Simultaneous detection of proteins and nucleic acids using proximity ligation of aptamers and quantitative polymerase chain reaction

Abstract

A method and composition for the simultaneous detection of a protein and a nucleic acid within a single biological sample using proximity ligation of aptamers and quantitative polymerase chain reaction (qPCR) is disclosed. The invention employs two aptamers, each targeting a distinct epitope of the protein of interest, functionalized with primer sites to enable ligation by way of a short DNA linker in the presence of the protein. This ligated construct is then amplified and detected using qPCR. Concurrently, viral RNA is detected in the same reaction using reverse transcription- qPCR (RT-qPCR) with TaqMan probes in a separate fluorescent channel. This dual detection approach is demonstrated with SARS-CoV-2 nucleocapsid protein and RNA and is validated in saliva samples and digital droplet PCR. The invention provides a sensitive, rapid, and specific method for multiplexed molecular diagnostics.

Description

Simultaneous Detection of Proteins and Nucleic Acids Using Proximity Ligation of Aptamers and Quantitative Polymerase Chain ReactionCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of U.S. Provisional Patent Application No. 63 / 662,333 filed June 20, 2024, the disclosure of which is fully incorporated by reference herein in its entirety.BACKGROUND OF THE INVENTION

[0002] Diagnostic tools capable of detecting both protein and nucleic acid biomarkers are essential for comprehensive and reliable disease identification. Current methodologies typically detect proteins via immunoassays such as ELISA (Enzyme-Linked ImmunoSorbent Assay) and nucleic acids via PCR (Polymerase Chain Reaction), requiring separate workflows. Aptamers, nucleic acid-based affinity ligands, offer a stable and reproducible alternative to antibodies. However, integrated systems to concurrently detect proteins and nucleic acids using aptamers with sufficient sensitivity or simplicity are not currently available.SUMMARY OF THE INVENTION

[0003] The global COVID-19 pandemic stressed the need for accurate and sensitive diagnostic tools to detect SARS-CoV-2 infection. While a real-time reversetranscription polymerase chain reaction (RT-qPCR) laboratory test remains the gold standard, antigen testing provides a faster and simpler alternative despite reduced sensitivity. Beyond these methods, aptamers - synthetically derived single stranded DNA or RNA molecules - have emerged as robust alternatives to antibodies for target recognition in viral detection.

[0004] Aptamers favorable biochemical properties, including stability, reproducibility, and ease of modification, make them well-suited for diagnostics. Aptamers are generated through systematic evolution of ligands by exponential enrichment (SELEX), and numerous aptamers have been reported to bind with high specificity to viral proteins, including the SARS-CoV-2 nucleocapsid (N) and spike (S) proteins.

[0005] The present invention utilizes a single-tube assay that integrates proximity ligation of aptamers (PLA) and RT-qPCR for the simultaneous detection of SARS- CoV-2 RNA and N protein. Proximity ligation, a technique traditionally performed using antibodies conjugated with DNA, enables the detection of proteins through target- induced oligonucleotide ligation. In the present invention, aptamers ECK1 and ECK4 serve as recognition elements for N protein and are configured to enable ligation when bound in proximity to the same target. The ligation product is amplified using Cy5- labeled probes, while RNA detection is simultaneously conducted using a separate primer / probe set in the FAM channel.

[0006] The invention is directed toward a method for the simultaneous detection of both proteins and nucleic acids using an aptamer-based proximity ligation assay (PLA) integrated with qPCR. The system uses two selected aptamers (e.g., ECK1 and ECK4) that bind non-overlapping epitopes of a target protein (e.g., SARS-CoV-2 nucleocapsid). One aptamer includes a 5’ phosphate and forward primer site, and the other includes a reverse primer site. In the presence of the target protein, the aptamers are brought into proximity, allowing a DNA linker to facilitate ligation via T4 DNA ligase.

[0007] The ligated construct is subsequently amplified using a primer-probe set specific to the junction site, yielding a signal in the Cy5 channel. Simultaneously, a second primer-probe set detects target RNA via TaqMan-based RT-qPCR in the FAM channel. This duplex reaction enables dual biomarker detection within a single vial.

[0008] The method is validated using recombinant protein and synthetic RNA titrations, showing limits of detection as low as 100 viral particle equivalents. Digital droplet PCR (ddPCR) further enhances sensitivity and quantification capabilities. The aptamers were selected by way of CE-SELEX and characterized using biolayer interferometry. Cross-reactivity was assessed with SARS and MERS proteins, confirming the aptamers’ versatility.

[0009] In the present invention, aptamers were developed targeting the nucleocapsid (N) protein of SARS-CoV-2 and applying them in a new test calledproximity ligation aptamer-mediated RT-qPCR (PLA / RT-qPCR) for simultaneous detection of N protein and viral RNA.

