Composition for inhibiting multidrug resistance, containing AMF as active ingredient

Abstract

The present invention relates to a composition for inhibiting multidrug resistance, the composition containing an autocrine motility factor (AMF) as an active ingredient. Specifically, treating cancer cells with an AMF protein or an AMF peptide inhibits the mRNA and protein expression of P-glycoprotein or multidrug resistance related protein-1 (MRP-1), which are major causes of multidrug resistance, and administering the AMF protein or AMF peptide in combination with an anticancer agent inhibits the release of the anticancer agent from cells, thus having the effect of increasing the accumulation of the anticancer agent inside cancer cells. Therefore, the composition can be effectively used as a pharmaceutical composition for inhibiting multidrug resistance to an anticancer agent or as an anticancer adjuvant for multidrug-resistant cancer.

Description

Composition for suppressing multidrug resistance containing AMF as an active ingredient

[0001] The present invention relates to a composition for suppressing multidrug resistance containing AMF as an active ingredient.

[0002]

[0003] This work was supported by the Ministry of Education's Creative Challenge Research Foundation Support Project (Project Number: RS-2022-NR074858).

[0004] Although various treatment methods such as surgical therapy, radiation therapy, and chemotherapy are being studied to treat cancer, a complete cure for cancer has not yet been achieved.

[0005] Among these, surgical therapy and radiotherapy are useful methods in the early stages of cancer development, so the dependence on chemotherapy is gradually increasing in cases of cancer that is difficult to detect in the early stages. Chemotherapy has a history of more than 50 years, and hundreds of anticancer drugs have been developed and used clinically to date, but there are still not many cases where satisfactory clinical effects are obtained.

[0006] Multidrug resistance (MDR), a major cause of chemotherapy failure, has recently emerged as a significant problem in the field of cancer treatment. Among the numerous mechanisms reported to contribute to MDR, ATP-binding cassette (ABC) transporters are the most important. P-glycoprotein (P-glycoprotein), a type of ATP-dependent transporter (ABC transporter), functions to transport lipophilic xenobiotics from the cell to the outside. Many lipophilic anticancer drugs serve as substrates for P-glycoprotein, and most fail to exhibit efficacy and are excreted by P-glycoprotein. Overexpression experiments of the ABC transporter P-glycoprotein (P-gp) have demonstrated that P-glycoprotein not only neutralizes the efficacy of a variety of widely used anticancer drugs, including paclitaxel (Taxol), doxorubicin, and vinorelbine, but is also more frequently implicated in multidrug resistance than other ABC transporters. Furthermore, multidrug resistance related protein-1 (MRP-1), another ABC transporter, has also been shown to be closely related to multidrug resistance, similar to P-gp.

[0007] Multidrug resistance is a significant limitation in the use of anticancer agents, and various studies are being conducted to overcome this multidrug resistance. Many P-glycoprotein inhibitors have been developed to date. First-generation drugs include calcium channel blockers (verapamil), calmodulin antagonists, steroids, immunosuppressants (cyclosporine), and antimalarials (quinine), which are drugs that inhibit P-glycoprotein and are already used for other therapeutic purposes. However, these first-generation drugs failed to be used clinically because their inhibition was not sufficiently effective, and their original pharmacological actions appeared as side effects. Second-generation drugs improved upon the shortcomings of the first-generation drugs, but many of them inhibit not only other types of transporters but also enzymes involved in metabolism, which can lead to prolonged increases in blood concentrations of anticancer agents and increase the side effects of co-administered anticancer agents. Third-generation drugs have excellent selectivity for other transporters, highly inhibitory effects on P-glycoprotein, and are not metabolized by CYP450 3A4, so they do not change the pharmacodynamic characteristics of co-administered anticancer drugs, thereby preventing side effects from the anticancer drugs. Despite these characteristics, many third-generation drugs developed to date (Tariquidar, Zosuquidar, VX-710, Laniquidar, ONT-093, etc.), with the exception of several drugs currently in clinical trials, have problems with unexpected side effects due to cytotoxicity caused by the P-glycoprotein inhibitor itself.

