Use of s protein or p4HB protein as target in preparation of drug for prevention or treatment of coagulopathy associated with SARS-cov-2 infection

Abstract

A use of a S protein or P4HB protein as a target in preparation of a drug for prevention or treatment of coagulopathy associated with SARS-CoV-2 infection. The S protein is the spike protein of SARS-CoV-2 virus, and the P4HB protein is human protein disulfide isomerase. By means of integrated proteomic and bioinformatic study on SARS-CoV-2 interaction networks in endothelial cells, pulmonary cells, and bronchial cells, the S protein is determined as a key contributor to the procoagulant characteristics of viruses, and the S protein plays a critical role in inducing endothelial cell dysfunction. The S protein directly interacts with P4HB by means of an RBM region thereof, and promotes the secretion of P4HB by means of a lysosomal secretion pathway, thereby promoting thrombosis both in vitro and in a mouse model. Genetic or pharmacological targeting of S-P4HB axis can alleviate coagulopathy in a mouse model. The level of P4HB and disulfide bonds of target proteins thereof are significantly altered in the plasma and leukocytes of COVID-19 patients and are closely associated with the disease severity and coagulation correlation of these patients.

Description

Application of S protein or P4HB protein as a target in preparation of a drug for preventing or treating coagulopathy related to new crown infection TECHNICAL FIELD

[0001] The present application belongs to the technical field of biological medicine, and specifically relates to application of S protein or P4HB protein as a target in preparation of a drug for preventing or treating coagulopathy related to new crown infection. BACKGROUND

[0002] The new coronavirus (SARS-CoV-2) belongs to the coronavirus family and the beta coronavirus genus. SARS-CoV-2 has a phospholipid bilayer envelope, and the appearance is a round or oval particle with protrusions on the surface, which looks like a crown, with a diameter of 60-140 nm; the envelope has spike protein (S protein), membrane protein (M protein), envelop protein (E protein), etc.; the envelope has linear single-stranded positive-strand RNA combined with nucleocapsid protein (N protein), and the genome size is about 30 kb. SARS-CoV-2 infects host cells by combining with receptor proteins such as angiotensin converting enzyme 2 (ACE2) mediated by S protein.

[0003] S protein is an important marker protein on the surface of the virus, which is a homotrimer combined by three identical subunits through non-covalent bonds; meanwhile, S protein has multiple N-glycosylation sites, and glycosyl is connected to the protein through covalent bonds to form glycoprotein, and the presence of a large number of glycosyl can change the spatial structure of the protein molecule through glycosylation to block or destroy the antigen epitope, thereby inhibiting the body's immune response and protecting the virus. The sequence of S protein mainly includes N-terminal domain (NTD), receptor binding domain (RBD), fusion peptide segment (FP), 2-segment heptad repeat (HR), central helix (CH), connector domain (CD), transmembrane domain (TD), etc., and there are also S1 / S2 and S2' two cleavage sites.

[0004] Each subunit of S protein is composed of 1273 amino acid residues, whose polypeptide chain is encoded by viral genomic RNA and translated directly in the cell by host ribosomes. S protein is a transmembrane protein, which can be divided into S1 subunit at the amino terminal (N-terminal) and S2 subunit at the carboxy terminal (C-terminal), S1 subunit is globular, responsible for binding to cell receptors, S2 subunit is a handle-shaped inserted into the viral envelope, responsible for mediating subsequent membrane fusion, receptor binding and membrane fusion are key steps in the SARS-CoV-2 infection cycle. Under normal circumstances, the S protein of SARS-CoV-2 exists in a metastable trimeric conformation. When the S1 subunit binds to the host cell receptor, the host protease cleaves the S1 / S2 cleavage site of the S protein, which destroys the stability of the pre-fusion trimer, resulting in the shedding of the S1 subunit and the conversion of the S2 subunit to the stable post-fusion conformation.

[0005] SARS-CoV-2 infection can cause COVID-19, and can also cause various complications and sequelae, among which COVID-19 associated coagulopathy (CAC) has received more and more attention because of its high correlation with the severity of COVID-19, mortality, and COVID-19 complications and sequelae ("long COVID").

[0006] Some randomized controlled trials and observational studies have evaluated the effect of therapeutic doses of heparin in reducing the risk of venous thromboembolic events or death in hospitalized patients with COVID-19. Given the results of these trials, therapeutic doses of low molecular weight heparin have been widely used in hospitalized patients with elevated D-dimer levels, and prophylactic doses of heparin have been provided for those who do not meet the criteria for therapeutic heparin. However, these drugs increase the risk of side effects, including heparin-induced thrombocytopenia (HIT). Since most severe cases of COVID-19 occur in the elderly or individuals with underlying cardiovascular disease, these individuals are more likely to develop HIT. Antiplatelet drugs such as aspirin and P2Y12 inhibitors, anti-complement drugs such as ravulizumab and eculizumab, and kallikrein-kinin system targeting therapy have limited effect in treating CAC.

[0007] A new study reveals significant changes in proteins related to coagulation, complement activation, and the immune system in the serum of patients experiencing long COVID. Preventing CAC can reduce the risk of patients developing COVID-19-related complications and sequelae, such as long COVID.

[0008] CAC is a complex condition involving dysregulation of multiple mechanisms, including inflammation, immunity, coagulation, fibrinolysis, complement, and kinin-kininase systems. Multiple mechanisms have been proposed, including vascular endothelial cell dysfunction, excessive inflammatory immune response, and hypercoagulability, which can contribute to the development of CAC. The first and most important mechanism of thrombotic complications caused by SARS-CoV-2 infection, which is different from the coagulation events caused by other common respiratory virus infections, is the injury and dysfunction of vascular endothelium. It has been proven that SARS-CoV-2 infection can directly infect vascular endothelial cells, however, whether the injury of endothelial cells is caused by direct infection of endothelial cells by SARS-CoV-2 or by endothelial cell dysfunction and thrombosis caused by natural immune response is still controversial. An important scientific problem that needs to be solved is how SARS-CoV-2 induces endothelial cell dysfunction, activation and vasculopathy.

[0009] SUMMARY

[0010] The present application is directed to the above-mentioned deficiencies in the prior art, and provides the application of S protein or P4HB protein as a target in the preparation of a drug for preventing or treating COVID-19 infection-related coagulopathy.

[0011] The present application first provides the application of S protein or P4HB protein as a target in the preparation of a drug for preventing or treating COVID-19 infection-related coagulopathy, wherein the S protein is the Spike protein of SARS-CoV-2, and the P4HB protein is the human protein disulfide-isomerase.

[0012] Preferably, the drug can target P4HB to reduce the expression level of P4HB, or inhibit the disulfide isomerase activity of P4HB, or a molecule that inhibits the binding of P4HB to S protein, or the drug can target the S protein of SARS-CoV-2 virus to reduce the expression level of S protein or a molecule that inhibits the binding of S protein to P4HB.

[0013] More preferably, the drug is at least one of the following: a small molecule inhibitor of P4HB, a polypeptide or protein inhibitor of P4HB, an antibody targeting the full-length or partial sequence of P4HB, an interfering sequence that reduces the expression level of the gene encoding P4HB, a small molecule inhibitor of S protein, a polypeptide or protein inhibitor of S protein, an antibody targeting the full-length or partial sequence of S protein, an interfering sequence that reduces the expression level of the gene encoding S protein.

