 30 per cent.

[0054] Methods of preparing these compositions include the step of bringing intoassociation a compound of the present disclosure with the carrier and, optionally, one or more accessory ingredients. In general, the formulations are prepared by uniformly and intimately bringing into association a compound of the present disclosure with liquid carriers, or finely divided solid carriers, or both, and then, if necessary, shaping the product.

[0055] When a compound of the present disclosure is administered aspharmaceuticals to humans and animals, they can be given per se or as a pharmaceutical composition containing, for example, 0.1 to 99.5% (more preferably, 0.5 to 90%) of active ingredient in combination with a pharmaceutically acceptable carrier.

[0056] In certain examples, the methods of the disclosure include administering to anindividual a therapeutically effective amount of a compound of the present disclosure in combination with another pharmaceutically active ingredient. Pharmaceutically active ingredients that may be used can be found in Harrison’s Principles of Internal Medicine, Thirteenth Edition, Eds. T.R. Harrison et al. McGraw-Hill N.Y., NY; and the Physicians’ Desk Reference 50th Edition 1997, Oradell New Jersey, Medical Economics Co., the complete contents of which are expressly incorporated herein by reference. A compound of the present disclosure and the pharmaceutically active ingredient may be administered to the individual in the same pharmaceutical composition or in different pharmaceutical compositions (at the same time or at different times).

[0057] Methods delineated herein include those wherein the individual is identified asin need of a particular stated treatment. Identifying an individual in need of such treatment can be in the judgment of an individual or a health care professional and can be subjective (e.g., opinion) or objective (e.g., measurable by a test or diagnostic method). In othermethods, the individual is prescreened or identified as in need of such treatment by assessment for a relevant marker or indicator of suitability for such treatment.

[0058] The following Statements provide various examples of the present disclosureand are not intended to be limiting in any way. Statement 1. A method for inducing apoptosis of cells comprising contacting the cells with a therapeutically effective amount of a compound having the following structure: .administering one or more BRAF inhibitors. The one or more BRAF inhibitors may be administered concomitantly with MMRi36; before administration of MMRi36; or following administration with MMRi36. Statement 2. A method according to Statement 1, wherein the cells are lymphoma cells, leukemia cells, sarcoma cells, or melanoma cells. Statement 3. A method according to Statement 1 or Statement 2, wherein the cells are rituximab resistant lymphoma cells. Statement 4. A method according to any one of the preceding Statements, wherein the method further comprises administering the compound to an individual in need of treatment. Statement 5. A method according to Statement 4, wherein the individual in need of treatment has lymphoma or is suspected of having lymphoma. Statement 6. A method for treating an individual having or suspected of having cancer comprising administering a therapeutically effective amount of a compound having the following structure: .according to Statement 6, wherein the cancer is lymphoma, leukemia, melanoma, or a sarcoma.Statement 8. A method according to Statement 7, wherein the individual’s cancer is resistant to treatment with rituximab.

[0059] The following example is presented to illustrate the present disclosure. It is notintended to be limiting in any way. EXAMPLE

[0060] This example provides a description of a method of the present disclosure.

[0061] Rituximab combined with systemic chemotherapy significantly improves therate of complete response in B-cell lymphomas. However, acquired rituximab resistance develops in most patients leading to relapse. The mechanisms underlying rituximab resistance are not well-understood. MDM2 and MDM4 proteins are major negative regulators of p53, but they also have p53-independent activities in mouse models of lymphomagenesis. Whether MDM2 or MDM4 is involved in rituximab resistance has not been explored. Described herein is MDM2 and MDM4 are upregulated in p53-mutant rituximab-resistant cells by transcriptional and post-transcriptional mechanisms. Knockdown of MDM2 or MDM4 significantly hindered growth of rituximab-resistant cells. To explore whether targeting the RING-domain of MDM2-MDM4 heterodimers is a viable strategy for the treatment of rituximab-resistant lymphomas, MMRi36 was identified in a high throughput small-molecule screen. It was shown that MMRi36 binds and stabilizes MDM2-MDM4 RING heterodimers and acts as an activator of the MDM2-MDM4 E3 ligase complex in vitro and promotes proteasomal degradation of MDM2 / MDM4 proteins in cells. MMRi36 potently induces apoptosis in rituximab-resistant lymphomas by p53-independent mechanisms. The pro- apoptotic mechanisms of MMRi36 involves activation of both caspase 3 and caspase 7 associated with increased polyubiquitination and degradation of XIAP. It was also shown that MMRi36 has in vivo activity in reducing lymphoma burden in mice. Therefore, MMRi36 is a novel prototype small-molecule for targeting MDM2 / MDM4 / XIAP for degradation and induction of apoptosis in p53-mutant lymphomas.