[0008] As discussed, numerous P-glycoprotein inhibitors are being developed to overcome multidrug resistance. However, no drug has yet been clinically applicable. Many drug candidates have failed to achieve clinical success due to inherent toxicity or pharmacodynamic interactions. Furthermore, few accurate measurement techniques have been developed to confirm patient improvement due to MDR inhibition. 99m Advanced functional imaging techniques utilizing Tc-sestamibi have enabled the identification of cancer patients responsive to P-glycoprotein modulation. This has highlighted the need for a pool of novel drug candidates with high efficacy and selectivity that can be screened using these imaging techniques.

[0009] Meanwhile, AMF (autocrine motility factor) is a housekeeping protein known to play a role in the interconversion of glucose-6-phosphate and fructose-6-phosphate in the second step of glycolysis related to energy metabolism within cells. Due to this function, it is also called glucose-6-phosphate isomerase (GPI). AMF, a cytokine secreted by tumors, is abundant in tumor sites and plays an important role in tumor proliferation, differentiation, and survival.

[0010] Prior art related to suppressing multidrug resistance includes Korean Patent No. 1360920, which discloses a composition for suppressing multidrug resistance comprising a Poria extract as an active ingredient, and Korean Patent No. 1373107, which discloses a pharmaceutical composition for suppressing multidrug resistance comprising a piperazine derivative or a pharmaceutically acceptable salt thereof as an active ingredient. However, a composition for suppressing multidrug resistance comprising the AMF of the present invention as an active ingredient has not yet been disclosed.

[0011] The present invention was derived from the above-mentioned needs, and provides a composition for suppressing multidrug resistance containing AMF (Autocrine motility factor) as an active ingredient, and more specifically, when AMF protein or AMF peptide is treated to cancer cells, the mRNA and protein expression of P-glycoprotein or MRP-1 (Multidrug resistance related protein-1), which are the main causes of multidrug resistance, is suppressed, and when administered in combination with an anticancer drug, the release of the anticancer drug out of the cell is suppressed, thereby increasing the accumulation of the anticancer drug into the cancer cells, thereby completing the present invention.

[0012] To solve the above problem, the present invention provides a pharmaceutical composition for suppressing multidrug resistance to an anticancer agent containing an AMF (Autocrine motility factor) protein or AMF peptide as an active ingredient.

[0013] In addition, the present invention provides an anticancer adjuvant for multidrug-resistant cancer containing an AMF (Autocrine motility factor) protein or AMF peptide as an active ingredient.

[0014] The present invention relates to a composition for suppressing multidrug resistance containing AMF (Autocrine motility factor) as an active ingredient, and more specifically, when AMF protein or AMF peptide is treated to cancer cells, the mRNA and protein expression of P-glycoprotein or MRP-1 (Multidrug resistance related protein-1), which are major causes of multidrug resistance, are suppressed, and when administered in combination with an anticancer drug, the release of the anticancer drug out of the cell is suppressed, thereby increasing the accumulation of the anticancer drug into the cancer cells.

[0015] Figure 1 shows the results of confirming the inhibitory effect on mRNA expression of P-glycoprotein (Pgp) when the AMF protein (2 μg / ml) of the present invention was treated on liver cancer cells (Hep3B), lung cancer cells (Calu-1), breast cancer cells (MDA-MB-231), and blood cancer cells (CRF-CEM and IM-9). con is a control group not treated with AMF.

[0016] Figure 2 shows the results of confirming the inhibitory effect of P-glycoprotein (Pgp) mRNA expression when the AMF peptides (AMF-Pep1, AMF-Pep2, AMF-Pep3, AMF-Pep4) of the present invention were treated on liver cancer cells (Hep3B). con is a control group not treated with AMF peptide.

