Therapeutic oligonucleotides for treating diseases being associated with or caused by a missense, nonsense or in-frame indel mutation

WO2025262186A3PCT designated stage Publication Date: 2026-01-29MAX PLANCK GESELLSCHAFT ZUR FOERDERUNG DER WISSENSCHAFTEN EV
View PDF 7 Cites 0 Cited by

Patent Information

Application Number
PCT/EP2025/067207
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-06-20
Filing Date
2025-06-18
Publication Date
2026-01-29

AI Technical Summary

Technical Problem

Current treatments for diseases caused by missense, nonsense, or in-frame indel mutations, such as Duchenne muscular dystrophy, cystic fibrosis, and neurologic disorders, lack effective methods to address the underlying genetic defects, particularly in-frame exons that disrupt the reading frame, leading to non-functional proteins.

Method used

Therapeutic oligonucleotides specifically hybridize to the 5'-splice site, 3'-splice site, or exonic splicing enhancer (ESE) of out-of-frame exons in genes with missense, nonsense, or in-frame indel mutations, causing exon skipping to induce frameshifts and upregulate functional paralogs, thereby correcting the reading frame and promoting the production of functional proteins.

Benefits of technology

This approach effectively induces exon skipping, leading to the decay of mutant mRNA and increased expression of functional paralogs, potentially ameliorating disease symptoms and slowing progression by restoring protein function.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The present invention relates to a therapeutic oligonucleotide for use in treating a disease in a subject that is associated with or caused by a missense, nonsense or in-frame indel mutation in a gene of the genome of the subject, wherein the therapeutic oligonucleotide is capable of specifically hybridizing to the 5'-splice site, the 3'-splice site or an exonic splicing enhancer (ESE) of an out-of- frame exon in the gene with the missense, nonsense or in-frame indel mutation, thereby causing skipping of the out-of-frame exon.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Therapeutic oligonucleotides for treating diseases being associated with or caused by a missense, nonsense or in-frame indel mutation

[0002] The present invention relates to a therapeutic oligonucleotide for use in treating a disease in a subject that is associated with or caused by a missense, nonsense or in-frame indel mutation in a gene of the genome of the subject, wherein the therapeutic oligonucleotide is capable of specifically hybridizing to the 5' -splice site, the 3' -splice site or an exonic splicing enhancer (ESE) of an out-of- frame exon in the gene with the missense, nonsense or in-frame indel mutation, thereby causing skipping of the out-of-frame exon.

[0003] In this specification, a number of documents including patent applications and manufacturer's manuals are cited. The disclosure of these documents, while not considered relevant for the patentability of this invention, is herewith incorporated by reference in its entirety. More specifically, all referenced documents are incorporated by reference to the same extent as if each individual document was specifically and individually indicated to be incorporated by reference.

[0004] Genetic variations resulting in a change of amino acid sequence can have a dramatic effect on stability, hydrogen bond network, conformational dynamics, activity and many other physiologically important properties of proteins.

[0005] A nonsense mutation is a point mutation in a sequence of DNA that results in a nonsense codon, or a premature stop codon in the transcribed mRNA, and leads to a truncated, incomplete, and possibly non-functional protein product or mutant mRNA degradation (no protein product). Frameshift mutations (for example caused by exonic deletions) can also lead to premature termination codons. Nonsense mutations are not always harmful; the functional effect of a nonsense mutation depends on many aspects, such as the location of the premature stop codon within the mature RNA. For example, the effect of a nonsense mutation depends on the proximity of the nonsense mutation to the original stop codon, and the degree to which functional subdomains of the protein are affected. As nonsense mutations leads to premature termination of polypeptide chains; they are also called chain termination mutations. Deleterious outcomes associated with the majority of nonsense mutations and are the most common outcome that is observed naturally. Deleterious nonsense mutations decrease the overall fitness and reproductive success of the organism. About 10% of patients facing genetic diseases have involvement with nonsense mutations. Some of the diseases that these mutations can cause are Duchenne muscular dystrophy (DMD), cystic fibrosis (CF), spinal muscular atrophy (SMA), cancers, metabolic diseases, and neurologic disorders.

[0006] Missense mutations differ from nonsense mutations since they are point mutations that exhibit a single nucleotide change to cause amino acid substitution. The substitutions of only one residue in a protein sequence can be related to many pathological conditions and may influence susceptibility to disease and drug treatment. The plausible effects of missense mutations range from affecting the macromolecular stability to perturbing macromolecular interactions and cellular localization. A review of individual cases and genome-wide studies that illustrate the association between missense mutations and disease is provided, for example, in Stefl et al. (2013), JMB, 425(21):3919-3936.

[0007] A common and well-known example of a missense mutation is sickle-cell anemia, a blood disease. People with sickle-cell anemia have a missense mutation at a single point in the DNA. This missense mutation calls for a different amino acid and affects the overall shape of the protein produced. This, in turn, causes the entire shape of blood cells to be different. People with the disease experience symptoms of not being able acquire oxygen efficiently, and experience blood clotting. However, they are partially protected from blood borne parasites which live in blood cells. Malaria is a disease caused by these parasites, and people with sickle-cell anemia have an inherent defense against the parasite. Their sickle-shaped blood cells cannot support the life cycle of the parasite. The missense mutation which causes all of the effects is only the difference of a single nucleotide. It is first translated into mRNA, then into a protein. The missense mutation causes a valine to be substituted by a glutamic acid. This non-conservative missense mutation causes the shape of the protein, hemoglobin, to change. Where normal hemoglobin separates, the mutated hemoglobin forms long chains. These chains, when incorporated into blood cells, change their shape and force them into a sickle.

[0008] In-frame insertion and deletion mutations (indels) are commonly observed in cancer samples accounting for over 1% of all reported mutations. Few somatic in-frame indels have been clinically documented as pathogenic and at present there are few tools to predict which indels drive cancer development. However, indels are a common feature of hereditary disease and several tools have been developed to predict the impact of in-frame indels on protein function. For instance, in-frame indels can cause cystic fibrosis (Baeissa and Pearl (2020), J Comput Biol; 27(5):786-795). The present invention provides a novel treatment option for treating a disease in a subject that is associated with or caused by a missense, nonsense or in-frame indel mutation.

[0009] Accordingly the present invention relates to a therapeutic oligonucleotide for use in treating a disease in a subject that is associated with or caused by a missense, nonsense or in-frame indel mutation in a gene of the genome of the subject, wherein the therapeutic oligonucleotide is capable of specifically hybridizing to the 5' -splice site, the 3' -splice site or an exonic splicing enhancer (ESE) of an out-of-frame exon in the gene with (or encoding) the missense, nonsense or in-frame indel mutation, thereby causing skipping of the out-of-frame exon.

[0010] Also described herein is a method of treating a disease in a subject that is associated with or caused by a missense, nonsense or in-frame indel mutation in a gene of the genome of the subject by administering to the subject a therapeutically effective amount of a therapeutic oligonucleotide being capable of specifically hybridizing to the 5' -splice site, the 3'-splice site or an exonic splicing enhancer (ESE) of an out-of-frame exon in the gene with the missense, nonsense or in-frame indel mutation, thereby causing skipping of the out-of-frame exon.

[0011] The therapeutic oligonucleotide according to the invention is capable of specifically hybridizing to the 5'-splice site, the 3'-splice site or an exonic splicing enhancer (ESE) of an out-of-frame exon in the gene with the missense, nonsense or in-frame indel mutation. It is therefore to be understood that the therapeutic oligonucleotide comprises of consists of an antisense nucleotide sequence that is at least partially complementary to a subsequence of the gene with the missense, nonsense or in-frame indel mutation comprising the 5'-splice site, the 3' -splice site or an ESE of an out-of-frame exon, so that the therapeutic oligonucleotide can specifically hybridize to the 5' -splice site, the 3' -splice site or an ESE.

[0012] Specific hybridization means that the therapeutic oligonucleotide is not capable or is essentially not capable of hybridizing to other genomic DNA and / or other expressed RNA sequences of the subject to be treated than the 5'-splice site, the 3' -splice site or the ESE to be targeted.

[0013] RNA splicing is a process in molecular biology where a newly-made precursor messenger RNA (pre- mRNA) transcript is transformed into a mature messenger RNA (mRNA). It works by removing all the introns and splicing back together exons. For those eukaryotic genes that contain introns, splicing is usually needed to create an mRNA molecule that can be translated into protein. Introns comprise the 5' -splice site and the 3' -splice site. The 5' -splice site is also known as splice donor site and the 3' -splice site as splice acceptor site. The splice donor site includes an almost invariant sequence GU (in mRNA and GT in genomic DNA) at the 5' end of the intron. It is preferred that the 3'-end of a therapeutic oligonucleotide hybridizing to the 5'-splice site hybridizes to the almost invariant sequence GU at the 5' end of the intron. The splice acceptor site terminates the intron with an almost invariant AG sequence. It is preferred that the 3'-end of a therapeutic oligonucleotide hybridizing to the 3' -splice site hybridizes to the almost invariant sequence AG at the 3' end of the intron. Upstream (5'-ward) from the AG there is generally a region high in pyrimidines (C and U), or polypyrimidine tract.

[0014] For the sake of completeness it is noted that introns also comprise a branch site (near the 3' end of the intron) that is in addition to splice sites required for splicing. The branch site includes an adenine nucleotide involved in lariat formation. The consensus sequence for an intron (in IUPAC nucleic acid notation) is: G-G-[cut]-G-U-R-A-G-U (donor site) ... intron sequence ... Y-U-R-A-C (branch sequence 20-50 nucleotides upstream of acceptor site) ... Y-rich-N-C-A-G-[cut]-G (acceptor site). It follows that the 5'-splice site and the 3' -splice site of the introns of any eukaryotic gene can be identified by routine means

[0015] An exonic splicing enhancer (ESE) is a DNA sequence motif consisting generally of 6 bases within an exon that directs, or enhances, accurate splicing of heterogeneous RNAs, including mRNAs. Computational methods are available that can be used to identify ESEs; see Fairbrother et al. (2002), Science. 297 (5583): 1007-13. In addition, ESEFinder is available as a tool that allows for the identification of ESEs (https: / / esefinder.ahc.umn.edu / cgi-bin / tools / ESE3 / esefinder.cgi). It is known that even silent mutations located in an ESEs can lead to exon skipping and the production of a nonfunctioning protein. Exon skipping is a form of mRNA splicing used to cause cells to "skip" over faulty or misaligned sections (exons) of genetic code, generally leading to a truncated protein.

[0016] Exon skipping is well researched for the treatment of Duchenne muscular dystrophy (DMD), where the muscular protein dystrophin is prematurely truncated, which leads to a non-functioning protein. Successful treatment by way of exon skipping, and thereby restoring the reading frame of DMD, can lead to a mostly functional dystrophin protein, and create a phenotype similar to the less severe Becker muscular dystrophy (BMD); see, for example, Goyenvalle et al. (2004), Science, 306 (5702):

[0017] 1796-9.

[0018] When the therapeutic oligonucleotide according to the invention specifically hybridizes to the 5'- splice site, the 3'-splice site or an exonic splicing enhancer (ESE) of an out-of-frame exon in the gene with the missense, nonsense or in-frame indel mutation this also causes exon skipping and this exon is in accordance with the invention the out-of-frame exon.

[0019] As used herein an "out-of-frame exon" refers to an exon when being skipped from a transcript leads to a shift in the reading frame, while an "in-frame exon" refers to an exon when being skipped from a transcript leads to the same reading frame. The out-of-frame exon to be skipped does not necessarily need to be the one where the missense, nonsense or in-frame indel mutations is located.

[0020] A missense mutation is a type of point mutation in which a different amino acid is placed within the produced protein, other than the original. A nonsense mutation is a point mutation in a sequence of DNA that results in a nonsense codon, or a premature stop codon in the transcribed mRNA, and leads to a truncated, incomplete, and possibly non-functional protein product. The nonsense mutation is preferably a nonsense mutation with low or no nonsense-mediated mRNA Decay (NMD) and more preferably a nonsense mutation wherein the mRNA with the nonsense mutation is transcribed and translated into a truncated protein. NMD reduces errors in protein expression by reducing or eliminating mRNA transcripts that contain premature stop codons. As is evident for the described nature of missense and nonsense mutations, missense and nonsense mutations do not change the reading frame / do not cause frameshift. An insertion-deletion mutation (indel) refers to the insertion and / or deletion of nucleotides into genomic DNA and generally includes events less than 1 kb in length. In-frame and frameshift indels are 2 major classes of indel mutations. In-frame indels are insertion and / or deletion of nucleotides into genomic DNA that do not change the reading frame / do not cause frameshift. An In-frame indel is caused by indels (insertions or deletions) of a number of nucleotides in a DNA sequence that is divisible by three.

[0021] Because missense mutations are shown in the appended examples, a missense mutation is preferred over a nonsense mutation or an in-frame indel mutation. A missense, nonsense or in-frame indel mutation can also be in an in-frame exon and, in this case, skipping any exon that is out-of-frame would be sufficient for treating a disease in a subject that is associated with or caused by a missense, nonsense or in-frame indel mutation in a gene of the genome of the subject.

[0022] The term "treating" comprises disease preventive treatment and curative treatment and is preferably a disease curative treatment. A curative treatment generally ameliorates or at least slows down the progression of one or more symptoms of the disease to be treated. The subject to be treated is preferably a mammal (including in particular farm animals and pets), more preferably a primate and most preferably human.

[0023] The present invention is based on the recently identified mode of genetic compensation that is known as "transcriptional adaptation", wherein deleterious mutations leading to mutant mRNA degradation trigger the upregulation of so-called adapting genes. In some cases, these adapting genes can be functional and structural paralogs of the mutated gene, thereby resulting in functional compensation. This phenomenon might explain why, in some cases, patients harboring mRNA- destabilizing mutations in certain disease-causing genes present a milder phenotype than patients with missense mutations do.

[0024] In transcriptional adaptation transcripts harboring premature termination codons (PTCs) undergo degradation through processes such as but not limited to nonsense-mediated decay (NMD), producing cleaved mRNA molecules (Rossi et al. (2015), Nature. 524, 230-3). These fragmented mRNA molecules and / or their derivatives are then used by the cell to target other genes or loci, termed adapting genes. In some cases, these adapting genes can act as functional paralogs to the PTC-bearing transcript (El-Brolosy et al. (2019), Nature, 568, 193-197, PMID: 31951195).

[0025] It is shown in the appended examples that antisense oligonucleotides targeting the 5' splice sites of out-of-frame exons in disease-causing genes cause their skipping and trigger the upregulation of functional paralogs. Notably, by achieving even a small degree of exon skipping and thus without significantly reducing the mRNA levels of the target disease gene, the upregulation of the functional or sequence paralogs was achieved. A more efficient exon skipping leads to a more complete degradation of the mRNA of the target disease gene as well as the upregulation of the functional or sequence paralogs. This ability to control the extent of degradation of the mRNA of the target disease gene may also be important for treatment purposes, while antisense oligonucleotides have previously been approved by the FDA for the treatment of multiple diseases via mRNA knock-down, it was surprisingly and advantageously found herein that it is at least highly plausible that patients with missense, nonsense or in-frame indel mutations in disease-causing genes could benefit from a rapid implementation of medical use of the invention by antisense oligonucleotides that induce transcriptional adaptation.