[0010] The present invention enables simultaneous detection of proteins and nucleic acids from a single sample by leveraging aptamer-based proximity ligation combined with quantitative PCR (qPCR). Two aptamers specific to the target protein are engineered with complementary primer sequences. In the presence of the protein, a DNA linker hybridizes with both aptamers, enabling ligation. The ligated product is detected using qPCR, while the target nucleic acid is concurrently detected using standard RT-qPCR in a separate channel. This method allows for high-sensitivity detection of both biomarkers in clinical samples, including saliva.

[0011] Capillary electrophoresis was used to select six high-affinity aptamers to the N protein. Two aptamers, ECK1 and ECK4, were selected based on their superior performance in a proximity ligation assay (PLA). These aptamers were adapted into a PLA assay using one aptamer with a forward primer and the other with a reverse primer, enabling ligation and subsequent detection by real-time PCR. Concurrently, viral RNA was detected via RT-qPCR with a Taqman probe in the same tube in a different color channel. The PLA / RT-qPCR performance was validated in spiked saliva, demonstrating feasibility in complex matrices.

[0012] Finally, aptamer epitopes were mapped to the N protein using pulldown proteomics after trypsin digestion, providing insights into their binding sites. A new aptamer-based PLA / RT-qPCR diagnostic method was developed for sensitive dual detection of SARS-CoV-2 protein and RNA in a single test.BRIEF DESCRIPTION OF DRAWINGS

[0013] FIG. 1 is a schematic of the dual detection mechanism combining proximity ligation and RT-qPCR.

[0014] FIG. 1A is a schematic representation of CE-SELEX of DNA aptamers to a protein target.

[0015] FIG. 2 is illustrates biolayer interferometry binding validation of aptamers.

[0016] FIG. 3 depicts amplification curves for dual-channel detection of RNA and protein.

[0017] FIG. 4 depicts the optimization of aptamer pair selection and ligation conditions.

[0018] Fig. 5 shows sensitivity curves from titration experiments.

[0019] FIG. 6 illustrates the validation in saliva and cross-reactivity with other coronaviruses.

[0020] FIG. 7 depicts digital droplet PCR results showing low copy number detection.

[0021] FIG. 8 shows epitope mapping using DEPC labeling and aptamer docking models.

[0022] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the U.S. Patent and Trademark Office upon request and payment of the necessary fee.DETAILED DESCRIPTION OF THE INVENTION

[0023] As noted above, an urgent need arose for accurate and sensitive diagnostic tools for detecting the presence of the SARS-CoV-2 virus after the outbreak of the Coronavirus disease (COVID-19). Effective detection methods were needed to timely identify infected individuals to enable appropriate containment measures and treatment interventions. The detection of SARS-CoV-2, the causative agent of COVID-19, is critical for diagnosis and disease surveillance. Real time reverse transcription polymerase chain reaction (RT-qPCR) detection of viral RNA remains the gold standard for SARS-CoV-2 diagnosis as it is highly sensitive and can detect low viral loads, making it well-suited for diagnosis in the early stages of infection.

[0024] Rapid antigen tests offer simpler, faster, and cheaper options for SARS-CoV-2 detection, though they are generally less sensitive than RT-qPCR. Anti g e n tests detect SARS-CoV-2 nucleocapsid protein and can provide results in under an hour; however, they have reduced sensitivity compared to RT-qPCR, especially when viral loads are lower. Beyond RT-PCR and antigen testing, other molecular methods such as CRISPR and next-generation sequencing show promise for SARS-CoV-2 detection and variant characterization. Serologicalantibody tests are also important for understanding population exposure and immune response. Traditional protein detection approaches primarily rely on antibodies, which have certain limitations, such as batch-to-batch variability and the need for specific handling and storage conditions.

[0025] In recent years, aptamers have emerged as promising alternatives to antibodies for the detection and treatment of viral infections. Aptamers are singlestranded oligonucleotides with the unique ability to bind specifically to target molecules, including viral proteins. Their high affinity and specificity, combined with their ease of synthesis and modification, make aptamers an attractive option for diagnostic applications. Aptamers are generated through a systematic evolution of ligands by exponential enrichment (SELEX), an iterative process of generation of high affinity aptamers from a large pool of randomized DNA.

[0026] The ongoing research of SARS-CoV-2 aptamers has contributed significantly to the development of innovative diagnostic strategies. The exploration of aptamers targeting various SARS-CoV-2 proteins, mostly Spike (S) protein and Nucleocapsid (N) protein, and other viral components, has paved the way for the development of sensitive and reliable diagnostic tools. S protein carries therapeutic potential as it is the protein involved in human ACE-2 recognition and a cell’s first infection. That research focused on aptamers against receptor binding domain (RBD) of S protein.