[0017] Figure 3 shows the results of confirming the protein expression inhibitory effect of P-glycoprotein (Pgp) when the AMF protein of the present invention was treated on liver cancer cells (Hep3B), lung cancer cells (Calu-1), breast cancer cells (MDA-MB-231), and blood cancer cells (CRF-CEM and IM-9). β-actin is a loading control.

[0018] Figure 4 shows the results of confirming the protein expression inhibitory effect of P-glycoprotein (Pgp) when the AMF peptides (AMF-Pep1, AMF-Pep2, AMF-Pep3, AMF-Pep4) of the present invention were treated on liver cancer cells (Hep3B). β-actin is a loading control.

[0019] Figure 5 shows the results of confirming the protein expression inhibitory effect of MRP-1 (Multidrug resistance related protein-1) when the AMF protein of the present invention was treated to liver cancer cells (Hep3B), lung cancer cells (Calu-1), breast cancer cells (MDA-MB-231), and blood cancer cells (CRF-CEM and IM-9). β-actin is a loading control.

[0020] Figure 6 shows the results of confirming the effect of increasing the accumulation of doxorubicin in cancer cells when doxorubicin was co-treated with the AMF protein of the present invention to liver cancer cells (Hep3B), lung cancer cells (Calu-1), breast cancer cells (MDA-MB-231), and blood cancer cells (CRF-CEM and IM-9), respectively. (a) shows fluorescent doxorubicin in cancer cells after treatment with the AMF protein of the present invention or verapamil as a positive control, and the scale bar is 200 μM. (b) shows an enlarged view of liver cancer cells, and (c) shows the quantification of fluorescent doxorubicin in cancer cells.

[0021] Figure 7 shows the results of confirming the effect of increasing the accumulation of doxorubicin in cancer cells when doxorubicin was co-treated with the AMF peptide of the present invention to blood cancer cells (CCRF-CEM and IM-9). (a) shows fluorescent doxorubicin in cancer cells after treatment with the AMF peptide of the present invention, and the scale bar is 200 μM. (b) shows the quantification of fluorescent doxorubicin in cancer cells.

[0022] Figure 8 shows the results of confirming the effect of increasing the accumulation of calcein-AM in breast cancer cells (MDA-MB-231) when calcein-AM was co-treated with the AMF protein of the present invention. (a) shows fluorescent calcein-AM in cancer cells after treatment with the AMF protein of the present invention or verapamil, a positive control, and (b) shows the quantification of this, and con is the control group treated with calcein-AM alone.

[0023] Figure 9 shows the results of confirming the effect of increasing the accumulation of calcein-AM in cancer cells when calcein-AM was co-treated with the AMF peptide of the present invention to liver cancer cells (Hep3B). (a) shows fluorescent calcein-AM in cancer cells after treatment with the AMF peptide of the present invention or verapamil, a positive control, and (b) shows the quantification of this, and con is the control group treated with calcein-AM alone.

[0024] Figure 10 shows the results of confirming the effect of increasing the accumulation of calcein-AM in cancer cells when calcein-AM was co-treated with the AMF peptide of the present invention to blood cancer cells (CCRF-CEM). (a) shows fluorescent calcein-AM in cancer cells after treatment with the AMF peptide of the present invention or verapamil, a positive control, and (b) shows the quantification of this, and con is the control group treated with calcein-AM alone.

[0025] The present invention provides a pharmaceutical composition for suppressing multidrug resistance to an anticancer agent containing an AMF (Autocrine motility factor) protein or an AMF peptide as an active ingredient.

[0026] In the pharmaceutical composition for suppressing multidrug resistance of the present invention, the scope of AMF according to the present invention includes a protein having an amino acid sequence represented by SEQ ID NO: 1 and a functional equivalent of the protein. The term "functional equivalent" refers to a protein that has at least 70%, preferably 80%, more preferably 90%, and even more preferably 95% sequence homology with the amino acid sequence represented by SEQ ID NO: 1 as a result of addition, substitution, or deletion of amino acids, and exhibits substantially the same physiological activity as the protein represented by SEQ ID NO: 1. In addition, it includes a peptide that exhibits substantially the same physiological activity as AMF. The term "substantially the same physiological activity" refers to an activity for suppressing multidrug resistance against an anticancer agent.

