Means and methods to suppress plant insect pests
Streptomyces sasae strains producing quinomycin C provide a broad-spectrum biocontrol solution for insect pests, addressing resistance concerns and enhancing crop yield by inhibiting pest growth and development.
Patent Information
- Application Number
- PCT/EP2025/068221
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-06-28
- Filing Date
- 2025-06-27
- Publication Date
- 2026-01-02
AI Technical Summary
Current biocontrol agents like Bacillus thuringiensis face issues with resistance development in insect pests and lack broad-spectrum efficacy, necessitating the development of alternative strategies to manage diverse insect species effectively.
Utilization of novel microbial strains, particularly Streptomyces sasae, which produce quinomycin C, a quinoxaline antibiotic, for insecticidal activity against pests such as Spodoptera, Diabrotica, and Tetranychus, through formulations that include bacterial spores, fermentation products, and compatible carriers.
The Streptomyces sasae strains effectively inhibit the growth and development of insect pests, reducing damage and enhancing crop yield with broad-spectrum control, minimizing environmental harm and resistance issues.
Smart Images

Figure IMGF000017_0001 
Figure IMGF000018_0001 
Figure IMGF000068_0001
Abstract
Description
[0001] MEANS AND METHODS TO SUPPRESS PLANT INSECT PESTS
[0002] FIELD OF THE INVENTION
[0003] The present invention relates to the field of biocontrol of plant insect pests. Particularly, the present invention discloses novel microbial strains effective in inhibiting the growth, activity and / or development of plant insect pests. These strains are therefore advantageous in protecting plants from deleterious effects of insects. Uses of these microbial strains as bio-pesticides are provided as well as methods of promoting crop yield and resistance of plants to insect pests.
[0004] BACKGROUND
[0005] Insects play a dual role in agriculture. While beneficial insects like bees contribute to pollination and crop yield, insect pests have a significant negative impact on crop productivity. Insect pests encompass a diverse array of insects that have a direct effect on plant yield by causing damage through feeding on plant tissues, and / or an indirect effect by being a vector of diseases. The damage inflicted by insect pests can manifest in various ways, including reduced plant fitness, leaf defoliation, stunted growth, deformation of fruit, flowers and general plant architecture, and even plant death in severe cases. Plant feeding insects are a major factor in the yield losses of economically valuable plants worldwide (including crops, trees and ornamental plants), making managing insect pests essential to safeguard crop productivity and ensure food security.
[0006] Traditionally, insect pests have been predominantly treated with chemical pesticides. Although these products are mostly very effective in targeting specific pests, they are more and more under pressure because of their potential negative consequences on the health of farmers and the environment, including soil contamination, water pollution, harm to non-target organisms, and the development of pesticide-resistant pest populations. Biological control offers a solid alternative to chemical pesticides by utilizing natural enemies of insect pests, and / or microbial agents producing natural insecticidal compounds. While being effective in controlling insect pests in the field, biocontrol agents minimize harm to ecosystems, farmers and consumers.
[0007] One of the most known bio-insecticidal control agents today is Bacillus thuringiensis. This bacterium produces specific protein toxins, particularly Cry proteins, that are toxic to insects like lepidopterans. During the larval stage of lepidopteran pests, such as caterpillars of moths and butterflies, the larvae can devour the plants bare by consuming leaves, stems, fruits, and seeds. When the larvae ingest the Cry proteins, the protein crystals destroy the lining of their gut, leading to them ceasing feeding and eventually dying within days. This mechanism of action is specific to insect larvae and does not harm other organisms like humans or mammals due to differences in gut receptors. The toxin produced by B. thuringiensis is highly effective against lepidopterans, making it a valuable tool in integrated pest management programs for controlling these insect pests. However, overreliance on a limited number of biocontrol agents will inevitably lead to emergence of resistant insects. Moreover, farmers prefer broad-spectrum agents that control diverse insect species. Therefore, there is a continuous need to develop alternative biocontrol strategies to safeguard crop productivity in the future.
[0008] The inventors of current application have developed a novel biocontrol agent based on the bacterial species Streptomyces sasae. While some strains of Streptomyces have been reported to produce bioactive compounds, including insecticidal compounds (e.g. Valan Arasu et al 2013 BMC Microbiology 13), the Streptomyces genus is still underexplored, largely because the genus is exceptionally large. Counterintuitively to the considerable attention that is and has been paid to actinomycetes as producers of secondary metabolites, only a very small selection of unpredictable Streptomyces strains demonstrates biocontrol potential such as fungicidal, insecticidal or herbicidal activity. Kim et al (2020) for example screened 1200 Streptomyces isolates of which only 10 isolates exhibited phytotoxic activity. Moreover, not all microbial strains producing one or more secondary metabolites of interest are suitable for industrial settings. Current application provides a solution to the above problems.
[0009] SUMMARY
[0010] In a first aspect the application provides an insecticidal composition comprising a bio-active agent, wherein said bio-active agent comprises or consists of quinomycin C. In one embodiment, the bioactive agent is produced or synthesized chemically. In another embodiment, quinomycin C is produced biologically, more particularly by a microorganism. Also provided thus is an insecticidal composition comprising a microorganism or a spore thereof, or a fermentation product derived from a cell culture of said microorganism, wherein said microorganism, said spore thereof or said fermentation product has insecticidal activity or wherein said microorganism produces at least one insecticidal compound and wherein said spore or said fermentation product comprises at least one insecticidal compound. In one embodiment, said insecticidal compound is a quinoxaline or quinomycin antibiotic. In one embodiment, said insecticidal compound is at least quinomycin C. In another embodiment, said microorganism is a bacterium. In a further embodiment, said bacterium is a Streptomyces species, more particularly Streptomyces sasae. In another or further embodiment, said bacterium comprises a 16S rDNA sequence having at least 99.50% sequence identity to SEQ. ID No. 1 over the full length of SEQ ID No. 1. In another or further embodiment, said bacterium has an average nucleotide identity or ANI of at least 90% to the whole genome sequence of the Streptomyces strain M25D9 as deposited under the Budapest Treaty at the Polish Collection of Microorganisms on April 2, 2024 with accession number B / 00529. In another or further embodiment, said bacterium comprises the quinomycin biosynthetic gene cluster. In a particular embodiment, said quinomycin biosynthetic gene cluster comprises one or more open reading frames (ORFs) encoding polypeptides sufficient to direct the synthesis of one or more quinomycin antibiotics, the ORFs being physically clustered together in the genome, wherein the polypeptides have at least 50% sequence identity to one or more sequences from the list consisting of SEQ ID NO: 5-24. In a further particular embodiment, the quinomycin biosynthetic gene cluster comprises the ORFs qmcA, qmcB, qmcC, qmcD, qmcE, qmcF, qmcG, qmcH, qmcl, qmcJ, qmcK, qmcL, qmcM, qmcN, qmcO, qmcP, qmcQ, qmcR, qmcS and qmcT, the ORFs being physically clustered together in the genome, wherein the ORFs encode polypeptides having at least 50% sequence identity to the corresponding amino acid sequences depicted in SEQ ID NO: 5-24.
[0011] In a most particular embodiment, said bacterium is the bacterial strain MED-B-M25D9 as deposited under the Budapest Treaty at the Polish Collection of Microorganisms (PCM) on April 2, 2024 under Accession No. B / 00529, or the bacterial strain MED-B-M11C5 as deposited under the Budapest Treaty at the BCCM-LMG on June 3, 2025 with accession number LMG P-34075, or a functional homologue thereof. In a further embodiment, said functional homologue is a Streptomyces species having at least 95% sequence identity on whole genome level compared to strain MED-B-M25D9 deposited as B / 00529, wherein the functional homologue comprises the quinomycin biosynthetic gene cluster, and wherein the functional homologue produces a detectable amount of quinomycin C.
[0012] In another or further embodiment, said fermentation product derived from a cell culture of the bacterium is selected from the list consisting of an extract, an extract fraction, a supernatant, a supernatant fraction, a filtrate and a whole cell broth. In another or further embodiment, the insecticidal composition is a synthetic composition, an unnatural composition or man-made composition. In yet another or further embodiment, the insecticidal composition further comprises an agricultural compatible carrier. In a particular embodiment, said carrier is a surfactant. In another particular embodiment, said insecticidal composition is a sprayable composition.
[0013] In a second aspect, an isolated bacterial strain or a spore thereof is provided, wherein said bacterial strain comprises a 16S rDNA sequence having at least 99.50% sequence identity to SEQ ID No. 1. In a particular embodiment said bacterial strain comprises a 16S rDNA sequence as depicted in SEQ ID No. 1. In a most particular embodiment said bacterial strain is the strain as deposited under the Budapest Treaty at the PCM on April 2, 2024 under Accession No. B / 00529 or at the BCCM-LMG on June 3, 2025 under Accession No. LMG P-34075. Also provided are an enriched culture and a biologically pure culture of any of said bacterial strains. Also provided is a composition wherein said bacterial strain is lyophilized, freeze-dried or in a form selected from dried cells, dehydrated cells, devitalized cells, inactivated cells, frozen cells or cells in artificial suspension or in a dry powder.
[0014] In a third aspect the use is provided of quinomycin C or any of the herein disclosed bacteria or bacterial strains, or a spore thereof, or a fermentation product derived from a cell culture of any of said bacteria or bacterial strains, for controlling an insect pest population or for protecting a crop against an insect pest. In one embodiment, the insect is of an order selected from the group consisting of Lepidoptera, Coleoptera, Trombidiformes and Thysanoptera. In a more particular embodiment, the insect is of the genus Spodoptera, Diabrotica, Tetranychus or Leptinotarsa.
[0015] In a fourth aspect, a biosynthetic gene cluster is provided comprising 20 ORFs encoding polypeptides for the production of one or more quinomycin antibiotics, wherein the polypeptides have at least 50%, at least 60%, at least 70%, at least 80% or at least 90% sequence identity to the amino acid sequences depicted in SEQ. ID NO: 5-24. Also the use of said gene cluster is provided for producing one or more quinomycin antibiotics in a host cell.
[0016] In a fifth aspect, a method is provided of controlling insect damage to a plant comprising the step of applying to said plant or plant part thereof any of the insecticidal compositions herein disclosed. In a particular embodiment, the step of applying comprises spraying, dusting, infiltration, immersion, dipping, incubation or any combination thereof. In another or further embodiment, the method further comprises a step of determining the insecticidal effect of the application of said composition. In a particular embodiment, said insect is of an order selected from the group consisting of Lepidoptera, Coleoptera, Trombidiformes and Thysanoptera.
[0017] Further embodiments and the full scope of applicability of the present invention will become apparent from the detailed description given hereinafter. However, it should be understood that the detailed description and specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.
[0018] It is to be understood that any combination of each of the aspects and the embodiments disclosed herein is explicitly encompassed within the disclosure of the present invention. These and further aspects and preferred embodiments of the invention are described in the following sections and in the appended claims. The subject-matter of the appended claims is hereby specifically incorporated in this specification.
[0019] DEPOSIT OF BIOLOGICAL MATERIAL
[0020] Two of the purified bacterial strains (proposed taxonomic designation Streptomyces sasae) as taught herein have been deposited under the Budapest Treaty. Strain MED-B-M25D9 (identification reference given to the deposited material by the depositor) has been deposited at the Polish Collection of Microorganisms (PCM) on 2ndApril 2024 under Accession No. B / 00529, while strain MED-B-M11C5 (identification reference given to the deposited material by the depositor) has been deposited at the Belgian Coordinated Collections of Microorganisms (BCCM) / LMG Bacteria collection (BCCM / LMG) on 3rdJune 2025 under Accession No. LMG P-34075. Table 1 summarizes the requisite indications relating to this deposited microorganisms. For reasons of brevity, the MED-B-M25D9 strain is also referred to as strain "M25D9" throughout this specification, and MED-B-M11C5 as strain "M11C5".
[0021] Table 1. Overview of deposited strains and details on the depository institutes.
[0022] BRIEF DESCRIPTION OF THE FIGURES
[0023] Figure 1 shows the results of 48 microbial extracts in the in vitro bio-assay investigating the insecticidal activity on Spodoptera exigua larvae. Mortality (left Y-axis) and percentage weight reduction (right Y- axis) of S. exigua larvae is shown. A pronounced insecticidal activity can be appreciated for Bt, Bl.02, BL03, BL04, BL07, BL14 and BL29. Mock, negative formulation control; Bt, positive Bacillus thuringiensis control.