[0014] Further preferably, the drug is a P4HB inhibitor quercetin-3-rutin, compound rutin, troxerutin or bacitracin.

[0015] Preferably, the P4HB interacts with the receptor binding domain of the S protein.

[0016] The application further provides a use of a molecule targeting the S protein or the P4HB protein in the preparation of a drug for preventing or treating a coagulopathy related to a COVID-19 infection, wherein the S protein is a spike protein of a novel coronavirus, and the P4HB protein is a human protein disulfide isomerase.

[0017] Preferably, the molecule is a molecule capable of targeting the P4HB to reduce the expression level of the P4HB or inhibit the binding of the P4HB to the S protein, or the molecule is a molecule capable of targeting the S protein of the SARS-CoV-2 virus to reduce the expression level of the S protein or inhibit the binding of the S protein to the P4HB.

[0018] More preferably, the molecule is at least one of the following: a small molecule inhibitor of P4HB, a polypeptide or protein inhibitor of P4HB, an antibody targeting the full-length or partial sequence of P4HB, an interfering sequence reducing the expression level of the gene encoding P4HB, a small molecule inhibitor of the S protein, a polypeptide or protein inhibitor of the S protein, an antibody targeting the full-length or partial sequence of the S protein, an interfering sequence reducing the expression level of the gene encoding the S protein.

[0019] Further preferably, the molecule is a P4HB inhibitor quercetin-3-rutin, compound rutin, troxerutin or bacitracin.

[0020] The application determines, through comprehensive proteomic and bioinformatic research on the SARS-CoV-2 interaction network in endothelial cells, lung cells and bronchial cells, that the spike protein (S) is a key contributor to the coagulation-promoting properties of the virus, and that the protein disulfide isomerase P4HB plays a key role in S-induced endothelial cell dysfunction. Further analysis shows that the S protein directly interacts with P4HB through its RBM region, and promotes the secretion of P4HB through the lysosomal secretory pathway, thereby promoting thrombosis in vitro and in a mouse model. Genetic or drug targeting of the S-P4HB axis is found to alleviate coagulopathy in a mouse model. The levels of P4HB and the disulfide bond modification of its target proteins are significantly changed in the plasma and leukocytes of COVID-19 patients, and are closely related to the severity of the disease and coagulation-related in these patients. In summary, our results reveal a new pathway of SARS-CoV-2 S-mediated endothelial cell dysfunction promoting coagulopathy through P4HB, and propose a new approach to treating CAC. BRIEF DESCRIPTION OF DRAWINGS

[0021] Figure 1 is a graph of the results of proteomic profiling of SARS-CoV-2 S interacting proteins identified P4HB as a key regulator of S-induced pro-thrombotic activity in vascular endothelial cells. (A) Schematic of the integrated proteomic and computational workflow. (B) High-confidence interacting proteins (HCIPs) were classified according to their cellular functions. (C) Heat map of protein relative abundance. (D) An interaction network of dysregulated S interacting proteins was constructed in the most significantly affected pathways. (E-G) HUVECs were transfected with SARS-CoV-2 S, N, E, M, or mock control, and expression of tissue factor (E), PAI-1 (F), and IL-6 (G) was assessed by qRT-PCR. (H) Expression of tissue factor and IL-6 was assessed by qRT-PCR in wild-type, S-transfected, and P4HB-knockout HUVECs. n = 3 in (E-H), data shown as mean ± SEM from three independent experiments, P values calculated by two-sided Student’s t test (*P < 0.05, ****P < 0.0001).

[0022] Figure 2 is a graph of SARS-CoV-2 S directly interacts with P4HB and promotes its secretion to facilitate platelet aggregation. (A) Platelet-rich plasma (PRP) was treated with the supernatant purified from HUVECs transfected with SARS-CoV-2 S, and the level of platelet aggregation was measured in real time. (B) PRP was treated with the supernatant purified from WT (wild type) or P4HB-KO HUVECs transfected with S, and the level of platelet aggregation was measured in real time. (C) HEK293T cells were co-transfected with Myc-tagged P4HB and SFB-tagged S, and cell lysates were incubated with S-beads. 5% of lysates were used as a control. (D) HEK293T cells were co-transfected with Myc-tagged P4HB and SFB-tagged S, and western blot analysis of cell lysates and purified supernatant. (E) HUVECs were transfected with SARS-CoV-2 S, and western blot analysis of cell lysates and purified supernatant. (F) HEK293T cells were co-transfected with Myc-tagged P4HB and SFB-tagged S and N, and western blot analysis of cell lysates and purified supernatant. (G) Complex structure model of S1 and P4HB, S1, RBD, and P4HB are shown in green, yellow, and gray, respectively, and hydrogen bonds between S1 and P4HB are shown as dashed lines. (H) HEK293T cells were co-transfected with Myc-tagged P4HB and SFB-tagged WT or mutant RBD in the RBM domain, and western blot analysis and quantification of cell lysates and purified supernatant, blots with antibodies targeting actin, Myc, or Flag epitopes are shown. (I) HEK293T cells were co-transfected with Myc-tagged P4HB and SFB-tagged WT or mutant RBD in the RBM domain, and cell lysates were incubated with S-beads, 5% of lysates were used as a control, blots with antibodies targeting actin, Myc, or Flag epitopes are shown. (J) PRP was treated with the supernatant purified from HUVECs transfected with WT or mutant RBD in the RBM domain, and the level of platelet aggregation was measured in real time. n = 3 in (A, B-E, G-I), data are shown as mean ± SEM of three independent experiments, P values were calculated by two-tailed Student’s t test (*P < 0.05, ****P < 0.0001).

[0023] Figure 3 is a graph of S protein promotes P4HB protein secretion in a lysosome- dependent manner. (A) Immunofluorescence detection of FLAG-S, HUVEC-S-WT was treated with BFA for 8 hours, then fixed and stained with labeled FLAG antibody, and detected using fluorescence colocalization microscopy. (B) Immunofluorescence experiment detected the colocalization of P4HB and ERGIC53, HUVEC-S-WT was treated with BFA for 8 hours, then fixed and stained with endogenous antibody, and detected using fluorescence colocalization microscopy. (C) and (D) Immunofluorescence experiment detected the colocalization of P4HB with Gro-α (C) or LAMP1 (D), HUVECs were treated with thrombin or transfected with SFB-labeled wild-type or mutant SARS-CoV-2 S, and fixed after 24 hours of treatment, stained with endogenous antibody, and detected using fluorescence colocalization microscopy. (E) HEK293T cells were treated with BFA for 8 hours, co-transfected with Myc-labeled P4HB and SFB-labeled S1, and cell lysates and purified supernatants were analyzed by Western blotting, and blots using antibodies targeting actin, Myc, or Flag epitopes were shown. Quantification of secreted P4HB. (F) HEK293T cells were treated with CID1067700 for 12 hours, co-transfected with Myc-labeled P4HB and SFB-labeled S1, and cell lysates and purified supernatants were analyzed by Western blotting, and blots using antibodies targeting actin, Myc, or Flag epitopes were shown, and quantification of secreted P4HB. (G) Schematic diagram of P4HB secretion mechanism triggered by SARS-CoV-2 S during SARS-CoV-2 infection. Under normal circumstances, P4HB is secreted from the endoplasmic reticulum through the cytoplasmic transport of secretory granules containing Gro-α, and during SARS-CoV-2 infection, P4HB is hijacked by SARS-CoV-2 S through direct binding, and then secreted to the extracellular space through the lysosome-dependent secretion pathway together with the virus S. n=3 in (A-C), data are shown as mean ± SEM of three independent experiments, P values were calculated by two-tailed Student’s t tests (****P<0.0001).

