KASP molecular marker closely linked to chili fruit length, primer, kit, and use

Abstract

A KASP molecular marker closely linked to chili fruit length. With the Zhangshugang version of the gene as a reference gene, the single nucleotide polymorphism at position 3333878 of chromosome 3 of chilies is a replacement of an A base with a T that occurs at the position. Also disclosed are a primer and kit for identifying the molecular marker closely linked to the chili fruit length gene and use thereof in identifying chili fruit length or in molecular-assisted breeding. The molecular marker can be used to rapidly screen for satisfactory plants, effectively reducing the planting scale, reducing the workload for subsequent identification, and improving the efficiency and accuracy of selection. The present invention is of great significance for the research on the fruit length formation mechanism. Therefore, the present invention is of great significance for the practice of fruit shape breeding of chili fruits and the research on the fruit shape change and regulation mechanisms.

Description

KASP molecular marker, primer, kit and application closely linked to pepper fruit length TECHNICAL FIELD

[0001] The present application belongs to the field of pepper breeding, and particularly relates to a KASP molecular marker, primer, kit and application closely linked to pepper fruit length. BACKGROUND

[0002] Pepper (Capsicum annuum L.) is a Capsicum of Solanaceae, and is one of the most important vegetable crops in China. Wild-type pepper fruits are small, and after natural selection and artificial domestication, great differences in fruit shape, size and horticultural traits are produced. China, as a major producer and consumer of peppers, has put forward higher requirements for the diversity and functionality of pepper fruit yield and quality, and understanding the basis of pepper fruit development is the primary condition for improving the quality of pepper fruits.

[0003] Pepper fruit yield parameters and growth habits often show continuous (quantitative) changes and are considered to be controlled by multiple genes, and their expression is affected by environmental factors. Before the availability of genetic maps of crops, quantitative traits were analyzed using biometric models, and although biological statistics described the inheritance, they could not explain the effects of individual quantitative trait loci (QTL) on traits.

[0004] Genome-wide association study (GWAS) uses hundreds of millions of single nucleotide polymorphism loci in the genome as small molecular genetic markers on the basis of linkage disequilibrium (LD). MAS, as an important part of plant molecular breeding, uses molecular markers closely linked to target genes (or functional markers based on target genes themselves) as selection markers, and in the breeding process, the selection of target traits is completed through the screening of molecular markers. However, the cloned fruit length genes and the like are difficult to apply in actual breeding processes, and analysis shows that different genes have different variation sites in different materials, and many markers cannot be used universally, so how to develop a variation site containing a conserved fruit control gene, design a marker assisted selection marker containing the gene and the trait linked to the gene, and solve the problem of inapplicable markers caused by differences in pepper materials are technical problems to be solved at present.

[0005] SUMMARY

[0006] The technical problem to be solved by the present application is to overcome the deficiencies of the prior art and provide a KASP molecular marker, primer, kit and application closely linked to pepper fruit length.

[0007] To solve the above technical problems, the technical scheme provided by the present application is:

[0008] A KASP molecular marker closely linked to the length of pepper fruits, taking the zhangshugang version gene as the reference gene (http: / / ted.bti.cornell.edu / ftp / pepper / genome / Zhangshugang / ), a single nucleotide polymorphism at 3333878 of the 3rd chromosome of pepper, where a base A is replaced by T.

[0009] The KASP molecular marker closely linked to the length of pepper fruits described above, preferably, the nucleotide sequence (as shown in SEQ ID NO: 1) comprises:

[0010] Chr03_3333878:

[0011] As a general inventive concept, the present application also provides a primer for identifying a KASP molecular marker closely linked to the length of pepper fruits, comprising:

[0012] Forward primer 1: 5'-GAAGGTGACCAAGTTCATGCTCTTCATTAGAGGCTTTACCCTGGT-3';

[0013] Forward primer 2: 5'-GAAGGTCGGAGTCAACGGATTCTTCATTAGAGGCTTTACCCTGGA-3';

[0014] Reverse primer: 5'-ATGAAGAAGAAAAGCACTGAAGGC-3'.