[0062] Described herein is that MDM2 / MDM4 supports the proliferation of p53-mutant RRCL cells and a small molecule MMRi36 that targets MDM2 / MDM4 / XIAP for degradation leading to p53-independent apoptosis in p53-mutant RRCLs and lymphoma cells was identified.

[0063] All lymphoma cell lines were cultured in RPMI-1640 medium supplementedwith 10% fetal bovine serum and 50 U / ml penicillin and 50 μg / ml streptomycin. Raji(p53R213Q), RL (p53A138P) and RAMOS-1 (Burkitt’s lymphoma, mut-p53 (I254D) werefrom American Type Culture Collection (Manassas, Virginia, USA). Rituximab-resistant cell lines Raji4RH and RL4RH were established as described previously. Knockdown of MDM2 or MDM4 were performed with lentivirus particles packaged with pLKO.1-MDM2 and pLKO.1-MDM4 (purchased from Sigma) followed by puromycin selection at 1 μg / ml for 2 days then clonal expansion in fully supplemented RPMI-1640 medium. MANCA, MANCA- mlp-puro and MANCA-mlp-MDM2 were generated as described previously and maintained in 10%FBS-Pen / Strep- RPMI-1640 medium. Small molecule compound MMRi36 was synthesized in house as previously described. The MMRi derivatives in the secondary screening were purchased from Hit2Lead ChemBridge Chemical Store (San Diego, CA, USA). The compounds were dissolved in DMSO as 10 mM stocks. SPYRO Orange dye was purchased from ThermoFisher in thermofluor and microscale thermophoresis (MST) assays.

[0064] Plasmids, antibodies and primers. HA-FLAG-MDM4, HA-MDM2 and HA-MDM2B plasmids for insect cell and mammalian expression were described previously. His- ubiquitin plasmid (pMT107) was a gift from Dr. Dirk P. Bohmann (University of Rochester Medical Center, Rochester, NY). MDM2-MDM4 RING heterodimer constructs, pETDuet- MDM2R and pETDuet-MDM4R, were generated by PCR cloning of the RING domain of human MDM2 or MDM4 into pETDuet-1 (Novagen, Madison, Wisconsin). Plasmid pEBB- XIAP was purchased from Addgene (Plasmid#11558). Plasmids pLKO.1 puro-MDM2 and pLKO.1 puro-MDM4 were from Sigma. The antibody information used in this this study are following. p53 (DO-1) (sc-126) was from Santa Cruz Biotechonology. MDM4 was from Proteintech (#17914-1-AP). MDM2(D1V2Z) (# 86934S), PARP (FL and Cleaved ) (#9532S), Activated Caspase 3 (ASP175) ( # 9661S), Cleaved Caspase-7 (Asp198) Antibody (#9491), XIAP Rabbit (#2042S) were from Cell Signaling Technology. Purified anti- Ubiquitin Antibody, Clone P4G7 was from BioLegend (#838704). The quantitative PCR (qPCR) primers are following: qHDM4-L1: TGATCAGCAGGAGCAGCATA (SEQ ID NO:1); qHDM4-R1: AGAGAGGGCTTGGGTCTTTC (SEQ ID NO:2; qHDM2-L1: GATGAAAGCCTGGCTCTGTG (SEQ ID NO:3); qHDM2-R1: CCTGATCCAACCAATCACCTG (SEQ ID NO:4). The iTaq universal SYBR Green Supermix was purchased from Bio-Rad (Catalog # 1725121).