[0026] Currently, antisense oligonucleotides are also often used to treat genetic diseases by skipping mutation-containing exons or attempting to correct transcripts' reading frames, thereby producing functional protein products. The present invention is based on a counterintuitive approach by intentionally inducing frame shifts in targeted transcripts leading to the decay of a part (e.g. some %) of total mRNA molecules population of the endogenous mutant transcript and the increased expression of the functional or sequence paralog.

[0027] In accordance with a preferred embodiment, the gene with the missense, nonsense or in-frame indel mutation has a functional or sequence paralog in the genome of the subject, wherein the skipping of an out-of-frame exon triggers the upregulation of the expression of this functional or sequence paralog, wherein the gene with the missense, nonsense or in-frame indel mutation and its functional paralog preferably encode functionally redundant proteins.

[0028] As explained above, when the therapeutic oligonucleotide according to the invention specifically hybridizes to the 5'-splice site, the 3'-splice site or an exonic splicing enhancer (ESE) of an out-of- frame exon in the gene with the missense, nonsense or in-frame indel mutation, this event causes out-of-frame exon skipping. The out-of-frame exon skipping intentionally induces frameshifts in the targeted transcripts leading to the decay of a portion of the endogenous transcript and the increased expression of the functional or sequence paralog. A number of endogenous transcripts and their corresponding functional or sequence paralog will be provided herein below.

[0029] Paralogs are genes that are separated by gene duplication events. For instance, Gene 1 in the ancestral species undergoes a duplication event generating Gene la and Gene lb. The ancestral species splits into two species, each with its own copy of Gene la and Gene lb. Gene la and Gene lb are paralogs.

[0030] In the case of a functional paralog Gene la and Gene lb may be functionally redundant; i.e. in general the genes encode functionally redundant protein, wherein Protein la can at least in part substitute for the function of Protein lb (and vice versa). Hence, functional paralogs in general and preferably encode functionally redundant proteins. Two functionally redundant proteins are preferably defined as two proteins having similar biochemical activities and / or substrate specificities allowing each one to compensate in the absence of the other (Ghosh and O'Connor (2017), Front Cell Infect Microbiol.; 7:467. doi: 10.3389 / fcimb.2017.00467). In the case of a sequence paralog Gene la and Gene lb and the encoded Protein la and Protein lb may also be sequences that share a high degree of sequence identity, preferably at least 70%, more preferably at least 80% and mots preferably at least 90% on the nucleotide and / or protein level. The sequence identity herein is preferably determined by nucleotide and / or protein BLAST. A paralog may also be at the same time, both a functional and a sequence paralog. A functional paralog is preferred.

[0031] In accordance with another preferred embodiment, the gene with the missense, nonsense or inframe indel mutation is DMD, LMNA, FBN1, CFTR, RHO, MYH7, TP53, LDLR, HFE, FGFR3, HEXA, PAH, FBN2, HNRNPH1, SOD1, SPTLC1, ACTL6B, GJB2, MY07A, TMC1, COL11A2, KCNQ4, SLC26A4 or COCH.

[0032] In accordance with a more preferred embodiment the functional or sequence paralog is UTRN, NEFL FBN2, TMEM16A, NEFL,

[0033] OPN1 M W / 0PN1 M W2 / OPN1MW3 / OPN1 L W / OPN1SW / OPN3 / OPN4 / RRH / OPN5, MYH6, TP73 / TP63, LPR8 / VLDLR / LRP1 / LRP1B / LRP4 / LRP2 / EGF / NID1 / NID2 / LRP5 / LRP6 / LRP12 / LRP10 / LRP3, HLA-F / HLA- C / HLA-G / HLA-A / HLA- E / AZGP1 / MR1 / MICB / FCGRT / MICA / CD1A / CD1 C / CD1 D / CD1 B / CD1 E / RAET1 L / ULBP1 / RAET1 G / ULBP2 / U LBP3 / RAET1E, FGFR2 / FGFR1 / FGFR4 / RET / KDR / FL T4 / FL Tl / KIT / FL T3 / PDGFRB / PDGFRA / CSF1 R / ROR2 / TIE2 / TEK / ROS1 / MST1R / ROR1 / EPHA4 / INSR / IGF1R / EPHA2 / ALK / AXL / NTRK2 / EPHA5 / EPHA7 / EPHA8 / MET / ERBB4 / EPHA 3 / EPHB3 / TYRO3 / MUSK / EPHB4 / ERBB2 / EPAH1 / NTRK3 / EPHB2 / EGFR / EPHB1 / EPHA6 / MERTK / NRTK1 / E PHA10 / LTK / EPHB6 / INSRR / ERBB3 / DDR2 / DDR1 / LMTK2 / RYK, HEXB, TPH2 / TPH1 / TH, FBN1, HRNPH2, CCS / SOD3, SPTLC2 / SPTLC3 / ALAS1 / GCAT / ALAS2,

[0034] ACTL6A / ACTB / ACTG1 / ACTC1 / ACTA2 / ACTG2 / ACTA1 / ACTBL2 / ACTR1A / ACTR1B / ACTL7B / ACTR3B / ACTR T2 / ACTR3 / ACTRT1 / ACTL9 / ACTRT3 / ACTR2 / ACTL7A / ACTL8 / ACTR8 / ACTR5 / ACTR10 / ACTR6 / ACTL10 / AC TR3C, GJB6 / GJB1 / GJB3 / GJA8 / GJB4 / GJA3 / GJA4 / GJB5 / GJA1 / GJB7 / GJA10 / GJA9 / GJA5 / GJD2 / GJC2 / GJC1 / GJD3 / GJD4 / GJET1, MY07B / MYH6 / MYH7 / MYH8 / MYH4 / MYH1 / MYH2 / MYH3 / MYH7B / MYH9 / MYH13 / MYH10 / MYH15 / MY 010 / MYH14 / MYO5B / MYO5A / MYO9B / MYO9A / MYO15A / MYO5C / MYO3A / MYO16 / MY01 B / MY018 A / MYO18B / MYO1E / MYO1C / MYO1A / MYO6 / MYO3B / MYO1D / MYO1F / MYO1G / MYO1H / MYO19 / CCDC15 8 / CGNL1 / TMF1 / CCDC102B / CCDC102A, TMC2-8,

[0035] COL5A1 / COL11A1 / COL2A1 / COL1A1 / COL5A3 / COL22A1 / COL5A2 / COL3A1 / COL1A2 / COL27A1 / COL4A5 / COL24A1 / COL4A3 / COL4A1 / COL4A6 / COL7A1 / COL4A4 / COL16A1 / COL4A2 / COL18A1 / COL9A1 / COL17A1 / COL15A1 / COL9A3 / COL28A1 / COL9A2 / COL13A1 / COL6A1 / COL25A1 / COL21A1 / COL6A2 / COL2QA1 / COL 23A1 / COLO / EMID1 / COL26A1 / EDA, KCNG1 / KCNS3 / KCNC2 / KCNF1 / KCNA4 / KCNG4 / KCNA2 / KCNA6 / KCNA3 / KCND3 / KCNG3 / KCNA10 / KCNA7 / KCNA1 / KCNS2 / KCNV2 / KCNS1,

[0036] SLC26A3 / SLC26A6 / SLC26A5 / SLC26A9 / SLC26A2 / SLC26A1 / SLC26A7 / SLC26A8 / SLC26A1, or

[0037] VIT / COL12A1 / COL6A3 / COL6A6 / COL14A1 / COL6A5 / MATN1 / MATN4 / MATN2 / VWA2 / MATN3 / VWA1. In accordance with a related preferred embodiment, the disease is selected from muscular dystrophy (preferably Duchenne muscular dystrophy, caused by mutations in the DMD gene), a laminopathy (caused by mutations in the LMNA gene), Marfan Syndrome (caused by mutations in the FBN1 gene), cystic fibrosis (caused by mutations in the CFTR gene), retinitis pigmentosa (caused by mutations in the RHO gene), hypertrophic cardiomyopathy (caused by mutations in the MYH7 gene), Li-Fraumeni Syndrome (caused by mutations in the TP53 gene), Familial Hypercholesterolemia (caused by mutations in the LDLR gene), Hereditary Hemochromatosis (caused by mutations in the HFE gene), Achondroplasia (caused by mutations in the FGFR3 gene), Tay-Sachs Disease (caused by mutations in the HEXA gene), Phenylketonuria (caused by mutations in the PAH gene), Congenital Contractural Arachnodactyly (caused by mutations in the FBN2 gene), Intellectual disability / developmental delay (caused by mutations in the HNRNPH1 gene), Amyotrophic lateral sclerosis (caused by mutations in SOD1 or SPTLC1), neurodevelopmental deficits and epilepsy (caused by mutations in ACTL6B), and hearing loss genetic diseases (caused by GJB2, MY07A, TMC1, COL11A2, KCNQ4, SLC2A64, or COCH).

[0038] The above non-limiting but preferred examples of (i) genes with a missense, nonsense or in-frame indel mutation, (ii) the functional or sequence paralogs (also referred to herein as "compensating gene"), and (iii) diseases are interrelated. This interrelation can be taken from the following Table 1.

[0039] Table 1

[0040]

[0041] Among the above list of (i) genes with a missense, nonsense or in-frame indel mutation, (ii) the functional or sequence paralogs (also referred to herein as "compensating gene"), and (iii) diseases that are interrelated the ones being associated with or caused by mutations in DMD, FBN1, CFTR, LMNA, RHO, MYH7, LDLR, FBN2, HNRNPH1, SOD1, and SPLTC1 are preferred, and the ones being associated with or caused by mutations in bFBNl, LMNA, and DMD are most preferred.

[0042] The hearing loss genetic diseases are preferably selected from syndromic and / or non-syndromic autosomal (recessive or dominant) deafness, autosomal recessive non-syndromic hearing loss, Stickler Syndrome and non-syndromic hearing loss, autosomal dominant non-syndromic hearing loss, Pendred Syndrome and autosomal dominant non-syndromic hearing loss.

[0043] The above table also shows that paralogs can be genes that are separated by a number of gene duplication events. For instance, the COCH has all of VIT, COL12A1, COL6A3, COL6A6, COL14A1, COL6A5, MATN1, MATN4, MATN2, VWA2, MATN3, VWA1 as paralogs.

[0044] In accordance with a preferred embodiment, the therapeutic oligonucleotide has a length of 12 to 35 nucleotides, preferably 15 to 25 nucleotides and most preferably 15 to 20 oligonucleotides. The marketed morpholino phosphorodiamidate antisense oligomer eteplirsen for the treatment of Duchenne muscular dystrophy comprises 30 nucleotides. Exon skipping is induced by eteplirsen but eteplirsen restores the phase of the reading frame thereby enabling production of functional, but internally edited, dystrophin. Hence, eteplirsen has a different mode of action than the therapeutic oligonucleotides of the invention that cause out-of-frame exon skipping. The herein exemplified therapeutic oligonucleotides have a length between 12 and 35 nucleotides. Therapeutic oligonucleotides generally have a length of 12 to 30 nucleotides. The preferred length is 15 to 25 nucleotides and most preferred are 15 to 20 oligonucleotides.

[0045] In accordance with another preferred embodiment, the therapeutic oligonucleotide has no more than 3, preferably no more than 2, more preferably 1 or 0 mismatch(es) to the complementary sequence of the gene with the missense, nonsense or in-frame indel mutation and most preferably comprises a fully complementary sequence of the gene with the missense, nonsense or in-frame indel mutation.

[0046] As discussed above, the therapeutic oligonucleotide according to the invention comprises or consists of an antisense nucleotide sequence that is at least partially complementary to a subsequence (or partial sequence) of the gene with the missense, nonsense or in-frame indel mutation comprising the 5' -splice site, the 3' -splice site or an ESE of an out-of-frame exon, so that the therapeutic oligonucleotide can specifically hybridize to the 5'-splice site, the 3' -splice site or an ESE.

[0047] The antisense nucleotide sequence that is at least partially complementary to a subsequence of the gene with the missense, nonsense or in-frame indel mutation comprising the 5'-splice site, the 3'- splice site or an ESE of an out-of-frame exon is in accordance with the above preferred embodiment such that no more than 3, preferably no more than 2, more preferably 1 or 0 mismatch(es) to the complementary sequence of the gene with the missense, nonsense or in-frame indel mutation are allowed. Most preferred is 0 mismatches to the complementary sequence of the gene with the missense, nonsense or in-frame indel mutation, so that the therapeutic oligonucleotide according to the invention comprises of consists of an antisense nucleotide sequence that is fully complementary to a subsequence of the gene with the missense, nonsense or in-frame indel mutation comprising the 5'-splice site, the 3'-splice site or an ESE of an out-of-frame exon.

[0048] In accordance with another preferred embodiment, the therapeutic oligonucleotide is an antisense oligonucleotide, interfering RNA (siRNA), a short-hairpin RNA (shRNA), or a U7 small nuclear RNA engineered to skip an out-of-frame exon.

[0049] The format of the therapeutic oligonucleotide is not particularly limited as long as it comprises of consists of an antisense nucleotide sequence that is at least partially complementary to a subsequence of the gene with the missense, nonsense or in-frame indel mutation comprising the 5'- splice site, the 3'-splice site or an ESE of an out-of-frame exon, so that the therapeutic oligonucleotide can specifically hybridize to the 5' -splice site, the 3' -splice site or an ESE and cause our-of-frame exon skipping.

[0050] For instance, the therapeutic oligonucleotide can be single-stranded or double-stranded and is preferably double-stranded. In the case of a double-stranded therapeutic oligonucleotide the first, target complementary sequence is also known as antisense sequence and the second strand is also known as sense sequence.

[0051] The format of the therapeutic oligonucleotide is an antisense oligonucleotide, interfering RNA (siRNA), a short-hairpin RNA (shRNA), or a U7 small nuclear RNA engineered to skip an out-of-frame exon. Within these options an antisense oligonucleotide is preferred, because they are illustrated by the appended examples.

[0052] An antisense oligonucleotide is single-stranded and preferably comprises or consists of a DNA sequence. An antisense oligonucleotide in accordance with the invention is capable of interacting with the target nucleic acid, more specifically it is capable of hybridizing with the target nucleic acid. Due to the formation of the hybrid, transcription of the target gene(s) and / or translation of the target mRNA is reduced or blocked, or splicing is modulated. Standard methods relating to antisense technology have been described (see, e.g., Melani et al., Cancer Res. (1991) 51:2897-2901). By hybridizing with transcripts by sequence complementarity, ribonuclease H may be recruited thereby inducing target RNA degradation. Nearly all organisms utilize ribonuclease H to degrade DNA-RNA hybrids as a defence against viral infection. In protein synthesis, DNA is first transcribed into mRNA, and then translated in an amino acid sequence. Antisense oligonucleotides can take advantage of this biological pathway by binding to the mRNA target. The DNA-mRNA duplex is degraded by RNase H. The degradation of the mRNA prevents protein synthesis.