[0027] Nucleocapsid is another common target due to its high evolutionary conservation and abundancy, making it a great candidate for detection applications. Aptamers have been developed to N protein, with some involved in applications in biosensors. Among the various viral proteins, the N protein plays a pivotal role in virus replication, assembly, packaging, and RNA transcription. Notably, this protein exhibits a lower propensity for mutations compared to other essential SARS-CoV-2 proteins, making it a reliable target for detection.

[0028] The present invention is directed to the discovery of aptamers against N protein and the use of them for the detection of the N protein through proximity ligation assay (PLA) followed by real-time PCR. PLA is a molecular technique employed to assess interactions between proteins or nucleic acids in proximity. PLAhas been widely employed through antibody-DNA conjugates, where two different antibodies recognize the target and bring their conjugated oligonucleotides together, allowing for ligation to happen. The use of aptamers as primary ligands is much rarer than the use of antibodies. However, several studies have demonstrated their feasibility.

[0029] The present invention utilizes a single-tube assay that integrates proximity ligation of aptamers (PLA) and RT-qPCR for the simultaneous detection of SARS- CoV-2 and viral RNA through TaqMan probe mediated RT-qPCR, as well as detection of N protein by PLA involving two aptamers that were selected as schematically illustrated in Fig 1. Detection of both protein and RNA in one PCR reaction can provide more confidence in virus detection than RNA alone. As shown in Fig. 1A, capillary electrophoresis (CE)-SELEX was employed as a platform for aptamer selection and the estimation of their epitopes. Six aptamers that interact with N protein with a high affinity were discovered.

[0030] Two of those aptamers, ECK1 and ECK4 were used to develop the method of the invention using a PLA approach. ECK1 and ECK4 aptamers, with a singular primer site each are used to achieve N protein detection through ligation of the two aptamers together using a linker sequence. Subsequently, a Cy5 TaqMan probe RT-qPCR is used to detect the ligation site. At the same time, RNA is detected with RT-qPCR in the FAM channel, enabling simultaneous detection of both the viral protein and RNA in a single RT-qPCR assay. The invention allows for a new approach to detection of both viral protein and RNA in a single vial simultaneously, opening new avenues for diagnostics and its applications.

[0031] A PLA / RT-qPCR method was further validated using saliva spiked with N protein. Saliva was chosen as a complex matrix that is generally collected for SARS- CoV-2 detection during RT-PCR testing. Without any cleanup steps, it was possible to distinguish saliva negative for N protein from the positive one using the method disclosed, proving robustness outside of simple buffer systems.

[0032] The binding epitope of the aptamers on the N protein was also determined by performing trypsin digestion of the N protein in the presence of the aptamer followed by pulldown experiment. By utilizing bottom-up proteomics approach,peptides that were enriched in the pulldown fraction were identified. This approach enabled determination of the epitope of the N protein recognized by the aptamer. A hypothetical molecular docking in silico was then constructed from the information collected.Materials and Methods Used

[0033] PROTEIN EXPRESSION. DH5a strain with a plasmid encoding for N protein was received from Rick Tarleton (Addgene, Watertown, MA). An LB agar plate containing 100 11g / mL kanamycin (Sigma-Aldrich, St. Louis, MO) was inoculated with the culture and incubated at 37°C for 24 hours. A single colony was picked and inoculated into 5 mL LB with 100 11g / mL kanamycin, which was incubated at 300 rpm and 37°C overnight. The plasmid was extracted using a miniprep kit (Qiagen, Germantown, MD), and 10 ng of the plasmid was used to transform into competent DE3 cells (Thermo Fisher Scientific, Waltham, MA) according to the manufacturer's protocol. The transformed competent cells were cultured in the same conditions as DH5a and were frozen in 50% glycerol / LB.

[0034] The frozen cells were used to inoculate 500 mL LB with 100 11g / mL kanamycin. The culture was incubated at 37°C on a magnetic stir plate at 300 rpm until an OD600 reached 1. The culture was then supplied with 1 mM IPTG (Sigma-Aldrich, St. Louis, MO) and further incubated for 3 hours. Cells were spun down at 4,000 g for 30 minutes and resuspended in T300 buffer (30mM triethanolamine, 300 mM NaCI, pH 7.8). Aliquots of 1 mg / mL of lysozyme and 1 mM PMSF (Sigma-Aldrich, St. Louis, MO) were added before sonication for 30 minutes on ice. The lysate was centrifugated at 21 ,000 g for 40 minutes, and pellets were resuspended in T300 with 8M urea (Sigma-Aldrich, St. Louis, MO). The solubilized pellets were then filtered through a 0.45pm nylon membrane.