[0015] Further, the two forward primers are respectively connected to different fluorescent linker sequences, the linker sequence matched with FAM fluorescence is GAAGGTGACCAAGTTCATGCT, and the blue fluorescence is detected by fluorescence signal scanning; the linker sequence matched with HEX fluorescence is GAAGGTCGGAGTCAACGGATT, and the green fluorescence is detected by fluorescence signal scanning.

[0016] As a general inventive concept, the present application also provides a kit for identifying a KASP molecular marker closely linked to the length of pepper fruits, comprising the primer described above.

[0017] As a general inventive concept, the present application also provides a KASP molecular marker described above, or a primer described above, or a kit described above, in the application of identifying the length of pepper fruits.

[0018] The application, preferably, in the process of identifying the shape of the pepper fruit or molecular-assisted breeding, takes the zhangshugang version gene of the pepper as a reference, identifies the base at 3333878 of the 3rd chromosome of the pepper as homozygous A, and determines that the pepper fruit is a long fruit single plant, identifies the base at 3333878 of the 3rd chromosome of the pepper as homozygous T, and determines that the pepper fruit is a short fruit single plant, and identifies the base at 3333878 of the 3rd chromosome of the pepper as heterozygous A / T, and determines that the pepper fruit is a long fruit single plant.

[0019] The application, preferably, adopts the PCR reaction to perform the detection.

[0020] Further, in the application, the steps specifically include the following steps:

[0021] The genomic DNA of the sample to be detected is taken as a template, and a molecular marker amplification primer is used to perform a PARMS PCR amplification by using a quantitative PCR device; when a fluorescent group and a corresponding fluorescent quenching group are close to each other, the fluorescence emitted by the fluorescent group is absorbed by the quenching group, and longer wavelength fluorescence or heat is emitted, at this time, the fluorescent signal of the group cannot be detected in the wavelength corresponding to the fluorescence, and once the two are separated, the fluorescent signal can be detected. The PARMS adopts the FRET principle to detect the amplification signal of the FAM and HEX fluorescent primer, and when the corresponding alleles are amplified, the corresponding light signal will appear.

[0022] The application, preferably, the specific process of identifying the length of the pepper fruit includes the following steps:

[0023] (1) extracting the DNA of the pepper to be detected as a template;

[0024] (2) using the above-mentioned molecular marker or the above-mentioned primer or the above-mentioned kit to perform PCR amplification, fluorescence signal scanning, and genotyping.

[0025] The application, preferably, in the fluorescence signal scanning, if only the blue fluorescence corresponding to the forward primer 1 of the primer connected with the fluorescent linker sequence is detected, it is determined that the pepper fruit is a homozygous single plant of long fruit (the length is greater than 20 cm), if only the green fluorescence corresponding to the forward primer 2 of the primer connected with the fluorescent linker sequence is detected, it is determined that the pepper fruit is a homozygous single plant of short fruit (the length is less than 20 cm), and if the fluorescence signals corresponding to the forward primers 1 and 2 of the primers connected with the fluorescent linker sequence are detected at the same time, red fluorescence is displayed, and it is determined that the pepper fruit is a heterozygous single plant of long fruit.

[0026] The application, preferably, the PCR amplification procedure comprises: preincubation 94℃ 900S; 94℃ 20S; 78℃ 10S; TD 62℃; 0Cyc->57(-0℃), 10 cycles; 94℃ 20S; 57℃ 60S, 35 cycles; cooling 37℃ 30S.