[0024] Figure 2 shows representative pictures of sweet pepper plants infested with S. exigua larvae and treated with a positive Bt control (Bt), a 5% DMSO negative control, BL02, BL03, BL04, BL07, BL14, Bl.29 and D08.
[0025] Figure 3 illustrates that the Bl.02 extract protects sweet pepper plants against plant damage caused by Spodoptera larvae. The graph shows the percentage plant area that is affected by the larvae at 1, 3, 5 and 7 days upon infestation. Positive controls (Altacor and Xentari) and negative controls (untreated control and a formulation DMSO control) are shown.
[0026] Figure 4 illustrates that the Bl.02 extract has insecticidal activity against Spodoptera larvae. The graph shows the percentage mortality of the larvae induced by the treatments at 1, 3, 5 and 7 days upon infestation. Positive controls (Altacor and Xentari) and negative controls (untreated control and a formulation DMSO control) are shown.
[0027] Figure 5 shows the percentage mortality of Tetranychus urticae mites after spraying with extract Bl.02 at a 1:5 dilution or with a 4% DMSO control (Blank). Data 24h and 72h after spraying are shown.
[0028] Figure 6 shows the percentage mortality of Frankliniella occidentalis thrips after spraying with extract Bl.02 (BI02) at a 1:5 dilution, with a 4% DMSO control (Blank) or a water control. Data 24h, 48h and 72h after spraying are shown.
[0029] Figure 7 shows the estimated feeding damage on potato leaf disks by the Colorado potato beetle Leptinotarsa decemlineata. Potato leaf disks were pretreated with extract Bl.02 (BI02), with a 2% DMSO control (blank) control or were not pretreated (untreated). Leaf damage was monitored after 24h and 48h. A clear protective effect of the potato leaves could be observed of the BL02 extract compared to the controls.
[0030] Figure 8 shows the structural formula of quinomycin C (A) and quinomycin A (B).
[0031] Figure 9 illustrates the insecticidal activity of quinomycin A (A) and quinomycin C (B). The y-axis shows the percentage mortality (grey bars) and growth delay (black dots). The x-axis shows the different treatments.
[0032] Figure 10 is a phylogenetic tree showing the phylogenetic similarities and differences between M25D9 and 13 different close relatives.
[0033] Figure 11 illustrates the insecticidal activity against Spodoptera larvae of the extracts of M25D9 and its 13 close relatives. The y-axis shows the percentage mortality (grey bars) and growth delay (black dots). The x-axis shows the different treatments. Figure 12 shows the effect of different quinomycin A and quinomycin C droplet treatments in pg / ml on leaf disks along 3 negative controls, i.e. mock (untreated), MQ. (milliQ. water) and DMSO at 5%. For each treatment the six replates are shown.
[0034] DETAILED DESCRIPTION
[0035] In order that the present description can be more readily understood, certain terms are first defined. Additional definitions are set forth throughout the detailed description.
[0036] DEFINITIONS
[0037] As used herein, the singular forms "a", "an", and "the" include both singular and plural referents unless the context clearly dictates otherwise.
[0038] The terms "comprise", "comprising", "comprises" and "comprised of" as used herein are synonymous with "include", "including", "includes" or "contain", "containing", "contains", and are inclusive or open- ended and do not exclude additional, non-recited members, elements or method steps. The terms also encompass "consisting of" and "consisting essentially of".
[0039] The recitation of numerical ranges by endpoints includes all numbers and fractions subsumed within the respective ranges, as well as the recited endpoints. This applies to numerical ranges irrespective of whether they are introduced by the expression "from... to..." or the expression "between... and..." or another expression.
[0040] The terms "about" or "approximately" as used herein when referring to a measurable value such as a parameter, an amount, a temporal duration, and the like, are meant to encompass variations of and from the specified value, such as variations of + / -10% or less, preferably + / -5% or less, more preferably + / -1% or less, and still more preferably + / -0.1% or less of and from the specified value, insofar such variations are appropriate to perform in the disclosed invention. It is to be understood that the value to which the modifier "about" or "approximately" refers is itself also specifically, and preferably, disclosed.
[0041] Furthermore, the terms first, second, third and the like in the description and in the claims, are used for distinguishing between similar elements and not necessarily for describing a sequential or chronological order, unless specified. It is to be understood that the terms so used are interchangeable under appropriate circumstances and that the embodiments of the invention described herein are capable of operation in other sequences than described or illustrated herein.
[0042] Whereas the term "one or more" or "at least one", such as one or more or at least one member(s) of a group of members, is clear per se, by means of further exemplification, the term encompasses inter alia a reference to any one of said members, or to any two or more of said members, such as, e.g., any >3, >4, >5, >6 or >7 etc. of said members, and up to all said members. In another example, "one or more" or "at least one" may refer to 1, 2, 3, 4, 5, 6, 7 or more.
[0043] The discussion of the background to the invention herein is included to explain the context of the invention. This is not to be taken as an admission that any of the material referred to was published, known, or part of the common general knowledge in any country as of the priority date of any of the claims. All documents cited in the present specification are hereby incorporated by reference in their entirety. Throughout this disclosure, various publications, patents and published patent specifications may be referenced by an identifying citation. All documents cited in the present specification are hereby incorporated by reference in their entirety. In particular, the teachings or sections of such documents herein specifically referred to are incorporated by reference.
[0044] Unless otherwise defined, all terms used in disclosing the invention, including technical and scientific terms, have the meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. By means of further guidance, term definitions are included to better appreciate the teaching of the invention. When specific terms are defined in connection with a particular aspect of the invention or a particular embodiment of the invention, such connotation or meaning is meant to apply throughout this specification, i.e., also in the context of other aspects or embodiments of the invention, unless otherwise defined.
[0045] In the following passages, different aspects or embodiments of the invention are defined in more detail. Each aspect or embodiment so defined may be combined with any other aspect(s) or embodiment(s) unless clearly indicated to the contrary. In particular, any feature indicated as being particular or advantageous may be combined with any other feature or features indicated as being particular or advantageous.
[0046] Reference throughout this specification to "one embodiment", "an embodiment" means that a particular feature, structure or characteristic described in connection with the embodiment is included in at least one embodiment of the present invention. Thus, appearances of the phrases "in one embodiment" or "in an embodiment" in various places throughout this specification are not necessarily all referring to the same embodiment, but may. Furthermore, the particular features, structures or characteristics may be combined in any suitable manner, as would be apparent to a person skilled in the art from this disclosure, in one or more embodiments. Furthermore, while some embodiments described herein include some but not other features included in other embodiments, combinations of features of different embodiments are meant to be within the scope of the invention, and form different embodiments, as would be understood by those in the art. For example, in the appended claims, any of the claimed embodiments can be used in any combination. By extensive experimental testing, the present inventors have found that extracts of certain microbial strains exhibit insecticidal effects in several insect species and hence that such extracts can advantageously be used as insect control products.
[0047] In all herein described aspects and embodiments - unless specified differently- "inhibit" or "decrease" or "suppress" or "reduce" are synonyms and refer to a statistically significant reduction in at least one feature and / or an at least 1%, 2%, 3%, 4% or 5% reduction or at least 6% reduction or at least 7% reduction or at least 8% reduction or at least 9% reduction or at least 10% reduction or at least 15% reduction or at least 20% reduction or at least 25% reduction or at least 30% reduction or at least 50% reduction or at least 75% reduction or at least a 100% reduction in at least one feature compared to a control or mock situation. In one embodiment, said feature is the growth, activity, feeding, fertility, reproduction, survival and / or development of the one or more (target) insect species. In another embodiment, said feature is the infestation, infection and / or damage of a plant, aerial plant part, root plant part, seed or any other plant part brought by the insect pest. In a further embodiment, said control or mock situation is a situation or condition wherein the target insect or plant, plant seed or other plant parts were not treated with any of the compositions or microbial strains herein disclosed (or a spore of the microbial strains or a fermentation product derived from a cell culture of the microbial strains). The skilled person is aware how a scientifically sound mock situation should be set up. "Treated" as used herein can be direct treatment (e.g. spraying plants or target insect) and / or indirect treatment (e.g. providing the substrate wherein the plant is growing with any one of the insecticidal compositions or the microbial strains of the application).
[0048] "Infestation" as used herein refers to a state where a plant is invaded or overrun by pests in significant numbers leading to damage, harm and / or disease and requires remedial action to prevent significant economic or aesthetical losses.
[0049] In all herein described aspects and embodiments - unless specified differently - "enhance" or "increase" or "improvement" refers to a statistically significant increase and / or an at least 1%, 2%, 3%, 4% or 5% increase or at least 6% increase or at least 7% increase or at least 8% increase or at least 9% increase or at least 10% increase or at least 15% increase or at least 20% increase or at least 25% increase or at least 30% increase or at least 50% increase or at least 75% increase or at least a 100% increase in the property being measured and compared to a control situation. Said control situation is a mock situation wherein any of the herein described compositions or microbial strains of the application (or a spore of the microbial strains or a fermentation product derived from a cell culture of the microbial strains) was not administered. In one embodiment, said property is plant growth, plant development, yield or any economically important crop related feature. The term "statistically significant" or "statistically significantly" different is well known by the person skilled in the art. Statistical significance plays a pivotal role in statistical hypothesis testing. It is used to determine whether the null hypothesis should be rejected or retained. It states that the results are obtained because of chance and are not supporting a real change or difference between two data sets. The null hypothesis is the default assumption that what one is trying to prove did not happen. In contrast the alternative hypothesis states that the obtained results support the theory being investigated. For the null hypothesis to be rejected (and thus the alternative hypothesis to be accepted), an observed result has to be statistically significant, i.e. the observed p-value is less than the pre-specified significance level a. The p stands for probability and measures how likely it is that the null hypothesis is incorrectly rejected and thus that any observed difference between data sets is purely due to chance. In most cases the significance level a is set at 0.05.
[0050] "Microbial" as used herein refers to microorganisms, wherein said microorganisms can include bacteria, archaebacteria, fungi, yeasts, mycorrhiza, microscopic eukaryotes (e.g. protozoa and algae), viruses, viroids or a combination thereof. A "microbial population" as used herein can thus refer to a synthetic or artificial collection of different microorganisms with distinct geographical origins. In various more particular embodiments of this application, "microbial" refers to "bacterial".
[0051] The terms "bacterium", "bacteria" or "bacterial" broadly refer in general to any prokaryotic organism, and may refer to an organism from either Kingdom Eubacteria (Bacteria), Kingdom Archaebacteria (Archaea), or both. In some cases, bacterial genera have been reassigned due to various reasons (such as, but not limited to, the evolving field of whole genome sequencing), and it is understood that such nomenclature reassignments are within the scope of any claimed genus. As used herein, "bacterial strain" (which may be abridged to "strain" where the context makes clear that a bacterial strain is meant) refers to any of the prokaryotic microorganism belonging to the same class of species, including the species. The term "strain" (such as for example in the phrase "bacterial strain") as a basic operational unit of microbial taxonomy, such as bacterial taxonomy, is frequently used to denote a population made up of the descendants of a single isolation in pure culture, usually made up of a succession of cultures ultimately derived from an initial single colony. Where a species encompasses two or more distinct isolates, the term "strain" may be used to refer to an isolate or group of isolates that can be distinguished from other isolates of the same genus and species by phenotypic characteristics or genotypic characteristics or both.
[0052] As used herein, "derived from" means directly isolated or obtained from a particular source or alternatively having identifying characteristics of a substance or organism isolated or obtained from a particular source. In the event that the "source" is an organism, "derived from" means that it may be isolated or obtained from the organism itself or culture broth, suspension, or medium used to culture or grow said organism. A compound or composition "derived from" or "obtainable from" means that the compound or composition may be isolated from or produced by a cell culture or a whole cell broth, or suspension, filtrate, supernatant, fraction, or extract derived from a cell culture or a whole cell broth.