[0035] A C 10 / 10 chromatography column (Cytiva, Marlborough, MA) was packed with 7.85 mL of Ni-NTA agarose beads (Thermo Fisher Scientific, Waltham, MA). Packed media was equilibrated with T300 buffer containing 8M urea for 4 column volumes. 10 mL of the solubilized sample was injected into the column, which wasthen washed 4 more column volumes of the same buffer containing urea. The buffer was slowly replaced with T300 by applying gradient for 8 column volumes to gradually remove urea and refold protein on the column. The column was then washed with T300 with 30 mM imidazole for 4 column volumes. The protein was then eluted with 4 column volumes of elution buffer (T300 and 300mM imidazole) and concentrated on a 10 kDa filter (Sigma-Aldrich, St. Louis, MO). All chromatography steps were performed using a flow rate of 3 mL / min.

[0036] Gel filtration chromatography was performed using a XK 16 / 70 column (Cytiva, Marlborough, MA) packed with 140 mL of Sephacryl S-100 HR resin (Cytiva, Marlborough, MA). The column was washed with 2 volumes of 150 mM ammonium acetate, pH~7.0. 1 mL of concentrated sample was injected and separated at a flow rate of 0.5 mL / min. A280 was monitored during the run to collect fractions of N protein. The collected protein was then concentrated on a 10 kDa filter to a final volume of 1 mL and stored at -20 °C until further use. The protein concentration was then determined using a nanodrop spectrophotometer. 2 μL of protein mixture was loaded onto a pedestal, and an A280 reading was taken. With a calculated extinction coefficient (43.9 x 103M’1cm’1), the concentration was calculated and the protein was aliquoted for further use.

[0037] Following protein expression, the purity of the protein was assessed through a direct infusion into Synapt G2 mass spectrometer (MS). The protein was diluted to 0.5 pg / mL in 50% acetonitrile with 0.1 % formic acid and was infused at 1 μL / min. The capillary voltage was set to 3.3 kV, and the cone voltage was set to 60V. Drying nitrogen gas was delivered at 10 L / h. The range of 300-3000 m / z was recorded at 1 Hz scan rate for 30 seconds to obtain the spectrum. Deconvolution was performed with UniDec software. The mass range was set to 500-1600 m / z, and the charge range was set to 10-80. Potential size range was set to 5-200 kDa.

[0038] CE-SELEX. All of the sequences studied are listed in Table 1 . The N40 DNA library (CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAG AAGCC) with 5’ Cy5 fluorescent tag was synthesized by IDT DNA Technology (Iowa, USA). It was diluted to a concentration of 5 pM in 20 mM ammonium acetate (pH = 7.0). The library was then heated to 95 °C for 2 minutes and slowly cooled down to 4 °C for 5minutes. 1 pM of N protein was added and the mixture was incubated at room temperature for 30 minutes.

[0039] A new CE capillary (60 cm, 360 pm O.D., 75 pm I.D.) was first washed with 1 M NaOH for 30 minutes at 20 psi, and then prefilled with separation buffer (20 mM ammonium acetate, pH = 9.2) for 5 min at 20 psi. A prepared library-protein mixture was injected at 0.5 psi for 10 seconds, sandwiched between 2 plugs of water injected with the same parameters. Separation was carried out at 20 °C with 500 V / cm electric field for 15 minutes. Collection was performed in 50 μL of separation buffer placed in a sample vial. The collected vial was then dried under vacuum, producing a dry DNA pellet.

[0040] EMULSION PCR AND ssDNA GENERATION. Emulsion PCR was used for all amplifications. An oil-surfactant mix was prepared by adding 4.5% (v / v) Span- 80, 0.4% (v / v) Tween 80, 0.05% (v / v) Triton X-100, and topping the mixture to 50 mL with mineral oil. Q5 high fidelity PCR master mix was prepared according to the manufacturer’s protocol. 200 pM of dNTPs were added, as well as 500 nM of forward and reverse primers each, 0.02 U / μL of Q5 polymerase and 10 pg / μL of BSA. 150 μL of the master mix was added to previously dried pellet of collected DNA and mixed well. 300 μL of the oil-surfactant mix was aliquoted into 1 .5 mL glass autosampler vial with a magnetic stir bar, and placed on a stir plate at 1000 rpm. 150 μL of master mix was added dropwise to a rotating oil-surfactant mix over the course of 2 minutes, emulsifying the mix. The master mix emulsion was then added to 8 x PCR tube strips, 50 μL in each. PCR was performed in an Eppendorf thermocycler. The PCR mix was first heated to 98 °C for 30 seconds for polymerase activation. 40 cycles of PCR were performed: 98 °C denaturation for 5 seconds, 56 °C annealing for 10 seconds and 72 °C elongation for 10 seconds. Final extension was done for 1 min at 72 °C prior to cooling samples down to 4 °C. The emulsion mix was then combined and spun down for 15 min at 20,000 g. Supernatant (mineral oil) was aspirated, and the pellet was extracted with 500 μL of diethyl ether twice to remove the surfactants.