[0024] Figure 4 is a graph of the results of S-P4HB axis promotes thrombosis in mouse models. Wherein (A) is a schematic diagram showing the in vivo analysis for verifying the role of P4HB and S protein interaction in thrombosis in mouse models, B6 mice infected with AAV delivering S1 and S1-ARBD genes, five weeks after infection, the left common carotid artery (LCCA) of the mice was exposed to ferric chloride for 2 minutes, and the coagulation process was monitored by ultrasound. (B) Immunofluorescence detection of the expression of exogenous S1 from AAV in the LCCA of mice. (C) Five weeks after infection, the tail bleeding time of AAV-NC, AAV-S1-WT and AAV-S1-ARBM infected mice was measured and compared. (D) Five weeks after infection, platelet-rich plasma of AAV-NC, AAV-S1-WT and AAV-S1-ARBM infected mice was collected, and flow cytometry was performed with anti-CD41a and CD62 antibodies to detect activated platelets. (E) and (F) Five weeks after infection, the relative velocity-time integral (VTI) (E) and resistance index (RI) (F) of the LCCA of AAV-NC, AAV-S1-WT and AAV-S1-ARBM infected mice were evaluated. n=5 in (C, E, F), and the data is shown as the mean ± SEM of three independent experiments.

[0025] Figure 5 is a B-mode image of the LCCA of mice treated with ferric chloride for 2 minutes, and the coagulation process was monitored by ultrasound, and the B-mode image was imaged every 10 minutes within 40 minutes after treatment.

[0026] Figure 6 is a corresponding power Doppler waveform of the B-mode image of the LCCA of mice treated with ferric chloride for 2 minutes, and the coagulation process was monitored by ultrasound, and the B-mode image was imaged every 10 minutes within 40 minutes after treatment.

[0027] Figure 7 is an analysis of image results using Vevo Lab software. Wherein the mean velocity (A) and VTI (B) curves over time are plotted. (C-F) Mice infected with AAV-NC (C and D) or AAV-S1 (E and F) were injected intravenously with bacatirin, quercetin-3-rutinoside or other clinically used antithrombotic drugs 5 weeks after infection, and the LCCA of the mice was treated with ferric chloride for 2 minutes 10 minutes later. The coagulation process was monitored by ultrasound, and then the images were analyzed using Vevo Lab software, and the mean velocity (C and E) and VTI (D and F) curves over time were plotted. (G) The PRP platelet concentration curve of mice treated with control, quercetin-3-rutinoside or heparin. n=5 in (A-G), and the data is shown as the mean ± SEM of three independent experiments.

[0028] Figure 8 is a graph showing that P4HB inhibitor quercetin-3-rutinoside reduced lung thrombosis in SARS-CoV-2 infected mice and reduced the risk of bleeding side effects. (A) Schematic showing the experiment to validate the role of P4HB in SARS-CoV-2 induced coagulation in a mouse infection model, mice were infected with SARS-CoV-2 (10 4 PFU / mouse) intranasally and treated with quercetin-3-rutinoside, heparin or PBS daily for 5 days post infection, mouse lungs were collected for histological examination at 3 days post infection and blood samples were collected for coagulation factor examination at 3 and 4 days post infection. (B) Immunofluorescence detection for FBG and CD31, lung tissue sections from mice in different groups were stained with indicated endogenous antibodies and visualized under microscope. (C) Immunohistochemistry detection for Spike protein, lung tissue sections from mice in different groups were stained with anti-Spike protein antibody and visualized under microscope, lung microthrombosis was marked with red arrow, the number of lung microthrombosis was calculated. (D) Immunofluorescence detection for CD41a and P-selectin, lung tissue sections from mice in different groups were stained with indicated endogenous antibodies and visualized under microscope, the mean fluorescence intensity and pixel area of microthrombosis were analyzed. (E) Mouse plasma from different groups were collected at 0, 3 and 4 days post infection, then D-Dimer and PAI-1 levels in collected mouse plasma were measured by ELISA detection method. (F) Schematic of LPS-induced lung injury model to validate Q-3-R induced bleeding side effects in vivo, mice were treated with LPS intranasally, 8 hours later, mice received anti-thrombotic drugs or Q-3-R by intraperitoneal injection, bronchoalveolar lavage (BAL) fluid was stained with antibodies and analyzed by flow cytometry, lung was surgically removed for histopathological staining and analysis. (G) Bleeding induction in mouse lung after treatment with various anticoagulants under LPS induction. (H) Bleeding induction in mouse cerebrospinal fluid after treatment with various anticoagulants under LPS induction. (I) Immunofluorescence detection for TER119, lung tissue sections from mice in different groups were stained with indicated endogenous antibodies, fluorescence colocalization microscopy detection. n=3 in (B-E and H-I), data are shown as mean ± SEM of three independent experiments, P values were calculated by two-tailed Student’s t test (****P<0.0001).

[0029] Figure 9 shows the elevated levels of P4HB in COVID-19 patients. (A and B) show the expression levels of P4HB in four coagulation-related blood cell types from 90 COVID-19 patients retrieved from the Oxford COVID-19 Multiomics Hematologic Atlas database. The figures are heatmaps (A) and corresponding scatter plots (B) of single-cell gene expression of P4HB in PLT, cMONO, Mono.cyc, and ncMono cells. (C and D) show the expression levels of tissue factor (C) and P4HB in plasma (C) and leukocytes (D) of COVID-19 patients assessed using indicated endogenous antibodies via Western blotting. Overall protein levels were assessed using co-Marseille brilliant blue staining. In (CD), n = 2 per group.

[0030] Figure 10 shows the results of detecting the disulfide bond modification status of proteins in the plasma of COVID-19 patients using label-free proteomics. (A) Disulfide bond modifications of proteins with significant alterations in thrombosis and SARS-CoV-2-related pathways were grouped based on gene ontology analysis and literature search; reported P4HB interacting proteins and substrates are represented by green and pink dots, respectively. (B) Proteins with significant alterations were enriched by KEGG pathway analysis. (C) Biochemical and mass spectrometry analyses of patient blood samples. (D) Levels of D-dimer and CRP. (Figures E and F) Results of mass spectrometry analysis. Detailed Implementation

[0031] The experimental materials and methods are as follows:

[0032] 1. Cell Culture

[0033] HEK293T, H1299, BEAS-2B, and HUVEC cells were purchased from the ATCC cell bank in the United States. HEK293T, H1299, and HUVEC cells were cultured in Dulbecco's modified Eagle's medium (DMEM). BEAS-2B cells were cultured in bronchial epithelial cell growth basal medium (Lonza, Switzerland). All media contained 10% fetal bovine serum (FBS, Gibco, Australia) and were supplemented with 1% penicillin and streptomycin (Sigma-Aldrich, UK).