[0027] The above AMF peptide may be, but is not limited to, AMF peptide 1 (AMF-Pep1) consisting of an amino acid sequence of SEQ ID NO: 2, AMF peptide 2 (AMF-Pep2) consisting of an amino acid sequence of SEQ ID NO: 3, AMF peptide 3 (AMF-Pep3) consisting of an amino acid sequence of SEQ ID NO: 4, or AMF peptide 4 (AMF-Pep4) consisting of an amino acid sequence of SEQ ID NO: 5.

[0028] The above AMF protein or AMF peptide preferably suppresses mRNA and protein expression of P-glycoprotein or MRP-1 (Multidrug resistance related protein-1) that induces multidrug resistance, but is not limited thereto.

[0029] The term "P-glycoprotein" as used herein refers to a type of transporter protein present in the cell membrane that has an ATP-binding cassette (ABC). The P-glycoprotein binds to a drug and releases the drug into the cell membrane through an active transport mechanism that uses ATP as an energy source, thereby imparting drug resistance to the cell. In particular, P-glycoprotein expressed in cancer cells is known to increase resistance to anticancer drugs, thereby significantly reducing the efficacy of anticancer treatment. In addition, MRP-1 (Multidrug resistance related protein-1) is also known to increase resistance to anticancer drugs, thereby significantly reducing the efficacy of anticancer treatment.

[0030] The above multidrug resistance inhibition is preferably, but not limited to, multidrug resistance inhibition in any one cancer cell selected from among liver cancer cells, lung cancer cells, breast cancer cells, and blood cancer cells.

[0031] The drug exhibiting the above multidrug resistance is preferably any one drug selected from the group consisting of doxorubicin, calcein-AM, colchicine, epirubicin, topotecan, vinblastine, vinca alkaloids, imatinib, etoposide, and paclitaxel (Taxol), and more preferably calcein-AM and doxorubicin, but is not limited thereto.

[0032] The pharmaceutical composition according to the present invention can be formulated and used in the form of oral formulations such as capsules, powders, granules, tablets, suspensions, emulsions, syrups, aerosols, external preparations, suppositories, and sterile injection solutions, respectively, according to conventional methods.

[0033] The pharmaceutical composition according to the present invention may further comprise a pharmaceutically acceptable carrier, excipient or diluent.

[0034] Carriers, excipients and diluents that may be included in the pharmaceutical composition of the present invention include various compounds or mixtures including lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.

[0035] When formulated, they are usually prepared using diluents or excipients such as fillers, bulking agents, binders, wetting agents, disintegrating agents, and surfactants. Solid preparations for oral administration include tablets, pills, powders, granules, and capsules, and these solid preparations are prepared by mixing the pharmaceutical composition with at least one excipient, such as starch, calcium carbonate, sucrose or lactose, gelatin, etc. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid preparations for oral administration include suspensions, oral solutions, emulsions, and syrups, and in addition to commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, and suppositories. Non-aqueous solvents and suspending agents can include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. Suppository bases can include withepsol, macrogol, Tween 61, cocoa butter, laurin butter, and glycerogelatin.

[0036] The appropriate dosage of the pharmaceutical composition of the present invention can be prescribed in various ways depending on factors such as the formulation method, administration method, patient's age, weight, sex, pathological condition, food, administration time, administration route, excretion rate, and reaction sensitivity.

[0037] The pharmaceutical composition of the present invention can be administered orally or parenterally, and in the case of parenteral administration, it can be administered by topical application to the skin, intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, transdermal administration, etc.

[0038] In addition, the present invention provides an anticancer adjuvant for multidrug-resistant cancer containing an AMF (Autocrine motility factor) protein or AMF peptide as an active ingredient.