[0041] The samples were subjected to electrophoresis on a 1 .2% agarose gel for a duration of 30 minutes at 12 V / cm in TBE buffer (100 mM Tris, 100 mM boric acidand 2 mM EDTA). Prior to gel electrophoresis, the samples were stained with 1X SYBR gold (Invitrogen, Cat No. 41003). The resulting gel was viewed under UV light and the 100 bp band was excised and extracted using Monarch DNA Gel Extraction Kit (NEB #T 1020). 3 mL of gel dissolving buffer was added to 1 mL of excised agarose and heated to 50 °C for 30 minutes. The mix was then passed through a silica column for 1 min at 10,000 g and washed twice with 100 μL of wash buffer. DNA was then eluted with 10 μL of deionized water and quantified on Nanodrop One.

[0042] A new master mix for asymmetric non-emulsion PCR was then prepared to generate an ssDNA pool for the next round of SELEX. 200 pM of dNTPs, 400 nM of forward primer, 20 nM of reverse primer, and 0.02 U / μL of Q5 polymerase were added along with 1-10 ng of template previously prepared. 25 cycles of PCR were performed with the same cycling parameters described above regarding emulsion PCR. The resulting product was then subjected to gel electrophoresis and extraction from gel using the same procedure outlined above. Cleaned up product was stored at - 80°C until further use for the next round of SELEX.

[0043] PREPARATION FOR ILLUMNA SEQUENCING. Three pools as well as the library itself were amplified using the emulsion PCR protocol outlined above. The primers were modified to include adapters, where the forward primer was 5’ACACT CTTTCCCTACACGACGCTCTTCCGATCTTTCTCCTCTGACTGTAACCACG3’ and the reverse primer was 5’GACTGGAGTTCAGACGTGTGCTCTTCCGATCTTTT GGCTTCTGGACTACCTATGC3’. The amplification products were separated on a 1.2% agarose gel in TBE buffer and 150 bp band was excised and extracted using the gel extraction kit identified above. 10 ng of dry DNA for each of the pools was shipped for sequencing.

[0044] SELECTION OF CLONES FROM SEQUENCING RESULTS. FASTQ files were first converted to FASTA using fastaptamer_count function of a FASTAptamer software package. The sequences with lengths between 78 and 82 were selected, and the rest were omitted because the 80 nts band was excised during every stage of selection and amplification prior to sequencing. Sequences not containing both primer binding sites were also removed from the analysis. Then,the sequences with primer repetitions in the variable region were removed, leaving only the sequences with true random variable region. Those sequences were then enriched according to the pool progression using fastaptamer_enrich function of FASTAptamer software package. Sequences present in both pools were sorted by their rank in pool 2, and top sequences were selected and synthesized for further analyses. Among these sequences, the 6 most abundant in the pool corresponding to round 2 of SELEX were selected. Round 3 was chosen as the primary pool for sequence selection because round 4 did not bring improvement to the binding of the pool. Round 3 was chosen because of a concern that an extra round of PCR would introduce more by-products.

[0045] BIOLAYER INTERFEROMETRY ANALYSIS. For evaluating the binding strength between the aptamer pools or full-length clones and N protein, Ni-NTA biosensors and the Octet N1 BLI instrument were employed. Initially, DNA-enriched pools or full-length aptamers were prepared in PBS, pH 7.4, 1 mM MgCL, 1 mM CaCL, 0.02% Tween 20 and 0.2% BSA. The Ni-NTA biosensor tips were loaded with his-tagged N protein, and the binding assay was initiated by establishing a baseline in the binding buffer. Subsequently, the association between the DNA and N protein on the biosensors was monitored. The association step involved four different samples: N40 library, round 1 , round 2, and round 3. The assay was performed at room temperature, with a 30-second baseline, 120-second loading, 100-second association, and 150-second dissociation periods.

[0046] For validation of the truncated clones, 400 nM biotinylated clones were prepared in PBS, pH 7.4, 1 mM MgCL, 1 mM CaCL, 0.02% Tween 20 and 0.2% BSA. Octet Streptavidin sensor was first hydrated in the same buffer for 10 minutes, and then incubated with the clone for 60 seconds, after which it was immersed in the buffer again. For the interaction kinetics experiment, the baseline was first established in the buffer for 30 seconds, after which the association was monitored in varying concentrations of N protein (0-125 nM) in the same buffer for 180 seconds. Dissociation was performed in the buffer for 60 seconds, followed by 30 seconds of regeneration of the sensor surface in 10 mM Glycine-HCI (pH = 2.0). Four concentrations of protein as well as a blank were monitored, each repeated 3times. For the competitive displacement experiment, 125 nM N protein was loaded onto the sensor for 180 seconds, followed by baseline establishment in the buffer for 60 seconds. Competitive binding was then monitored by association or dissociation in presence of 100 nM of the aptamer clone.