[0065] In vitro and in vivo ubiquitination. In vitro assays for ubiquitination byMDM2-MDM4 were performed as described previously. Briefly, reactions were carried out at 30 °C for 1h in a volume of 20 μl reaction in the presence of different concentrations of MMRi or vehicle solvent DMSO, followed by WB for p53, MDM2, MDM4 andpolyubiquitin. In vivo ubiquitination was performed as described previously. Briefly, 293Tcells were transfected with pEBB-XIAP and His-ubiquitin plasmid with or without MDM2B and FLAG-MDM4. Sixteen hours after transfection cells were treated with 5 μM of MMRi62, MMRi67, or MMRi36 for 24h before denatured His-pulldown of the proteins followed by WB for XIAP.

[0066] Biochemical and biophysical analysis of compound effect on RING-RINGdomain interaction. In vitro pulldown assays using insect cells-expressed and affinity-purified FLAG-MDM4 and HA-MDM2B were performed as described previously. RING domain heterodimers of MDM2-MDM4 were purified from c-expression in E. Coli as previously described and used in MMRi36 binding affinity measurement by microscale thermophoresis (MST) assays and in studying MMRi36 effect on RING heterodimer stability by thermofluor (TF) assays as described previously.

[0067] IC50 measurement. Cells at 5,000-10,000 / well were plated in 96-well plates at100µl / well and compounds of different concentrations at double dilutions with corresponding medium were added to each well at 100µl / well. After culturing the cells for 70 h, 40 µl of 6x resazurin stock solution was added to each well to allow formation of fluorescent metabolite by viable cells for 2h, followed by reading fluorescence at Ex / Em of 530-560 / 590 nm in BioTek Synergy 2 Microplate Reader. The IC50 values and dose-effect curves were obtained by Chou-Median-Effect Equation using CompuSyn software using affected fractions of compound-treated wells as Y-axis.

[0068] In vivo efficacy studies. All animal experiments were performed according toapproved Institutional Animal Care and Use Committee (IACUC) protocols. The formulation for MMRi36 was 0.9%MMRi36-10%NMP-10% Castor oil -20%DEGEE. Female SCID mice (9-week-old) were i.v. injected with one million Rajiluc cells. One week later the mice were treated with either vehicle or MMRi36 at MTD of 36mg / kg iv every other day for 6 i.v. injections within two weeks. The tumor growth was measured by weekly bioluminescence imaging using IVIS Spectrum (Perkin Elmer) at Roswell Park Translational Imaging Shared Resource (TISR).

[0069] MDM2 and MDM4 play a critical role in the proliferation of p53-mutantrituximab resistance lymphoma cells. To understand whether MDM2 and MDM4 are involved in rituximab resistance, Western blot analysis of MDM2 and MDM4 was performed in established p53-mutant RRCLs, Raji4RH and RL4RH(4). MDM4 protein levels were significantly upregulated in both RL4RH cells (18-fold) and Raji4RH cells (6-fold) compared to parental cells, while MDM2 protein levels were significantly increased in RL4RH by 3-fold but only slightly increased in Raji4RH cells by 1.6-fold (FIG.1A). Analysis of gene expression by qPCR indicated that the MDM4 transcript was moderately upregulated by about 2-fold in in both RRCLs while MDM2 transcripts were upregulated by about 8-fold compared to parental cells (FIG.1B). Given the much higher increase in MDM4 and MDM2 protein levels relative to their transcripts, results suggest both transcriptional and post- transcriptional mechanisms are involved in controlling MDM4 / MDM2 protein expression. Of note, mutant p53 expression was downregulated in RRCLs, possibly due to increased degradation by increased MDM2-MDM4 E3 activity.