[0039] The above multidrug resistance is preferably multidrug resistance to any one anticancer drug selected from the group consisting of doxorubicin, calcein-AM, colchicine, epirubicin, topotecan, vinblastine, vinca alkaloids, imatinib, etoposide, and paclitaxel (Taxol), and more preferably multidrug resistance to doxorubicin or calcein-AM, but is not limited thereto.

[0040] The above cancer is preferably any one selected from liver cancer, lung cancer, breast cancer, and blood cancer, but is not limited thereto.

[0041] The above anticancer adjuvant may contain one or more active ingredients exhibiting the same or similar function as the AMF protein or AMF peptide in addition. The above anticancer adjuvant may be administered orally or parenterally during clinical administration, and when administered parenterally, may be administered by intraperitoneal injection, intrarectal injection, subcutaneous injection, intravenous injection, intramuscular injection, intrauterine epidural injection, intracerebrovascular injection, or intrathoracic injection, and may be used in the form of a general pharmaceutical formulation.

[0042] The above anticancer adjuvant can be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy, and biological response modifiers. The daily dosage of the above anticancer adjuvant is about 0.0001 to 100 mg / kg, preferably 0.001 to 10 mg / kg, and it is preferable to administer it once or several times a day, but the range varies depending on the patient's weight, age, sex, health condition, diet, administration time, administration method, excretion rate, and disease severity. The anticancer adjuvant of the present invention can be administered in various non-oral dosage forms during actual clinical administration, and when formulated, it is prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants. Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, and suppositories. Non-aqueous solvents and suspending agents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. Suppository bases include witepsol, macrogol, Tween 61, cocoa butter, laurin, and glycerogelatin.

[0043]

[0044] Hereinafter, the present invention will be described in detail by examples. However, the following examples are only illustrative of the present invention, and the content of the present invention is not limited to the following examples.

[0045]

[0046] [Materials and Methods]

[0047] 1. Cell culture

[0048] Liver cancer cells (Hep3B), lung cancer cells (Calu-1), and breast cancer cells (MDA-MB-231), as well as blood cancer cells, acute T-lymphoblastic leukemia cells (CCRF-CEM) and B-lymphoblastic cells (IM-9) were provided by the Korea Cell Line Bank (Korea). Liver cancer cells, lung cancer cells, and breast cancer cells were cultured in a humidified incubator containing 5% CO2 at 37°C in Dulbecco's Modified Eagle Medium (DMEM) containing 10% FBS (Fetal Bovine Serum) and 1% antibiotics, and acute T-lymphoblastic leukemia cells and B-lymphoblastic cells were cultured under the same conditions as above in RPMI 1640 medium containing 10% FBS (Fetal Bovine Serum) and 1% antibiotics.

[0049]

[0050] 2. Quantitative PCR

[0051] RNA extraction was performed using the RNeasy Mini Kit (Qiagen, Germany), followed by reverse transcription using the Super-Script III cDNA Synesis Kit (Invitrogen, USA). Quantitative PCR was performed using Bio-Rad SYBR Green Supermix (Bio-Rad, USA) with specific primers for the target genes of P-glycoprotein (Pgp, forward: GACTCGGGAGCAGAAGTTTGA, SEQ ID NO: 6, reverse: ACCCCGAAGATGTGTGCTTT, SEQ ID NO: 7), multidrug resistance related protein-1 (MRP-1, forward: ATCACAGGGTTGATTGTCCG, SEQ ID NO: 8, reverse: GCGCATTCCTTCTTCCAGTT, SEQ ID NO: 9), and β-actin (forward: CATGTACGTTGCTATCCAGGC, SEQ ID NO: 10, reverse: CTCCTTAATGTCACGCACGAT, SEQ ID NO: 11).

[0052]

[0053] 3. Western Blot Analysis

[0054] Samples (20 μg per lane) were separated by SDS-PAGE and transferred to PVDF membranes for subsequent immunoblotting and chemiluminescence detection. P-glycoprotein (Pgp), MRP-1, and β-actin antibodies were supplied by Santa Cruz Biotech (Santa Cruz, USA).