[0047] PROXIMITY LIGATION OF APTAMERS. The Hamilton Microlab Star liquid handling system was used to prepare and mix all solutions. Stock solutions of aptamer pairs were prepared at the concentrations of 10 nM in ddH2O in the presence of 0.001 % PEG8000 to prevent tube wall interactions. Reaction solutions were prepared in 25 mM ammonium acetate (pH = 9.2) and 0.001 % PEG8000 with 10 nM of N protein or BSA for control samples, and 1 nM of each of the aptamer. Incubation was performed at room temperature for 1 hour, after which the ligation master mix was added according to manufacturer’s recommendations (NEB T4 ligase), as well as 3 nM linker. Ligation was performed for 5 minutes at 37 °C, followed by heat deactivation at 65 °C for 20 minutes. Reaction mixture was then diluted 5-fold with ddH2O and used directly for rPCR experiment.

[0048] During concentration titrations, all of the above conditions were kept the same except the concentration of N protein, which ranged between equivalency of 102,400 and 100 viral particles. For ligation time optimization, all the above conditions were kept the same, and the concentration of N or BSA proteins were equivalent to 51 ,200 viral particles.

[0049] REAL-TIME RT-PCR. RT-qPCR was performed using Promega GoTaq 1- step RT-PCR master mix. The master mix was prepared according to the manufacturer’s protocol in the presence of 500 nM concentration of each primer and 125 nM of each probe. Two sets of primers / probe were added, one for ligation product detection, and another for RNA detection. 1 μL of ligation reaction product as well as 3000 cp / μL RNA template (EURM019, Sigma) were added per 10 μL of reaction mixture. Two channels, FAM and Cy5, were monitored during PCR amplification. Samples were first held at 40 °C for 10 min to reverse transcribe RNA into cDNA, followed by 50 cycles of 95 °C hold for 3 sec and 50 °C annealing / extension for 45 seconds. Readings were taken at the end of each cycle and used to construct amplification curves shown in Fig. 3.Results

[0050] IDENTIFICATION AND VALIDATION OF HIGH-AFFINITY APTAMERS. CE-SELEX was employed to isolate six DNA aptamers with high affinity for the SARS- CoV-2 N protein. The N40 library underwent three rounds of selection. In addition to monitoring pool affinity via CE. BLI was performed as an orthogonal method to confirm the enhanced affinity of the pools compared to the initial library. A Ni-NTA sensor with immobilized 6xHis-tagged N protein to assess the binding affinity of the DNA pools was utilized. The first pool demonstrated lower affinity than the starting library; however, all subsequent pools showed improved binding, corroborating the CE data as shown in Fig. 2A.

[0051] As shown in Table 2, six clones selected from sequencing analysis were tested using BLI. Random scrambled 80-nt sequences served as a negative control, while the previously published tNSP3 aptamer was utilized as a positive control. Scrambled DNA exhibited very low affinity compared to all six aptamers and the tNSP3 positive control. Like the pools, Ni-NTA sensors with immobilized N protein were employed. As shown in Fig. 2, the affinity curves confirmed that the full- length aptamers bind more effectively than the scrambled DNA or the library.

[0052] To reduce the length and cost of the aptamers, the aptamers were truncated by removing the forward and reverse primer binding sites, resulting in 40-nt sequences as shown in Table 3. The sequences were synthesized in biotinylated forms for binding validation. Streptavidin Octet BLI sensors were used to immobilize the DNA aptamers via the biotin label. Various concentrations of the N protein were used to monitor the binding kinetics of each aptamer. Fig. 2B illustrates four different concentrations of N protein, along with a blank for each aptamer. All six aptamers showed adequate binding, with KD values ranging from 4.8 nM for ECK1 to 11.9 nM for ECK6. A positive control aptamer, tNSP3, was used which demonstrated comparable binding affinity to the best clones. All binding curves were conducted in triplicates, with kinetic values displayed in Table 2.

[0053] SIMULTANEOUS DETECTION OF N PROTEIN AND RNA. A synthetic RNA standard with the N1 sequence from the CDC’s standard operating procedures was employed for our RT-qPCR. Two sets of primers and probes were used: one for the N1 region of the RNA with a FAM fluorophore and anotherfor the ligated region between two aptamers, tagged with a Cy5 fluorophore. Itwasan aim to replicate the natural ratio of N protein to RNA observed in real virus particles by adding 1000 copies of N protein per single RNA copy, which was deemed equivalent to one “viral particle.” As shown in Fig. 3, amplification indicated that both RNA and N protein detection are possible in one vial. Regardless of RNA presence, both positive and negative ligation products were able to amplify with different Ct values. In positive ligation samples, for 102,400 viral particle equivalents, the Ct values ranged from 24 to 26, while in negative ligation samples, the Ct values were between 32 and 33.