[0070] To assess whether MDM4 and MDM2 play critical roles in proliferation ofRRCLs, we silenced their expression via lentiviral delivery of shMDM2 or shMDM4 silencing RNA to establish stably depleted cell line derivatives. Despite strong puromycin selection, generation of RRCL cells with stable knockdown of both MDM2 and MDM4 was rare. A few Raji4RH MDM4 knockdown clones were obtained but no viable RL4RH MDM4-knockdwon clones were obtained, suggesting MDM4 was essential for viability of Raji4RH cells. Likewise, a few RL4RH MDM2 knockdown clones were obtained but no viable Raji4RH MDM2 knockdown clones were obtained. In all viable shMDM2-Raji4RH clones, MDM4 protein levels were increased (FIG.1C). Similarly, in all viable shMDM4- RL4RH clones the expression of MDM2 protein was increased (FIG.1D). Cell proliferation assays indicated that all shMDM2-Raji4RH and shMDM4-RL4RH clones had significantly retarded growth rates (FIG.1CD). These data suggest a requirement for either MDM2 or MDM4 to maintain the growth and viability of RRCLs, suggesting MDM2 / MDM4 as potential drug targets for treating RRCLs.

[0071] Identification of MMRi36 as potent apoptosis inducer in p53-mutantlymphoma and RRCL cells. A high throughput screen of small molecule inhibitors of the MDM2-MDM4 E3 heterodimer E3 ligase (MMRi) was previously presented and identified several primary hits. In follow-up studies, a secondary apoptosis screen of available analogues related to the primary hit MMRi3 using p53-mutant RAMOS lymphoma cells was performed. Analogue 6 of MMRi3 (designated as MMRi36) proved to be a potent apoptosis inducer as indicated by caspase 3 activation and PARP cleavage (FIG.2A). RAMOS cells are more sensitive to MMRi36 than equivalent doses of Daunorubicin (FIG.8). MMRi36- induced apoptosis was p53-independent since drug sensitivity was similar in the leukemic cell line NALM6 and a p53 knockdown derivative (shp53NALM6) (FIG.9). MMRi36 is a derivative of [1,3,4] thiadiazol (FIG.2B) with a favorable scaffold for drug development. It was tested whether MMRi36 was also capable of inducing apoptosis in p53-mutant Raji4RHcells and RL4RH cells together with 12 other chemotherapeutics used or tested in the clinic. After 24h treatment with these compounds at a concentration of 5x IC50, MMRi36 and bortezomib were the only two compounds that could induce apoptosis as indicated by cleaved PARP (cPARP) in these two cell lines (FIG.2C). Interestingly, MMRi36 induced superior apoptotic responses in both parental and RRCL cells compared with the current therapy etoposide or the MDM2-p53 disruptor Nutlin3a or our previously reported MMRi64(29). Etoposide and MMRi64 could induce apoptosis in parental Raji and RL cells, but not in Raji4RH and RL4RH cells. The MDM2-p53 disruptor Nutlin3a failed to induce apoptosis in any of the four cell lines since they express mutant p53 (FIG.2D). These observations suggest MMRi36 has a unique mechanism of action. Consistent with the apoptotic response, results from proliferation assays indicated that RRCL and parental cells showed similar sensitivity to MMRi36 while RRCLs showed increased resistance to Etoposide relative to their parental cells (~10-fold increase in IC50 for RL4RH, ~4-fold increase for Raji4RH) (FIG.2E). These results suggest that MMRi36 has a potential to overcome resistance mechanisms operable in RRCL cells.