[0053] Preferred examples of antisense oligonucleotides are gapmers and morpholinos. Gapmers are antisense oligonucleotides composed of a central DNA segment flanked by nucleotides of modified chemistry. The flanks are typically composed of locked nucleic acids (LNA), 2'-0Me, or 2'-F modified bases. Morpholins (also known as a Morpholino oligomer or phosphorodiamidate Morpholino oligomer (PMO)) are a type of antisense oligonucleotides containing DNA bases attached to a backbone of methylenemorpholine rings linked through phosphorodiamidate groups. Morpholinos block access of other molecules to small (generally about 25 base) specific sequences of the basepairing surfaces of ribonucleic acid (RNA). Morpholinos can be used for knocking down gene function.

[0054] In accordance with the present invention, the term "small interfering RNA (siRNA)", also known as short interfering RNA or silencing RNA, refers to a class of 18 to 30, preferably 19 to 25, most preferred 21 to 23 or even more preferably 21 nucleotide-long double-stranded RNA molecules that play a variety of roles in biology. Most notably, siRNA is involved in the RNA interference (RNAi) pathway where the siRNA interferes with the expression of a specific gene. In addition to their role in the RNAi pathway, siRNAs also act in RNAi-related pathways, e.g. as an antiviral mechanism or in shaping the chromatin structure of a genome. siRNAs naturally found in nature have a well-defined structure: a short double-strand of RNA (dsRNA) with 2-nt 3' overhangs on either end. Each strand has a 5' phosphate group and a 3' hydroxyl (-OH) group. This structure is the result of processing by dicer, an enzyme that converts either long dsRNAs or small hairpin RNAs into siRNAs. siRNAs can also be exogenously (artificially) introduced into cells to bring about the specific knockdown of a gene of interest. Essentially any gene for which the sequence is known can thus be targeted based on sequence complementarity with an appropriately tailored siRNA. The double-stranded RNA molecule or a metabolic processing product thereof is capable of mediating target-specific nucleic acid modifications, particularly RNA interference and / or DNA methylation. Exogenously introduced siRNAs may be devoid of overhangs at their 3' and 5' ends, however, it is preferred that at least one RNA strand has a 5'- and / or 3'-overhang. Preferably, one end of the double-strand has a 3'-overhang from 1 to 5 nucleotides, more preferably from 1 to 3 nucleotides and most preferably 2 nucleotides. The other end may be blunt-ended or has up to 6 nucleotides 3'-overhang. In general, any RNA molecule suitable to act as siRNA is envisioned in the present invention. The most efficient silencing was so far obtained with siRNA duplexes composed of 21-nt sense and 21-nt antisense strands, paired in a manner to have a 2-nt 3'- overhang. The sequence of the 2-nt 3' overhang makes a small contribution to the specificity of target recognition restricted to the unpaired nucleotide adjacent to the first base pair. 2'-deoxynucleotides in the 3' overhangs are as efficient as ribonucleotides, but are often cheaper to synthesize and probably more nuclease resistant. Delivery of siRNA may be accomplished using any of the methods known in the art, for example by combining the siRNA with saline and administering the combination intravenously or intranasally or by formulating siRNA in glucose (such as for example 5% glucose) or cationic lipids and polymers can be used for siRNA delivery in vivo through systemic routes either intravenously (IV) or intraperitoneally (IP) (Fougerolles et al. (2008), Current Opinion in Pharmacology, 8:280-285; Lu et al. (2008), Methods in Molecular Biology, vol. 437: Drug Delivery Systems - Chapter 3: Delivering Small Interfering RNA for Novel Therapeutics).

[0055] A short hairpin RNA (shRNA) is a sequence of RNA that makes a tight hairpin turn that can be used to silence gene expression via RNA interference. shRNA uses a vector introduced into cells and utilizes the U6 promoter to ensure that the shRNA is always expressed. This vector is usually passed on to daughter cells, allowing the gene silencing to be inherited. The shRNA hairpin structure is cleaved by the cellular machinery into siRNA, which is then bound to the RNA-induced silencing complex (RISC). This complex binds to and cleaves mRNAs which match the siRNA that is bound to it. si / shRNAs to be used in the present invention are preferably chemically synthesized using appropriately protected ribonucleoside phosphoramidites and a conventional DNA / RNA synthesizer. Suppliers of RNA synthesis reagents are Proligo (Hamburg, Germany), Dharmacon Research (Lafayette, CO, USA), Pierce Chemical (part of Perbio Science, Rockford, IL, USA), Glen Research (Sterling, VA, USA), ChemGenes (Ashland, MA, USA), and Cruachem (Glasgow, UK). Most conveniently, siRNAs or shRNAs are obtained from commercial RNA oligo synthesis suppliers, which sell RNA-synthesis products of different quality and costs. In general, the RNAs applicable in the present invention are conventionally synthesized and are readily provided in a quality suitable for RNAi.

[0056] Further molecules effecting RNAi include, for example, microRNAs (miRNA). Said RNA species are single-stranded RNA molecules. Endogenously present miRNA molecules regulate gene expression by binding to a complementary mRNA transcript and triggering of the degradation of said mRNA transcript through a process similar to RNA interference. Accordingly, exogenous miRNA may be employed as an inhibitor after introduction into the respective cells.

[0057] Most U-rich small nuclear ribonucleoproteins (snRNPs) are complexes that mediate the splicing of pre-mRNAs. U7 snRNP is an exception in that it is not involved in splicing but is a key factor in the unique 3' end processing of replication-dependent histone mRNAs. However, by introducing controlled changes in the U7 snRNA histone binding sequence and in the Sm motif, it can be used as an effective tool for exon skipping; see Gadgil and Raczyriska (2021), J Gene Med.; 23:e3321. The spliceosomal Sm proteins belong to a larger family of Sm and Sm-like (LSm) proteins, defined by the presence of a conserved motif, the Sm motif. The Sm motif is composed of two conserved regions, termed Sml and Sm2, which are separated by a non-conserved linker region (Urlaub et al. (2001), EMBO J., 20(l-2):187-196. The modified U7 snRNP (U7 Sm OPT) is not involved in the processing of replication-dependent histone pre-mRNA but targets splicing by inducing efficient skipping or inclusion of selected exons.

[0058] In accordance with a preferred embodiment, the therapeutic oligonucleotide comprises one or more chemical modifications, preferably being selected from backbone modifications, sugar modifications, base modifications, scaffold modifications and conjugates.

[0059] In accordance with a preferred embodiment, the therapeutic oligonucleotide comprises one or more backbone modifications, preferably being selected from phosphorothioate, mesyl phosphoramidate, phosphoryl guanidine, phosphorodiamidate.

[0060] In accordance with a preferred embodiment, the therapeutic oligonucleotide comprises one or more sugar modifications, wherein nucleotides preferably presents one or more of 2'-O-methyl (2'-0Me), 2'-O-methoxy-ethyl (2'-MOE), 2'-fluoro (2'-F), 2'-deoxy, 2'-amino, 2' -alkyl, 2'-O-Hexadecyl, 2', 4'- constrained 2'-O-methoxyethyl (cMOE BNA), 2',4'-constrained 2'-0-Ethyl (cEt BNA), locked nucleic acid (LNA), tryciclo-DNA (tcDNA) modifications.

[0061] In accordance with a preferred embodiment, the therapeutic oligonucleotide comprises one or more base modifications selected from 5-methylcytosine (5-meC), 2-thio-deoxythymidine (2-Thio-dT), 2,6- diaminopurine, and a non-natural base.

[0062] In accordance with a preferred embodiment, the therapeutic oligonucleotide comprises one or more scaffold modifications selected from phosphorodiamidate morpholino and peptide nucleic acid.

[0063] In accordance with a preferred embodiment, the therapeutic oligonucleotide comprises one or more conjugates selected from N-acetylgalactosamine (GalNAc), Glucagon-Like Peptide 1 Receptor (GLP1R) agonist, an antibody, or a lipid such as cholesterol, docosahexaenoic acid, or dodecanoic acid bisdecylamide.

[0064] The one or more modified nucleotides are with increasing preference at least two, at least five at least ten and all nucleotides of the therapeutic oligonucleotide.

[0065] It is known that the incorporation of modified nucleotides into therapeutic oligonucleotides can improve the in vivo activity of therapeutic oligonucleotides. The modified nucleotides can improve nuclease resistance in plasma, tissues, and cells. The modified nucleotides can make the therapeutic oligonucleotides resistant or more resistant against RNase H cleavage.

[0066] A 2'-O-methyl modified nucleotide, a nucleotide comprising a 5'-phosphorothioate group, a terminal nucleotide linked to a cholesteryl derivative, a dodecanoic acid bisdecylamide group, a 2'-deoxy-2'- fluoro modified nucleotide, a 2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, an abasic nucleotide, a 2'-amino-modified nucleotide, a 2'-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, and a non-natural base comprising nucleotide are nonlimiting but preferred examples of modified nucleotides that can improves the in vivo activity of therapeutic oligonucleotides and / or make the therapeutic oligonucleotides resistant or more resistant against RNase H cleavage.

[0067] In accordance with another preferred embodiment, all nucleotides of the therapeutic oligonucleotide are modified with 2'-O-methoxyethylribose and phosporothioate (i.e. nucleotides with 2'-O- methoxyethylribose that are phosphorothioate-modified)

[0068] In accordance with another preferred embodiment, all nucleotides of the therapeutic oligonucleotide are modified with 2'-O-methoxyethylribose, phosporothioate and / or 5-methylcytosine.

[0069] The exemplified therapeutic oligonucleotides in the appended examples are therapeutic oligonucleotides being modified with 2'-O-methoxyethylribose-phosporothioate. The therapeutic oligonucleotide is also in this case preferably a single-stranded antisense oligonucleotide.

[0070] In accordance with further preferred embodiment, the therapeutic oligonucleotide is capable of specifically hybridizing to the 5' -splice site or the 3'-splice site, preferably to the 5' -splice site of an out-of-frame exon.

[0071] Therapeutic oligonucleotide is capable of specifically hybridizing to the 5'-splice site or the 3'-splice site, preferably to the 5'-splice site of an out-of-frame exon, because the therapeutic oligonucleotides being capable of specifically hybridizing to the 5'-splice site of an out-of-frame exon are illustrated by the appended examples. Moreover, and as explained above, the 5'-splice sites and the 3' -splice sites of introns can be easily identified from non-spliced mRNAs and gene sequences based on their conserved sequence motifs.

[0072] In accordance with a yet further preferred embodiment, the therapeutic oligonucleotide (I) has a sequence being selected from SEQ ID NOs 1 to 11 or a sequence being at least 80%, preferably at least 90% identical thereto; (II) has a sequence being selected from SEQ ID NOs 12 to 19 or a sequence being at least 80%, preferably at least 90% identical thereto; or (III) has a sequence being selected from SEQ ID NOs 20 to 25 and SEQ ID NOs 39 to 46 or a sequence being at least 80%, preferably at least 90% identical thereto. The above at least at least 90% identity is preferably at least 95% identity for the therapeutic oligonucleotides of 20 nucleotides or more.

[0073] The design of therapeutic oligonucleotides that are useful for the present invention is a matter of routine based on the non-spliced mRNA / gene sequences of the target. In order to illustrate this matter of routine for different genes / exons to be skipped as well as therapeutic oligonucleotides being capable of specifically hybridizing to the 5' -splice site, the 3'-splice site or an ESE the following non-limiting but preferred examples of therapeutic oligonucleotides that are useful for the present invention are provided.

[0074] DMD Exon 52: SEQ ID NOs 1 to 11

[0075] - 18mer 5' splice site: 5' - GTAAGTTTTTTAACAAGC - 3' (used in the examples))

[0076] - 25mer 5' splice site 1: 5' - GTAAGTTTTTTAACAAGCATGGGAC - 3'

[0077] - 25mer 5' splice site 2: 5' - GATCGAAGTAAG I I I I I I AACAAGC - 3'

[0078] - 18mer 3' splice site: 5' - GGATATTTGTTCTTACAG - 3'

[0079] - 25mer 3' splice site 1: 5' - TACTAAGGGATATTTGTTCTTACAG - 3'

[0080] - 25mer 3' splice site 2: 5' - GGATATTTGTTCTTACAGGCAACAA - 3'

[0081] - 25mer ESEI: 5' - GTTCTTACAGGCAACAATGCAGGAT- 3'

[0082] - 21mer ESE2: 5' - GAACAGAGGCGTCCCCAGTTG- 3'

[0083] - 25mer ESE3: 5' - ACTCATTACCGCTGCCCAAAATTTG- 3'

[0084] - 24mer ESE4 + ESE5: 5' - GACCAGCAATCAAGAGGCTAGAAC- 3'

[0085] - 25mer ESE6: 5' - TTACGGATCGAAGTAAGTTTTTTAA - 3'

[0086] FBN1 Exon 3: SEQ ID NOs 12 to 19

[0087] - 18mer 5' splice site: 5' - gtaagtaaatagaaaact - 3' (used in the examples)

[0088] - 25mer 5' splice site 1: 5'- gtaagtaaatagaaaacttgtcatt - 3'

[0089] - 25mer 5' splice site 2: 5'- attgtccgtaagtaaatagaaaact - 3'

[0090] - 18mer 3' splice site: 5'- cttctgtttttgttttag - 3'

[0091] - 25mer 3' splice site 1: 5'- tggaattcttctgtttttgttttag - 3'

[0092] - 25mer 3' splice site 2: 5'- cttctgtttttgttttagacccaat - 3'

[0093] - 15mer ESEI: 5' - tctgtggatcacgtt - 3'

[0094] - 20mer ESE2 + ESE3: 5' - tgcttactgttgccctggat - 3' LMNA Exon 6: SEQ ID NOs 20 to 25 and SEQ ID NOs 39 to 46

[0095] - 18mer 5' splice site: 5' - GTGGGCTGGGGAGACGTC - 3'

[0096] - 25mer 5' splice site: 5' - GTGGGCTGGGGAGACGTCGGGGAGG- 3'

[0097] - 25mer 5' splice site: 5' - AGGAGAGGTGGGCTGGGGAGACGTC - 3'

[0098] - 18mer 3' splice site: 5' - CCTCCCACCCCCCTTCAG - 3'

[0099] - 25mer 3' splice site 1: 5' - ACCAAACCCTCCCACCCCCCTTCAG- 3'

[0100] - 25mer 3' splice site 2: 5' - CCTCCCACCCCCCTTCAGCTGGCAG - 3'

[0101] > LMNA ESEI: TGGAGGACTCACTGGCCCGTGAGCGGGACACCAGCCGGCGG

[0102] > LMNA ESE2: GAGCGGGA (SEQ ID NO: 40)

[0103] > LMNA ESE3: CCGAGATGCGGGC

[0104] > LMNA ESE4: GGATGCAGCAGCAGCTGGACGAGTAC

[0105] > LMNA ESE5: AGCTTCTGGA

[0106] > LMNA ESE6: GGCCCTGGAC

[0107] > LMNA ESE7: GATCCACGCCTACCGCAAGCTCTTGG

[0108] > LMNA ESE8: GCGAGGAGGAG

[0109] Also in connection with SEQ ID NOs 1 to 25 and 39 to 46 and sequences being at least 80%, preferably at least 90% identical thereto the therapeutic oligonucleotide is preferably in the format of a single-stranded antisense oligonucleotide. It is most preferred a single-stranded antisense oligonucleotide, wherein all nucleotides of the therapeutic oligonucleotide are modified with 2'-O- methoxyethylribose-phosporothioate.