[0054] A linear response was achieved in the range of 100 to 102,400 particles, with the limit of quantitation (LOQ) being roughly 100 particles, at which RNA detection became indistinguishable from blank. While dual detection in one vial is feasible at higher concentrations (51 ,600 to 102,400 particles), at the lower range of the curve, detection of RNA was suppressed by the amplification curve of the ligated product. It is believed that this effect occurs because the PLA product outcompetes RNA, as this reaction is duplex PCR.

[0055] OPTIMIZATION OF PLA. Tests were performed with multiple aptamer pairs between ECK1-6 and ECK1 and ECK4 were chosen because, as shown in Fig. 4A, they showed the greatest Ct difference in the presence of the N protein compared to its absence. It is believed that other aptamer pairs face steric hindrance and are unable to interact with one molecule of the N protein simultaneously, possibly due to sharing the same or similar epitope on the protein. It is noteworthy that the ECK2 and ECK4 pair also exhibited a positive result; however, the Ct difference between the sample and control is lower than that of the ECK1 and ECK4 pair. Other pairs either showed no Ct difference or had a higher Ct for samples with the N protein present. It is possible that for these aptamers, the ligation site is not well exposed, and in the presence of the protein, the ligation efficiency decreases instead of the expected increase.

[0056] Multiple ligation reactions under identical conditions were performed, varying the reaction time. It was determined that prolonged ligation time exhibited almost no effect on the sample containing N protein as shown in Fig. 4B. The Ct values between 5 minutes of ligation and 3 hours of ligation ranged from 24 to 26 cycles; however, ligation time was significant for the BSA controls. The shortest ligation time for BSA resulted in the greatest difference in Ct between N and BSA, while extended ligation caused both BSA and N to have similar Ct values.

[0057] SEPARATE VIAL DETECTION OF N AND RNA. At viral particle (VP) equivalents below 51 , 600, the RNA signal was completely lost, suggesting that in the duplex RT-qPCR reaction, one target template (RNA or N protein-derived amplicons) was preferentially amplified, leading to competitive inhibition and suppression of the weaker signal. While simultaneous detection of both targets was achievable at higher VP concentrations, it became challenging at lower concentrations, particularly in the range of 100-200 VP equivalents. Given this competitive interference, it was decided to split the sample into two equal aliquots: one dedicated to PLA / RT-qPCR detection of the nucleocapsid (N) protein, and the other for RNA detection by RT-qPCR. This strategy mitigated competition between the two targets and allowed the achievement of enhanced sensitivity and lower limits of detection for each analyte independently.

[0058] To determine the minimum detectable concentration of viral particles using the method of this invention, a series of experiments was conducted involving a dilution series of N protein and RNA inputs. As shown in Fig. 5, higher concentrations of N protein resulted in progressively lower Ct values in the qPCR readout, indicating improved ligation efficiency and a greater abundance of amplification templates. In the lower concentration range, N protein was successfully detected by PLA at inputs as low as 100 VP equivalents and RNA at 200 VP equivalents. These findings highlight the enhanced sensitivity achieved by analyzing protein and RNA targets separately, enabling the detection of low viral particle loads that would otherwise remain undetected in a duplex reaction format.

[0059] DETECTION OF N PROTEIN IN SALIVA AND CROSS-REACTIVITY OF ECK APTAMERS. While detecting the N protein using PLA performed wellin the buffer system used, its effectiveness could be diminished in complex biological matrices, which are typically the targets for detection. Since SARS-CoV-2 detection is usually conducted using a patient’s saliva, saliva was selected as our appropriate biological matrix for spiking with the N protein. Fig. 6A shows the successful detection of 100 viral particle equivalents in saliva with only one centrifugation cleaning step, indicating that the method of this invention is robust in the complex protein matrix of human saliva. The Ct difference between positive and negative saliva samples remained approximately 5 cycles, indicating that the saliva matrix does not interfere with the method of this invention.

[0060] To evaluate the cross-reactivity of the selected aptamers, the same PLA was conducted using recombinant nucleocapsid (N) proteins from SARS-CoV-2, SARS, and ME RS to determine whether the aptamers originally selected against the SARS-CoV-2 N protein could also detect N proteins from other closely related coronaviruses. The results indicated that both aptamers could detect all three viral N proteins, with the highest detection efficiency observed for SARS, followed by SARS- CoV-2, and the lowest detection for MERS. This pattern, as shown in Fig. 6B, aligns with the sequence conservation of the aptamer binding sites across the viral species. Specifically, ECK1 binds to a region that is conserved among SARS-CoV-2, SARS, and MERS, facilitating cross-reactivity. ECK4 binds to a sequence that is highly conserved between SARS-CoV-2 and SARS but less conserved in MERS, which accounts for the reduced detection efficiency for MERS.