[0053] The bacteria, bacterial species or bacterial strains of current application can be cultivated or fermented by shake flask cultivation or by small scale or large-scale fermentation (including but not limited to continuous, batch, fed-batch, or solid state fermentation) in laboratory or industrial fermenters performed in a suitable medium and under conditions allowing for bacterial cell growth. The fermentation or cultivation can take place in suitable nutrient medium comprising carbon and nitrogen sources and inorganic salts, using procedures known in the art. Suitable media are available from commercial sources or are prepared according to publications well-known in the art.
[0054] As used herein, the term "culture", "cell culture" or "whole cell culture" refers to a population of microorganisms that are propagated on or in media of various kinds and thus refers to a fluid, pellet, scraping, dried sample, lyophilizate or a support, container, or medium such as a plate, paper, filter, matrix, straw, pipette or pipette tip, fibre, needle, gel, swab, tube, vial, particle, etc. that contains any of the bacterial strains herein disclosed or a functional homolog thereof, preferably in an amount that exceeds that found in nature. In the present invention, an "isolated culture" of a microbial strain is a culture fluid or a scraping, pellet, dried preparation, lyophilizate, or a support, container, or medium that contains the bacterial strain of the application or the functional homolog thereof, in the absence of other microorganisms. In nature, a bacterial strain is typically part of a microbiome (e.g. plant or soil microbiome), consisting of more than thousands of microbial species.
[0055] A "spore" or "spores" refers to microbial structures that are generally viable, more resistant to environmental influences such as heat, pH, absence of nutrients and / or microbicidal agents than other forms of the same microbial species, and typically capable of germination and out-growth. Bacteria that are "capable of forming spores" are those bacteria comprising the genes and other necessary abilities to produce spores under suitable environmental conditions.
[0056] "CFU" or "cfu" as used herein refers to colony-forming unit. This unit is well-known by the person skilled in the art of microbiology (as well as the methodology how to determine the number of colonyforming units) and is used to estimate the number of viable microorganisms such as bacteria or bacterial cells in a sample. "Viable" or "live" is defined as the ability to multiply via binary fission under controlled conditions and thus to form colonies. Counting with colony-forming units requires culturing the microorganisms and counts only viable cells, in contrast with microscopic examination which counts all cells, living or dead. In order to reconstruct the evolutionary relationships and sequence identity of one bacterial isolate to another, phylogenetic approaches are used standardly exploiting the 16S sequence. The term "16S sequence" or synonymous terms such as "16S nucleotide sequence" "16S", "16S rDNA" or "16S rRNA" refer to the nucleic acid sequence, such as in particular the DNA sequence, of the 16S ribosomal RNA (rRNA) of a bacterium. 16S rDNA gene sequencing is a well-established method for studying phylogeny and taxonomy of bacteria. A full length 16S nucleic acid sequence is approximately 1500 nucleotides in length. In certain embodiments, the bacterial strain may comprise a single copy of the 16S rRNA gene. In certain embodiments, the bacterial strain may comprise more than one copy of the 16S rRNA gene, such as two, three or more (multicopy) copies of the 16S rRNA gene. In such embodiments where two or more 16S rRNA gene copies are found in the bacterial strain, at least one of these 16S rRNA gene copies complies with the sequence identity requirements specified in the present application, preferably two or more and preferably all of the 16S rRNA gene copies (each independently) comply with the stated sequence identity requirements. By means of an example and without limitation, where a bacterial strain comprises three 16S rRNA gene copies, at least one, preferably at least two, and more preferably all three 16S rRNA gene copies will, each independently, display at least 99.5% sequence identity to SEQ ID NO: 1, and may in certain preferred embodiments be identical. Conveniently, the 16S rRNA sequence can be determined by sequencing (e.g. Sanger sequencing) the 16S gene sequence(s) in the chromosomal DNA, which may be amplified (e.g. PCR amplified) using suitable amplification primers, such as in particular the Forward primer 27F: AGAGTTTGATCCTGGCTCAG (SEQ ID NO: 2) and Reverse primer 1492R: GGTTACCTTGTTACGACTT (SEQ ID NO: 3). Alternative methods to identify groups of derived and functionally identical or nearly identical strains include Multi-locus sequence typing (MLST), concatenated shared genes trees, Whole Genome Alignment (WGA), Average Nucleotide Identity (ANI) method, and MinHash (Mash) distance metric.
[0057] The term "defined by SEQ ID No. X" or "as depicted in SEQ ID No. X" as used herein refers to a biological sequence consisting of the sequence of amino acids or nucleotides given in the SEQ ID No. X or SEQ ID NO: X. For instance, a nucleotide defined in / by SEQ ID No. X consists of the nucleotide sequence given in SEQ ID No. X. A further example is a nucleotide sequence comprising SEQ ID No. X, which refers to a nucleotide sequence longer than the nucleotide sequence given in SEQ ID No. X but entirely comprising the nucleotide sequence given in SEQ ID No. X, or to a nucleotide sequence consisting of the nucleotide sequence given in SEQ ID No. X.
[0058] In this application, "sequence similarity", "sequence identity" and "sequence homology" are interchangeably used. The term "sequence identity" as used herein refers to the extent that sequences are identical on a nucleotide-by-nucleotide basis over a window of comparison. Thus, a "percentage of sequence identity" is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g., A, T, C, G, U) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity. A gap, i.e., a position in an alignment where a residue is present in one sequence but not in the other is regarded as a position with non-identical residues. Determining the percentage of sequence identity can be done manually, or by making use of computer programs that are available in the art. Examples of useful algorithms are PILEUP (Higgins & Sharp, CABIOS 5:151 (1989), BLAST and BLAST 2.0 (Altschul et al. J. Mol. Biol. 215: 403 (1990). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (http: / / www.ncbi.nlm.nih.gov / ).
[0059] According to some embodiments of the invention, the identity is a global identity, i.e., an identity over the entire nucleic acid sequences herein disclosed or the full length of the sequences provided and not over portions thereof. According to some embodiments, the identity is partial identity, i.e., an identity over certain percentages of the length of the nucleic acid sequences as described herein. According to certain exemplary embodiments, the identity betweenl6S rDNA sequences is calculated over at least 97%, at least 98%, at least 98.5%, at least 99% or at least 99.5% of the full length of SEQ ID No. 1, which resembles a query coverage of at least 97%, 98%, 98.5%, 99%, or 99.5%. As used herein, the term "query coverage" or "coverage" refers to a percentage that describes how much of the query sequence is included in the region aligned to the target sequence. According to a specific embodiment, the identity between 16S rDNA sequences is calculated over the full length of SEQ ID No. 1, resembling a 100% query coverage.
[0060] As used herein, the term "plant" refers to all plants, plant parts, seed, and plant populations, such as desirable and undesirable wild plants, weeds, cultivars, transgenic plants, and plant varieties. Cultivars and plant varieties can be plants obtained by conventional propagation and breeding methods that can be assisted or supplemented by one or more biotechnological methods such as by use of double haploids, protoplast fusion, random and directed mutagenesis, molecular or genetic markers or by bioengineering and genetic engineering methods. The embodiments disclosed herein may generally be used for any plant species, including, but not limited to, monocots and dicots. As used herein, the term "plant parts" refers to all above ground and below ground parts and organs of plants such as shoot, leaf, buds, blossom and root, whereby for example leaves, needles, stems, branches, blossoms, fruiting bodies, fruits and seeds, as well as roots, tubers, corms and rhizomes are included. Vegetative and generative propagating material, for example, cuttings, corms, rhizomes, tubers, runners and seeds are also plant parts. The term "insect" as used herein refers to small air-breathing arthropods of the class Insecta. The adult forms are characterized by a body divided into head, thorax, and abdomen, three pairs of legs, and typically two pairs of wings. Insects undergo metamorphosis, transitioning through various stages including egg, larva (caterpillar), pupa (chrysalis), and adult, with larvae being the immature feeding stage of the insect life cycle. Hence, "insect" as used herein encompasses eggs, larvae, juvenile and mature forms of insects. The biocontrol agents herein disclosed can target insects at any stage of their development. For example, insects can be targeted after the first instar, during the second instar, third instar, fourth instar, fifth instar, or any other developmental or adult growth stage. As used herein, the term "instar" is used to denote the developmental stage of the larval or nymphal forms of insects, well known to the person skilled in the art.
[0061] An "insect pest" as used herein refers to any insect or arthropod that causes visible or invisible damage to crops or ornamental plants that results in a suboptimal fitness, aesthetic damage and / or economic losses, pre-harvest and / or post-harvest. Insect pests include insects selected from the orders Coleoptera, Lepidoptera, Hemiptera, Diptera, Hymenoptera, Lepidoptera, Mallophaga, Homoptera, Hemiptera, Orthroptera, Thysanoptera, Trombidiformes, Dermaptera, Isoptera, Anoplura, Siphonaptera, Trichoptera, etc.
[0062] The term "insecticidal" refers to "anti-insect activity" or "insect controlling activity" and is used herein to mean any negative effect of an active ingredient, biological or chemical agent, microorganism or compound on the growth, activity, metabolism, feeding, fertility, reproduction, survival and / or development of at least one insect. In one embodiment, insecticidal means killing the insect that has been treated. In another embodiment, insecticidal means inducing a weight reduction, growth reduction, growth delay and / or development retardation of the insect that has been treated. In another or further embodiment, insecticidal means inducing a reduction in activity and / or reproduction of the insect that has been treated. Without wishing to be bound by theory, the insecticidal agent suppresses the growth, activity, metabolism, feeding, fertility, reproduction, survival and / or development of a target insect by interfering with the normal growth, activity, metabolism, feeding, fertility, reproduction, survival and / or development of the target insect.
[0063] The term "insecticide" or "insecticidal composition" is used herein to refer to a composition comprising an insecticidal active ingredient. The term "insecticidal active ingredient" refers to an active ingredient that - at an effective amount - has anti-insect activity and thus kills, controls, suppresses or otherwise adversely modifies the growth, activity, metabolism, feeding, fertility, reproduction, survival and / or development of one or more insect species, more particularly of a target insect species.
[0064] An "effective amount" refers to an amount sufficient to effect one or more desired results. An effective amount of an insecticide (equivalent to an insecticidally effective amount or an insect controlling amount) then refers to an amount that leads to a statistically significant adverse effect on insect growth, activity, metabolism, feeding, fertility, reproduction, survival and / or development of the one or more target insect species treated with the insecticide as compared to that of said insect species in a control situation. A control situation for assessing an insecticidal effect provides a reference point for measuring growth, activity, metabolism, feeding, fertility, reproduction, survival and / or development of the one or more target insect species in the absence of the insecticidal composition of the application. An effective amount can be administered in one or more administrations.
[0065] The term "controlling an insect pest" refers to one or more of inhibiting or reducing the growth, activity, feeding, fertility, survival, reproduction, and / or development of an insect or killing (i.e. causing the morbidity or mortality, or reduced fecundity) of an insect pest. As such, a plant treated with an agent that controls an insect pest may show a reduced infestation of insects, more particularly of the target insect or insect pest, or reduced damage caused by the insect pest by a statistically significant amount. Alternatively or additionally, application of an agent that controls an insect pest on a plant or plant part or on a substrate on or in which the plant is growing has a plant growth promoting effect due to the controlling effect of an insect pest that negatively affects plant growth and development.
[0066] The term "plant growth promoting" as used herein, refers to a promoting effect on a wide range of growth and development properties of cultured plants or crops, including but not limited to increased root development, increased leaf area, increased plant yield, increased fresh or dry weight, increased seed yield or fruit yield, increased seed germination, increased photosynthesis, increase in accumulated biomass of the plant, increased nitrogen fixation or increased efficiency of nutrients such as nitrogen, phosphorus or potassium.
[0067] The terms or definitions provided herein are solely to aid in the understanding of the invention. Unless specifically defined herein, all terms used herein have the same meaning as they would to one skilled in the art of the present invention. Practitioners are particularly directed to "Fermentation Microbiology and Biotechnology", 4thed., Edited by El-Mansi, Nielsen, Mousdale and Carlson, to "Handbook of Bacterial Biotechnology", 2nded., Edited by Arora (2003) CRC Press, to "Practical Handbook of Microbiology", 4thed., Edited by Green and Goldman (2021) CRC Press, and to Ausubel et al., Current Protocols in Molecular Biology (Supplement 47), John Wiley & Sons, New York (1999), for definitions and terms of the art. The definitions provided herein should not be construed to have a scope less than understood by a person of ordinary skill in the art.