[0110] Among SEQ ID NOs 1 to 25 and 39 to 46 SEQ ID NOs 1 and 12 are particularly preferred since they were used in the appended examples.

[0111] Additional 275 non-limiting but preferred examples of therapeutic oligonucleotides for DMD that are useful for the present invention are provided in the following Table 7. Table 7: Therapeutic oligonucleotides

[0112] The above # 1 to 275 oligonucleotides corresponds to SEQ. ID NO: 55 to 329. These oligonucleotides are particularly preferred because they target DMD nucleotide sequences (within twenty-eight- nucleotide regions) that are evolutionary conserved between of human and mouse with at most one nucleotide mismatch. This allows, for example, to test the safety of the oligonucleotides in mice before their administration to humans. Within Table 7 the oligonucleotides having a length of 28 nucleotides are preferred.

[0113] In accordance with a preferred embodiment, the therapeutic oligonucleotide is formulated as a lipid particle.

[0114] In accordance with a more preferred embodiment, the lipid particle is composed of ionizable lipids, helper phospholipids, cholesterol, and / or polyethylene glycol-l ipids.

[0115] Lipid particles have attracted great interest because of their specificity and the duration of action they offer from the standpoint of drug delivery. Lipid particle have been used to effectively deliver therapeutic oligonucleotides, such as siRNA and ASOs in vivo into cells (Zimmermann et al. (2006) Nature, 441:111-114). The lipid particles are preferably composed of ionizable lipids, helper phospholipids, cholesterol, and / or polyethylene glycol-lipids (Albertsen et al. (2022), Adv Drug Deliv Rev.; 188: 114416).

[0116] In accordance with a further preferred embodiment the therapeutic oligonucleotide is delivered with one or more nanocarriers selected from liposomes, peptides, dendrimers, exosomes, spherical nucleic acid (SNAs), or DNA nanostructures. In accordance with another preferred embodiment the therapeutic oligonucleotide is used as naked therapeutic oligonucleotide.

[0117] As discussed above, the incorporation of modified nucleotides into therapeutic oligonucleotides can improve their in vivo activity and in vivo stability. Therefore in particular therapeutic oligonucleotides with modified nucleotides may be used as naked therapeutic oligonucleotide for therapeutic applications.

[0118] Regarding the embodiments characterized in this specification, in particular in the claims, it is intended that each embodiment mentioned in a dependent claim is combined with each embodiment of each claim (independent or dependent) said dependent claim depends from. For example, in case of an independent claim 1 reciting 3 alternatives A, B and C, a dependent claim 2 reciting 3 alternatives D, E and F and a claim 3 depending from claims 1 and 2 and reciting 3 alternatives G, H and I, it is to be understood that the specification unambiguously discloses embodiments corresponding to combinations A, D, G; A, D, H; A, D, I; A, E, G; A, E, H; A, E, I; A, F, G; A, F, H; A, F, I; B, D, G; B, D, H; B, D, I; B, E, G; B, E, H; B, E, I; B, F, G; B, F, H; B, F, I; C, D, G; C, D, H; C, D, I; C, E, G; C, E, H; C, E, I; C, F, G; C, F, H; C, F, I, unless specifically mentioned otherwise.

[0119] Similarly, and also in those cases where independent and / or dependent claims do not recite alternatives, it is understood that if dependent claims refer back to a plurality of preceding claims, any combination of subject-matter covered thereby is considered to be explicitly disclosed. For example, in case of an independent claim 1, a dependent claim 2 referring back to claim 1, and a dependent claim 3 referring back to both claims 2 and 1, it follows that the combination of the subject-matter of claims 3 and 1 is clearly and unambiguously disclosed as is the combination of the subject-matter of claims 3, 2 and 1. In case a further dependent claim 4 is present which refers to any one of claims 1 to 3, it follows that the combination of the subject-matter of claims 4 and 1, of claims 4, 2 and 1, of claims 4, 3 and 1, as well as of claims 4, 3, 2 and 1 is clearly and unambiguously disclosed.

[0120] The above considerations apply mutatis mutandis to all appended claims.

[0121] The figures show:

[0122] Figure 1 - FBN1 nonsense and frameshift mutants, but not a missense mutant, display FBN2 upregulation, (a) Scheme illustrating the location of the premature termination codons (in red) or missense mutation in the FBN1 transcript. Blue, natural stop codon. qPCR analysis of (b) FBN1 mRNA, (c) FBN1 pre-mRNA, or (d) FBN2 mRNA levels in the FBN1 HEK293T mutants.

[0123] Figure 2 - An antisense oligonucleotide skipping an out-of-frame exon in FBN1 triggers FBN2 upregulation, (a) Scheme illustrating the binding site of the antisense oligonucleotide used to skip exon 3 (i3-5ss), and the RT-PCR showing the skipping of exon 3 upon its transfection, (b) Scheme showing predicted premature termination codon upon skipping exon 3. (c) qPCR analysis of FBN1 and FBN2 mRNA levels upon transfection of i3-5ss in WT HEK293T cells.

[0124] Figure 3 - LMNA mRNA degradation leads to NEFL upregulation. qPCR analysis of (a) LMNA, (b) LMNB1 and NEFL mRNA levels, (c) Scheme illustrating the binding site of the antisense oligonucleotide used to skip exon 6 (i6-5ss), and the RT-PCR showing the skipping of exon 6 upon its transfection. qPCR analysis of (d) LMNA, (e) LMNB1 and NEFL mRNA levels upon transfection of i6- 5ss in WT HAP1 cells.

[0125] Figure 4 - Promoting the inclusion of an alternatively spliced PTC - containing exon triggers DMD mutant mRNA decay and UTRN upregulation. a, Effects on endogenous DMD E37 alternative splicing in WT HEK293T cells after treatment with camptothecin (CPT) or trichostatin A (TSA); alternative splicing assessed by RT-PCR followed by agarose gel electrophoresis and SYBR Gold staining, b, Schematic illustration of the DMD PTC allele generated with CRISPR / Cas9 in HEK293T cells; red indicates the premature termination codon (PTC); gRNA, guide RNA. c, d, qPCR analysis of DMD mRNA levels in WT and DMDPTC / +cells after treatment with DMSO (c) or TSA (d) (n = 4). e, f, qPCR analysis of UTRN mRNA levels in WT and DMDPTC / +cells after treatment with DMSO (e) or TSA (f) (n = 5). g, h, Western blot and protein quantification showing dystrophin and utrophin levels in WT and DMDPTC / +cells treated with DMSO (g) or TSA (h) (n = 3). Data are normalised to WT and are mean ± s.d.; a two-tailed Student's t-test was used to calculate p values.

[0126] Figure 5 - Blocking nonsense-mediated decay results in the reversal of UTRN upregulation, whereas overexpressing DMD does not.

[0127] (a-c) Blocking NMD results in the normalization of DMD and UTRN mRNA levels. qPCR analysis of DMD mRNA (a), UTRN mRNA (b), and UTRN pre-mRNA (c) levels after siRNA-mediated UPF1 and SMG6 knockdown in WT and DMDPTC / +cells treated with TSA (n = 5); siCTRL, scrambled control, (d-f) Overexpression (OE) of dystrophin protein does not alter UTRN upregulation upon inclusion of DMD E37PTC / +. d, Western blot and protein quantification showing the OE of dystrophin protein in cells in which a DMD overexpression plasmid was transfected (n = 3). qPCR analysis of UTRN mRNA (e) and UTRN pre-mRNA (f) levels in WT and DMDPTC / +HEK293T cells transfected with an empty vector or a DMD overexpression plasmid, followed by addition of 1 pM TSA for 24 h (n = 4). Data are normalised to WT and are mean ± s.d.; a two-tailed Student's t-test was used to calculate p values. Figure 6 - UTRN upregulation induced by a DMD PTC minigene. a, Schematic illustration of the DMD WT and PTC minigenes, (b-e) OE of the DMD PTC minigene in WT cells results in UTRN upregulation. qPCR analysis of DMD (b) and UTRN (c) mRNA levels in WT HEK293T transfected with an empty vector, the DMD WT minigene, or the DMD PTC minigene (n = 5). qPCR analysis of DMD (d) and UTRN (e) mRNA levels in human myoblasts transfected with an empty vector, the DMD WT minigene, or the DMD PTC minigene (n = 4). Data are normalised to WT transfected with the DMD WT minigene or the empty vector and are mean ± s.d.; a two-tailed Student's t-test was used to calculate p values.

[0128] Figure 7 - Introducing a PTC in DMD using a splice-switching ASO triggers UTRN upregulation. a, b, qPCR analysis of DMD (a) and UTRN (b) mRNA levels in differentiated myoblasts derived from the paravertebral muscles of DMD patients compared with differentiated myoblasts derived from the paravertebral muscles of a healthy control, c, schematic illustration of the binding site of the spliceswitching ASO in DMD pre-mRNA (i52-5ss), and RT-PCR showing DMD E52 skipping upon its transfection in WT myoblasts, d, e, skipping an out-of-frame exon in the DMD gene triggers UTRN upregulation. qPCR analysis of DMD (d) and UTRN (e) mRNA levels in WT myoblasts after treatment with a scramble control ASO (Sc) or i52-5ss (n = 2). f, schematic illustration of the binding site of the eteplirsen-like ASO in DMD pre-mRNA, and RT-PCR showing DMD E51 skipping upon its transfection in DMDPTC1myoblasts, g, h, qPCR analysis of DMD (g) and UTRN (h) mRNA levels in DMDPTC1myoblasts after treatment with a scramble control ASO (Sc) or an eteplirsen-like ASO (n = 3). Data are normalised to the healthy control and are mean ± s.d.; a two-tailed Student's t-test was used to calculate p values.

[0129] Figure 8 - DMD E37 is an elongation-sensitive alternatively spliced exon. a, qPCR analysis of DMD E37 mRNA levels in WT cells after treatment with CPT. b, Schematic illustration of the effect of CPT and TSA on endogenous DMD E37 alternative splicing. Horizontal black half-arrows indicate primers used, c, Western blot and protein quantification of histone acetylation in WT cells after treatment with TSA (n = 3). d, qPCR analysis of DMD E37 mRNA levels in WT cells after treatment with TSA. Data are normalised to DMSO and are mean ± s.d.; a two-tailed Student's t-test was used to calculate p values (n = 5).

[0130] Figure 9 - DMD E37 skipping in DMDPTC / +cells.

[0131] (a-c) Effects on endogenous DMD E37 alternative splicing in DMDPTC / +cells after treatment with CPT or TSA. d, e, DMD E37 skipping occurs more frequently in DMDPTC / +cells than in WT cells, f, Graphic output from ESEfinder showing color bars, where the height of each bar indicates the score value, and its width represents its position along the deleted 20 nt sequence. Alternative splicing was analysed as in Fig. 4a and Extended Data Fig. 4d. Data are normalised to WT and are mean ± s.d.; a two-tailed Student's t-test was used to calculate p values.

[0132] Figure 10 - UTRN upregulation is due to increased transcription. a, qPCR analysis of DMD mRNA levels in WT cells after treatment with DMSO or TSA (n = 4). Black half-arrows indicate primers used, b, c, UTRN pre-mRNA levels are increased upon inclusion of the PTC - containing exon. qPCR analysis of UTRN pre-mRNA levels in WT and DMDPTC / +cells after treatment with DMSO (b) or TSA (c) (n = 5). d, Western blot and protein quantification showing dystrophin and utrophin protein upon treatment with 100 pg of cycloheximide (CHX) for 0, 24 and 48 h (n = 2). Data are normalised to WT and are mean ± s.d.; a two-tailed Student's t-test was used to calculate p values.

[0133] Figure 11 - UTRN upregulation in D / WDPTC / +cells occurs in a TSA dose and time dependent manner.

[0134] (a-d) DMD E37 inclusion by TSA treatment is dose and time dependent. Effect on DMD E37 alternative splicing in WT (a, c) and DMDPTC / +(b, d) cells after treatment with 0.1, 0.5, or 1 pM TSA for 24 h (a, b), and after treatment with 1 pM TSA for 8, 16, or 24 h (c, d). e, UTRN mRNA levels increase in a TSA dose-dependent manner. qPCR analysis of DMD and UTRN mRNA levels in DMDPTC / +cells after treatment with 0.1, 0.5, or 1 pM TSA for 24 h. f, UTRN mRNA levels increase in a TSA timedependent manner. qPCR analysis of DMD and UTRN mRNA levels after treatment with 1 pM TSA for 8, 16, or 24 h. Alternative splicing was analysed as in Fig. 4a and Extended Data Fig. 4d. Data are normalised to WT and are mean ± s.d.; a two-tailed Student's t-test was used to calculate p values (n = 3).

[0135] Figure 12 - UTRN upregulation in DMDPTC / +cells occurs in a TSA dose and time dependent manner.

[0136] (a-d) DMD E37 inclusion by TSA treatment is dose and time dependent. Effect on DMD E37 alternative splicing in WT (a, c) and DMDPTC / +(b, d) cells after treatment with 0.1, 0.5, or 1 pM TSA for 24 h (a, b), and after treatment with 1 pM TSA for 8, 16, or 24 h (c, d). e, UTRN mRNA levels increase in a TSA dose-dependent manner. qPCR analysis of DMD and UTRN mRNA levels in DMDPTC / +cells after treatment with 0.1, 0.5, or 1 pM TSA for 24 h. f, UTRN mRNA levels increase in a TSA timedependent manner. qPCR analysis of DMD and UTRN mRNA levels after treatment with 1 pM TSA for 8, 16, or 24 h. Alternative splicing was analysed as in Fig. 4a and Fig. 8d. Data are normalised to WT and are mean ± s.d.; a two-tailed Student's t-test was used to calculate p values (n = 3). Figure 13 - UPF1 and SMG6 knockdown efficiency. qPCR analysis of UPF1 (A) and SMG6 (B) mRNA levels after siRNA-mediated UPF1 and SMG6 knockdown in WT and DMDPTC / +cells treated with TSA. Data are normalised to WT treated with TSA and siCTRL and are mean ± s.d.; a two-tailed Student's t-test was used to calculate p values (n = 5).

[0137] Figure 14 - Model of DMD E37 elongation rate-sensitive alternative splicing coupled to transcriptional adaptation.

[0138] SSF, splicing silencer factor; green box indicates an intronic splicing silencer and red box indicates a 3' splice site. Figure modified from (21).

[0139] Figure 15 - UTRN upregulation is due to increased transcription.