[0061] SIMULTANEOUS DETECTION OF LOW COPY NUMBERS OF N AND RNA USING ddPCR. To enhance the sensitivity of the PLA / RT-qPCR assay, droplet digital PCR (ddPCR) was incorporated to simultaneously detect both SARS-CoV-2 RNA and nucleocapsid protein in a single vial as shown in Fig. 7. Unlike conventional RT-qPCR, which struggles to detect both targets at low concentrations due to competition between the RNA and PLA templates, ddPCR alleviates this issue by partitioning the sample into a large number of oil droplets. This separation significantly reduces competition and allows for more accurate quantification of both RNA and protein, even at low concentrations. The ddPCR- based approach demonstrated comparable sensitivity but enabled the detection ofboth viral RNA and N protein with minimal interference, thus improving diagnostic accuracy.

[0062] BINDING EPITOPE. As shown in Fig. 8A, DEPC labeling in the presence and absence of aptamers revealed two differentially present peptides, each with one DEPC label. The presence of the ECK4 aptamer during the labeling event significantly reduced the presence of the ADE-TQALPQR peptide with one DEPC label, while the ECK1 aptamer reduced the presence of the RTATKAYNVTQAFGR peptide, also with one DEPC label. Surprisingly, ECK4 also decreased the quantity of RTATKAYNVTQAFGR. However, the statistical significance was more pronounced with ECK1 compared to ECK4, which it is believed partially shields the epitope of ECK1 due to their proximity. The 3D structures of the aptamers and the molecular docking analysis were obtained, showing the complex structure of Figs. 8C, D and E.

[0063] This invention includes the discovery of at least two DNA aptamers binding simultaneously to different peptide epitopes of N protein to be used in a new method for SARS-CoV-2 detection using aptamers. These aptamers were brought into proximity in a solution and a ligation event was enabled between these two aptamers to produce a single long DNA molecule. PCR amplification and real-time detection of this ligated DNA molecule indicates the presence of N protein in solution as opposed to the absence of protein, where ligation would occur at lower efficiency. By employing PLA / RT-qPCR, viral protein can be indirectly detected by detecting ligated DNA. This is a new method of detection of SARS-CoV-2, where the PLA product is amplified alongside of viral genome in 2 separate channels, allowing detection of both nucleoprotein and RNA simultaneously.

[0064] In developing this invention, quantification in saliva was important since saliva is the matrix routinely collected in the clinical setting for SARS-CoV-2 detection. Since saliva is a complicated matrix, introduction of RNAse inhibitors was mandatory due to abundance of RNAses. In the absence of inhibitors, the RNA signal is lost completely, however, the PLA signal is unaffected. As part of the present invention, detection of both protein and RNA in one reaction provides higher confidence of diagnosis as RNA detection alone is prone to false positive results.The amplification of both products, however, results in an increase in detection confidence.

[0065] While the present invention has been described with reference to what are presently considered to be the preferred examples of the aptamers developed and method of detection involved, it is to be understood that the invention is not limited to the disclosed embodiments, Instead, the invention is intended to cover various modifications and equivalent arrangements included within the scope of the appended claims.

Claims

What is claimed is:1 . A method for simultaneous detection of a protein and a nucleic acid in a biological sample comprising: a) incubating the sample with a first aptamer comprising a forward primer site and a 5’ phosphate and a second aptamer comprising a reverse primer site, both specific to the protein; b) adding a linker oligonucleotide and a DNA ligase to ligate the aptamers in the presence of the protein; c) adding primers and fluorescent probes for both the ligated product and the nucleic acid target; and d) performing quantitative RT-PCR to detect both the ligation product and the nucleic acid target.

2. The method of claim 1 , wherein the protein is SARS-CoV-2 nucleocapsid protein and the nucleic acid is SARS-CoV-2 RNA.

3. The method of claim 1 , wherein the linker oligonucleotide comprises sequences complementary to the 3’ end of the first aptamer and the 5’ end of the second aptamer.

4. The method of claim 1 , wherein detection is performed using dual-channel fluorescence in a single reaction vessel.

5. The method of claim 1 , wherein detection is performed using droplet digital PCR.

6. A diagnostic kit comprising: a) a first and second aptamer for proximity ligation; b) a linker oligonucleotide; c) DNA ligase; d) primers and fluorescent probes for detecting both protein and nucleic acid targets; and e) instructions for use in a multiplexed PCR reaction.

Images