[0072] MMRi36 stabilizes MDM2-MDM4 heterodimers and activates MDM2-MDM4 E3 ligase activity in vitro. To understand whether MMRi36 acts on the E3 ubiquitin ligase of MDM2-MDM4 complex, in vitro ubiquitination assays were performed using recombinant MDM4 and an MDM2 splice isoform MDM2B that lacks the p53 binding domain. It was previously shown that the MDM4-MDM2B heterodimers possess elevated E3 ligase activity and play a significant role in regulating the stability of MDM4, MDM2, and p53 in cells. In contrast to the inhibitory effect of MMRi3, the primary hit, MMRi36 increased ubiquitination of p53 and polyubiquitination of all MDM2 substrates at 10 µM (FIG.3A). Thus, MMRi36 activates the E3 ligase activity of the MDM2-MDM4 E3 complex. To examine effects of MMRi36 on RING-RING interaction between MDM2- MDM4, in vitro pulldown experiments were performed, and it was found that MMRi36 increased formation of MDM2B-MDM4 heterodimers in the presence of 5 µM of MMRi36 (FIG.3B). Using purified preformed RING domain MDM2 / MDM4 heterodimers for MST analysis, it was calculated that MMRi36 binds to the RING domain heterodimer with a Kd of ~308 nM (FIG.3C). Thermofluor (TF) assays were then performed with the RING heterodimers and it was found that MMRi36 stabilized the RING heterodimers by increasing the Tm from 53.8 ºC to 56.4 ºC, in contrast to MMRi62, a disrupter of the MDM2-MDM4 heterodimers (30) that showed a decreased Tm from 53.8 ºC to 35.2 ºC (FIG.3D), consistent with results from in vitro MDM2B-MDM4 heterodimer pulldown (FIG.3B). Titration ofconcentration-dependent activity revealed that MMRi36 was a potent activator of the E3 complex at concentrations as low as 0.31 µM as indicated by increased ubiquitination of MDM4, MDM2B and p53 during in vitro ubiquitination assays (FIG.3E).

[0073] MMRi36 promotes ubiquitination and degradation of MDM2 / MDM4 / p53associated with apoptosis induction in cells. As an activator of the E3 ligase activity of MDM2-MDM4, MMRi36 is expected to promote ubiquitin-dependent degradation of MDM2 / MDM4 / p53 in cells. To test this activity, protein analysis of MDM2 / MDM4 / p53 levels in RL and RL4RH cells after MMRi36 treatment was performed. The results showed that, indeed, MMRi36 induced downregulation of MDM2 / MDM4 / p53 protein levels in a concentration-dependent manner in these cells (FIG.4A). In cells where MDM2 / MDM4 / p53 were downregulated, apoptosis was also observed as indicated by PARP cleavage. Apoptotic PARP cleavage was associated with activation of effector caspases including activated caspase 3 (AC3) and caspase 7 (AC7) (FIG.4A). Interestingly, MMRi36 induced AC7 in RL4RH cells, but little induction of AC3. It was noticed that RL4RH cells expressed a 20 kDa form of caspase 3 which is reminiscent of a reported short splice isoform lacking pro- apoptotic activity. MMRi36-induced apoptosis is dependent on activation of both caspase3 / 7 since a Caspas3 / 7 inhibitor completely abolished apoptotic PARP cleavage in Raji4RH cells (FIG.4B). To establish that MMRi36-induced downregulation of MDM2 / MDM4 / p53 depends on MDM2 E3 ligase activity, matched MANCA cell lines were used in which cells either express control miRNA (MANCA-mlp-puro) or miRNA that stably knocked down MDM2 (MANCA-mlpMDM2). These results showed that MMRi36-induced, but not doxorubicin-induced, downregulation of MDM4 was rescued by MDM2-knockdown (FIG. 4C), suggesting that MMRi36-induced MDM4 downregulation was MDM2-dependent. Notably, compromised MDM4-degradation in MANCA-mlp-MDM2 cells was associated with reduced apoptotic PARP cleavage (FIG.4C) implying that MDM4 may inhibit the apoptotic pathway.