[0068] INSECTICIDAL BIO-ACTIVE AGENT
[0069] By extensive experimental testing, the present inventors have found that certain microbial species exhibit insect killing effects or insect growth, activity, feeding, fertility, reproduction, survival and / or development reducing effects when administered to insects or to plants infested with insects, and more importantly plant damage reducing effects when administered to insects or to plants infested with insects. Hence such microbial species and fermentation products thereof can advantageously be used as insecticidal or insect control agents and plant protection agents. More particularly, bacterial species (classification Streptomyces) have been isolated of which both the extract and the supernatant of a cell culture of the bacterial species individually significantly reduces the growth or activity of a plethora of insect species, among which economically relevant insect pests such as caterpillars, spider mites, thrips and crop damaging beetles.
[0070] In a first aspect, the application provides an insecticidal composition, which owing to its effect can also alternatively be denoted an insect control composition, or a composition for controlling insect growth, activity, feeding, fertility, reproduction, survival and / or development, or a composition for protecting plants against insect damage, or a composition for reducing plant yield losses caused or induced by insect infestation. Said composition comprises a bioactive agent, wherein the bioactive agent comprises a quinoxaline antibiotic, also known as quinomycin antibiotic.
[0071] Quinoxaline antibiotics are a family of heterodetic cyclodepsipeptide antibiotics that contain a quinoxaline moiety, which is a bicyclic structure composed of a benzene ring fused to a pyrazine ring (Kuroya et al 1961 J Antibiotics, Ser A14). These colorless antibiotics are highly active against grampositive bacteria. Non-limiting examples of quinoxaline antibiotics are quinomycin A (also known as echinomycin), quinomycin C, triostin A and triostin C. The inventors of current application found that particularly quinomycin A and C have insecticidal activity. The family of quinomycins is characterized by a bicyclic peptide backbone and quinoxaline chromophores.
[0072] The structural formula of quinomycin C (CAS number 11001-74-4) is represented by Formula I
[0073] (Formula I). Quinomycin C is also known as antibiotic U48160 and BRN 1071168. Its molecular formula is C55H72N12O12S2 and molecular weight 1157.36 g / mol.
[0074] The structural formula of quinomycin A (CAS number 512-64-1) is represented by Formula II
[0075] (Formula II).
[0076] Quinomycin A is also known as echinomycin or NSC-13502. Its molecular formula is C51H64N12O12S2 and molecular weight 1101 g / mol.
[0077] Quinomycin C is an analog of echinomycin in which the LN-methylvalines are replaced by Ny-dimethyl- allo-isoleucines. Interestingly, although the structures of quinomycin A and C are similar, quinomycin C was found to be slightly but significantly more effective against insects and while quinomycin A induces limited phytotoxicity when sprayed on plant leaves, this was not observed for quinomycin C. Hence, from an agricultural and commercial point of view quinomycin C has clear and surprising advantages.
[0078] In particular embodiments, the bioactive agent from the insecticidal composition herein disclosed comprises at least one or more quinomycins. In more embodiments, the bioactive agent comprises at least quinomycin A or quinomycin C. In yet another particular embodiment, the bioactive agent comprises or consists of a combination of quinomycin A and quinomycin C. In yet another particular embodiment, the bioactive agent comprising or consists of at least quinomycin C. In yet another particular embodiment, the insecticidal composition herein disclosed comprises only one quinomycin antibiotic, wherein said only one quinomycin antibiotic is quinomycin C as represented in Formula I or any stereoisomer thereof. In one embodiment, said quinomycin antibiotic is produced synthetically or chemically. In a further embodiment, said insecticidal composition is a chemically or synthetically produced composition.
[0079] In another embodiment, said quinomycin antibiotic is a microbial product or is biologically produced. Hence, in another embodiment, said bioactive agent is a microorganism, a spore thereof and / or a fermentation product derived from a cell culture of said microorganism. Particularly, said microorganism produces at least one or more quinomycins. In another particular embodiment, the microorganism produces at least quinomycin A or quinomycin C. In yet another particular embodiment, the microorganism produces a combination of quinomycin A and quinomycin C. In yet another particular embodiment, the microorganism produces at least quinomycin C.
[0080] The quinomycin compounds disclosed herein may exist as one or more stereoisomers. The term "stereoisomer" refers to molecules that have the same molecular formula and the same bonding order of atoms but differ only in the 3-dimensional (3-D) spatial arrangement of the atoms. Throughout current application, when a disclosed compound is named or depicted by structure without indicating stereochemistry, it is understood that the name or structure encompasses all possible stereoisomers, including essentially pure stereoisomers, as well as combinations and mixtures thereof. Enantiomers and diastereomers are examples of stereoisomers. The term "enantiomer" refers to one of a pair of molecular species that are mirror images of each other and are not superimposable. When two enantiomers are present in a mixture composed of equimolar quantities of two enantiomeric species, the mixture is a racemic mixture or racemate. Racemates are thus mixtures of stereoisomers and are also envisaged herein when a disclosed compound is named or depicted by structure without indicating stereochemistry. The term "diastereomer" refers to stereoisomers that are not mirror images, but still differ in 3-D arrangement.
[0081] In a further embodiment, the microorganism produces at least 20 mg / l, at least 25 mg / l, at least 30 mg / l or at least 35 mg / l of quinomycin A and / or quinomycin C. In another further embodiment, the fermentation product derived from a cell culture of said microorganism comprises at least 20 mg / l, at least 25 mg / l, at least 30 mg / l or at least 35 mg / l of quinomycin A and / or quinomycin C. In another embodiment, the insecticidal composition comprises at least 20 mg / l, at least 25 mg / l, at least 30 mg / l or at least 35 mg / l of quinomycin A and / or quinomycin C.
[0082] In one embodiment, said microorganism is a fungus or fungal species. In another embodiment, said microorganism is a bacterium or bacterial species. In a particular further embodiment, said bacterium is a Streptomyces species. In a more particular embodiment, said bacterial species comprises a 16S rDNA sequence having at least 99.85%, at least 99.90% or 100% sequence identity to SEQ ID No. 1. In another more particular embodiment, said bacterial species comprises a 16S rDNA sequence having at least 99.30%, at least 99.40%, at least 99.45%, at least 99.50%, at least 99.60%, at least 99.65%, at least 99.70%, at least 99.75%, at least 99.85%, at least 99.90% or 100% sequence identity to SEQ ID No. 1, wherein said sequence identity is calculated over the full length of SEQ ID No. 1. In another or further embodiment, said bacterial species comprises a 16S rDNA sequence as depicted in in SEQ ID No. 1 or having 100% sequence identity to a 16S rDNA sequence from the bacterial strain deposited under the Budapest Treaty at the Polish Collection of Microorganisms on 2ndApril 2024 with accession number B / 00529. In yet another or further embodiment, said bacterial species has an average nucleotide identity (ANI) of at least 90.00%, at least 91.00%, at least 92.00%, at least 93.00% or at least 94.00% compared to the Streptomyces strain M25D9 with accession number B / 00529. In a most particular embodiment, said bacterial species has an average nucleotide identity (ANI) of at least 95.00%, at least 96.00%, at least 97.00%, at least 98.00% or at least 99.00% compared to the Streptomyces strain M25D9 with accession number B / 00529. In a particular embodiment, said ANI percentage is calculated over at least 1000 genes by making use of the BLAST algorithm.
[0083] "Average Nucleotide Identity" also referred herein as ANI is a descriptor of genetic relatedness. This descriptor is based on a large number of genes (ty pica I ly> 1000 genes in total), thereby increasing the robustness and resolution of extracted phylogenetic signals. The genomic sequence identity or %ANI can be determined by several methods well-known by the person skilled in the art. A non-limiting example is to first perform a whole-genome alignment between two genome sequences. To do so, the genomic DNA has to be extracted and quantified. To extract sufficient high-quality DNA for whole genome sequencing, many different methods including conventional procedures and the use of commercial kits, can be carried out. After that, whole genome sequencing can be performed with high- throughput DNA sequencing technology using benchtop instruments such as, but not limited to, 454 GS FLX Titanium / GS Junior (Roche), Genome Analyzer / HiSeq 2000 / MiSeq (Illumina), SOLiD / lon Torrent PGM (Life Technologies), or RS (Pacific Biosciences). The whole-genome alignment can then be done using bioinformatics tools like MUMmer, Mauve, or BLAST (Qi et al 2024 Front Microbiol 15). Next, the percentage identity between the aligned genomic regions is calculated. This represents the overall genomic sequence identity between the two strains. Tools like MUMmer or BLAST can provide the % identity directly (Qi et al 2024 Front Microbiol 15). Alternatively, the number of identical nucleotides across the entire aligned genomes can be calculated and divided by the total number of aligned nucleotides to calculate the % genomic sequence identity. For example, if the whole-genome alignment shows that 94% of the nucleotides are identical between the two bacterial strains, then the percent genomic sequence identity would be 94%. The BLAST calculation of ANI values, using the BLAST algorithm, is called ANIb. ANI values can be calculated by using the NUCmer program in the MUMmer software package and are called ANIm.
[0084] In another particular embodiment, said bacterial species comprises a 16S rDNA sequence having at least 99.10%, at least 99.20%, at least 99.30%, at least 99.40%, at least 99.45%, at least 99.50%, at least 99.60%, at least 99.65%, at least 99.70%, at least 99.75%, at least 99.85%, at least 99.90% or 100% sequence identity to SEQ ID No. 4, wherein said sequence identity is calculated over the full length of SEQ ID No. 4. In another or further embodiment, said bacterial species comprises a 16S rDNA sequence as depicted in in SEQ. ID No. 4 or having 100% sequence identity to a 16S rDNA sequence from the bacterial strain deposited under the Budapest Treaty at the BCCM-LMG on 3rdJune 2025 with accession number LMG P-34075. In yet another or further embodiment, said bacterial species has an average nucleotide identity (ANI) of at least 90.00%, at least 91.00%, at least 92.00%, at least 93.00% or at least 94.00% compared to the Streptomyces strain M11C5 with accession number LMG P-34075. In a most particular embodiment, said bacterial species has an ANI of at least 95.00%, at least 96.00%, at least 97.00%, at least 98.00% or at least 99.00% compared to the Streptomyces strain M11C5 with accession number LMG P-34075. In a particular embodiment, said ANI percentage is calculated over at least 1000 genes by making use of the BLAST algorithm.
[0085] In another or further embodiment, said bacterial strain produces a detectable and / or effective amount of at least quinomycin C. In another or further embodiment, said spore or said fermentation product comprises a detectable and / or effective amount of at least quinomycin C. In another or further embodiment, said insecticidal composition is a microbial insecticidal composition or bio-insecticidal composition.
[0086] In one embodiment, said bio-active agent has biocontrol activity, more particularly insecticidal activity, in the pre-harvest stage. "Pre-harvest stage" as used herein refers to the stage before the crop is harvested. Pre-harvest biocontrol thus relates to all activities to safeguard optimal plant growth in the ground or in open field and can comprise biocontrol treatments of seeds, aerial plant parts, root plant parts or in furrow applications of biocontrol agents. In another embodiment, said bio-active agent has biocontrol activity, more particularly insecticidal activity, in the post-harvest stage. "Post-harvest stage" refers to the stage of the crops or plant parts after these have been harvested and during which there is a need to preserve the quality and safety of the harvest.
[0087] In one embodiment, the inhibitory activity or insecticidal activity on the pest or insect is exerted directly by the bio-active agent, for example but without the intention to limit, by contacting the insect pest with the bio-active agent, or indirect by ingestion by the insect of plant material treated or covered by the bio-active agent.
[0088] The inventors of current application could also identify the biosynthetic gene cluster responsible for the production of quinomycin antibiotics in the bacterial strains of current application. The term "biosynthetic gene cluster" or "gene cluster" as used herein refers to a group of two or more genes that are physically clustered together in the genome, and are functionally related. The genes typically encode proteins involved in the same metabolic pathway. The genes or open reading frames (ORFs) can be located both the sense and antisense strand. "Clustered together" means that the ORFs are arranged in the genome close to each other, particularly at consecutive genomic positions, however it is not rare that there are some spacing irregularities wherein totally unrelated ORFs are located within a gene cluster.