[0034] 2. Plasmid construction and transfection

[0035] Genes encoding S protein variants, P4HB and PDIA6 were synthesized, cloned into pDONR201 vector (Invitrogen, USA) as entry clones, and subsequently transferred into Gateway-compatible destination vectors for expression of SFB-tagged viral proteins and Myc-tagged candidate proteins. sgRNAs against P4HB or PDIA6 were synthesized and cloned into lentiCRISPRv2 vector (Addgene #52961). All clones were verified by sequencing.

[0036] P4HB-sgRNA-F: CACCGCATGGTGTGGTCACTGCAAA;

[0037] P4HB-sgRNA-R: AAACTTTGCAGTGACCACACCATGC.

[0038] sgRNAs against PDIA6 were synthesized with primers:

[0039] PDIA6-sgRNA-F: CACCGCTCGTGAAGGATCGCCTCG;

[0040] PDIA6-sgRNA-R: AAACCGAGGCGATCCTTCACGAGC.

[0041] Clones with SFB- or Myc-tagged protein-encoding genes were transfected into HEK293T, H1299, BEAS-2B and HUVEC cells. Knockout or stable transduction cell lines were constructed, P4HB / PDIA6 sgRNAs or SFB-tagged S protein were introduced into HEK293T cells by packaging into lentivirus through co-transfection with packaging plasmids pMD2.G and pSPAX2. Supernatants were collected 48 hours after transfection to infect HUVEC, Beas-2B and H1299 cells. Infection was repeated twice every 24 hours to achieve maximum infection efficiency. Stable cell lines were selected using culture medium containing 2-5 μg / mL puromycin.

[0042] 3. SARS-CoV-2 infection of K18-hACE2 mice

[0043] The SARS-CoV-2 virus strain was isolated from a COVID-19 patient in Shanghai (GenBank accession number: MT121215). We purified and amplified the initial virus passage in Vero-E6 cells on a large scale and stored the virus at -80°C. Eighteen female K18-hACE2 mice (9-14 weeks old, Shanghai Model Animals, China) were divided into three groups: control group, SARS-CoV-2 infection group, and SARS-CoV-2 infection and quercetin-3-rutinose treatment group. When the virus infection was performed, the mice were intranasally infected with SARS-CoV-2 (10 4 PFU per mouse). From the day of virus infection, the mice in the SARS-CoV-2 + quercetin-3-rutinose group received a one-time intraperitoneal injection of 1 mg / kg of quercetin-3-rutinose. The animals were housed in a BSL3 laboratory: individually ventilated cages (IVCs), 12 / 12-hour light / dark cycle. The environmental temperature was set at 20-25°C, and the relative humidity was 30-70%. All studies were evaluated and approved by the Animal Ethics Committee of Fudan University (protocol BSL3-2022S2).

[0044] 4. Preparation of blood samples from COVID-19 patients

[0045] Blood samples were collected from COVID-19 patients at the Second Affiliated Hospital of Zhejiang University School of Medicine. Two samples were collected from each mild and severe case. All severe patients had symptoms of spinal vascular rupture.

[0046] For plasma preparation, 3 mL of venous blood was collected into an anticoagulant-treated tube. From it, 1.2 mL of whole blood was separated into a 1.5 mL EP tube, then centrifuged at 2000 x g for 15 minutes at 4°C. The supernatant was collected as plasma, and the virus was inactivated by heating in a 56°C water bath for 30 minutes. To use AKTA for label-free quantitative mass spectrometry analysis to detect changes in protein disulfide bond modification, the plasma samples were pretreated to remove high-abundance proteins.

[0047] For the preparation of leukocytes, 1 mL of whole blood was separated from the anticoagulant tube into a 50 mL centrifuge tube, and 10 mL of 1-fold red blood cell lysis solution (Invitrogen, catalog number 00-4333) was used to lyse for 10 minutes at room temperature. Then the reaction was terminated by adding 25 mL of PBS and centrifuging at 500g for 15 minutes at 4°C. The cell pellet was washed three times with 1-fold PBS, and the washed leukocyte pellet was collected, and the virus was inactivated by heating in a 56°C water bath for 30 minutes.

[0048] 5. Protein secretion experiment and platelet aggregation experiment

[0049] HUVEC or myc-P4HB transfected HEK293T cells and supernatant were collected separately. After cell lysis, supernatant was concentrated by ultracentrifugation at 30000 rpm for 3 hours. Subsequently, cell lysate and concentrated supernatant were mixed with 5x loading buffer, boiled for 15 minutes and subjected to Western blot analysis. Western blot bands in cell lysate and supernatant were scanned using IMAGE J software to determine protein expression levels. Relative protein secretion efficiency was calculated based on the ratio of band gray scale in supernatant to that in cells.

[0050] For platelet aggregation experiment, 50 μL of rat platelet rich plasma (PRP) (Bersee Biotech) was treated with 50 μL of concentrated supernatant and thrombin at a final concentration of 0.02 U / mL. After incubation at 37 °C for 5 minutes, the absorbance of the mixture was measured using a Varioskan LUX microplate reader (Thermo). Negative and positive controls were used with thrombin concentrations of 0 U / mL and 1 U / mL, respectively. Transmittance (T) = 100 - absorbance -A , where A is absorbance, aggregation rate (%) = (T-T neg ) / (T pos -T neg ) x 100%.

[0051] 6. In vitro cell permeability experiment

[0052] HUVECs (human umbilical vein endothelial cells) were plated in the upper chamber of Transwell plates (CORNING) and cultured in complete medium for 24 hours, then starved in EBM 2% FBS 1% BSA for 3 hours, and fluorescent isothiocyanate (FITC)-dextran (MedChem Express) was used to determine permeability. When the cells reached a dense layer, FITC-dextran with histamine 100 μM was added to the medium (EBM 2% FBS) in the top chamber at a concentration of 25 mg / ml. At 2 hours and 5 hours, 50 μl of medium was collected from the bottom chamber, and the amount of FITC-dextran in the medium was measured by Microplate Reader (Thermo) to measure the intercellular permeability between cells.

[0053] 7. Tandem affinity mass spectrometry

[0054] Stable expression of SARS-CoV-2 viral proteins in HEK293T, SH-SY5Y, H1299, BEAS-2B and HepG2 cells were selected in the medium containing 2-5 pg / mL puromycin. Protein expression was confirmed by immunostaining and Western blotting. For TAP, 1 x 10 8 Membrane-bound and soluble proteins of cells. The lysate was incubated with streptavidin-conjugated beads (Thermo Fisher Scientific, USA) at 4 °C for 2 h. The beads were washed three times with lx NETN buffer (20 mM Tris-HCl, pH 8.0, 100 mM NaCl, 1 mM EDTA, 0.5% Nonidet P-40) and the bound proteins were washed with NETN buffer containing 2 mg / mL biotin (Sigma-Aldrich, USA) at 4 °C for 2 h. The eluate was incubated with s-protein beads (Millipore, USA) for 1 h, washed three times with NETN buffer, and subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The entire band after electrophoresis of each sample was excised and subjected to in-gel trypsin digestion and liquid chromatography (LC)-MS.

[0055] The excised gel band was cut into approximately 1 mm 3 pieces and subjected to in-gel trypsin digestion and drying. The samples were reconstituted in 5 pl of HPLC solvent A (2.5% acetonitrile and 0.1% formic acid). A nanoscale reversed-phase high-performance LC capillary column was prepared by flame-tipping a fused-silica capillary (100 pm inner diameter x -20 cm long) packed with 5 pm C18 spherical silica beads. After equilibration of the column, each sample was loaded using an autosampler. A gradient was formed, and polypeptides were eluted with increasing concentrations of solvent B (97.5% acetonitrile and 0.1% formic acid), and the peptides were subjected to MS as they eluted.