[0140] Schematic illustration of the DMD PTC alleles in the DMD patient-derived myoblasts; red indicates the premature termination codons (PTCs). b, UTRN pre-mRNA levels are increased in DMD patients. qPCR analysis of UTRN pre-mRNA levels in DMDPTC1and DMDPTC2human myoblasts.

[0141] Figure 16 -Therapeutic oligonucleotides of SEQ ID NOs 1 to 11 in DMD, Exon 52.

[0142] Figure 17 - Therapeutic oligonucleotides of SEQ ID NOs 12 to 19 in FBN1. Exon 3.

[0143] Figure 18 -Therapeutic oligonucleotides of SEQ ID NOs 20 to 15 in LMNA, Exon 6

[0144] The Examples illustrate the invention:

[0145] Example 1 - Materials and Methods

[0146] Generation of HEK293T mutant cells with CRISPR / Cas9

[0147] HEK293T cells were transfected with the sgRNA listed on Table 2 cloned into the pSpCas9(BB)-2A- Puro plasmid (Addgene #62988). HEK293T cells were seeded at the density of 600.000 cells per well in a 6-well plate 24 h before plasmid transfection. Plasmid (2.5 pg) transfections were performed 24 h after cells were plated using Lipofectamine 3000 (Invitrogen) according to the manufacturer's protocol. Cells were incubated for 24 h after transfection; then the transfected cells were selected with medium containing puromycin (4 pg / mL) for 1 week (Gibco). Puromycin resistant cells were diluted in 10 cm dishes and incubated in fresh medium until single clones formed colonies. Colonies were transferred to a 96 well plate and genomic DNA was isolated from each colony for genotyping. Table 2. Guide RNAs used in this study to generate HEK293T mutant cells.

[0148] ASOs sequences and transfection

[0149] All ASOs used in this study were 18mers uniformly modified with 2'-O-MOE ribose, PS linkages, and 5'-methylcytosine (Table 3). They were obtained from Integrated DNA Technologies. Cells were transfected with ASOs using Lipofectamine 3000 according to the manufacturer's protocol. For transfections in myoblasts, after 4 h of transfection, cells were incubated in fresh differentiation media without ASOs and harvested 48 h later. For transfections in HEK293T and HAP1 cells, after 24 h, cells were incubated in fresh media without ASOs and harvested 24 h later.

[0150] Table 3. Antisense oligonucleotides used in this study.

[0151] Stable Cas9 HAP1 cells transient knockouts

[0152] Stable Cas9 HAP1 cells were transfected with the sgRNA listed on Table 4 in vitro synthetized using MEGAshortscript T7 transcription kit (Thermo Fisher). Stable Cas9 HAP1 cells were seeded at the density of 15.000 cells per well in a 96-well plate 24 h before sgRNA transfection. sgRNA (100 ng) transfections were performed 24 h after cells were plated using Lipofectamine RNAiMAX (Invitrogen) according to the manufacturer's protocol. Cells were harvested 48 h after transfection.

[0153] Table 4. sgRNAs used in this study.

[0154] Dystrophin expression plasmid

[0155] The plasmid p37-2iDMD-LR containing the coding sequence for the WT DMD gene was a gift from Michele Calos (Addgene # 88892). DMD exons 29 to 34 from p37-2iDMD-LR as well as intron 31 from HEK293T wild-type genomic DNA were cloned at the 3' of the Kozak sequence of the pSBbi-GP plasmid using a Gibson assembly cloning kit (New England Biolabs), resulting in the DMD WT minigene. The plasmid pSBbi-GP was a gift from Eric Kowarz (Addgene plasmid # 60511). A PTC at amino acid position 1421 (E1421X) was altered on the DMD WT minigene via site directed mutagenesis to generate the DMD PTC minigene.

[0156] Cell culture and treatments

[0157] HEK293T cells (DSMZ) were grown in Dulbecco's modified Eagle's medium (DMEM) containing 4.5 g of glucose (Gibco) and 10% fetal bovine serum (Sigma) at 37°C. Cells were plated at a density of 50.000 cells or 400.000 cells per well in 6-well plates 24 h before siRNA or plasmid transfection, respectively. siRNA (20 nM), plasmid (1 pg) transfections were performed 24 h after cells were plated, using Lipofectamine 3000 (Thermo Fisher Scientific) according to the manufacturer's protocol. 24 h later, cells were treated with Trichostatin A (Sigma, T8552), or vehicle, for the indicated time, and harvested for downstream procedures. siRNAs used are listed in Table 5. To block translation, wild-type and DMDPTC / +cells were treated with 100 pg of cycloheximide (Sigma) or DMSO for the indicated time points.

[0158] Table 5. List of siRNAs used.

[0159] Myoblasts derived from healthy humans The biopsies used for generating the cell lines were supplied by MyoBank, the tissue bank associated with the Institut de Myologie in Paris and affiliated with EuroBioBank. MyoBank is authorised by the French Ministry of Higher Education, Research, and Innovation to distribute human samples for research purposes (Authorization code AC-2019-3502). Human myoblasts were cultured in Skeletal Muscle Cell Growth Medium (Promocell) and 20% fetal bovine serum. Human myoblasts were differentiated by replacing growth medium with Skeletal Muscle Cell Differentiation Medium (Promocell) and incubated at 37°C for 6 days. The characterization of the DMD human myoblast cell lines is included in Table 6.

[0160] Table 6. Characterization of human myoblasts.

[0161] RNA extraction and RT-(q)PCR

[0162] Cells were harvested with 1 mL of Trizol (Invitrogen). Total RNA was isolated according to the manufacturer's protocol. One microgram of total RNA was reverse transcribed using Superscript III (Thermo Fisher Scientific) reverse transcriptase and oligo-dT primers. The resulting cDNA was amplified using Gotaq (Promega) and primers surrounding the exon to be skipped. After amplification, products were loaded in a 2% agarose gel and stained with SYBR Gold (Invitrogen) for visualization. Non-consecutive lanes were denoted by a vertical white line of separation. For qPCR, one microgram of total RNA was reverse transcribed using MAXIMA cDNA Synthesis Kit (ThermoFisher Scientific, K1671). qPCR reactions were prepared using DyNAmo ColorFlash SYBR Green PCR mix (Thermo Fisher Scientific, F-416). A standard program was run on Quantstudio™ 7 Pro Real-Time PCR System (ThermoFisher Scientific, A43185), and data analysis was performed using Design & Analysis Software 2.7.0 from ThermoFisher Scientific.

[0163] Western blots

[0164] Cells were lysed in RIPA buffer (Sigma). Protein samples were separated by 3-8% Tris-Acetate Protein Gel or 4-20% precast polyacrylamide gel and electroblotted onto PVDF membranes (Bio-rad). The blots were probed with 1:5000 anti-Dystrophin (Proteintech, 68120-1-lg), 1:2000 anti-Utrophin (Proteintech, 29133-1-AP), 1:2000 anti-H3K9ac (Proteintech, 29133-1-AP), or 1:2000 anti-tubulin

[0165] (Sigma, T6557) antibodies.

[0166] Example 2 - Results

[0167] Example 2.1 - Marfan syndrome

[0168] Marfan syndrome (MFS) is a dominant disease that affects the connective tissue and is mainly caused by mutations in the FBN1 gene (Sakai et al., 2016). FBN1 encodes fibrillin-1, a glycoprotein found in the extracellular matrix that acts as a scaffold for calcium-binding microfibrils (Handford et al., 2000). MFS patients harbouring FBN1 mutations leading to a premature termination codon (PTC) and mutant mRNA decay presented a milder phenotype (Dietz et al., 1993) or were under-represented (Faivre et al., 2009) when compared with patients carrying FBN1 missense mutations. Therefore, we hypothesized that FBN1 mutant mRNA degradation could lead to the upregulation of genes with similar functions, such as FBN2, as well as the upregulation of the wild-type allele of FBN1 (self- Transcriptional Adaptation / self-TA / self-TA), thereby partially compensating for fibrillin-1 protein loss.

[0169] In order to test whether mRNA destabilizing mutations in FBN1 indeed caused the upregulation of functional paralogs, such as FBN2, we generated both FBN1 missense and nonsense or frameshift mutants in HEK293T cells (Figure la). We observed a reduction in FBN1 mRNA levels in the homozygous nonsense mutant E991X and, notably, also in the missense mutant H975L compared with wild-type (WT) cells (Figure lb). Surprisingly, the frameshift mutant p.991X did not show any obvious reduction in FBN1 mRNA levels compared with WT cells (Figure lb). In order to test whether self-TA could be occurring in the p.991X mutant, we measured the precursor mRNA (pre-mRNA) levels of FBN1 in this mutant, and found them upregulated compared with WT cells (Figure lc), suggesting that self-TA is taking place in this mutant. We then measured FBN2 mRNA levels, and as expected, observed an increase in the nonsense and frameshift mutants (i.e., p.E991X and p.979x), but not so in the missense mutant (Figure Id).

[0170] We then wanted to see whether an antisense oligonucleotide targeting the 5' splice site of the out- of-frame exon 3 of FBN1 (Figure 2a, b) also led to FBN2 upregulation. Indeed, we observed FBN2 upregulation upon transfection of this antisense oligonucleotide in WT HEK293T cells (Figure 2c). Notably, instead of observing FBN1 mRNA degradation, we observed an increase in its mRNA levels, potentially due to self-TA (Figure 2c). Example 2.2 - Laminopathies

[0171] Laminopathies are a group of genetic disorders caused by mutations in the genes that encode proteins of the nuclear lamina, such as LMNA. Most disease-associated mutations in the LMNA gene are missense mutations, while nonsense or frameshift mutations only contribute to a small proportion of them (Lin et al., 2020). Striated laminopathies, which affect either cardiac or skeletal muscle, as well as premature aging syndromes, are associated with a higher proportion of non- missense and intronic mutations compared to other phenotypes. In contrast, lipodystrophies, neuropathies, and bone / skin diseases are primarily characterized by missense mutations (Lin et al., 2020). We hypothesised that nonsense mutations in LMNA do no not lead to neuropathies due to upregulation of NEFL, which encodes a component of the neuronal cytoskeleton, primarily involved in maintaining the structural integrity and function of neurons. We designed small guide RNAs targeting LMNA and transfected them into HAP1 cells expressing Cas9. We could observe a mild reduction in LMNA mRNA levels (Figure 3a), and upregulation of both LMNB1 and NEFL (Figure 3b).

[0172] We then designed an antisense oligonucleotide targeting the out-of-frame exon 6 of LMNA and introduced it into WT HAP1 cells (Figure 3c). We observed a mild reduction in LMNA mRNA levels (Figure 3d) and clear upregulation of NEFL mRNA levels (Figure 3e).

[0173] Example 2.3 - Duchenne muscular dystrophy

[0174] Duchenne Muscular Dystrophy (DMD) is an X-linked recessive neuromuscular disease caused by mutations in the DMD gene, which encodes dystrophin - a protein that acts as a mechanical link between the cytoskeleton and the extracellular matrix, safeguarding muscle cells from contraction- induced damage1-2. Utrophin, encoded by UTRN - the autosomal paralog of DMD, has been shown to be upregulated at the sarcolemma of skeletal muscles in DMD patients carrying frameshift or nonsense mutations in DMD that result in premature termination codons (PTCs)3-7, as well as in the mdx DMD mouse model8 11, which harbours a nonsense mutation in exon 23 of the Dmd gene. In contrast, patients with in-frame deletions in DMD do not display utrophin upregulation7. Preclinical studies have revealed an inverse correlation between utrophin expression and disease course severity in DMD12-13. Furthermore, mdx mutant mice display a milder phenotype than the Utrn / Dmd double mutant mice8. Therefore, utrophin upregulation has been proposed to be a compensatory mechanism to partially counteract the lack of dystrophin. However, the mechanisms behind its upregulation have remained largely elusive and are thought to be due to the loss of dystrophin protein14. Here, to investigate the mechanisms underlying UTRN upregulation in DMD patients carrying frameshift or nonsense alleles, we developed several genetic tools and show that DMD mutant mRNA decay plays a pivotal role in UTRN upregulation through a newly identified cellular response called transcriptional adaptation. Furthermore, we reveal a novel application for spliceswitching antisense oligonucleotides to trigger genetic compensation via transcriptional adaptation.

[0175] Fast transcriptional elongation promotes DMD E37 inclusion whereas slow transcriptional elongation causes its skipping

[0176] To study the role of DMD frameshift or nonsense mutations on UTRN expression, we first decided to investigate how to modulate the splicing of DMD exon 37 (E37). Previous studies have identified frameshift or nonsense mutations in this in-frame exon leading to a milder form of DMD, termed Becker muscular dystrophy15 17. Furthermore, bioinformatics analysis has predicted that DMD E37 presents a weak 3' splice site and a low exonic splicing enhancer (ESE) density, thereby leading to frequent exon skipping18.

[0177] To evaluate whether the transcriptional elongation rate has an effect on DMD E37 inclusion, we assessed the effect of camptothecin (CPT), a DNA topoisomerase I inhibitor, previously shown to indirectly inhibit elongation19-20. We treated wild-type (WT) human embryonic kidney 293T (HEK293T) cells with 3 pM CPT for 6 h, a treatment condition that have been shown not to completely shut down transcription21-22, and observed E37 skipping (Fig. 4a and Extended Data Fig. 4a), suggesting that inclusion of this exon follows the kinetic model of co-transcriptional splicing. As inhibiting elongation caused E37 skipping, we reasoned that stimulating RNAPII elongation would cause the opposite effect (Fig. 8b). Therefore, we treated WT HEK293T cells with 1 pM of the histone deacetylase inhibitor TSA for 24 h (Fig. 8c), a treatment condition that creates a more relaxed chromatin structure that enhances elongation21-23-24. We did indeed observe that TSA promotes E37 inclusion (Fig. 4a and Fig. 8d).

[0178] Introduction of a premature termination codon in DMD E37

[0179] The ability to induce the splicing of DMD E37 at will set it as a promising exon in which to introduce a frameshift or nonsense mutation that would lead to mRNA decay. Therefore, we targeted E37 in HEK293T cells using a guide RNA with a high fidelity Cas9 and generated a heterozygous DMD line, DMDPTC / +, that carries a 20 nt deletion in E37 resulting in a PTC positioned 118 nt upstream of its 3' end (Fig. 4b). We measured the effect of CPT and TSA on DMD E37 splicing in these cells, and found that the impact of elongation rate on DMD E37 inclusion was similar as that previously observed in WT cells (Extended Data Fig.52a-c). We also observed that DMD E37 skipping happened more frequently in DMDPTC / +than in WT cells in control conditions (Extended Data Fig. 5d, e), an observation consistent with previous reports showing that frameshift indels can lead to the skipping of in-frame exons, with the resulting transcripts escaping from nonsense-mediated decay (NMD)25-2S. We then utilised the splicing-factor binding-site prediction tool, ESEfinder27, and found that the deleted 20 nt sequence in E37 was predicted to harbour many splicing enhancers (Extended Data Fig. 5f), potentially explaining the more frequent skipping of E37 in DMDPTC / +compared with WT.