[0089] The quinomycin C gene cluster as identified in M25D9 and its close relatives M12E3, M12E4, M11C5 and NBRC13836 consists of 20 genes. Hence, in a further particular embodiment, said bacterial strain that is the bio-active agent in the above-described insecticidal composition comprises the quinomycin biosynthetic gene cluster. In a further particular embodiment, said quinomycin biosynthetic gene cluster comprises one or more open reading frames (ORFs) encoding polypeptides sufficient to direct the synthesis of one or more quinomycin antibiotics, the ORFs being physically clustered together in the genome, wherein the polypeptides have at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90% sequence identity to one or more sequences from the list consisting of SEQ ID NO: 5-24. In a most particular embodiment, the quinomycin biosynthetic gene cluster comprises the ORFs qmcA, qmcB, qmcC, qmcD, qmcE, qmcF, qmcG, qmcH, qmcl, qmcJ, qmcK, qmcL, qmcM, qmcN, qmcO, qmcP, qmcQ, qmcR, qmcS and qmcT, the ORFs being physically clustered together in the genome, wherein the ORFs encode polypeptides having at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90% sequence identity to the corresponding amino acid sequences depicted in SEQ ID NO: 5-24.
[0090] In a most particular embodiment, the bacterial species that is part of the insecticidal composition as described above is the Streptomyces strain M25D9 as deposited under the Budapest Treaty at the Polish Collection of Microorganisms on 2ndApril 2024 with accession number B / 00529, or the Streptomyces strain M11C5 as deposited under the Budapest Treaty at the BCCM-LMG on 3rdJune 2025 with accession number LMG P-34075.
[0091] Also provided is an insecticidal composition comprising a fermentation product derived from a cell culture of one of the bacteria or bacterial species herein disclosed, and a surfactant to improve the uptake of said fermentation product by an insect or to prolong the presence of the insecticidal composition onto a plant or plant part. In another or further embodiment, said fermentation product derived from a cell culture of one of the bacterial strains herein disclosed has insecticidal activity, more particularly comprises at least quinomycin C.
[0092] Throughout the application, a fermentation product derived from a cell culture of any of the bacteria or bacterial species herein disclosed can be an extract, an extract fraction, a supernatant, a supernatant fraction, a filtrate, a whole cell broth or a bioactive substance endogenously produced by said bacteria or bacterial species. In a particular embodiment, said fermentation product has insecticidal activity, more particularly comprises at least quinomycin C. The term "extract" or synonyms "cell extract" or "lysate" refers to the liquid substance removed from cells. Microbial extracts are obtained by removing the cell walls and / or cell membranes of the microbial cells, a process known as lysis, thereby obtaining one or more endogenous products of the cultured microbial cells. Removing the cell walls and / or cell membranes of microbial cells (such as the bacterial species of the application) can be performed by several procedures which are well-known by the person skilled in the art. Non-limiting examples are the addition of chemicals to the culture (solvent, detergent, buffer, and / or organic solvent, for example), heating the culture, or induce cell lysis in a mechanical way. The extract and the cell debris can be separated from each other by centrifugation, filtration, or other methods known in the art. An extract can also be obtained by autolysis of the bacterial species. The extract may comprise a concentrated amount of an effective fermentation product (such as a compound or metabolite) compared to the concentration of the fermentation product in the cells prior to extraction. Non-limiting examples of an extract are a solvent extract, a supercritical fluid extract, a pressurized liquid extract, a microwave-assisted extract, an ultrasound assisted extract, an enzyme-assisted extract and other extracts well known by the skilled person. An "extract fraction" as used herein refers to a part, portion, fragment, segment, piece, or fraction of a whole, complete, or full extract of a microbial culture. An extract fraction can be obtained by fractionation for example by chromatography. In a particular embodiment, the extract fraction comprises quinomycin C. The extract or the extract fraction can be further purified using methods well- known in the art. In some embodiments, the extract is a cell-free or inactivated preparation of any of the bacteria or bacterial species as disclosed herein.
[0093] The term "supernatant" refers to the liquid broth remaining when cells grown in said broth are removed by centrifugation, filtration, sedimentation or other means well known in the art. In analogy with the term "extract fraction", "supernatant fraction" as used herein refers to a part, portion, fragment, segment, piece, or fraction of a whole, complete, or full supernatant of a microbial culture. In a particular embodiment, the supernatant fraction comprises quinomycin C.
[0094] As used herein, "filtrate" refers to the liquid from a whole cell broth culture that has passed through a membrane. Hence, filtrate is a particular form of the supernatant of said whole cell broth.
[0095] "Whole-cell broth" as used herein refers to the contents of a microbial bioreactor wherein the bacterial species of current application is grown and thus to the liquid culture comprising both the bacterial cells and the liquid fermentation medium including nutrients, waste, and other components present or produced during the fermentation or cell culture process.
[0096] In yet another particular embodiment, the application provides a bioactive substance endogenously produced by any of the bacteria or bacterial species of current application. As used herein, "bioactive substance" refers to a compound or product with a biological effect, and thus that modifies, causes, promotes, enhances, blocks, reduces, limits the production or activity of a biological process, or reacts with or binds to an endogenous molecule that has a biological effect. In line with current application, a "biological effect" may be - but is not limited to - one that impacts a biological process in / onto an insect, for example an insect from the Lepidoptera, Coleoptera or Trombidiformes order. Non-limiting examples of a biological effect include, for example, suppressing, inhibiting, limiting, or controlling growth, activity, feeding, fertility, reproduction, survival and / or development of or killing one or more insect species or target insect species such as undesirable plant insect pests. In one embodiment said bioactive substance is a compound or product produced by any of the bacteria or bacterial species of the application, such as quinomycin antibiotic. More particularly, the bioactive substance can be present in the above-described extract, extract fraction, supernatant, supernatant fraction, filtrate, or whole cell broth.
[0097] "Endogenously produced" as used herein refers to the bioactive substance that is produced by any of the bacteria or bacterial species of current application. Non-limiting examples of endogenously produced bioactive substance of the bacterial species of current application are a metabolite, a lipid, a fatty acid, a steroid, a carbohydrate, a protein, a peptide, an enzyme, an antibody, a nucleic acid, a chemical compound, a vitamin and a mineral. In a particular embodiment, said bioactive substance is a quinomycin antibiotic, more particularly quinomycin A and / or quinomycin C, most particularly comprises at least quinomycin C.
[0098] In particular embodiments, the fermentation product derived from a cell culture of any of the bacterial species of current application, more particularly the extract, extraction fraction, supernatant, supernatant fraction, filtrate, whole cell broth or bioactive substance endogenously produced by said bacterial species, may be diluted with another composition, such as water, buffer, fresh media and / or a formulation before using them for example to spray on plants to protect said plants against insect infestations. In other particular embodiments, said fermentation product may be concentrated. Such diluted or concentrated extracts, extraction fractions, supernatants, supernatant fractions, filtrates, whole cell broths or bioactive substances endogenously produced by any of the bacterial species of current application are still considered fermentation products derived from a cell culture of any of the bacterial species of current application.
[0099] Also provided is a kit comprising (i) any of the insecticidal compositions described herein; and (ii) a delivery system for applying said insecticidal composition to an insect, to a plant or to a part thereof or to the plant growth medium. In a further embodiment, said kit further comprises instructions for using the insecticidal composition. GENE CLUSTER
[0100] In another aspect of the invention, a biosynthetic gene cluster (BGC) is provided directing the production of one or more quinomycin antibiotics, particularly triostin and / or quinomycin, more particularly a quinomycin antibiotic selected from the list consisting of triostin A, triostin C, quinomycin A and quinomycin C, even more particularly quinomycin A and C.
[0101] In total 20 ORFs were identified in the quinomycin cluster from M25D9. These were named qmcA to qmcT according to their consecutive location in the genome (Table 3). A biosynthetic gene cluster for the production of triostin A has been identified previously in Streptomyces triostinicus (Praseuth et al. 2008 Biotechnol Prog 24) and for echinomycin production in S. lasaliensis (Watanabe et al. 2006 Nat Chem Biol 2). Interestingly, while the triostin (trs) and echinomycin (ecm) BGC both consist of 19 ORFs, the quinomycin (qmc) BGC identified in the bacterial strains disclosed herein comprises an additional ORF, more precisely qmcH encoding a quinomycin antibiotic biosynthesis mono-oxygenase (see Table 4) as depicted in SEQ ID No. 12, 32, 52, 72, and 92.
[0102] Biosynthetic gene clusters, although showing a certain level of conservation, can differ significantly in nucleic acid sequence without being affected in their technical effect. This is at least due to the degenerate or redundant genetic code, meaning that multiple codons can code for the same amino acid. But also on amino acid level, sequence differences are observed between polypeptides with the same function derived from close relatives. This is illustrated for strains M12E3, M12E4, M11C5 and NBRC13836 in Table 5, in which the percentage identity is shown to M25D9 on the level of each polypeptide of the quinomycin cluster. Hence, a strain can comprise a biosynthetic gene cluster comprising multiple amino acid differences compared to SEQ ID No. 5-24, 25-44, 45-64, 65-84 or 85- 104 and still be capable of producing quinomycin A and / or quinomycin C and thus be as effective as insect control agent. Hence, the current disclosure is broader than just the quinomycin gene cluster from the strains M25D9, M12E3, M12E4, M11C5 and NBRC13836. The current application provides also gene clusters that have a minimal number of differences on amino acid level compared to said strains, but importantly when expressed in a host cell still provide the host cell with a significant insecticidal activity when applied to a target insect.
[0103] According to Sato et al. (2013 Curr Opin Chem Biol 17) the Ecm 13, 12, 11, 2, 3 and 4 enzymes are needed to catalyze the transition of L-tryptophan to quinoxaline-2-carboxylic acid (QXC), while Ecm 1, 6, 7, 17 and 18 are needed to produce the quinomycin peptide core from QXC. Therefore, in one embodiment, a gene cluster is provided comprising qmcA, qmcB, qmcD, qmcE, qmcF and qmcG encoding amino acid sequences SEQ ID No. 5, 6, 8, 9, 10 and 11, variants or portions thereof. In a further embodiment, the gene cluster further comprises qmcH encoding for a mono-oxygenase with amino acid sequence SEQ ID No. 12, variants or portions thereof.
[0104] In another embodiment, a gene cluster is provided comprising qmcC, qmcM, qmcN, qmcl and qmcL encoding for amino acid sequences SEQ ID No. 7, 17, 18, 13 and 16, variants or portions thereof. In a further embodiment, the gene cluster further comprises qmcH encoding for a mono-oxygenase with amino acid sequence SEQ ID No. 12, variants or portions thereof.
[0105] In yet another embodiment, a gene cluster is provided comprising qmcA, qmcB, qmcC, qmcD, qmcE, qmcF, qmcG, qmcl, qmcL, qmcM and qmcN encoding amino acid sequences SEQ ID No. 5, 6, 7, 8, 9, 10, 11, 13, 16, 17 and 18, variants or portions thereof. In a further embodiment, the gene cluster further comprises qmcH encoding for a mono-oxygenase with amino acid sequence SEQ ID No. 12, variants or portions thereof.
[0106] In yet another embodiment, a gene cluster is provided comprising qmcA, qmcB, qmcC, qmcD, qmcE, qmcF, qmcG, qmcH, qmcl, qmcL, qmcK, qmcL, qmcM, qmcN, qmcO, qmcP, qmcQ, qmcR, qmcS and qmcT encoding amino acid sequences SEQ ID NO: 5-24, variants or portions thereof.
[0107] In one embodiment, the variants or portions retain the biological activity of the corresponding polypeptide. In a particular and further embodiment, said variants or portions of a specific amino acid sequence have at least 50.0%, at least 55.0%, at least 60.0%, at least 65.0%, at least 70.0%, at least 75.0%, at least 80.0%, at least 85.0%, or at least 90.0% sequence identity to said specific polypeptide. In yet another embodiment, variants or portions of SEQ ID No. 5-24 are SEQ ID No. 25-44, 45-64, 65- 84 and / or 85-104.