[0056] For MS, Orbitrap Fusion Lumos was used, with a source operating at 1.9 kV, no sheath gas flow, and an ion transfer tube set at a temperature of 350 °C. A data-dependent acquisition mode was used. Survey scans were performed in the m / z 350 to 1500 range, with a resolution of 60000 at m / z 200. Collision-induced dissociation was performed on the 20 most intense peaks with a charge greater than or equal to 2, with a normalized collision energy of 30% and one microscan; an intensity threshold was set to 1000. The resolution of the MS2 spectra was 15000. Peptides were detected, separated, and fragmented to produce a tandem mass spectrum of specific fragment ions for each peptide.

[0057] 8. Mass spectrometry data analysis

[0058] MS peptide sequences and protein identification were determined by matching fragment patterns in protein databases using the Mascot software program (Matrix Science, USA). The enzyme specificity was set to partial trypsin with two missed cleavages. Peptide modifications included carboxyamidomethylation (cysteine variable), oxidation (methionine variable), phosphorylation, and acetylation. Mass tolerances for precursor and fragment ions were set to 20 ppm. UniProt was used for searching databases (H. sapiens and SARS-CoV-2 variants). Spectra matches were filtered using the target-decoy approach to have a false discovery rate below 1% at the peptide level, and manual annotation was used when necessary. The same principle was used for the study when protein isoforms were present, using the MUSE algorithm for interactive filtering to assign a quality score to the identified protein-protein interactions (PPIs). The proteome and processed protein identification table was uploaded to the website http: / / 172.16.75.33:3535.

[0059] Proteins identified by MS were first annotated using the UniProt database, in combination with relevant pathways, tissues, subcellular localization, transmembrane information, and whether they act as receptors. Using the HCIP dataset, the overall and individual interactions of the core components of the Notch pathway were enriched in signaling pathways and functional categories. The estimation of P values used the Ingenuity Pathway Analysis software program. We also performed GO enrichment and KEGG pathway enrichment analysis using the clusterProfiler package in the R program. GO terms included cellular component, molecular function, and biological process. Only statistically significant associations (P < 0.05) were listed. The -log(P value) for each function and associated hcip was listed.

[0060] 9. Bioinformatics analysis and structure prediction

[0061] We used the genous Prime software (https: / / www.geneious.com / prime) to perform a multiple sequence alignment of the sequences of the 8 variants and generated a neighbor-joining tree based on the alignment. For drug repurposing analysis, we integrated data from the Drug Repurposing Hub database, which is a curated and annotated collection of FDA-approved drugs. We performed a drug screen on all the prey in the MS data to provide new potential coronavirus-specific drugs. Then we categorized the drugs according to their clinical stage.

[0062] For structure prediction, HCIPs annotated as membrane proteins with PSM > 10 in all 80 TAP-MS experiments of S proteins were selected for structure prediction. We selected 319 candidate S interactors and predicted their structures in complex with S using AlphaFold 2.2. Based on the predictions, we calculated the most likely interaction repertoire of S proteins and potential receptors. The predicted complex structures were visualized using PyMol (https: / / pymol.org / 2 / ).

[0063] 10. Immunoblotting, immunoprecipitation and immunofluorescence

[0064] Cells were collected in NETN buffer and incubated on ice for 30 min. After determining the protein concentration using bicinchoninic acid (BCA) kit (Thermofisher), 5x loading buffer (Beyotime, China) was added and boiled for 15 min. After 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis, proteins were transferred to PVDF membrane (Millipore).

[0065] Immunoprecipitation (IP) and co-IP experiments: 1 x 10 7 Cells were lysed in ice-cold NETN buffer for 30 min. Cell lysates were incubated with 5 μl protein A / G agarose (Millipore, USA) for 1 h, and then incubated with indicated antibodies at 4 °C overnight. After centrifugation, 10 μl protein A / G agarose was used for incubation at 4 °C for 1 h. Pre-cooled NETN buffer was used for washing 3 times, and then eluted with 40 μl protein lysis buffer (Beyotime, China). 20 μl 5x loading buffer (Beyotime, China) was added and boiled for 15 min for Western blot analysis. The following primary antibodies were used: anti-myc (1 :2000, CST, #2276, USA) and anti-flag (1 :2000, CST, #14793, USA).

[0066] For immunofluorescence detection, after plating cells, they were fixed with 4% paraformaldehyde for 10 min at room temperature. Permeabilization was performed with 0.1% Triton X-100 for 10 min, washed with PBS, blocked with 5% BSA in PBS for 30 min, and then labeled with primary antibodies for 1 h at room temperature. After incubation with the indicated antibodies for 1 h at room temperature, cells were washed twice with PBS, stained with goat anti-rabbit or goat anti-mouse fluorescently labeled IgG (1 : 1000, Abeam, UK) for 1 h at room temperature, and then subjected to 4', 6-diamidino-2-phenylindole (DAPI) staining (Sigma-Aldrich, USA). Coverslipping was performed using FluorSave™ reagent (Millipore, USA). Cells were observed using an Olympus IX73 microscope imaging system (Olympus, Japan).

[0067] Generation and infection of SARS-CoV-2 pseudovirus: HEK293T cells were cultured in 10 cm pre-coated with poly-1-lysine dishes and incubated with DMEM supplemented with 10% fetal bovine serum, penicillin / streptomycin and 1-glutamine. The next day, cells were co-transfected with pNL4-3.1uc. SARS-CoV-2 S plasmid was transfected using VigoFect DNA transfection reagent (vigor, China). Supernatants were collected at 48 and 72 h post-transfection, mixed with polyethylene glycol overnight, passed through a 0.45 pm filter, centrifuged at 500 x g for 5 min, drained, and stored at -80 °C.

[0068] To transfect cells with SARS-CoV-2 pseudotype virus, cells were plated in 96-well plates and then infected with SARS-CoV-2 pseudotype virus for 24 h. The medium was changed to total medium for 36 h and luciferase reporter activity was detected using the dual luciferase assay system (Promega, USA).

[0069] Example 1: P4HB plays a key role in S-induced endothelial cell dysfunction

[0070] To gain insight into SARS-CoV-2 S-induced procoagulant effects and identify key host proteins involved in this process, we established SARS-CoV-2 S interaction networks in HUVECs, NCI-H1299 cells and BEAS-2B cells by TAP-MS (Figure 1A). Mass spectrometry analysis of purified protein extracts showed successful purification of S protein (NC_045512 REGION: 21563..25384) with at least 387 matches to S protein. High-confidence maps of S-bound host proteins were established. We found that the strongest S protein interacting proteins were mainly involved in viral invasion, such as ZDHHC5, GOLGA7 and AXL, which were reported to be host proteins facilitating viral invasion, protein folding and maturation in the endoplasmic reticulum, and inflammation and thrombosis processes (Figure IB). Figure 1C is a heatmap of protein relative abundances that were significantly dysregulated in at least one sample (left), the most enriched pathways involved in at least one of the six dysregulated protein blocks (right), with lines connecting each protein block to its most enriched pathway, showing the distribution of proteins involved in each biological pathway, distinguished by dysregulated protein blocks. Functional annotation and pathway enrichment analysis showed that S interacting proteins were highly involved in pathways closely related to coagulation processes, such as neutrophil degranulation, platelet activation and aggregation, and hemostasis processes (Figure 1C). We analyzed important pathways closely related to S protein function and thrombosis to highlight key S interacting proteins involved in these processes (Figure ID). Protein disulfide isomerase family members P4HB and PDIA6 were identified as the most important results, indicating that these proteins can play a key role in S-mediated thrombotic events.