[0180] Promoting the inclusion of the PTC - containing exon triggers DIVID mutant mRNA decay as well as UTRN upregulation.

[0181] To determine whether DMD mutant mRNA decay was taking place upon the inclusion of the PTC- containing exon, we measured the mRNA levels of a region of the DMD transcript where the inclusion of exons was not affected by TSA (i.e., DMD E39-40) (Extended Data Fig. 6a). In control conditions, DMD expression levels were similar between WT and DMDPTC / +cells (Fig. 4c), whereas they were significantly reduced in DMDPTC / +compared with WT when we induced the inclusion of the PTC-containing exon (Fig. 4d), which is consistent with transcripts bearing PTCs being subjected to NMD28 30.

[0182] As mdx mice harbouring a nonsense mutation in Dmd display increased expression of utrophin mRNA and protein8 11, we then wanted to test whether utrophin mRNA and protein levels would be similarly upregulated when inducing the inclusion of the PTC-containing E37 in DMDPTC / +cells. In contrast to control conditions, where there are no changes in UTRN mRNA levels between WT and DMPTC / +cells (Fig. 4e), we observed an increase in UTRN expression levels in DMDPTC / +cells compared with WT when treated with 1 pM TSA for 24 h (Fig. 4f). Furthermore, the fold change of this UTRN upregulation was around 1.5-2, which is similar as that reported in mdx mice31. To determine whether this increase in UTRN mRNA levels was due to increased transcription or increased mRNA stability, we measured its precursor mRNA (pre-mRNA) levels, and found that they were also increased upon inclusion of the PTC-containing exon (Extended Data Fig. 6b, c), indicating that UTRN upregulation is due to increased transcription.

[0183] We then investigated whether these changes in DMD and UTRN mRNA levels resulted in protein level changes. We observed an upregulation of utrophin protein despite no obvious loss of dystrophin protein (Fig. 4g, h), the latter most likely due to a long protein half-life as previously observed in vivo32. To evaluate the half-life of dystrophin and utrophin proteins, we treated both WT and DMDPTC / +cells with the protein translation inhibitor cycloheximide (CHX) for 24 and 48 h. We found that whereas utrophin levels were severely reduced at 24 h and almost absent at 48 h, dystrophin levels were reduced but still present at 48 h (Fig. lOd). Altogether, these findings suggest that UTRN upregulation is not due to the loss of dystrophin protein but to RNA feedback loops involving DMD mRNA decay. They also show that increased UTRN mRNA levels lead to increased utrophin protein levels.

[0184] UTRN upregulation correlates with DMD E37 inclusion levels and occurs downstream of DMD mRNA decay

[0185] The effect of TSA on DMD E37 inclusion is dose and time dependent in both WT and DMDPTC / +cells (Fig. lla-d). Increasing the concentration of TSA led to a more pronounced decrease in DMD mRNA levels and a more pronounced increase in UTRN mRNA levels (Fig. lie). In terms of time dependency, after 8 h of treatment with TSA, a significant decrease in DMD mRNA levels was already present in DMDPTC / +compared with WT, whereas UTRN mRNA levels were only slightly altered at this time but significantly upregulated (1.5-fold) after 16 h of treatment (Fig. Ilf). Together, these findings suggest that changes in UTRN mRNA levels are caused by DMD mRNA decay.

[0186] We could also reverse the effects of TSA by washing it away and letting the cells recover for 48 h. Recovery from TSA led to a reduction in DMD E37 inclusion levels (Fig. 12a-d) as well as a normalization in DMD and UTRN mRNA levels (Fig. 12e, f).

[0187] Mutant mRNA decay plays a role in UTRN upregulation

[0188] To investigate the role of the NMD surveillance machinery in DMDPTC / +, we knocked down UPF1 and SMG6, two key NMD proteins28-30(Fig. 13a, b). Blocking NMD led to a reduction in DMD mutant mRNA decay (Fig. a) as well as a loss of UTRN upregulation at both the mRNA (Fig. 5b) and pre-mRNA (Fig. 5c) levels. These data indicate that DMD mRNA decay is a key factor in triggering UTRN upregulation, which led us to explore whether transcriptional adaptation (TA) was taking place.

[0189] TA is a widespread and evolutionary conserved response to mutations whereby mutant mRNA decay leads to the transcriptional modulation of so-called adapting genes33-43. Importantly, this process is independent of the loss of protein function and can lead to functional compensation in some cases, potentially explaining why certain mutations resulting in PTCs in critical genes do not cause an obvious phenotype33-40. TA has been identified thus far in zebrafish33-35, C. elegans37, and mouse cells in culture36, but reports of TA in human cells are still lacking. UTRN upregulation is not due to loss of dystrophin protein, but to transcriptional adaptation

[0190] To test the hypothesis that UTRN upregulation is caused by TA, we first overexpressed DMD in DMDPTC / +cells treated with TSA, and observed UTRN mRNA and pre-mRNA upregulation compared with controls, despite dystrophin protein overexpression (Fig. 56d-f). These findings further indicate that mutant mRNA decay, and not the loss of dystrophin protein, plays a key role in UTRN upregulation in DMDPTC / +cells, supporting the hypothesis that TA plays a primary role in increase in UTRN expression when the PTC-containing exon is included in the DMD transcript.

[0191] As a second approach, we generated a DMD minigene consisting of E29 to E35 as well as intron 31, hereafter referred to as the DMD WT minigene (Fig. 6a). We then introduced a PTC in E31 to obtain a DMD PTC minigene (Fig. 6a). We transfected one of these two plasmids or an empty vector - consisting of the backbone from which both the DMD WT and PTC minigenes were generated - into WT HEK293T cells. We observed lower DMD mRNA levels in WT cells transfected with the DMD PTC minigene compared with WT cells transfected with the DMD WT minigene (Fig. 6b), indicating that degradation of the DMD transcript encoded by the PTC minigene is taking place. Furthermore, we found increased UTRN mRNA levels upon overexpression of the DMD PTC minigene, but not of the DMD WT minigene or empty vector (Fig. 6c). Notably, we also observed UTRN upregulation upon overexpression of the DMD PTC minigene in human myoblasts compared with control (Fig. 6d, e).

[0192] These findings, which show an increase in UTRN mRNA levels in the presence of DMD mutant mRNA decay despite no loss of endogenous dystrophin protein, further indicate that mRNA decay and not the loss of protein function is the trigger for UTRN upregulation, placing TA as the mechanism behind UTRN upregulation in some DMD patients.

[0193] Altogether, these data suggest a model in which inclusion of the DMD PTC-containing exon by promoting fast transcriptional elongation leads to mutant mRNA decay via NMD, triggering downstream processes that result in UTRN upregulation independently of the loss of dystrophin protein (Fig. 14). A splice-switching ASO can introduce PTCs in the DMD transcript and trigger UTRN upregulation

[0194] To place these findings in a disease context, we first measured DMD and UTRN mRNA levels in myotubes derived from two DMD patients, each carrying a different lesion in DMD that are both predicted to lead to PTCs: an E52 deletion and a nonsense mutation in E26 (Fig. 15a). In both cases, we observed reduced DMD mRNA levels and increased UTRN mRNA levels compared with myotubes derived from a healthy control (Fig. 7a, b). Furthermore, as previously observed in HEK293T cells (Extended Data Fig. 6b, c), we also found increased UTRN pre-mRNA levels in myotubes derived from the DMD patients compared with myotubes derived from a healthy control (Fig. 15b), indicating that UTRN upregulation in these cases is also due to increased transcription. These findings are consistent with our data showing a direct correlation between DMD mutant mRNA decay and UTRN upregulation.

[0195] We then used a splice-switching antisense oligonucleotide (ASO) designed to target the 5' splice site of the out-of-frame exon 52 (i52-5ss) in the DMD pre-mRNA, to induce its skipping (Fig. 7c). We tested this ASO in WT myoblasts and observed increased exon 52 skipping (Fig. 7c) when compared with a scramble control ASO (Sc). We reasoned that skipping E52 should lead to the introduction of PTCs in the DMD transcript (Fig. 15a), and thereby trigger UTRN upregulation. Indeed, skipping E52 triggered UTRN upregulation; however, we did not observe a significant reduction in DMD mRNA levels (Fig. 7d, e), most likely due to the higher prevalence of the full-length isoform compared with the isoform where E52 is skipped (Fig. 7c). Thus, by achieving some degree of E52 skipping we can trigger UTRN upregulation without causing a severe reduction in DMD mRNA levels, which could be beneficial therapeutically.

[0196] An eteplirsen-like ASO blocks UTRN upregulation

[0197] In a converse approach, we introduced an eteplirsen-like ASO in myoblasts derived from a DMD patient with an E52 deletion. Eteplirsen is an FDA-approved ASO that restores the DMD reading frame in DMD patients with specific mutations in DMD by skipping E5144-46. By skipping E51, an internally truncated but partially functional dystrophin protein is generated. We found that this eteplirsen-like ASO not only restores the reading frame in these DMD mutant myoblasts but it also blocks UTRN upregulation (Fig. 7f-h), potentially counteracting some of the beneficial effects of eteplirsen. Discussion

[0198] Since the generation of the mdx mouse model to study DMD, where utrophin upregulation was observed and shown to compensate for the loss of dystrophin8, upregulation of utrophin has been one of the main strategies to treat this disease47-48. Nevertheless, the mechanisms underlying utrophin upregulation are barely understood, and thought to be caused by dystrophin protein loss. By utilising four different approaches, we show that DMD mRNA decay plays a key role in UTRN upregulation. Contrary to previous assumptions, our data indicate that the increased expression of UTRN is not due to the loss of dystrophin protein function, but rather to TA.

[0199] TA as a mode of genetic compensation was first identified in zebrafish (Danio rerio) when investigating differences between mutation-induced phenotypes and antisense (morpholino)- induced phenotypes33. Further investigations revealed the presence of TA in C. elegans37, and mutant mRNA decay as playing a key role in triggering TA in zebrafish as well as in mouse cells in culture36. Nevertheless, TA has not been reported in humans thus far. Here, we present the first example of TA in humans and its potential role in a hereditary disease.

[0200] Our data show that myoblasts from a DMD patient with an E52 deletion display UTRN upregulation. Skipping of E51 in these myoblasts using an eteplirsen-like ASO blocks UTRN upregulation. In the case of DMD patients treated with eteplirsen, it would be of significant interest to test whether a cocktail of both eteplirsen and an ASO designed to block a microRNA site in UTRN* , known to repress its expression, could further benefit the disease phenotype by stimulating UTRN expression, whose upregulation via TA is blocked by eteplirsen treatment.

[0201] Missense mutations are reportedly more prevalent than nonsense or frameshift mutations, which often lead to mRNA decay, in many human genetic diseases49-56. In some of these diseases (e.g., sickle cell disease, Marfan syndrome, and hypertrophic cardiomyopathy caused by mutations in MYH7), it has been reported that missense mutations have more detrimental effects than nonsense mutations54-56. Functional compensation via TA could explain why nonsense mutations are less frequently reported than missense mutations, as they may cause a milder phenotype. ASOs have been approved by the FDA for the treatment of multiple diseases; here, we show a new application for splice-switching ASOs to trigger mutant mRNA decay, and thereby induce functional compensation via TA.

[0202] We also took advantage of endogenous DMD E37 splicing to create an inducible DMD mutant mRNA decay model. This inducible splicing-dependent system constitutes a novel tool to induce endogenous mRNA decay. In the last few years, it has been shown that alternative splicing is not an exception but rather more of a rule in multicellular organisms, occurring in approximately 95% of human genes57, and genome-wide analyses have revealed that around 20% of a cell's alternative splicing events are elongation-sensitive57. Therefore, this inducible splicing-dependent system holds promise to induce mRNA decay across a wide range of genes and observing immediate changes over time. Additionally, in the 2019 Ensembl database, about 15000 human alternative splicing variants are annotated as NMD-sensitive isoforms57. Inducing the inclusion of elongation-sensitive exons bearing PTCs (poison exons) or introducing PTCs via splice-switching ASOs, also emerge as promising approaches to induce mRNA decay, without the need to modify the genome. Altogether, these findings highlight the importance of TA as a mechanism underlying genetic robustness and its relevance to hereditary diseases, helping in the design of therapeutic approaches that take advantage, or do not interfere, with TA-triggered.

[0203] References - Examples 2.1 and 2.2

[0204] 1. Sakai L. Y., Keene D. R., Renard M., De Backer J. FBN1: The disease-causing gene for Marfan syndrome and other genetic disorders. Gene 591, 279-291 (2016).

[0205] 2. Handford P. A. Fibrillin-1, a calcium binding protein of extracellular matrix. Biochim Biophys Acta. 1498, 84-90 (2000).

[0206] 3. Dietz H. C., McIntosh I., Sakai L. Y., Corson G. M., Chalberg S. C., Pyeritz R. E., Francomano C. A. Four novel FBN1 mutations: significance for mutant transcript level and EGF-like domain calcium binding in the pathogenesis of Marfan syndrome. Genomics 17, 468-475 (1993).

[0207] 4. Faivre L., Collod-Beroud G., Callewaert B., Child A., Binquet C., Gautier E., Loeys B. L., Arbustini E., Mayer K., Arslan-Kirchner M., Stheneur C., Kiotsekoglou A., Comeglio P., Marziliano N., Wolf J. E., Bouchot O., Khau-Van-Kien P., Beroud C., Claustres M., Bonithon-Kopp C., Robinson P. N., Ades L., De Backer J., Coucke P., Francke U., De Paepe A., Jondeau G., Boileau C. Clinical and mutation-type analysis from an international series of 198 probands with a pathogenic FBN1 exons 24-32 mutation. Eur. J. Hum. Genet. 17, 491-501 (2009).

[0208] 5. Lin E. W., Brady G. F., Kwan R., Nesvizhskii A. I., Omary M. B. Genotype-phenotype analysis of LMNA-related diseases predicts phenotype-selective alterations in lamin phosphorylation. FASEB J. 34, 9051-9073 (2020).

[0209] References - Example 2.3

[0210] 1. Blake, D. J., Weir, A., Newey, S. E., Davies, K. E. Function and genetics of dystrophin and dystrophin-related proteins in muscle. Physiol. Rev. 82, 291-329 (2002).

[0211] 2. Duan, D., Goemans, N., Takeda, S., Mercuri, E., Aartsma-Ru, A. Duchenne muscular dystrophy. Nat. Rev. Dis. Primers. 7, 13 (2021).

[0212] 3. Helliwel I, T. R., Man, N. T., Morris, G. E., Davies, K. E. The dystrophin- related protein, utrophin, is expressed on the sarcolemma of regenerating human skeletal-muscle fibers in dystrophies and inflammatory myopathies. Neuromuscul. Disord. 2, 177-184 (1992).

[0213] 4. Arechavala-Gomeza, V., Kinali, M., Feng, L., Brown, S. C., Sewry, C., Morgan, J. E., Muntoni, F. Immunohistological intensity measurements as a tool to assess sarcolemma-associated protein expression. Neuropathol. Appl. Neurobiol. 36, 265-74 (2010).