[0108] In another embodiment, a gene cluster is provided comprising: qmcA encoding an amino acid sequence having at least 94% identity to SEQ ID No. 5; qmcB encoding an amino acid sequence having at least 93% identity to SEQ ID No. 6; qmcC encoding an amino acid sequence having at least 94% identity to SEQ ID No. 7; qmcD encoding an amino acid sequence having at least 96% identity to SEQ ID No. 8; qmcE encoding an amino acid sequence having at least 96% identity to SEQ ID No. 9; qmcF encoding an amino acid sequence having at least 94% identity to SEQ ID No. 10; qmcG encoding an amino acid sequence having at least 92% identity to SEQ ID No. 11; qmcH encoding an amino acid sequence having at least 90% identity to SEQ ID No. 12; qmcl encoding an amino acid sequence having at least 92% identity to SEQ ID No. 13; qmcJ encoding an amino acid sequence having at least 96% identity to SEQ ID No. 14; qmcK encoding an amino acid sequence having at least 90% identity to SEQ ID No. 15; qmcL encoding an amino acid sequence having at least 93% identity to SEQ ID No. 16; qmcM encoding an amino acid sequence having at least 93% identity to SEQ ID No. 17; qmcN encoding an amino acid sequence having at least 92% identity to SEQ ID No. 18; qmcO encoding an amino acid sequence having at least 93% identity to SEQ ID No. 19; qmcP encoding an amino acid sequence having at least 98% identity to SEQ ID No. 20; qmc encoding an amino acid sequence having at least 92% identity to SEQ ID No. 21; qmcR encoding an amino acid sequence having at least 94% identity to SEQ ID No. 22; qmcS encoding an amino acid sequence having at least 93% identity to SEQ ID No. 23; and qmcT encoding an amino acid sequence having at least 92% identity to SEQ ID No. 24;
[0109] In a most particular embodiment, a gene cluster is provided comprising the ORFs qmcA, qmcB, qmcC, qmcD, qmcE, qmcF, qmcG, qmcH, qmcl, qmcJ, qmcK, qmcL, qmcM, qmcN, qmcO, qmcP, qmc , qmcR, qmcS and qmcT, the ORFs encoding amino acid sequences SEQ ID NO: 5-24, variants or portions thereof, wherein the variants or portions thereof have at least 91% or at least 92% sequence identity to SEQ ID NO: 5-24.
[0110] In yet another embodiment, the ORFs qmcA, qmcB, qmcC, qmcD, qmcE, qmcF, qmcG, qmcH, qmcl, qmcJ, qmcK, qmcL, qmcM, qmcN, qmcO, qmcP, qmc , qmcR, qmcS and qmcT, or variants or portions thereof, are physically clustered together on the chromosome. In yet another embodiment, the ORFs qmcA, qmcB, qmcC, qmcD, qmcE, qmcF, qmcG, qmcH, qmcl, qmcJ, qmcK, qmcL, qmcM, qmcN, qmcO, qmcP, qmc , qmcR, qmcS and qmcT, or variants or portions thereof, are distributed among 5, 4, 3 or 2 vectors, expression cassettes or plasmids. In yet another embodiment, the ORFs qmcA, qmcB, qmcC, qmcD, qmcE, qmcF, qmcG, qmcH, qmcl, qmcJ, qmcK, qmcL, qmcM, qmcN, qmcO, qmcP, qmc , qmcR, qmcS and qmcT, or variants or portions thereof, are present on one vector, expression cassette or plasmid.
[0111] Any of the above-described gene clusters is referred to as any of the gene clusters of the application.
[0112] As explained above, the herein disclosed BGC encodes components necessary for the production of one or more quinomycin antibiotics. The production can be performed in a host cell or in an in vitro transcription / translation system. An in vitro transcription-translation system, often abbreviated as IVTT, is a cell-free system that allows for the synthesis of proteins from a DNA template in a test tube. This technology essentially replicates the fundamental processes of gene expression, including transcription and translation, outside of a living cell. Both heterologous expression of gene clusters and cell-free production of secondary metabolites are established techniques well known by the person skilled in the art. By means of example a small subset of numerous references on the topic comprises Nah et al 2017 Front Microbiol 8, Libis et al 2022 Nat Comm 13, Moore et al 2023 Nat Prod Rep 40 and Buntru et al 2022 Front Plant Sci 12. Also provided is a vector, an expression cassette or a plasmid comprising any of the gene clusters of the application. Also provided is a host cell heterologously expressing any of the gene clusters of the application. "Heterologous expression" refers to the process of expressing a gene, a gene cluster or a part of a gene (cluster) in a host organism that does not naturally possess that gene, gene cluster or part of that gene (cluster). It is a fundamental technique in molecular biology and biotechnology that enables scientists to utilize genetic information from one organism within another.
[0113] STRAINS
[0114] In another aspect of the invention, an isolated bacterium or bacterial species, more particularly a Streptomyces species according to the proposed classification is provided.
[0115] In a first embodiment, said bacterium or bacterial species comprises a 16S rDNA sequence having at least 99.85%, at least 99.90% or 100% sequence identity to SEQ ID No. 1. In another embodiment, said bacterial species comprises a 16S rDNA sequence having at least 99.30%, at least 99.40%, at least 99.45%, at least 99.50%, at least 99.60%, at least 99.65%, at least 99.70%, at least 99.75%, at least 99.85%, at least 99.90% or 100% sequence identity to SEQ ID No. 1, wherein said sequence identity is calculated over the full length of SEQ ID No. 1. In another or further embodiment, said bacterial species comprises a 16S rDNA sequence as depicted in in SEQ ID No. 1 or having 100% sequence identity to a 16S rDNA sequence from the bacterial strain M25D9 deposited under the Budapest Treaty at the Polish Collection of Microorganisms on 2ndApril 2024 with accession number B / 00529.
[0116] In yet another or further embodiment, said bacterium or bacterial species has an average nucleotide identity (ANI) of at least 90%, at least 91%, at least 92%, at least 93% or at least 94% compared to the Streptomyces strain M25D9 with accession number B / 00529. In a most particular embodiment, said bacterium or bacterial species has an average nucleotide identity (ANI) of at least 95%, at least 96%, at least 97%, at least 98% or at least 99% compared to the Streptomyces strain M25D9 with accession number B / 00529. In a particular embodiment, said ANI percentage is calculated over at least 1000 genes by making use of the BLAST algorithm.
[0117] In a most particular embodiment, said bacterial species is the Streptomyces strain MED-B-M25D9 or a functional homologue thereof, wherein a representative culture of M25D9 has been deposited under the Budapest Treaty at the PCM on 2ndApril 2024 with Accession number B / 00529.
[0118] A "representative culture" of M25D9 as used herein refers to a culture obtained from bacterial strain M25D9 and that consists of the descendants of the original isolated bacterium. Although said descendants are genetically identical, because of spontaneous mutations in non-essential genomic regions that occur during the steps of culturing, and because of inevitable sequencing errors of state- of-the art sequencing technologies, duplicates of strain M25D9 will likely not have a 100% sequence identity on 16S level and / or on whole genome level. In one embodiment, the average technical error is 0.15% or less. This means that two bacterial cultures having 99.85% or more sequence identity will still be considered genetically identical. In another embodiment, the average technical error is 0.12% or less, or 0.10% or less, or 0.08% or less, or 0.06% or less, or 0.04% or less or 0.02% or less. This means that two bacterial cultures have at least 99.88% sequence identity, or at least 99.90%, or at least 99.92%, or at least 99.94%, or at least 99.96% or at least 99.98% will still be considered genetically identical.
[0119] The terms "functional homologue", "functional mutant", "functionally homologous", "functional variant" are grammatical equivalents that are used herein interchangeably and refer to a modification on nucleotide level (e.g., nucleotide substitution or mutation) of the bacterial strain of the invention resulting in a bacterial strain that is endowed with substantially the same ensemble of biological activities - particularly the capability to kill at least one type of insect or to control or inhibit the growth, activity, feeding, fertility, reproduction, survival and / or development of at least one type of insect, or the capability to protect plants from a deleterious effect of at least one insect pest, (e.g., reducing the plant damage with at least 5%, 10%, 20%, 40%, 50%, 75% or 100%) - as that of the bacterial strain of the invention and can be classified to the same bacterial species based on known methods of species / strain classifications as described herein. In one embodiment, said capability to kill at least one type of insect or to control or inhibit the growth, activity, feeding, fertility, reproduction, survival and / or development of at least one type of insect, or the capability to protect plants from a deleterious effect of at least one insect pest is at least due to the production of quinomycin A and / or quinomycin C by the functional homologue. The modification on nucleotide level can be man-made or evolutionary, e.g., during propagation with or without selection.
[0120] In one particular embodiment, said functional homologue of MED-B-M25D9 is a Streptomyces bacterium comprising a 16S rDNA sequence having at least 99.90% sequence homology to the 16S rDNA of M25D9, having an ANI of at least 95.0% to M25D9 and comprising any of the quinomycin gene clusters of current application. More particularly, said functional homologue of MED-B-M25D9 is a Streptomyces bacterium comprising a 16S rDNA sequence having at least 99.90% sequence homology to the 16S rDNA of M25D9, having an ANI of at least 96.0% to M25D9 and comprising any of the quinomycin gene clusters of current application. More particularly, said functional homologue of MED- B-M25D9 is a Streptomyces bacterium comprising a 16S rDNA sequence having at least 99.90% sequence homology to the 16S rDNA of M25D9, having an ANI of at least 97.0% to M25D9 and comprising any of the quinomycin gene clusters of current application. More particularly, said functional homologue of MED-B-M25D9 is a Streptomyces bacterium comprising a 16S rDNA sequence having at least 99.90% sequence homology to the 16S rDNA of M25D9, having an ANI of at least 98.0% to M25D9 and comprising any of the quinomycin gene clusters of current application. More particularly, said functional homologue of MED-B-M25D9 is a Streptomyces bacterium comprising a 16S rDNA sequence having at least 99.90% sequence homology to the 16S rDNA of M25D9, having an ANI of at least 99.0% to M25D9 and comprising any of the quinomycin gene clusters of current application. More particularly, said functional homologue of MED-B-M25D9 is a Streptomyces bacterium comprising a 16S rDNA sequence having 100% sequence homology to the 16S rDNA of M25D9, having an ANI of at least 95.0% to M25D9 and comprising any of the quinomycin gene clusters of current application. More particularly, said functional homologue of MED-B-M25D9 is a Streptomyces bacterium comprising a 16S rDNA sequence having 100% sequence homology to the 16S rDNA of M25D9, having an ANI of at least 96.0% to M25D9 and comprising any of the quinomycin gene clusters of current application. More particularly, said functional homologue of MED-B-M25D9 is a Streptomyces bacterium comprising a 16S rDNA sequence having 100% sequence homology to the 16S rDNA of M25D9, having an ANI of at least 97.0% to M25D9 and comprising any of the quinomycin gene clusters of current application. More particularly, said functional homologue of MED-B-M25D9 is a Streptomyces bacterium comprising a 16S rDNA sequence having 100% sequence homology to the 16S rDNA of M25D9, having an ANI of at least 98.0% to M25D9 and comprising any of the quinomycin gene clusters of current application. More particularly, said functional homologue of MED-B-M25D9 is a Streptomyces bacterium comprising a 16S rDNA sequence having 100% sequence homology to the 16S rDNA of M25D9, having an ANI of at least 99.0% to M25D9 and comprising any of the quinomycin gene clusters of current application.
[0121] In another particular embodiment, said functional homologue of MED-B-M25D9 is strain M12E3, M12E4, M12E5 or M11C5.
[0122] In another more particular further embodiment, said functional homologue of MED-B-M25D9 is directly or indirectly obtained by induced or spontaneous mutation of MED-B-M25D9 and produces a detectable amount of at least Formula I.