[0071] SARS-CoV-2 infection leads to damage of vascular endothelial cells, triggering an inflammatory response and activation of coagulation-related processes, ultimately leading to thrombosis. To investigate the effect of S protein on endothelial cell activation, we transfected HUVECs with the four viral structural proteins S, N, E and M (S protein: NC_045512 REGION: 21563..25384, N protein: NC_045512 REGION: 28274..29533, E protein: NC_045512 REGION: 26245..26472, M protein: NC_045512 REGION: 26523..27191) and evaluated the expression levels of factors related to thrombosis, IL-6, tissue factor and PAI-1 (Figures IE-G). Overexpression of S significantly increased the levels of all three factors, indicating that this protein plays an important role in the inflammatory response and procoagulant effects caused by viral infection. Notably, knockdown of P4HB in HUVECs significantly inhibited the enhancement of these proteins (Figure 1H), indicating that P4HB can play a potential role in S-induced coagulation.

[0072] Example 2: S protein directly interacts with P4HB and promotes its secretion

[0073] To investigate the effect of S protein on coagulation function, we established an in vitro model to assess the function of HUVECs on platelet aggregation. We established a series of HUVECs stably expressing wild type (NC_045512 REGION: 21563..25384) or Omicron S (OM858820.1) by lentivirus infection, and purified the secreted proteins from the supernatant by ultracentrifugation. Platelet-rich plasma (PRP) enriched with platelets was treated with these purified cell supernatants, and the level of platelet aggregation was recorded. We found that overexpression of S protein significantly promoted platelet aggregation compared with the control group (Figure 2A). Knockout of P4HB reversed the S-stimulated platelet aggregation (Figure 2B).

[0074] Studies have shown that P4HB is rapidly secreted into plasma during vascular injury, modifying plasma protein VTN and membrane surface integrin B3 on platelets and endothelial cells. This modification process leads to the activation of the above-mentioned cells, and is therefore essential for the progression of thrombus. To study the role of S protein in promoting P4HB secretion, we first verified whether S directly interacts with P4HB (Figure 2C). Overexpression of S significantly enhanced the secretion of P4HB into the culture medium (Figures 2D and F), while overexpression of N had no such effect. Overexpression of S also promoted the secretion of endogenous P4HB protein in HUVECs (Figure 2E). We repeated the above experiments using Omicron S and obtained similar results. Overexpression of Omicron S protein also led to upregulation of IL6, tissue factor and PAI-1, indicating that Omicron S promotes platelet aggregation using a similar mechanism.

[0075] These data suggest that overexpression of S protein in cells leads to upregulation of thrombus-related factors by promoting the secretion of P4HB, thereby enhancing platelet aggregation in vitro.

[0076] To determine the binding region of P4HB on S, we constructed a series of deletion mutants of the S1 subunit of S (S1 subunit is amino acid sequence 1-694 of S protein) S1-FL (1-694), S1-NTD (1-299), S1-RBD (300-694). We found that the receptor binding domain (RBD) of S1 is mainly responsible for their interaction. We further constructed RBD variants with domain deletion according to the reported structure of RBD domain, RBD-Δ300-446 (deletion of amino acid sequence 300-446), RBD-Δ447-515 (deletion of amino acid sequence 447-515), RBD-Δ516-526 (deletion of amino acid sequence 516-526), RBD-Δ527-600 (deletion of amino acid sequence 527-600), and mapped the binding region to residues 447-515 (RBM). Deletion of 447-515 on S1 not only blocked its binding to P4HB, but also attenuated the upregulation of factors IL6, tissue factor and PAI-1 related to thrombosis in HUVECs. This deletion also reduced the secretion of P4HB compared to the intact S1, leading to reduced platelet aggregation levels. Overall, these findings suggest that S protein promotes the secretion of P4HB through its RBD by direct interaction, which is essential for S protein-mediated thrombosis.

[0077] Recent studies have shown that the SARS-CoV-2 virus can promote thrombosis by binding of the S protein to platelet ACE2, while the 447-515 amino acid residues are responsible for S protein recognition of the host cell membrane receptor ACE2 and mediate viral invasion. To investigate the precise region of RBD interaction with P4HB and avoid the influence of RBM on the high thrombogenic ACE2 affinity, we used AlphaFold2.2 to predict the interaction between P4HB and S protein, which showed that P4HB interacts with residues 481-499 of S protein (Figure 2G), while these residues are not primarily responsible for ACE2 binding (33). We then constructed a series of RBM deletion mutations and confirmed that residues 481-499 of S are critical for promoting the secretion of P4HB and its subsequent impact on procoagulant function by repeating the above experiments (Figures 2H-J). In summary, residues 481-499 of S protein directly interact with P4HB, promoting its secretion and subsequent coagulation process. Since this region of S is highly variable in different SARS-CoV-2 variants, we selected five representative VOCs and four Omicron variants of S (S-WT: NC_045512 REGION: 21563..25384; S-alpha: H69V70-delete, Y144-delete, N501Y, A570D, D614G, P681H, T716I, S982A, D1118H; S-gamma: L18F, T20N, P26S, D138Y, R190S, K417T, E484K, N501Y, D614G, H655Y, T1027I; S-delta: T19R, G142D, EFR156-158G, L452R, T478K, D614G, P681R, D950N; S-omicron: OM858820.1; S-BA.3: A67V, del69 / 70, T95I, G142D, del143 / 145, N211I, del212 / 212, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K; S-BA.5: T19I, L24S, del25 / 27, del69 / 70, G142D, V213G, G339D, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, L452R, S477N, T478K, E484A, F486V, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K; S-BF.7: T19I L24S, del25 / 27, del69 / 70, G142D, V213G, G339D, R346T, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, L452R, S477N, T478K, E484A, F486V, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K; S-BQ.1: T19I, L24S, del25 / 27, del69 / 70, G142D, V213G, G339D, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, K444T, L452R, N460K, S477N, T478K, E484A, F486V, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K) and verified their interaction with P4HB. All variant S proteins interacted with P4HB, indicating that the binding ability of S protein to P4HB is not limited by the conservation of its 481-499 region.

[0078] Example 3: S protein facilitates the secretion of P4HB by way of lysosomal secretion

[0079] At the late stage of the coronavirus life cycle, four viral structural proteins, namely the nucleoprotein (N), the membrane protein (M), the envelope protein (E), and the spike protein (S), are packaged into the endoplasmic reticulum-golgi intermediate compartment (ERGIC), leading to the formation of mature viruses. Once assembled, the viral particles are transported to the cell surface by vesicles and released through the secretory lysosomal pathway. Scanning electron microscopy (SEM) analysis revealed that spike protein transfection led to the formation of hard, rigid protrusions from the plasma membrane, which was consistent with our confocal microscopy findings in a stable HUVEC cell line overexpressing S protein (HUVEC-S-WT) (Figure 3A). Furthermore, these protrusions were significantly reduced upon BFA (an inhibitor of ER-to-Golgi transport) treatment, indicating that BFA treatment disrupted the transport of S protein to the plasma membrane (Figure 3A). Overexpression of S protein led to increased colocalization of P4HB with ERGIC (Figure 3B). ER-Golgi transport blockage by BFA treatment also led to more pronounced accumulation of P4HB in ERGIC and prevented the secretion of P4HB (Figure 3E). These data suggest that S protein facilitates the transport of P4HB from the ER to the Golgi.