[0214] 5. Anthony, K., Arechavala-Gomeza, V., Ricotti, V., Torelli, S., Feng, L., Janghra, N., Tasca, G., Guglieri, M., Barresi, R., Armaroli, A., Ferlini, A., Bushby, K., Straub, V., Ricci, E., Sewry, C., Morgan, J., Muntoni, F. Biochemical characterization of patients with in-frame or out-of-frame DMD deletions pertinent to exon 44 or 45 skipping. JAMA Neurol. 71, 32-40 (2014).

[0215] 6. Ruiz-Del-Yerro, E., Garcia-Jimenez, I., Mamchaoui, K., Arechavala-Gomeza, V. Myoblots: dystrophin quantification by in-cell western assay for a streamlined development of Duchenne muscular dystrophy (DMD) treatments. Neuropathol. Appl. Neurobiol. 44, 463-473 (2018).

[0216] 7. Janghra, N., Morgan, J. E., Sewry, C. A., Wilson, F. X., Davies, K. E., Muntoni, F., Tinsley, J. Correlation of Utrophin Levels with the Dystrophin Protein Complex and Muscle Fibre Regeneration in Duchenne and Becker Muscular Dystrophy Muscle Biopsies. PLoS One. 11, e0150818 (2016). 8. Deconinck, A. E., Rafael, J. A., Skinner, J. A., Brown, S. C., Potter, A. C., Metzinger, L., Watt, D. J., Dickson, J. G., Tinsley, J. M., Davies, K. E. Utrophin-dystrophin-deficient mice as a model for Duchenne muscular dystrophy. Cell. 90, Y1-T1 (1997).

[0217] 9. Partridge, T. A. The mdx mouse model as a surrogate for Duchenne muscular dystrophy. FEBSJ. 280, 4177-4186 (2013).

[0218] 10. Law, D.J., Allen, D.L., Tidball, J.G. Talin, vinculin and DRP (utrophin) concentrations are increased at mdx myotendinous junctions following onset of necrosis. J. Cell. Sci. 107, 1477-83 (1994).

[0219] 11. Georgieva, A.M., Guo, X., Bartkuhn, M., Gunther, S., Kunne, C., Smolka, C., Atzberger, A., Gartner, U., Mamchaoui, K., Bober, E., Zhou, Y., Yuan, X., Braun, T. Inactivation of Sirt6 ameliorates muscular dystrophy in mdx mice by releasing suppression of utrophin expression. Nat. Commun. 13, 4184 (2022).

[0220] 12. Kleopa, K.A., Drousiotou, A., Mavrikiou, E., Ormiston, A., Kyriakides, T. Naturally occurring utrophin correlates with disease severity in Duchenne muscular dystrophy. Hum. Mol. Genet. 15, 1623-1628 (2006).

[0221] 13. Guiraud, S., Davies, K. Utrophin correlates with disease severity in Duchenne muscular dystrophy. Med. 4, 220-222 (2023).

[0222] 14. Valera I. C., Wacker A. L., Hwang H. S., Holmes C., Laitano O., Landstrom A. P., Parvatiyar M. S. Essential roles of the dystrophin-glycoprotein complex in different cardiac pathologies. Adv. Med Sci. 66, 52-71 (2021).

[0223] 15. Hamed, S., Sutherland-Smith, A., Gorospe, J., Kendrick-Jones, J., Hoffman, E. DNA sequence analysis for structure / function and mutation studies in Becker muscular dystrophy. Clin. Genet. 68, 69-79 (2005).

[0224] 16. Tuffery-Giraud, S., Beroud, C., Leturcq, F., Yaou, R. B., Hamroun, D., Michel-Calemard, L., Moizard, M. P., Bernard, R., Cossee, M., Boisseau, P., Blayau, M., Creveaux, I., Guiochon-Mantel, A., de Martinville, B., Philippe, C., Monnier, N., Bieth, E., Khau Van Kien, P., Desmet, F. O., Humbertclaude, V., Kaplan, J. C., Chelly, J., Claustres, M. Genotype-phenotype analysis in 2,405 patients with a dystrophinopathy using the UMD-DMD database: a model of nationwide knowledgebase. Hum. Mutat. 30, 934-945 (2009).

[0225] 17. Juan-Mateu. J., Gonzalez-Quereda, L, Rodn'guez, M. J., Verdura, E., Lazaro, K., Jou, C., Nascimento, A., Jimenez-Mallebrera, C., Colomer, J., Monges, S., Lubieniecki, F., Foncuberta, M. E., Pascual-Pascual, S. L, Molano, J., Baiget, M., Gallano, P. Interplay between DMD point mutations and splicing signals in Dystrophinopathy phenotypes. PLoS One. 8, e59916 (2013).

[0226] 18. Flanigan, K. M., Dunn, D. M., von Niederhausern, A., Soltanzadeh, P., Howard, M. T., Sampson, J. B., Swoboda, K. J., Bromberg, M. B., Mendell, J. R., Taylor, L. E., Anderson, C. B., Pestronk, A., Florence, J. M., Connolly, A. M., Mathews, K. D, Wong, B., Finkel, R. S., Bonnemann, C. G., Day, J. W., McDonald, C. Nonsense mutation-associated becker muscular dystrophy: Interplay between exon definition and splicing regulatory elements within the DMD gene. Hum. Mutat. 32, 299-308 (2011).

[0227] 19. BOIREAU, S., MAIURI, P., BASYUK, E., DE LA MATA, M., KNEZEVICH, A., PRADET- BALADE, B., BACKER, V., KORNBLIHTT, A. R., MARCELLO, A., BERTRAND, E. THE TRANSCRIPTIONAL CYCLE OF HIV-1 IN REAL-TIME AND LIVE CELLS. J. CELL. BlOL. 179, 291-304 (2007).

[0228] 20. Darzacq, X., Shav-Tal, Y., de Turris, V., Brody, Y., Shenoy, S. M., Phair, R. D., Singer, R. H. In vivo dynamics of RNA polymerase II transcription. Nat. Struct. Mol. Biol. 14, 796-806 (2007). 21. Dujardin, G., Lafaille, C., de la Mata, M., Marasco, L. E., Munoz, M. J., Le Jossic-Corcos, C., Corcos, L., Kornblihtt, A.R. How slow RNA polymerase II elongation favors alternative exon skipping. Mol. Cell 54, 683-690 (2014).

[0229] 22. Listerman, I., Sapra, A. K., Neugebauer, K. M. Cotranscriptional coupling of splicing factor recruitment and precursor messenger RNA splicing in mammalian cells. Nat. Struct. Mol. Biol. 13, 815-822 (2006).

[0230] 23. Marasco, L. E., Dujardin, G., Sousa-Lui's, R., Liu, Y. H., Stigliano, J. N., Nomakuchi, T., Proudfoot, N. J., Krainer, A. R, Kornblihtt, A. R. Counteracting chromatin effects of a splicing-correcting antisense oligonucleotide improves its therapeutic efficacy in spinal muscular atrophy. Cell. 185, 2057-2070 (2022).

[0231] 24. Schor, I. E., Rascovan, N., Pelisch, F., Allo, M., Kornblihtt, A. R. Neuronal cell depolarization induces intragenic chromatin modifications affecting NCAM alternative splicing. Proc. Natl. Acad. Sci. USA. 106, 4325-4330 (2009).

[0232] 25. Lalonde, S., Stone, O. A., Lessard, S., Lavertu, A., Desjardins, J., Beaudoin, M., Rivas, M., Stainier, D. Y. R., Lettre, G. Frameshift indels introduced by genome editing can lead to in-frame exon skipping. PLoS One. 12, e0178700 (2017).

[0233] 26. Anderson, J. L., Mulligan, T. S., Shen, M. C., Wang, H., Scahill, C. M., Tan, F. J., Du, S. J., Busch- Nentwich, E. M., Farber, SA. mRNA processing in mutant zebrafish lines generated by chemical and CRISPR-mediated mutagenesis produces unexpected transcripts that escape nonsense-mediated decay. PLoS Genet. 13, el007105 (2017).

[0234] 27. Cartegni, L., Wang, J., Zhu Z., Zhang, M. Q„ Krainer A. R. ESEfinder: A web resource to identify exonic splicing enhancers. Nucleic Acids Res. 31, 3568-3571 (2003).

[0235] 28. Maquat, L. E. Nonsense-mediated mRNA decay in mammals. J. Cell Sci. 118, 1773-6 (2005).

[0236] 29. Sato, H., Singer, R. H. Cellular variability of nonsense-mediated mRNA decay. Nat. Commun. 12, 7203 (2021).

[0237] 30. Monaghan, L., Longman, D., Caceres, J. F. Translation-coupled mRNA quality control mechanisms. EMBOJ. 42, ell4378 (2023).

[0238] 31. McCarthy, J. J., Esser, K. A., Andrade, F. H. MicroRNA-206 is overexpressed in the diaphragm but not the hindlimb muscle of mdx mouse. Am. J. Physiol Cell Physiol. 293, C451-7 (2007).

[0239] 32. Verhaart, I. E., van Vliet-van den Dool, L., Sipkens J. A., de Kimpe S. J., Kolfschoten I. G., van Deutekom J. C., Liefaard, L., Ridings, J. E., Hood, S. R., Aartsma-Rus, A. The Dynamics of Compound, Transcript, and Protein Effects After Treatment With 2OMePS Antisense Oligonucleotides in mdx Mice. Mol. Ther. Nucleic Acids. 3, el48 (2014).

[0240] 33. Rossi, A., Kontarakis, Z., Gerri, C., Nolte, H., Hblper, S., Kruger, M., Stainier, D. Y. R. Genetic compensation induced by deleterious mutations but not gene knockdowns. Nature. 524, 230-3 (2015). 34. El-Brolosy, M. A., Stainier, D. Y. R. Genetic compensation: A phenomenon in search of mechanisms. PLoS Genetics (2017).

[0241] 35. Ma, Z., Zhu, P., Shi, H., Guo, L., Zhang, Q., Chen, Y., Chen, S., Zhang, Z., Peng, J., Chen, J. PTC- bearing mRNA elicits a genetic compensation response via Upf3a and COMPASS components. Nature. 568, 259-63 (2019).

[0242] 36. El-Brolosy, M. A., Kontarakis, Z., Rossi, A., Kuenne, C., Gunther, S., Fukuda, N., Kikhi, K., Boezio, G. L., Takacs, C. M., Lai, S. L., Fukuda, R., Gerri, C., Giraldez, A. J., Stainier D. Y. R. Genetic compensation triggered by mutant mRNA degradation. Nature. 568, 193-197 (2019).

[0243] 37. Serobyan, V., Kontarakis, Z., El-Brolosy, M. A., Welker, J. M., Tolstenkov, O., Saadeldein, A. M., Retzer, N., Gottschalk, A., Wehman, A. M., Stainier D. Y. R., Transcriptional adaptation in Caenorhabditis elegans. eLife. 9, e50014 (2020).

[0244] 38. Kontarakis, Z., Stainier, D. Y. R. Genetics in light of transcriptional adaptation. Trends Genet. 36, 926-35 (2020).

[0245] 39. Sztal, T. E., Stainier, D. Y. R. Transcriptional adaptation: a mechanism underlying genetic robustness. Development. 147, (2020).

[0246] 40. Jakutis, G., Stainier, D. Y. R. Genotype-Phenotype relationships in the context of transcriptional adaptation and genetic robustness. Annu. Rev. Genet. 55,71-91 (2021).

[0247] 41. Jiang, Z., El-Brolosy, M. A., Serobyan, V., Welker, J. M., Retzer, N., Dooley, C. M., Jakutis, G., Juan, T., Fukuda, N., Maischein, H. M., Balciunas, D., Stainier, D. Y. R. Parental mutations influence wildtype offspring via transcriptional adaptation. Sci. Adv. 8, eabj2029 (2022).

[0248] 42. Fernandez-Abascal, J., Wang, L., Graziano, B., Johnson, C. K., Bianchi, L. Exon dependent transcriptional adaptation by exon-junction complex proteins Y14 / RNP-4 and MAGOH / MAG-1 in Caenorhabditis elegans. PLoS Genet. 18, el010488 (2022).

[0249] 43. Welker, J. M., Serobyan, V., Esfahani, E. Z., Stainier, D. Y. R. Partial sequence identity in a 25- nucleotide long element is sufficient for transcriptional adaptation in the Caenorhabditis elegans act- 5 / act-3 model. PLoS Genet. 19, el010806 (2023).

[0250] 44. Arechavala-Gomeza, V., Graham, I. R., Popplewell, L. J., Adams, A. M., Aartsma-Rus, A., Kinali, M., Morgan, J. E., van Deutekom, J. C., Wilton, S. D., Dickson, G., Muntoni, F. Comparative analysis of antisense oligonucleotide sequences for targeted skipping of exon 51 during dystrophin pre-mRNA splicing in human muscle. Hum. Gene Ther. 18, 798-810 (2007).

[0251] 45. Galli, F., Bragg, L., Rossi, M., Proietti, D., Perani, L., Bagicaluppi, M., Tonlorenzi, R., Sibanda, T., Caffarini, M., Talapatra, A., Santoleri, S., Meregalli, M., Bano-Otalora, B., Bigot, A., Bozzoni, I., Bonini, C., Mouly, V., Torrente, Y., Cossu, G. Cell-mediated exon skipping normalizes dystrophin expression and muscle function in a new mouse model of Duchenne Muscular Dystrophy. EMBO Mol. Med., Epub ahead of print (2024). doi: 10.1038 / s44321-024-00031-3.

[0252] 46. Aartsma-Rus, A., Straub, V., Hemmings, R., Haas, M., Schlosser-Weber, G., Stoyanova-Beninska, V., Mercuri, E., Muntoni, F., Sepodes, B., Vroom, E., Balabanov, P. Development of exon skipping therapies for Duchenne muscular dystrophy: a critical review and a perspective on the outstanding issues. Nucleic Acid. Ther. 27 , 251-259 (2017).

[0253] 47. Tinsley, J. M., Potter, A. C., Phelps, S. R., Fisher, R., Trickett, J. I., Davies, K. E. Amelioration of the dystrophic phenotype of mdx mice using a truncated utrophin transgene. Nature. 384, 349-53 (1996).

[0254] 48. Sengupta, K., Loro, E., Khurana, T. S. PMO-based let-7c site blocking oligonucleotide (SBO) mediated utrophin upregulation in mdx mice, a therapeutic approach for Duchenne muscular dystrophy (DMD). Sci. Rep. 10, 21492 (2020).

[0255] 49. Genschel, J., Schmidt, H. H. Mutations in the LMNA gene encoding lamin A / C. Hum. Mutat. 16, 451-459 (2000).

[0256] 50. Ferec, C., Cutting, G. R. Assessing the disease-liability of mutations in CFTR. Cold Spring Harb. Perspect. Med. 2, a009480 (2012).