[0074] MMRi36 promotes XIAP ubiquitination and degradation in cells. WhileRaji4RH and RL4RH clones with knockdown of MDM2 or MDM4 showed attenuated apoptotic PARP cleavage, MMRi36 induced apoptosis was not completely abolished (FIG.9). This suggests MMRi36-induced apoptosis involves other cellular targets beyond MDM2 / MDM4. The activation of Caspase3 / 7 by MMRi36 in these p53-mutant lymphoma cells ruled out the involvement of BH3-only proteins such as PUMA and NOXA, the two p53 target gene products that promote p53-dependent apoptosis and suggested some critical events might be induced downstream of the mitochondria. It is speculated that XIAP (X-linked mammalian inhibitor of apoptosis protein) might be a target of MMRi36 since it is a RING-domain protein and a member of IAP family that inhibits effector caspases3 / 7 by their physical interaction and ubiquitin-dependent degradation. As predicted, western blot analysis indicated that MMRi36 indeed decreased XIAP protein expression in both parental and RRCLs and p53-mutant RAMOS-1 cells in a concentration-dependent manner, concurrent with AC3 / 7 induction and PARP cleavage (FIG.5AB). In vivo ubiquitination assays were performed by transfecting plasmids expressing His-tagged ubiquitin with XIAP together with or without MDM2B and MDM4. Our results showed that MMRi36 but not MMRi62 or MMRi67 significantly decreased the levels of exogenously expressed XIAP together with increased smearing of XIAP bands in direct western blots suggesting increased post- translational modification of XIAP upon MMRi36 treatment (FIG.5C). When his-ubiquitin pulldown samples carried out under the denaturing conditions were blotted for XIAP, polyubiquitinated XIAP species at the top of gel were significantly increased in MMRi36 treated cells (FIG.5D), suggesting that MMRi36 stimulated XIAP ubiquitination and promoted its proteasomal degradation. This MMRi36-induced XIAP ubiquitination was largely unaffected by the presence or absence of co-transfected MDM2B / MDM4.

[0075] MMRi36 has in vivo anti-lymphoma activity. MMRi36 was well-tolerated inmice with a MTD of about 36 mg / kg. Tests with mouse bone marrow in CFU-GM colony formation assays indicated that MMRi36 is much less toxic to bone marrow progenitor cells (IC50 of 16 µM) as compared to 0.56 µ^ and 0.79 µM for RL4RH and Raji4RH cells (FIG.8). To test whether MMRi36 has in vivo anti-lymphoma activity, experiments with mice transplanted with RajiLuc lymphoma cells via the tail vein were performed. One week after transplantation, six i.v. injection of MMRi36 at 36 mg / kg were administered every other day. These results showed that MMRi36-treated group had reduced tumor burdens by ~50% as compared to the vehicle-treated control group on day18 and day 20 (final sacrifice day) (FIG.6). However, the treatment group did not gain survival benefit compared to vehicle treated group. Taken together, it was proposed a working model for novel RRCL drug resistance mechanisms and MMRi36 induction of p53-independent apoptosis in RRCLs. RRCLs survives current chemotherapies by upregulation of MDM2 and MDM4 that promote survival and proliferation and by alternative splicing to inactivate caspase-3-dependent apoptosis. MMRi36 independently targets the RING domains of MDM2-MDM4 (FIG.7 left cascade) and XIAP (FIG.7 right cascade) for their ubiquitin-dependent degradation. Thissimultaneously inactivates MDM2 / MDM4-mediated survival / proliferation and activates caspase-dependent apoptosis downstream of p53.