[0123] In a second embodiment, said bacterium or bacterial species comprises a 16S rDNA sequence having at least 99.1%, at least 99.20%, at least 99.30%, at least 99.40%, at least 99.45%, at least 99.50%, at least 99.60%, at least 99.65%, at least 99.70%, at least 99.75%, at least 99.85%, at least 99.90% or 100% sequence identity to SEQ ID No. 4, wherein said sequence identity is calculated over the full length of SEQ ID No. 4. In another embodiment, said bacterial species comprises a 16S rDNA sequence as depicted in in SEQ ID No. 4 or having 100% sequence identity to a 16S rDNA sequence from the bacterial strain deposited under the Budapest Treaty at the BCCM-LMG on 3rdJune 2025 with accession number LMG P-34075. In yet another or further embodiment, said bacterial species has an average nucleotide identity (ANI) of at least 90.0%, at least 91.0%, at least 92.0%, at least 93.0% or at least 94.0% compared to the Streptomyces strain M11C5 with accession number LMG P-34075. In a most particular embodiment, said bacterial species has ANI of at least 95.0%, at least 96.0%, at least 97.0%, at least 98.0% or at least 99.0% compared to the Streptomyces strain M11C5 with accession number LMG P-34075. In a particular embodiment, said ANI percentage is calculated over at least 1000 genes by making use of the BLAST algorithm.
[0124] In one embodiment, said bacterial species is the Streptomyces strain MED-B-M11C5 or a functional homologue thereof, wherein a representative culture of MED-B-M11C5 has been deposited under the Budapest Treaty at the BCCM-LMG on 3rdJune 2025 with Accession number LMG P-34075.
[0125] In one particular embodiment, said functional homologue of MED-B-M11C5 is a Streptomyces bacterium comprising a 16S rDNA sequence having at least 99.90% sequence homology to the 16S rDNA of M11C5, having an ANI of at least 95.0% to M11C5 and comprising any of the quinomycin gene clusters of current application. More particularly, said functional homologue of MED-B-M11C5 is a Streptomyces bacterium comprising a 16S rDNA sequence having at least 99.90% sequence homology to the 16S rDNA of M11C5, having an ANI of at least 96.0% to M11C5 and comprising any of the quinomycin gene clusters of current application. More particularly, said functional homologue of MED- B-M11C5 is a Streptomyces bacterium comprising a 16S rDNA sequence having at least 99.90% sequence homology to the 16S rDNA of M11C5, having an ANI of at least 97.0% to M11C5 and comprising any of the quinomycin gene clusters of current application. More particularly, said functional homologue of MED-B-M11C5 is a Streptomyces bacterium comprising a 16S rDNA sequence having at least 99.90% sequence homology to the 16S rDNA of M11C5, having an ANI of at least 98.0% to M11C5 and comprising any of the quinomycin gene clusters of current application. More particularly, said functional homologue of MED-B-M11C5 is a Streptomyces bacterium comprising a 16S rDNA sequence having at least 99.90% sequence homology to the 16S rDNA of M11C5, having an ANI of at least 99.0% to M11C5 and comprising any of the quinomycin gene clusters of current application. More particularly, said functional homologue of MED-B-M11C5 is a Streptomyces bacterium comprising a 16S rDNA sequence having 100% sequence homology to the 16S rDNA of M11C5, having an ANI of at least 9.05% to M11C5 and comprising any of the quinomycin gene clusters of current application. More particularly, said functional homologue of MED-B-M11C5 is a Streptomyces bacterium comprising a 16S rDNA sequence having 100% sequence homology to the 16S rDNA of M11C5, having an ANI of at least 96.0% to M11C5 and comprising any of the quinomycin gene clusters of current application. More particularly, said functional homologue of MED-B-M11C5 is a Streptomyces bacterium comprising a 16S rDNA sequence having 100% sequence homology to the 16S rDNA of M11C5, having an ANI of at least 97.0% to M11C5 and comprising any of the quinomycin gene clusters of current application. More particularly, said functional homologue of MED-B-M11C5 is a Streptomyces bacterium comprising a 16S rDNA sequence having 100% sequence homology to the 16S rDNA of M11C5, having an ANI of at least 98.0% to M11C5 and comprising any of the quinomycin gene clusters of current application. More particularly, said functional homologue of MED-B-M11C5 is a Streptomyces bacterium comprising a 16S rDNA sequence having 100% sequence homology to the 16S rDNA of M11C5, having an ANI of at least 99.0% to M11C5 and comprising any of the quinomycin gene clusters of current application.
[0126] In another more particular further embodiment, said functional homologue of MED-B-M11C5 is directly or indirectly obtained by induced or spontaneous mutation of MED-B-M11C5 and produces a detectable amount of at least Formula I. In a most particular embodiment, the differences in genetic sequence on whole genome level or onl6S rDNA level between the functional homologue and M25D9 or M11C5 are silent mutations.
[0127] In other most particular embodiments, said functional homologue of MED-B-M25D9 or MED-B-M11C5 or a fermentation product thereof exhibits a similar insecticidal effect compared to MED-B-M25D9 or MED-B-M11C5 respectively or a fermentation product thereof, when applied to a target insect or to a plant or plant part thereof on which said target insect feeds. In a particular embodiment, said "similar insecticidal activity" or a "similar insecticidal effect" is at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90% of the insecticidal activity of MED-B- M25D9 or MED-B-M11C5 or a fermentation product thereof. In a most particular embodiment, said similar insecticidal activity is an insecticidal activity that is not statistically significantly different from that of MED-B-M25D9 or MED-B-M11C5 or a fermentation product thereof.
[0128] From hereon, any of the above-described bacteria, bacterial species or bacterial strains will be referred to as the bacterial species of current application. The proposed taxonomic designation of the bacterial species of current application is a Streptomyces bacterial species.
[0129] In a most particular embodiment, any of the herein disclosed bacterium or bacterial species is resistant to or compatible with a biocide. A "biocide" as used herein is a chemical substance that can exert a controlling effect on an organism by chemical or biological means. Biocides include pesticides, such as fungicides, bactericides, insecticides, herbicides or other crop protection chemicals, and the like. Such compounds are discussed in detail elsewhere herein. A bacterium or bacterial species is compatible with a biocide (or product in general) when it is able to survive and / or reproduce in the presence of an effective amount of a biocide of interest (or of said product). Also provided is the bacterial species of current application wherein the growth of the species is compatible with one or more agricultural chemicals used to improve performance of biocides. Such agricultural chemicals include safeners, surfactants, stickers, spreaders, UV protectants, and suspension and dispersal aids. Safeners are chemicals that improve or modify the performance of insecticides. Surfactants, spreaders, and stickers are chemicals included in agricultural spray preparations that change the mechanical properties of the spray (for example, by altering surface tension or improving penetration or uptake). UV protectants improve the performance of agricultural biocides by reducing degradation by ultraviolet light. Suspension and dispersal aids improve the performance of biocides by altering their behaviour in a spray tank.
[0130] In another or further most particular embodiment, the bacterial species of current application, more particularly the Streptomyces strains with accession numbers B / 00529 or LMG P-34075 or any fermentation product derived from a culture of said bacterial species is not harmful to bees.
[0131] In a particular embodiment, the bacterial species of current application is an isolated species. The term "isolated" means that the bacterial species has been removed from its natural environment. "Isolated" thus implies a purification step. However, "isolated" does not necessarily reflect the extent to which the microorganism, more particularly the bacterium has been purified. In one embodiment, the bacterial species of current application is purified at least 2x, at least 5x, at least lOx, at least 50x or at least lOOx from the raw material from which it is isolated. As a non-limiting example, if a microorganism is isolated from soil as raw material, the microorganism can be isolated to an extent that its concentration in a given quantity of purified or partially purified material (e.g. soil) is at least 2x, at least 5x, at least lOx, at least 50x or at least lOOx higher than in the original raw material.
[0132] In another aspect of the application a culture of any of the bacteria or bacterial species of current application is provided. In one embodiment, said culture is an enriched culture of any of the bacterial species of current application. This is equivalent as saying that a culture of microorganisms, more particularly a bacterial culture, is provided, wherein said culture is enriched with any of the bacterial species of current application (e.g. Streptomyces strain M25D9) and wherein "enriched" means that the total microbial (or more particularly the total bacterial) population of said culture contains more than 50%, more than 60%, more than 70%, more than 80%, more than 90%, or more than 95% of any of the isolated bacterial species of current application, for example of the Streptomyces strain M25D9 with deposit accession number B / 00529 or a functional homologue thereof.
[0133] In another embodiment, a biologically pure culture of any of the bacterial species of current application is provided. As used herein, "biologically pure" refers to a culture which contains substantially no other microorganisms than the desired species and thus a culture wherein virtually all of the cells present are of the selected species. In practice, a culture is defined biologically pure if the total microbial (or more particularly the total bacterial) population of said culture contains at least more than 96%, at least more than 97%, at least more than 98% or at least more than 99% of any of the bacterial species of current application, for example of Streptomyces strain M25D9 with deposit accession number B / 00529 or a functional homologue thereof. When a biologically pure culture contains 100% of the desired microorganism a monoculture is reached. A monoculture thus only contains cells of the selected species or strain and is the most extreme form of a biologically pure culture.
[0134] In yet another embodiment, the total microbial (or more particularly the total bacterial) population of said culture of the bacterial species of the application comprises at least 1%, at least 5%, at least 10%, at least 25%, at least 50%, at least 75%, at least 80%, at least 85%, at least 90% or at least 95% living bacterial species of the application, for example living Streptomyces strain M25D9 or a functional homologue thereof.
[0135] In a particular embodiment, any of the bacterial species of current application may be lyophilized, freeze-dried or in a form selected from fresh cells, dried cells, dehydrated cells, devitalized cells, inactivated cells, frozen cells or cells in aqueous suspension or in a dry powder. In another particular embodiment, an aqueous slurry of the bacterial species of the current application or of any culture herein described comprising any of the bacterial species of the application is provided. In a further embodiment, the slurry is dried to a powder at a temperature which does not adversely affect viability of the bacterial strain. Also provided is a preparation or bacterial preparation comprising any of the bacterial species of current application.
[0136] Also provided is a fermentation product derived from any of the bacteria or bacterial species of current application. In one embodiment, said fermentation product is selected from the list consisting of an extract, an extract fraction, a supernatant, a supernatant fraction, a filtrate and a whole cell broth. Hence, in another particular embodiment, the application provides an extract or an extract fraction thereof of any of the bacterial species of current application, more particularly of Streptomyces strain M25D9, M11C5 or functional homologues thereof. Also provided is a supernatant or supernatant fraction of the culture or cell culture of any of the bacterial species of the application or the functional homologs thereof, more particularly of Streptomyces strain M25D9, M11C5 or functional homologues thereof. In another particular embodiment, the application provides a filtrate of a cell culture of the bacterial species of current application or of the functional homologs thereof. In yet another particular embodiment, the application also provides a whole cell broth collected from the fermentation of any of the bacterial species of the application. AGRICULTURAL COMPOSITIONS
[0137] In one aspect, the insecticidal bio-active agent herein disclosed, as well as any of the bacteria or bacterial species of the application or any fermentation product (such as extracts, filtrates, supernatants and alike) derived from a culture of said bacterial species, are applied to plants as a formulation or a composition, more particularly as an agricultural composition. An "agricultural composition" as used herein refers to a composition for agricultural purposes. Given that the composition is of use to control one or more insect species, also an insecticidal composition is provided or a plant protection product effective in reducing, suppressing or preventing damage caused to a plant by an insect pest. More particularly, the application provides a composition, an agricultural composition, a plant protection product effective in reducing or preventing damage caused to a plant by an insect pest, or an insecticidal composition for controlling, preventing, reducing, suppressing or inhibiting the growth, activity, feeding, survival, fertility, reproduction and / or development of one or more insect species, comprising a) a quinomycin antibiotic, more particular quinomycin A and / or quinomyc C; b) any of the bacterial species of current application, more particularly a Streptomyces species or the Streptomyces sasae strain of current application, or c) any fermentation product derived from the cell culture of said bacterial species or strain. In a particular embodiment, said one or more insect species refers to one or more target insects.
[0138] In one embodiment, a composition is provided comprising an effective amount of quinomycin antibiotics. In a particular embodiment, said effective amount has a concentration of at least 1 pg / ml, at least 1.5 pg / ml, at least 2.0 pg / ml, at least 2.5 pg / ml, at least 3 pg / ml, at least 5 pg / ml, at least 10 pg / ml, at least 20 pg / ml, at least 35 pg / ml, at least 50 pg / ml or at least 100 pg / ml. In another particular embodiment, said effective amount has a concentration of at least 1 mg / kg, at least 1.5 mg / kg, at least 2.0 mg / kg, at least 2.5 mg / kg, at least 3 mg / kg, at least 5 mg / kg, at least 10 mg / kg, at least 20 mg / kg, at least 35 mg / kg, at least 50 mg / kg or at least 100 mg / kg. In a particular embodiment, said quinomycin antibiotic is a combination of quinomycin A and quinomycin C. In another particular embodiment, said quinomycin antibiotic is a combination of quinomycin A and quinomycin C wherein the ratio of quinomycin A versus quinomycin C is at least 0.2, more particularly at least 0.5, most particularly greater than 1. In another particular embodiment, said quinomycin antibiotic is quinomycin C.