[0257] 51. Faivre, L., Collod-Beroud, G., Callewaert, B., Child, A., Binquet, C., Gautier, E., Loeys, B. L., Arbustini, E., Mayer, K., Arslan-Kirchner, M., Stheneur, C., Kiotsekoglou, A., Comeglio, P., Marziliano, N., Wolf, J. E., Bouchot, O., Khau-Van-Kien, P., Beroud, C., Claustres, M., Bonithon-Kopp, C., Robinson, P. N., Ades, L., De Backer, J., Coucke, P., Francke, U., De Paepe, A., Jondeau, G., Boileau, C. Clinical and mutation-type analysis from an international series of 198 probands with a pathogenic FBN1 exons 24-32 mutation. Eur. J. Hum. Genet. 17, 491-501 (2009).

[0258] 52. Carlice-Dos-Reis T, Viana J, Moreira FC, Cardoso GL, Guerreiro J, Santos S, Ribeiro-Dos-Santos A. Investigation of mutations in the HBB gene using the 1,000 genomes database. PLoS One. 12, e0174637 (2017).

[0259] 53. Kelly, M. A., Caleshu, C., Morales, A., Buchan, J., Wolf, Z., Harrison, S. M., Cook, S., Dillon, M. W., Garcia, J., Haverfield, E., Jongbloed, J. D. H., Macaya, D., Manrai, A., Orland, K., Richard, G., Spoonamore, K., Thomas, M., Thomson, K., Vincent, L. M., Walsh, R., Watkins, H., Whiffin, N., Ingles, J., van Tintelen, J. P., Semsarian, C., Ware, J. S., Hershberger, R., Funke, B. Adaptation and validation of the ACMG / AMP variant classification framework for MYH7-associated inherited cardiomyopathies: recommendations by ClinGen's Inherited Cardiomyopathy Expert Panel. Genet. Med. 20, 351-359 (2018).

[0260] 54. Boontanrart, M. Y., Schroder, M. S., Stehli, G. M., Banovic, M., Wyman, S. K., Lew, R. J., Bordi, M., Gowen, B. G., DeWitt, M. A., Corn, J. E. ATF4 Regulates MYB to Increase y-Globin in Response to Loss of P-Globin. Cell Rep. 32, 107993 (2020).

[0261] 55. Dietz, H. C., McIntosh, I., Sakai, L. Y., Corson, G. M., Chalberg, S. C., Pyeritz, R. E., Francomano, C. A. Four novel FBN1 mutations: significance for mutant transcript level and EGF-like domain calcium binding in the pathogenesis of Marfan syndrome. Genomics 17, 468-475 (1993).

[0262] 56. Anderson BR, Jensen ML, Hagedorn PH, Little SC, Olson RE, Ammar R, Kienzle B, Thompson J, McDonald I, Mercer S, Vikesaa J, Nordbo B, Iben L, Cao Y, Natale J, Dalton-Kay G, Cacace A, Hansen BR, Hedtjarn M, Koch T, Bristow U. Allele-Selective Knockdown of MYH7 Using Antisense Oligonucleotides. Mol. Ther. Nucleic Acids. 19, 1290-1298 (2020). 57. Marasco, L. E., Kornblihtt, A. R. The physiology of alternative splicing. Nat. Rev. Mol. Cell Biol. 24, 242-254 (2022).

[0263] 58. Mamchaoui, K., Trollet, C., Bigot, A., Negroni, E., Chaouch, S., Wolff, A., Kandalla, P. K., Marie, S., Di Santo, J., St Guily, J. L., Muntoni, F., Kim, J., Philippi, S., Spuler, S., Levy, N., Blumen, S. C., Voit, T., Wright, W. E., Aamiri, A., Butler-Browne, G., Mouly, V. Immortalized pathological human myoblasts: towards a universal tool for the study of neuromuscular disorders. Skelet. Muscle. 1, 34 (2011).

[0264] 59. Kim Y. J., Sivetz N., Layne J., Voss D. M., Yang L., Zhang Q., Krainer A. R. Exon-skipping antisense oligonucleotides for cystic fibrosis therapy. Proc. Natl. Acad. Sci. USA. 119, e2114858118 (2022).

Claims

CLAIMS1. A therapeutic oligonucleotide for use in treating a disease in a subject that is associated with or caused by a missense, nonsense or in-frame indel mutation in a gene of the genome of the subject, wherein the therapeutic oligonucleotide is capable of specifically hybridizing to the 5'- splice site, the 3' -splice site or an exonic splicing enhancer (ESE) of an out-of-frame exon in the gene with the missense, nonsense or in-frame indel mutation, thereby causing skipping of the out-of-frame exon.

2. The therapeutic oligonucleotide for use of claim 1, wherein the gene with the missense, nonsense or in-frame indel mutation has a functional or sequence paralog in the genome of the subject, wherein the skipping of the out-of-frame exon triggers the upregulation of the expression of the functional or sequence paralog, wherein the gene with the missense, nonsense or in-frame indel mutation and its functional paralog preferably encode functionally redundant proteins.

3. The therapeutic oligonucleotide for use of claim 1 or 2, wherein the gene with the missense, nonsense or in-frame indel mutation is DMD, LMNA, FBN1, CFTR, RHO, MYH7, TP53, LDLR, HFE, FGFR3, HEXA, PAH, FBN2, HNRNPH1, SOD1, SPTLC1, ACTL6B, GJB2, MY07A, TMC1, COL11A2, KCNQ4, SLC26A4 or COCH.

4. The therapeutic oligonucleotide for use of claim 2 or 3, wherein the functional or sequence paralog is UTRN, NEFL FBN2, TMEM16A, NEFL, 0PN1M W / 0PN1 M W2 / 0PN1 M W3 / 0PN1 L W / 0PN1S W / OPN3 / OPN4 / RRH / OPN5, M YH6,TP73 / TP63, LPR8 / VLDLR / LRP1 / LRP1B / LRP4 / LRP2 / EGF / NID1 / NID2 / LRP5 / LRP6 / LRP12 / LRP10 / LRP3, HLA- F / HLA-C / HLA-G / HLA-A / HLA- E / AZGP1 / MR1 / MICB / FCGRT / MICA / CD1A / CD1 C / CD1 D / CD1 B / CD1 E / RAET1 L / ULBP1 / RAET1 G / UL BP2 / ULBP3 / RAET1E,FGFR2 / FGFR1 / FGFR4 / RET / KDR / FL T4 / FL Tl / KIT / FL T3 / PDGFRB / PDGFRA / CSF1 R / ROR2 / TIE2 / TEK / ROS1 / MST1R / ROR1 / EPHA4 / INSR / IGF1R / EPHA2 / ALK / AXL / NTRK2 / EPHA5 / EPHA7 / EPHA8 / MET / E RBB4 / EPHA3 / EPHB3 / TYRO3 / MUSK / EPHB4 / ERBB2 / EPAH1 / NTRK3 / EPHB2 / EGFR / EPHB1 / EPHA6 / MERTK / NRTK1 / EPHA10 / LTK / EPHB6 / INSRR / ERBB3 / DDR2 / DDR1 / LMTK2 / RYK, HEXB,TPH2 / TPH1 / TH, FBN1, HRNPH2, CCS / SOD3, SPTLC2 / SPTLC3 / ALAS1 / GCAT / ALAS2, ACTL6A / ACTB / ACTG1 / ACTC1 / ACTA2 / ACTG2 / ACTA1 / ACTBL2 / ACTR1A / ACTR1B / ACTL7B / ACTR3B / A CTR T2 / A CTR3 / A CTR T1 / ACTL9 / A CTR T3 / A CTR2 / A CTL 7 A / A CTL8 / A CTR8 / A CTR5 / A CTR10 / A CTR6 / ACTL10 / ACTR3C, GJB6 / GJB1 / GJB3 / GJA8 / GJB4 / GJA3 / GJA4 / GJB5 / GJA1 / GJB7 / GJA10 / GJA9 / GJA5 / GJD2 / GJC2 / GJC1 / GJD3 / GJD4 / GJET1, MY07B / MYH6 / MYH7 / MYH8 / MYH4 / MYH1 / MYH2 / MYH3 / MYH7B / MYH9 / MYH13 / MYH10 / MYH 15 / MYO10 / MYH14 / MYO5B / MYO5A / MYO9B / MYO9A / MYO15A / MYO5C / MYO3A / MYO16 / MYO 1 B / MY018A / MY018B / MY01 E / MY01 C / MYO1A / MYO6 / MYO3B / MYO1 D / MY01 F / MY01 G / MYO 1H / MY019 / CCDC158 / CGNL1 / TMF1 / CCDC102B / CCDC102A, TMC2-8,COL5A1 / COL11A1 / COL2A1 / COL1A1 / COL5A3 / COL22A1 / COL5A2 / COL3A1 / COL1A2 / COL27A1 / CO L4A5 / COL24A1 / COL4A3 / COL4A1 / COL4A6 / COL7A1 / COL4A4 / COL16A1 / COL4A2 / COL18A1 / COL9 A1 / COL17A1 / COL15A1 / COL9A3 / COL28A1 / COL9A2 / COL13A1 / COL6A1 / COL25A1 / COL21A1 / COL 6A2 / COL20A1 / COL23A1 / COLQ / EMID1 / COL26A1 / EDA, KCNG1 / KCNS3 / KCNC2 / KCNF1 / KCNA4 / KCNG4 / KCNA2 / KCNA6 / KCNA3 / KCND3 / KCNG3 / KCNA10 / KCNA 7 / KCNA1 / KCNS2 / KCNV2 / KCNS1, SLC26A3 / SLC26A6 / SLC26A5 / SLC26A9 / SLC26A2 / SLC26A1 / SLC26A7 / SLC26A8 / SLC26A1, or VIT / COL12A1 / COL6A3 / COL6A6 / COL14A1 / COL6A5 / MATN1 / MATN4 / MATN2 / VWA2 / MATN3 / V WAI.

5. The therapeutic oligonucleotide for use of any one of claims 1 to 4, wherein the disease is selected from muscular dystrophy (preferably Duchenne muscular dystrophy, caused by mutations in the DMD gene), a laminopathy (caused by mutations in the LMNA gene), Marfan Syndrome (caused by mutations in the FBN1 gene), cystic fibrosis (caused by mutations in the CFTR gene), retinitis pigmentosa (caused by mutations in the RHO gene), hypertrophic cardiomyopathy (caused by mutations in the MYH7 gene), Li-Fraumeni Syndrome (caused by mutations in the TP53 gene), Familial Hypercholesterolemia (caused by mutations in the LDLR gene), Hereditary Hemochromatosis (caused by mutations in the HFE gene), Achondroplasia (caused by mutations in the FGFR3 gene), Tay-Sachs Disease (caused by mutations in the HEXA gene), Phenylketonuria (caused by mutations in the PAH gene), Congenital Contractural Arachnodactyly (caused by mutations in the FBN2 gene), Intellectual disability / developmental delay (caused by mutations in the HNRNPH1 gene), Amyotrophic lateral sclerosis (caused by mutations in SOD1 or SPTLC1), neurodevelopmental deficits and epilepsy (caused by mutations in ACTL6B), and hearing loss genetic diseases (caused by GJB2, MY07A, TMC1, COL11A2, KCNQ4, SLC2A64, or COCH).

6. The therapeutic oligonucleotide for use of any one of claims 1 to 5, wherein the therapeuticoligonucleotide has a length of 12 to 35 nucleotides, preferably 15 to 25 nucleotides and most preferably 15 to 20 oligonucleotides.

7. The therapeutic oligonucleotide for use of any one of claims 1 to 6, wherein the therapeutic oligonucleotide has no more than 3, preferably no more than 2, more preferably 1 or 0 mismatch(es) to the complementary sequence of the gene with the missense, nonsense or inframe indel mutation and is most preferably comprises a fully complementary sequence of the gene with the missense, nonsense or in-frame indel mutation.

8. The therapeutic oligonucleotide for use of any one of claims 1 to 7, wherein the therapeutic oligonucleotide is an antisense oligonucleotide, interfering RNA (siRNA), a short-hairpin RNA (shRNA), or a U7 small nuclear RNA engineered to skip an out-of-frame exon.

9. The therapeutic oligonucleotide for use of any one of claims 1 to 8, wherein the therapeutic oligonucleotide comprises one or more backbone modifications selected from phosphorothioate, mesyl phosphoramidate, phosphoryl guanidine, phosphorodiamidate, one or more sugar modifications selected from 2'-O-methyl (2'-0Me), 2'-O-methoxy-ethyl (2'- MOE), 2' -fluoro (2'-F), 2' -deoxy, 2'-amino, 2' -alkyl, 2'-O-Hexadecyl, 2',4'-constrained 2'-O- methoxyethyl (cMOE BNA), 2',4'-constrained 2'-0-Ethyl (cEt BNA), locked nucleic acid (LNA), tryciclo-DNA (tcDNA) modifications, one or more base modifications selected from 5- methylcytosine (5-meC), 2-thio-deoxythymidine (2-Thio-dT), 2,6-diaminopurine, non-natural base, one or more scaffold modifications selected from phosphorodiamidate morpholino and peptide nucleic acid, one or more conjugates selected from N-acetylgalactosamine (GalNAc), Glucagon-Like Peptide 1 Receptor (GLP1R) agonist, an antibody, or a lipid..

10. The therapeutic oligonucleotide for use of any one of claims 1 to 9, wherein all nucleotides of the therapeutic oligonucleotide are modified with 2'-O-methoxyethylribose and phosporothioate.

11. The therapeutic oligonucleotide for use of any one of claims 1 to 10, wherein the therapeutic oligonucleotide is capable of specifically hybridizing to the 5' -splice site or the 3' -splice site, preferably to the 5' -splice site of an out-of-frame exon.

12. The therapeutic oligonucleotide for use of any one of claims 1 to 10, wherein the therapeutic oligonucleotide(I) has a sequence being selected from SEQ ID NOs 1 to 11 or a sequence being at least 80%, preferably at least 90% identical thereto;(II) has a sequence being selected from SEQ ID NOs 12 to 19 or a sequence being at least 80%, preferably at least 90% identical thereto; or (III) has a sequence being selected from SEQ ID NOs 20 to 25 and SEQ ID NOs 39 to 46 or a sequence being at least 80%, preferably at least 90% identical thereto.

13. The therapeutic oligonucleotide for use of any one of claims 1 to 12, wherein the therapeutic oligonucleotide is formulated as a lipid particle.

14. The therapeutic oligonucleotide for use of claims 1 to 13, wherein the lipid particle comprises ionizable lipids, helper phospholipids, cholesterol, and / or polyethylene glycol-l ipids.

15. The therapeutic oligonucleotide for use of any one of claims 1 to 12, wherein the therapeutic oligonucleotide is used as naked therapeutic oligonucleotide.

Citation Information

Patent Citations

  • Multiple EXON skipping compositions for dmd

    WO2010048586A1

  • Treatment of amyotrophic lateral sclerosis

    WO2016016449A1

  • Compositions and methods for treating duchenne muscular dystrophy and related disorders

    WO2017062835A2

  • Oligonucleotide analogues targeting human lmna

    WO2017190041A1

  • Muscle-targeting complexes and uses thereof

    WO2021142313A1