[0080] Studies have shown that the secretion of P4HB in endothelial cells in the absence of viral infection depends on Gro-α-containing secretory granules. To investigate the mechanism by which S protein promotes P4HB secretion, we performed immunofluorescence analysis for P4HB and Gro-α in HUVECs. Consistent with previous reports, P4HB was localized in the whole cell in HUVECs in this study (Figure 3C). Thrombin treatment caused P4HB to exhibit perinuclear dot localization of granules associated with Gro-α (Figure 3C). Overexpression of S or S-ARBM failed to colocalize P4HB with Gro-α (Figure 3C), indicating that S protein does not promote the secretion of P4HB in a Gro-α-containing granule-dependent manner.

[0081] During SARS-CoV-2 infection, assembled progeny virus particles are released from host cells through the lysosomal secretory pathway. We found that overexpression of S, but not S-ARBM, significantly enhanced the colocalization of P4HB with lysosomal marker LAMP1 (Figure 3D). Since RAB7 plays a key role in the generation and maintenance of lysosomes, we treated cells with RAB7 inhibitor CID1067700 and found that S-induced P4HB secretion was greatly reduced (Figure 3F), indicating that the secretion of P4HB is promoted by direct binding with S protein, which is a process dependent on the lysosomal secretory pathway (Figure 3G).

[0082] Example 4: S-P4HB axis promotes thrombosis in a mouse model

[0083] Studies using mouse and rhesus monkey models showed that SARS-CoV-2 infection caused endothelial dysfunction and thrombosis in vivo. To further validate the role of P4HB and S protein in COVID-19-induced dysregulated coagulation in vivo, we overexpressed wild-type S1 and P4HB-binding deficient mutant S1-ARBM in mice using AAV and studied thrombosis (Figure 4A). Exogenous proteins from AAV were normally expressed 5 weeks after infection (Figure 4B). The tail bleeding time of AAV-S1-ARBM (overexpressing P4HB-binding deficient mutant S1-ARBM) and AAV-NC (negative control group) mice was significantly prolonged compared with AAV-S1-WT mice (overexpressing wild-type S1) (Figure 4C). In AAV-S1-WT infected mice, significantly increased platelet activation was detected in platelet-rich plasma compared with AAV-NC and AAV-S1-ARBM infected mice (Figure 4D). The left common carotid artery (LCCA) of each mouse was subjected to ultrasound examination every week from the second week after infection. The results showed that in AAV-NC and AAV-S1-ARBM infected mice, the blood flow index of LCCA remained at a certain level for several weeks after AAV infection, with no significant change (Figures 4E and F). However, in AAV-S1-WT infected mice, the relative velocity time integral (VTI) of LCCA blood flow gradually decreased from 20 mm to about 14 mm at the fifth week after infection (Figure 4E), and the resistance index increased from 1.4 to 1.8 (Figures 4E and F), indicating the presence of increased vascular resistance in AAV-S1-WT infected mice.

[0084] To further assess whether these mice have the potential to develop thrombosis, the FeCl3-induced thrombosis model of LCCA was used. Slight changes in LCCA blood flow VTI and velocity were observed in AAV-NC and AAV-S1-ARBM infected mice (Figures 5 and 6). Both variables gradually decreased starting 20 minutes after treatment, eventually reaching the same level (Figures 7A and B). Meanwhile, a significant decrease in LCCA blood flow VTI and velocity was observed in AAV-S1-WT infected mice (Figures 5 and 6). The decrease started earlier than 5 minutes and completely stopped the blood flow 25 minutes after treatment (Figures 7A and B). These results confirmed the role of S in promoting thrombosis in vivo and that the binding between P4HB and S protein is crucial for this effect. To further validate the role of P4HB in this process, we injected two P4HB inhibitors with different structures, quercetin-3-rutinoside (quercetin-3-rutinose / rutin) and bacitracin (53-55), into AAV-S1 and AAV-NC mice, respectively. The anti-thrombotic ability was evaluated by ultrasound detection. Commonly used anti-thrombotic drugs, such as heparin, aspirin, and clopidogrel, were used as controls. Both P4HB inhibitors reduced thrombosis in AAV-S1-WT infected mice to a level similar to that in AAV-NC infected mice, and their ability to slow down thrombosis was comparable to other anti-thrombotic drugs (Figures 7C-F). In addition, we also demonstrated that P4HB inhibitors can effectively inhibit platelet aggregation caused by overexpression of S protein, and their effect is similar to that of other widely used anti-thrombotic drugs in in vitro platelet aggregation experiments.

[0085] Since heparin is the main anticoagulant used clinically, and HIT (heparin-induced thrombocytopenia) related side effects pose a great risk to patients with severe COVID-19, we continued to evaluate whether quercetin-3-rutinoside treatment would cause a decrease in the number of platelets compared to heparin treatment. Mice were injected intraperitoneally with heparin or quercetin-3-rutinoside for 5 days. The platelet count in the PRP of mice decreased significantly after 2 days of heparin treatment, and remained at a low level thereafter, while no significant changes were found between the quercetin-3-rutinoside group and the control mice (Figure 7G), indicating that the drug has great potential in treating CAC, but limited side effects in promoting HIT.

[0086] Example 5: P4HB inhibitor quercetin-3-rutinoside alleviates pulmonary thrombosis in SARS-CoV-2 infected mice

[0087] A large number of reports have shown that COVID-19-associated coagulopathy (CAC) can manifest as microthrombi and macrothrombi, leading to multi-organ impairment and significantly contributing to the morbidity and mortality of COVID-19 patients. Since quercetin-3-rutin inhibited S-protein-mediated P4HB function in vitro and in mouse models, we wondered if it could be used to treat CAC in vivo. We infected K18-hACE2 mice, which are highly susceptible to SARS-CoV-2 infection and develop infection after intranasal exposure (Fig. 8A). Severe alveolar, bronchial, and vascular damage, as well as significant inflammatory cell infiltration, were observed in the lungs of SARS-CoV-2 infected mice on day 3 post-infection (Fig. 8A). Quercetin-3-rutin treatment greatly alleviated the damage and significantly reduced the levels similar to those of microthrombosis in the lungs, similar to heparin treatment (Fig. 8C). Then, mouse lungs were stained with antibodies against endothelial cell marker CD31 and microthrombus fibrinogen. Fibrinogen deposition was observed to gradually increase in the lung tissue and microvessels of mice in the SARS-CoV-2 infection group, while both heparin and quercetin-3-rutin treatment reversed this change (Fig. 8B). The formation of microthrombi was further evaluated by immunofluorescence staining of microthrombi using antibodies against activated platelet markers CD41a and P-selectin (Fig. 8D). In the quercetin-3-rutin and heparin treatment groups, the mean fluorescence intensity and pixel area of microthrombi were reduced (Fig. 8D). Blood samples were collected from each group of mice at 0, 3, and 4 days post-infection, and the levels of thrombus-related proteins D-dimer and PAI-1 were measured in the plasma. Quercetin-3-rutin treatment significantly inhibited the stimulating effect of SARS-CoV-2 infection on plasma D-dimer and PAI-1 levels, comparable to heparin treatment (Fig. 8E). Subsequently, we evaluated the safety of quercetin-3-rutin (Q-3-R) intervention. Since bleeding is one of the major side effects associated with the clinical application of antithrombotic drugs. Therefore, we first focused on the effect of quercetin-3-rutin treatment on the permeability of HUVEC cells. The results showed that the overexpression of S protein could increase the permeability of HUVEC cells after histamine treatment, and quercetin-3-rutin treatment caused limited increase in permeability relative to other drugs in both HUVEC and HUVEC-S-WT cells. The lower risk of bleeding caused by quercetin-3-rutin treatment was also confirmed in vivo by a mouse model of LPS-induced lung injury (Fig. 8F), and the degree of bleeding in mice was evaluated by RBC concentration in lung tissue and BALF. The results showed that bleeding caused by quercetin-3-rutin was significantly lighter compared to other drugs, especially compared to clopidogrel, and actually played a protective role in blood vessels (Fig. 8G-I).