[0027] Compared with the prior art, the application has the advantages that:

[0028] The KASP molecular marker linked to the pepper fruit length gene in the application, and the primers and kits developed for the molecular marker can be used for identification of long and short pepper fruits, and further assisted breeding relying on the molecular marker can effectively solve the problems of long breeding period and being easily affected by the environment. By using the molecular marker early, satisfactory plants can be quickly screened, the planting scale is effectively reduced, the workload of later identification is reduced, and the selection efficiency and accuracy are improved. It has great significance for studying the formation mechanism of fruit length. Therefore, the application has important significance in pepper fruit shape breeding practice and fruit shape change and regulation mechanism research. BRIEF DESCRIPTION OF DRAWINGS

[0029] Fig. 1 is a statistical diagram of fruit length of a cultivation breeding population in the embodiment of the application;

[0030] Fig. 2 is a GWAS (genome-wide association study) diagram of 50K chips in the embodiment of the application;

[0031] Fig. 3 is a genotyping diagram of KASP detection of fruit length fragments of a breeding population in the embodiment of the application. DETAILED DESCRIPTION

[0032] In order to facilitate the understanding of the application, the application will be described more fully below with reference to the accompanying drawings and preferred embodiments, but the scope of protection of the application is not limited to the following specific embodiments.

[0033] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. The technical terms used herein are only for the purpose of describing specific embodiments and are not intended to limit the scope of protection of the application.

[0034] Unless otherwise specified, all reagents and raw materials used in the application can be commercially available or can be prepared by known methods.

[0035] Embodiment:

[0036] I. Obtaining of the KASP molecular marker linked to the pepper fruit length gene

[0037] 1. Phenotype identification of the genetic population

[0038] The core breeding material of the research group, 191 pepper materials, was planted (material source: Lijun O, Dong L, Junheng L, et al. Pan-genome of cultivated pepper (Capsicum Capsicum) and its use in gene presence-absence variation analyses [J]. The New Phytologist, 2018 (2): 220.), and the fruit length phenotype of the breeding population was investigated. Three fruits on the “four door” of each single plant at the green and mature stage were harvested, photographed with a digital camera, and the fruit length and width were measured using a digital vernier caliper to complete the phenotypic identification of fruit shape traits, as shown in FIG. 1.

[0039] 2. Fruit length GWAS analysis

[0040] Using 50K chip capture sequencing, whole genome association analysis (GWAS) was performed on pepper fruit shape traits according to the sequencing results. 29450 SNPs (MAF greater than 0.05) were extracted for Chlorate sensitivity trait GWAS analysis, and TASSEL 4.0 software was used for MLM linear mixed model association analysis. The Manhattan plot was drawn using R language, as shown in FIG. 2. Whole genome association analysis (GWAS) refers to searching for sequence variations, i.e. single nucleotide polymorphism (SNP) sites, between different individuals in the whole genome region, so as to detect genes or QTLs significantly related to the trait. GEMMA uses a mixed linear model (Mixed Linear Model, MLM) to detect the association significance between traits and genetic markers. MLM introduces population genetic structure (as a fixed effect) and individual kinship matrix (as a random effect) to correct the effects of population structure and individual kinship. The P-value obtained by association significance test is corrected by multiple hypothesis testing, and the fruit length is subjected to whole genome association analysis. A very strong GWAS signal is found on chromosome 3, and the significantly associated SNP site is finally found to be Chr3_3333878.

[0041] 3. Development of molecular markers linked to fruit length

[0042] The GWAS highest point of about 2M was analyzed for marker development. The SNP screening conditions are as follows: first, filter the quality of single-sample SNPs, the depth of single-sample is less than 200, discard the sites with minimum allele frequency below 0.05; discard the sites with heterozygosity greater than 0.2 in the population, and perform marker screening. Design KASP markers and test in the breeding population.

[0043] Finally, Chr3_3333878 was selected for KASP markers, and it was found that they could be well typed, as shown in Figure 3, and the long and short fruits were better for assisted backcross breeding.