[0076] As described herein, MDM4 and MDM2 are upregulated in rituximab resistantp53 mutant lymphoma cell lines and play critical roles in the proliferation of these cells in vitro. Although it was reported that MDM2 is required for survival of p53-null T cell lymphoma, how exactly MDM2 / MDM4 regulates cell survival of p53-deficient / mutant cancer cell is unclear. The effect of MDM2 or MDM4 knockdown on slowing the proliferation of RRCLs in vitro (FIG.1) is likely related to its role in cell survival as well as in promoting cell cycle progression independent of p53 as revealed in Mdm2L466A mice previously. Therefore, small-molecule compounds targeting the E3 ligase activity of MDM2- MDM4 complex should cancel both the p53-dependent and p53-independent oncogenic activity of MDM2 / MDM4. This targeting strategy should be advantageous over MDM2-p53 disruptors whose antitumor activity depends on p53. It is believed MMRi36 is the first reported activator of the MDM2-MDM4 E3 complex resulting in cellular degradation of MDM2 / MDM4 proteins as MDM2 / MDM4 are known to be substrates for their own ubiquitin ligase activity. Therefore, MMRi36 represents a new strategy and a new chemical class for physically eliminating MDM2 / MDM4 proteins in cells. Distinct from MMRi62 that weakens the RING-RING interaction of MDM2-MDM4, MMRi36 binding to RING heterodimers stabilizes them and activates their E3 ligase activity (FIGs.2 & 3) which is a unique feature of MMRi36. Owing to the nature of our screening methods, MMRi36 is not necessarily a specific binder of MDM2 / MDM4 RING domain, and its binding to RING domains of other proteins cannot be ruled out. Although the evidence of direct binding of MMRi36 to XIAP protein has not been obtained, it was speculated herein that MMRi36 may bind to the RING domain of XIAP and modify its intrinsic E3 ligase activity, as it induced increased ubiquitination of XIAP and its downregulation in cells (FIG.5). By abrogating both MDM2 / MDM4 and XIAP-mediated survival mechanisms, MMRi36 bypassed p53 and mitochondria events to induce p53-independent apoptosis, a desirable endpoint for relapsed lymphoma patients that no longer respond to current chemotherapies.

[0077] RRCLs are extremely resistant to apoptosis induction by chemotherapy.Newer targeted therapies such as MLN2238 induce caspase-independent cell death and HDAC inhibitors like Entinostat and Vorinostat only induce growth arrest in RRCLs. The observation of the short splice isoform caspase 3 in RL4RH cells suggested that development of the apoptosis-resistant RRCL phenotype may involve alternative splicing during rituximab treatment. Alternative splicing generates a short form caspase 3 (C3s) of about 21 kDa, 90-aashorter than the 32 kDa caspase-3 zymogen, which cannot be processed into active caspase 3 but antagonizes caspase-3 apoptotic activity. Therefore, the MMRi36-induced XIAP ubiquitination and degradation leading to caspase 7 activation might circumvent such molecular resistance mechanisms to induce apoptosis in RRCLs that predominantly express C3s. In this sense, the loose specificity of MMRi36 toward more than one drug target provides a new format to develop novel compounds to bring about more favorable cancer killing profile. Despite potent in vitro pro-apoptotic activity, MMRi36 exhibited more limited efficacy in treating lymphoma in vivo (FIG.6). Nevertheless, identification of MMRi36 opens a new avenue for developing new therapeutic compounds in the future since MMRi36 is well-tolerated and has a thiadiazole nucleus which is a core structure of many drug categories including anti-microbial, anti-inflammatory, analgesic, antiviral and anti- neoplastic agents. Once the MMRi36-MDM2 / MDM4 and MMMRi36-XIAP binding interfaces are solved and optimized with improved target binding and improved pharmacokinetic and pharmacodynamic profiles, it may potentially produce beneficial therapeutic effect in in vivo mouse models as well as in relapsed R-CHOP-treated patients.

[0078] Although the present disclosure has been described with respect to one ormore particular embodiments and / or examples, it will be understood that other embodiments and / or examples of the present disclosure may be made without departing from the scope of the present disclosure.

Claims

CLAIMS:

1. A method for inducing apoptosis of cells comprising contacting the cells with a therapeutically effective amount of a compound having the following structure: .

2. The method according to claim 1, wherein the cells are lymphoma cells, leukemia cells, sarcoma cells, or melanoma cells.

3. The method according to claim 1, wherein the cells are rituximab resistant lymphoma cells.

4. The method according to claim 1, wherein the method further comprises administering the compound to an individual in need of treatment.

5. The method according to claim 4, wherein the individual in need of treatment has lymphoma or is suspected of having lymphoma.

6. The method for treating an individual having or suspected of having cancer comprising administering a therapeutically effective amount of a compound having the following structure: .

7. The method according to claim 6, wherein the cancer is lymphoma, leukemia, melanoma, or a sarcoma.

8. The method according to claim 7, wherein the individual’s cancer is resistant to treatment with rituximab.

Images