[0055]

[0056] 4. AMF protein production

[0057] Escherichia coli BL21 cells containing cDNA encoding GPI (glucose-6-phosphate isomerase) (Genbank: MW664918) were cultured overnight in LB medium containing ampicillin (100 mg / mL), diluted 1:100 in fresh culture medium, and further cultured at 37°C for 2 h. After cooling on ice for 30 min, the cells were induced with 0.5 mM IPTG and cultured at 15°C for 24 h with shaking at 200 rpm. The harvested cells were lysed in buffer (20 mM Tris-HCl pH 8.0, 200 mM NaCl, 1 mM DTT, 0.5 mM PMSF) containing lysozyme (1 mg / mL) and disrupted using a French press (model FA-078A, Thermo IEC, Milford, MA). The soluble fraction obtained after centrifugation (12,000 rpm, 20 min, 4°C) was purified by His60 Ni resin affinity chromatography (Promega, Madison, WI). Protein quantification was performed using Bio-Rad protein assay reagent.

[0058]

[0059] 5. AMF peptide production

[0060] AMF peptide was purchased and used after requesting production from Biostem (Suwon, Korea).

[0061]

[0062] 6. Fluorescence detection

[0063] Cells were seeded in 96-well culture plates and when approximately 50% confluence was reached, doxorubicin (0.5 μM) was treated alone or together with AMF protein (0.5–2.5 μg / mL), AMF peptide (2 μg / mL), or verapamil (5 μM) for 24 h, and the degree of intracellular doxorubicin accumulation was measured. Calcein-AM (2 μM) was also treated with AMF protein and AMF peptide in the same manner, and the degree of intracellular accumulation was measured. The fluorescence signals of doxorubicin (excitation at 490 nm, emission at 550 nm) and calcein-AM (excitation at 501 nm, emission at 521 nm) were detected using a BioTek Cytation 7 Cell Imaging Multi-Mode Reader (Agilent Co., USA).

[0064]

[0065] Example 1. Inhibition of P-glycoprotein expression

[0066] To determine whether the AMF protein and its derived peptide of the present invention affect the expression of P-glycoprotein (Pgp), a major cause of multidrug resistance, hepatoma cells (Hep3B), lung cancer cells (Calu-1), breast cancer cells (MDA-MB-231), and blood cancer cells (CCRF-CEM and IM-9) were treated with AMF protein (2 μg / ml) and AMF peptide (2 μg / ml) for 24 hours, respectively, and then quantitative PCR and Western blot analysis were performed.

[0067] As a result, as disclosed in FIGS. 1 and 2, it was confirmed that the mRNA and protein expression of P-glycoprotein was significantly reduced in the AMF protein and AMF peptide treatment groups of the present invention compared to the control group (con) (FIGS. 3 and 4).

[0068]

[0069] Example 2. Inhibition of MRP-1 expression

[0070] To determine whether the AMF protein of the present invention and its derived peptides affect the expression of MRP-1 (Multidrug resistance related protein-1), one of the ABC transporter proteins important for multidrug resistance, hepatoma cells (Hep3B), lung cancer cells (Calu-1), breast cancer cells (MDA-MB-231), and blood cancer cells (CCRF-CEM and IM-9) were treated with AMF protein (2 ㎍ / ㎖) for 24 hours, and then quantitative PCR and Western blot analysis were performed.

[0071] As a result, as disclosed in Fig. 5, it was confirmed that MRP-1 protein expression was significantly reduced in the AMF protein treatment group of the present invention compared to the control group (con).

[0072]

[0073] Example 3. Increased accumulation of anticancer drugs in cancer cells

[0074] Hepatoma cells (Hep3B), lung cancer cells (Calu-1), breast cancer cells (MDA-MB-231), and blood cancer cells (CCRF-CEM and IM-9) were treated with the AMF protein or AMF peptide of the present invention together with doxorubicin, an anticancer drug affected by P-glycoprotein, and the extent of doxorubicin accumulation in the cancer cells was confirmed through fluorescence detection. Verapamil, a P-glycoprotein inhibitor and first-generation multidrug resistance (MDR) modulator, was used as a positive control.