[0044] II. Application of KASP molecular markers linked to pepper fruit length genes

[0045] 1. AB method was used to extract DNA from 90 single plants in GWAS population

[0046] (1) Add dithiothreitol (DTT, 0.2%) to the CTAB extraction solution;

[0047] (2) Add 2.0 ml centrifuge tube cover size fresh leaves 2 pieces; grind into powder with liquid nitrogen, add 800-900 μL CTAB buffer, mix well;

[0048] (3) 65℃ water bath for 30 min, during which gently inverted shaking 2 times, after water bath, cool to below 15℃ at room temperature;

[0049] (4) Add 500 chloroform / isopentyl alcohol (24:1), mix well up and down for 4 min, ensure that the sample is fully mixed with chloroform;

[0050] (5) 12,000 rpm centrifugation for 10 min, take 500 μL supernatant, add 500 μL isopropanol to 1.5 mL centrifuge tube, mix well by gently inverting up and down; 4℃ refrigerator for 30 minutes;

[0051] (6) 12,000 rpm centrifugation for 15 min, discard the supernatant, wash the precipitate with 500ul of 75% alcohol, centrifuge at 12,000 rpm for 5 min, discard the supernatant;

[0052] (7) Super clean dry DNA, let the alcohol evaporate completely; add 100 μL of pure water (containing a final concentration of 1% RNase) to dissolve the DNA;

[0053] (8) 37℃ water bath for 1h to remove RNA; take DNA for electrophoresis detection, after identifying the complete band, use microspectrophotometer to measure the DNA concentration, the ratio of 260 / 280 and 260 / 230 is required to be greater than 1.8, dilute the DNA to 100 ng, and store at -20℃ for standby.

[0054] 2. Detection of KASP markers in fruit shape

[0055] (1) KASP primer reagent is generally composed of 3 primers, of which 2 are allele-specific forward primers; 1 is a universal reverse primer. The 3' end bases of the 2 allele-specific forward primers are different, corresponding to different alleles respectively. The allele-specific forward primers will produce different fluorescence signals through competitive PCR reaction. The linker sequence matched with FAM fluorescence is GAAGGTGACCAAGTTCATGCT, and the linker sequence matched with HEX fluorescence is GAAGGTCGGAGTCAACGGATT.

[0056] The KASP primer is designed from SNPWay (http: / / www.snpway.com / ), synthesized from PAGE (purified), and respectively shown in SEQ ID NO: 2-4:

[0057] Forward primer 1: 3'-GAAGGTGACCAAGTTCATGCTCTTCATTAGAGGCTTTACCCTGGT-5';

[0058] Forward primer 2: 3'-GGAAGGTCGGAGTCAACGGATTCTTCATTAGAGGCTTTACCCTGGA-5';

[0059] Reverse primer: 3'-ATGAAGAAGAAAAGCACTGAAGGC-5'.

[0060] (2) Typing system

[0061] Amplification procedure:

[0062] Preincubation 94℃900S; 94℃20S; 78℃10S, TD 62℃, 0Cyc->57(-0℃), 10 cycles; 94℃20S, 57℃60S, 35 cycles; Cooling 37℃30S.

[0063] (3) Typing results

[0064] When scanning the fluorescence signal, if the detection only detects the blue fluorescence corresponding to the primer forward primer 1 connected with the fluorescence linker sequence, it is determined that the pepper fruit is a long fruit homozygous single plant, if only the green fluorescence corresponding to the primer forward primer 2 connected with the fluorescence linker sequence is detected, it is determined that the pepper fruit is a short fruit homozygous single plant, and if the fluorescence signals corresponding to the primers forward primer 1 and 2 connected with the fluorescence linker sequence are detected at the same time, it is determined that the pepper fruit is a long fruit heterozygous single plant.

[0065] Results The KASP markers were used to identify the fruit length of single plant in GWAS population, and part of the results are shown in Table 1. As can be seen from Table 1, the genotyping results are highly consistent with the phenotyping results.