[0088] In summary, quercetin-3-rutinose significantly inhibited the thrombotic events caused by SARS-CoV-2 in a mouse model, thus having significant potential in the prevention or treatment of COVID-19-related coagulopathy (Fig. 8F).

[0089] Example 6: P4HB levels are elevated in plasma and leukocytes of infected patients and highly correlated with disease severity

[0090] During thrombosis, large amounts of P4HB protein are secreted from vascular endothelial cells and bound to the surface of blood cells such as platelets and monocytes, thereby promoting their activation. Proteomic data showed that P4HB and PDIA6 levels were higher in COVID-19 patients’ platelets than in healthy individuals. To investigate the relationship between P4HB secretion and thrombotic risk in COVID-19 patients, we analyzed the Oxford COVID-19 multi-omics blood atlas (https: / / mlv.combat.ox.ac.uk / projects / data_view / 3512). Our analysis showed that SARS-CoV-2 infection stimulated P4HB levels in blood cells involved in coagulation, including platelets (PLT), classical monocytes (c.Mono), non-classical monocytes (nc.Mono), and circulating classical monocytes (Mono.cyc) (Fig. 9A). Moreover, there was a significant positive correlation between P4HB levels and disease severity in COVID-19 patients (Fig. 9B).

[0091] Subsequently, we obtained blood samples from four COVID-19 patients, including two mildly symptomatic patients and two severely symptomatic patients who developed vertebral artery dissection after SARS-CoV-2 infection. The levels of tissue factor, PAI-1, and IL6 were all elevated in all patients’ plasma samples, especially in the samples of severely symptomatic patients (Fig. 9C), indicating the presence of a hypercoagulable state after infection. To further investigate the role of P4HB in CAC, we measured the levels of P4HB in COVID-19 patients’ plasma and leukocytes and compared these levels to those of healthy individuals. The results showed that P4HB levels were elevated in the plasma and leukocytes of infected patients and were highly correlated with disease severity (Fig. 9C and D). To investigate the function of secreted P4HB disulfide isomerase activity in the thrombotic process, we used mass spectrometry to detect the disulfide bond modifications of COVID-19 patient serum proteins. The serum proteins with significantly changed disulfide bond modifications after viral infection were mainly involved in thrombosis-related pathways such as thrombocytopenia, inflammatory response, platelet activation, and complement response. Among them, we found that the disulfide bond modification levels of the reported P4HB substrates VTN, APOB, FGB, and C3 were correlated with patient condition (Fig. 10A and B).

[0092] To investigate the function of rutin in preventing CAC, we designed a clinical trial of rutin in preventing thrombotic complications in COVID-19 patients. Patients were randomly divided into rutin and placebo groups, and blood samples were taken from patients at 1 day, 4 days, and 7 days after enrollment for biochemical detection and mass spectrometry analysis (Figure 10C). Our data showed that the intervention of rutin significantly reduced the levels of D-dimer and CRP in the plasma of patients (Figure 10D). The results of mass spectrometry analysis showed that compared with the placebo group, the abundance of 226 plasma proteins was significantly changed in the rutin group, and these proteins were involved in thrombus-related pathways such as complement and coagulation, platelet activation and aggregation, and acute inflammatory response (Figures 10E and F). A large number of CAC-related genes (CRP, MPO, S100A8 / A9, and ELANE) and complement proteins (C1R, C1S, C1Q, C2, C4, C8, and C9) were significantly reduced after rutin treatment.

Claims

1. The application of S protein or P4HB protein as targets in the preparation of drugs for the prevention or treatment of COVID-19 infection-related coagulopathy, among which, The S protein is the spike protein of the novel coronavirus, and the P4HB protein is a human protein disulfide isomerase.

2. The application according to claim 1, characterized in that, The drug can target P4HB to reduce the expression level of P4HB, or inhibit the disulfide isomerase activity of P4HB, or inhibit the molecules that bind P4HB to the S protein, or the drug can target the S protein of SARS-CoV-2 virus to reduce the expression level of the S protein or inhibit the molecules that bind the S protein to P4HB.

3. The application according to claim 2, characterized in that, The drug is at least one of the following: a small molecule inhibitor of P4HB, a peptide or protein inhibitor of P4HB, an antibody targeting the full-length or partial sequence of P4HB, an interfering sequence that reduces the expression level of the coding gene of P4HB, a small molecule inhibitor of S protein, a peptide or protein inhibitor of S protein, an antibody targeting the full-length or partial sequence of S protein, or an interfering sequence that reduces the expression level of the coding gene of S protein.

4. The application according to claim 3, characterized in that, The drug is a P4HB inhibitor, quercetin-3-rutin, compound rutin, troxerutin, or bacitracin.

5. The application according to claim 1, characterized in that, P4HB interacts with the receptor-binding domain of the S protein.

6. The application of molecules targeting the S protein or P4HB protein in the preparation of drugs for the prevention or treatment of COVID-19 infection-related coagulopathy, among which, The S protein is the spike protein of the novel coronavirus, and the P4HB protein is a human protein disulfide isomerase.

7. The application according to claim 6, characterized in that, The molecule is a molecule that can target P4HB to reduce the expression level of P4HB or inhibit the binding of P4HB to the S protein, or the molecule is a molecule that can target the S protein of SARS-CoV-2 virus to reduce the expression level of the S protein or inhibit the binding of the S protein to P4HB.

8. The application according to claim 7, characterized in that, The molecule is at least one of the following: a small molecule inhibitor of P4HB, a peptide or protein inhibitor of P4HB, an antibody targeting the full-length or partial sequence of P4HB, an interfering sequence that reduces the expression level of the coding gene of P4HB, a small molecule inhibitor of S protein, a peptide or protein inhibitor of S protein, an antibody targeting the full-length or partial sequence of S protein, or an interfering sequence that reduces the expression level of the coding gene of S protein.

9. The application according to claim 8, characterized in that, The molecule is a P4HB inhibitor, quercetin-3-rutin, compound rutin, troxerutin, or bacitracin.

Images