[0075] As a result, as disclosed in FIGS. 6 and 7, compared to the doxorubicin-only treatment group, the AMF protein of the present invention; or AMF peptide; and doxorubicin combination treatment group significantly increased doxorubicin accumulation in cancer cells in a concentration-dependent manner, and the 2 ㎍ / ㎖ AMF protein treatment group showed a doxorubicin accumulation effect at a level similar to that of the positive control group.

[0076] In addition, when breast cancer cells (MDA-MB-231), liver cancer cells (Hep3B), and acute T-lymphoblastic leukemia cells (CCRF-CEM) were treated with the AMF protein of the present invention; or the AMF peptide; and calcein-AM, an anticancer agent affected by P-glycoprotein, to determine the degree of accumulation of calcein-AM within cancer cells through fluorescence detection, the AMF protein treatment group and the AMF peptide treatment group of the present invention showed a significant increase in calcein-AM accumulation within cancer cells compared to the calcein-AM treatment group alone (con), and showed a calcein-AM accumulation effect at a level similar to that of the positive control group (Figs. 8 to 10).

Claims

1. A pharmaceutical composition for suppressing multidrug resistance to anticancer drugs containing AMF (Autocrine motility factor) protein or AMF peptide as an active ingredient.

2. A pharmaceutical composition for suppressing multidrug resistance to an anticancer agent, characterized in that in paragraph 1, the AMF protein is composed of an amino acid sequence of sequence number 1, and the AMF peptide is composed of any one amino acid sequence selected from amino acid sequences of sequence numbers 2 to 5.

3. A pharmaceutical composition for suppressing multidrug resistance to an anticancer agent, characterized in that in paragraph 1, the AMF protein or AMF peptide suppresses mRNA and protein expression of P-glycoprotein or MRP-1 (Multidrug resistance related protein-1) that induce multidrug resistance.

4. A pharmaceutical composition for suppressing multidrug resistance to an anticancer agent, characterized in that the multidrug resistance suppression in the first paragraph is multidrug resistance suppression in any one cancer cell selected from among liver cancer cells, lung cancer cells, breast cancer cells, and blood cancer cells.

5. A pharmaceutical composition for suppressing multidrug resistance to an anticancer agent, characterized in that the anticancer agent in paragraph 1 is any one anticancer agent selected from the group consisting of doxorubicin, calcein-AM, colchicine, epirubicin, topotecan, vinblastine, vinca alkaloids, imatinib, etoposide, and paclitaxel (Taxol).

6. A pharmaceutical composition for suppressing multidrug resistance to an anticancer agent, characterized in that, in addition to the effective ingredient in paragraph 1, it further comprises a pharmaceutically acceptable carrier, excipient or diluent.

7. A pharmaceutical composition for suppressing multidrug resistance to an anticancer agent, characterized in that the composition is prepared in any one formulation selected from among capsules, powders, granules, tablets, suspensions, emulsions, syrups, and aerosols in the first paragraph.

8. An anticancer adjuvant for multidrug-resistant cancer containing AMF (Autocrine motility factor) protein or AMF peptide as an active ingredient.

9. An anticancer adjuvant for multidrug-resistant cancer, characterized in that the multidrug resistance in paragraph 8 is multidrug resistance to any one anticancer agent selected from the group consisting of doxorubicin, calcein-AM, colchicine, epirubicin, topotecan, vinblastine, vinca alkaloids, imatinib, etoposide, and paclitaxel (Taxol).

10. An anticancer adjuvant for multidrug-resistant cancer, characterized in that the cancer in paragraph 8 is any one cancer selected from liver cancer, lung cancer, breast cancer, and blood cancer.

Images