[0066] Table 1 KASP in breeding materials fruit length and genotype

[0067] Three, pepper fruit shape linkage molecular marker in molecular breeding

[0068] The long fruit pepper was used as a recurrent parent, and was crossed with short fruit material which needed to be improved. In BC1F1, the heterozygous single plant was detected by Chr03_3333878 marker, and the heterozygous single plant with agronomic traits close to the recurrent parent was selected as the male parent for further backcrossing. After BC3F1, the plant was self-crossed for two generations, and at the same time, the agronomic traits were selected and combined with Chr03_3333878 marker for assisted selection. Finally, the fruit length strain which was homozygous with the background of the recurrent parent was obtained.

Claims

1. A KASP molecular marker closely linked to the length of chili pepper fruits, characterized in that, Using the zhangshugang version of the gene as a reference gene, a single nucleotide polymorphism was found at 3333878 on chromosome 3 of pepper, where an A-to-T substitution occurred.

2. The KASP molecular marker closely linked to pepper fruit length as described in claim 1, characterized in that, Its nucleotide sequence is: TAACATCGACCTGATTTTGAACAAAAAATCCTTGGTCAACATGAAGAAGAAAAGCA CTGAAGGCTTTATGGAATATGCGATAAGGTGGCGTGAACAGGCC[A / T]CCAGGGTAAAGCCTCTAATGAAGAAGAGTAAGCTAGTAGAGGTCTTCATTCAGGTACAGGATGAGACCTATTTTCAATAATTACTTTCGGCAATGGGAAA.

3. A primer for identifying KASP molecular markers closely linked to pepper fruit length, characterized in that, Including: Forward primer 1: 5'-GAAGGTGACCAAGTTCATGCTCTTCATTAGAGGCTTTACCCTGGT- 3'; Forward primer 2: 5'-GAAGGTCGGAGTCAACGGATTCTTCATTAGAGGCTTTACCCTGGA- 3'; Reverse primer: 5'-ATGAAGAAGAAAAGCACTGAAGGC- 3'.

4. A kit for identifying KASP molecular markers closely linked to pepper fruit length, characterized in that, Includes the primers described in claim 3.

5. The application of a KASP molecular marker as described in claim 1 or 2, a primer as described in claim 3, or a kit as described in claim 4 in identifying pepper fruit length or in pepper-assisted breeding.

6. The application as described in claim 5, characterized in that, In the process of identifying the shape of chili pepper fruits, the zhangshugang genome version of chili pepper was used as a reference. When the base at 3333878 on chromosome 3 of chili pepper was identified as homozygous A, the chili pepper fruit was determined to be from a single plant with long fruits. When the base at 3333878 on chromosome 3 of chili pepper was identified as homozygous T, the chili pepper fruit was determined to be from a single plant with short fruits. When the base at 3333878 on chromosome 3 of chili pepper was identified as heterozygous A / T, the chili pepper fruit was determined to be from a single plant with long fruits.

7. The application as described in claim 5, characterized in that, The specific process for determining the length of a chili pepper includes: (1) Extract DNA from the peppers to be tested as a template; (2) PCR amplification, fluorescence signal scanning, and genotyping are performed using the molecular markers described in claim 1 or 2, the primers described in claim 3, or the kits described in any one of claims 4-5.

8. The application as described in claim 5, characterized in that, During fluorescence signal scanning, if only blue fluorescence is detected corresponding to the forward primer 1 which is connected to the fluorescent adapter sequence, the pepper fruit is determined to be a homozygous plant with long fruit. If only green fluorescence is detected corresponding to the forward primer 2 which is connected to the fluorescent adapter sequence, the pepper fruit is determined to be a homozygous plant with short fruit. If fluorescence signals corresponding to both forward primers 1 and 2 which are connected to the fluorescent adapter sequence are detected simultaneously, the pepper fruit is determined to be a heterozygous plant with long fruit.

9. The application as described in claim 7, characterized in that, In step (2), the PCR amplification program includes: 94℃ 900S; 94℃ 20S; 78℃ 10S; TD 62℃; 0Cyc->57(-0℃), 10 cycles; 94℃ 20S; 57℃ 60S, 35 cycles; Cooling 37℃ 30S.

Images