[0139] Also provided is a composition comprising any of the bacterial species of current application, more particularly the bacterial strain deposited under accession number B / 00529, LMG P-34075 or a functional homologue thereof. This is equivalent as saying that the composition comprises an inoculum of any of the bacterial species of the application, more particularly the bacterial strain deposited under accession number B / 00529, LMG P-34075 or a functional homologue thereof. As used herein, the term "inoculum" is intended to mean any form of bacterial cells, or spores, which is capable of propagating on or in a substrate when the conditions of temperature, moisture, etc., are favourable for bacterial growth. A "spore" generally refers to a microorganism in its dormant, protected state.
[0140] In another embodiment, a composition is provided comprising any of the bacterial species of current application further comprising a cryoprotectant and / or growth medium appropriate for Streptomyces species, more particularly a Streptomyces species. A "cryoprotectant" as used herein protects the bacterial cells by preventing the damaging effects of water crystals when cells are frozen, more particularly at -60°C, or -70°C or -80°C or in liquid nitrogen. Non-limiting examples of a cryoprotectant is glycerol and trehalose. In another embodiment, a composition is provided comprising any of the bacterial species or strains herein disclosed wherein the bacterial species of strain is lyophilized, freeze dried or in the form selected from fresh cells, dried cells, dehydrated cells, devitalized cells, inactivated cells, frozen cells or cells in aqueous suspension or in a dry powder. In one embodiment, the composition can further comprise a preservative.
[0141] In a particular embodiment, any of the compositions herein disclosed may be in the form of a liquid, a semisolid, a solid or a gas and / or in a form of a tablet, capsule, powder, dry powder, wettable powder, dust, spray dried formulation, granulate, aerosol, paste, syrup, slurry, suspension, emulsion or solution.
[0142] The skilled person knows that there are various formulation types available such as solid or liquid formulations. Agricultural composition can be formulated as powders for application in dry state (DS) or as powders that first need to be dispersed at high concentration in water before application as a slurry (i.e. water dispersible powder for slurry treatment (WS) or wettable powder (WP)). Another solid formulation type is the water dispersible granules (WG or WDG). The latter formulation consists of granules that are to be applied after disintegration and dispersion in water, thereby overcoming the dustiness of WS formulations.
[0143] Emulsifiable concentrate (EC) formulations are one of the most common liquid formulation types worldwide. EC formulations combine an active ingredient dissolved in a solvent with emulsifiers. When EC formulations are diluted with water they form a spontaneous emulsion, with emulsion droplets in the size range of 0.1 to 1.0 pm. The spontaneous emulsion can be achieved by selecting one or more surfactants based upon their ability to emulsify the solvent system, including the active ingredient, into water. It is by means of balancing the water soluble and oil soluble surfactant components at the water / solvent interface that a physically stable emulsion is formed. When sprayed, the dilute emulsion gives a uniform and accurate application of active ingredient on the plant or plant parts. Concentrated aqueous emulsion (EW) formulations can be considered as a safer and more environmentally friendly alternative to emulsifiable concentrates (EC). In an EW the continuous phase is water (as opposed to an organic solvent for ECs) which offers the benefit of lower phytotoxicity, no flashpoint concern, ease of handling, and a lower environmental impact. EW formulations are physically stabilized by specifically identified polymeric surfactants incorporated at an appropriate level. The emulsion has already been established in the formulation and is only diluted further before use.
[0144] Suspension concentrates (SC) formulations, also known as "flowables" (F), consist of a solid active ingredient dispersed in water. SCs have grown in popularity due to benefits such as the absence of dust, ease of use, and effectiveness when compared to other formulation types such as ECs and wettable powder (WP). To formulate a stable SC, the solid particles of the active ingredient must remain insoluble and suspended under all temperature conditions.
[0145] Flowable concentrates for seed treatment (FS) formulations are a modification of suspension concentrates (SC) with supplemental additives for adhesion to the seed surface and colourants as safety markers to indicate that a seed has been treated with a product. The active ingredients are typically mixed with a polymer or copolymer and fillers such as talc, graphite, aluminium or calcium salts. FS formulations are now the most popular type of seed treatment because they are concentrated formulations that can be directly applied on the seed or after dilution and are safer to apply as they are water based.
[0146] Microemulsion (ME) formulations are water-based formulations with a very small emulsified droplet size; this makes the formulation transparent. They are thermodynamically stable over a wide temperature range due to this very fine droplet size, usually between 0.01 and 0.05 pm. Therefore in contrast to other emulsion systems, where the oil droplets can slowly coalesce causing phase separation, in ME formulations this does not occur.
[0147] Suspoemulsion (SE) formulations are used to combine two active ingredients with very different physical properties into one formulation. They are a combination of suspension concentrate (SC) and concentrated aqueous emulsion (EW) technologies. The advantages are that it is possible to formulate multiple active ingredients together, broadening the spectrum of activity and eliminating the disadvantage of (tank-mix) incompatibility.
[0148] An oil dispersion (OD) formulation is a solid active ingredient dispersed in oil. The oil can vary from paraffinic to aromatic solvent types and vegetable oil or methylated seed oils. Ideally the active ingredient is uniformly suspended in the oil phase. ODs are an excellent delivery system for water sensitive active ingredients such as sulfonylureas. However, ODs have extended to other active ingredients due to their better spray retention, spreading and foliar uptake as the carrier oil often acts as an adjuvant.
[0149] A (micro)capsule suspension (CS) formulation is a combination of an active ingredient encapsulated in polymer shell suspended in water with a dispersant and wetting agent. CS formulations remain one of the most advanced formulation types for agricultural active compositions worldwide. These are typically next generation formulations. When CS formulations are diluted with water they form a spontaneous suspension, with particles in the size range of 0.1 to 20 pm. When sprayed, the dilute emulsion gives a uniform and accurate application of active ingredient on to the crop or seeds. It is possible to use CS formulations to give controlled or delayed release of active ingredients as well as provide better protection against toxic active ingredients or prevent degradation of material. For special seed treatment applications gel formulations (GF) are also used.
[0150] In a particular embodiment, a formulation is provided comprising the compound according to Formula I and / or II (i.e. quinomycin C and / or quinomycin A respectively) or any stereoisomer thereof, and / or any of the bacterial strains of the application or spore thereof and / or any fermentation product of any of the bacterial strains of the application, wherein said formulation is a dry state formulation, a wettable powder formulation, a water dispersible granule formulation, an emulsifiable concentrate formulation, a concentrated aqueous emulsion formulation, a suspension concentrate formulation, a flowable concentrate formulation, a microemulsion formulation, a suspoemulsion formulation, an oil dispersion formulation, or a (micro)capsule suspension formulation. In a most particular embodiment, said formulation is a suspension concentrate, an emulsifiable concentrate or a suspoemulsion.
[0151] In a particular embodiment, any of the bacterial species of current application may be lyophilized, freeze-dried or in the form selected from dried cells, dehydrated cells, devitalized cells, inactivated cells, frozen cells or cells in artificial suspension or in a dry powder before it is used in the processing of the composition. In another particular embodiment, an aqueous slurry of the bacterial species of the current application is provided, which is optionally dried to a powder at a temperature which does not adversely affect viability of the bacteria. The powder may then be mixed with an agriculturally compatible carrier. In other embodiments, a liquid suspension or slurry of the bacterial species of current application may be applied to an absorbent material, e.g. a granular mass. In embodiments wherein the composition is a powder (e.g. a wettable powder), a liquid, such as water, may need to be added to the powder before application, e.g. to the soil. Also provided is an inert material or an organic material or an inorganic material comprising an inoculum of the bacterial species of the application.
[0152] In one embodiment, any of the compositions described herein further comprises an agriculturally compatible carrier. Said carrier can be inert (e.g. a mineral carrier or a detectable agent or label or liquid carrier) or active (e.g. a fertilizer), but should allow the bio-active ingredient (e.g. quinomycin C) or the bacterial or Streptomyces species of the application or any insecticidal fermentation product derived thereof to remain viable or efficacious. An "agriculturally compatible carrier" may be a natural or synthetic, organic or inorganic material with which the active ingredient (e.g. the bacterial species of the application or a fermentation product of the culture of any of the bacterial species or strain of the application) are combined to facilitate its application on one or more plants, plant parts, plant seeds or to the plant growth medium or to one or more insect species, more particularly target insect species. Said "agriculturally compatible carrier" which can be regarded as a vehicle, is generally inert and it must be acceptable in agriculture. Thus, the phrase "agriculturally compatible" denotes a substance that can be used routinely under field conditions without interfering with growers' planting or spraying equipment, and without adversely influencing crop development or the desired ecological balance in a cultivated area.
[0153] The carrier may be any one or more of a number of carriers that confer a variety of properties, including increased stability, wettability, dispersibility, etc. The agriculturally compatible carrier can be solid. Solid carriers can include but are not limited to clays, natural or synthetic silicates, silica, resins, waxes, solid fertilizers, a polymer, a granular mass, perlite, a perlite granule, peat, a peat pellet, soil, vermiculite, charcoal, sugar factory carbonation press mud, rice husk, carboxymethyl cellulose, fine sand, calcium carbonate, flour, alum, a starch, talc, polyvinyl pyrrolidone, or a combination thereof. The carrier can be a mineral carrier. The carrier can be derived from organic waste material such as biomass residues, compost or manure.
[0154] The agriculturally compatible carrier can be a liquid. In one embodiment, the liquid carrier is water, sugar water, diluted or non-dilute growth medium to culture the bacterial species of the application. Non-limiting examples of suitable growth media for said bacterial species include Yeast Malt medium (comprising yeast extract, malt extract, dextrose, peptone and agar), Tryptic Soy Broth (TSB), Nutrient Agar (containing beef extract and peptone), Starch Casein Agar, Glycerol Asparagine Agar.
[0155] Other non-limited examples of liquid carriers can include but are not limited to alcohols, ketones, petroleum fractions, oils, aromatic or paraffinic hydrocarbons, chlorinated hydrocarbons, liquefied gases, or a combination thereof. More particularly, the agriculturally compatible carrier can include a dispersant, a surfactant, an additive, a thickener, an anti-caking agent, residue breakdown, a composting formulation, a granular application, diatomaceous earth, a coloring agent, a stabilizer, a preservative, a polymer, a coating, or a combination thereof.
[0156] The additive can comprise an oil, a gum, a resin, a clay, a polyoxyethylene glycol, a terpene, a viscid organic, a fatty acid ester, a sulfated alcohol, an alkyl sulfonate, a petroleum sulfonate, an alcohol sulfate, a sodium alkyl butane diamate, a polyester of sodium thiobutant dioate, a benzene acetonitrile derivative, a proteinaceous material, or a combination thereof. The proteinaceous material can include a milk product, wheat flour, soybean meal, blood, albumin, gelatin, or a combination thereof. The thickener can comprise a long chain alkylsulfonate of polyethylene glycol, polyoxyethylene oleate or a combination thereof. The surfactant can contain a heavy petroleum oil, a heavy petroleum distillate, a polyol fatty acid ester, a polyethoxylated fatty acid ester, an aryl alkyl polyoxyethylene glycol, an alkyl amine acetate, an alkyl aryl sulfonate, a polyhydric alcolhol, an alkyl phosphate, or a combination thereof. The anti-caking agent can include a sodium salt such as a sodium sulfite, a sodium sulfate, a sodium salt of monomethyl naphthalene sulfonate, or a combination thereof, or a calcium salt such as calcium carbonate, diatomaceous earth, or a combination thereof.
[0157] The carrier can also be a slurry, optionally comprising a sticking agent capable of sticking the inoculum to the substrate of interest, for example an inert substrate or to a plant part such as a leaf, fruit or flower. Non-limiting examples of sticking agents include alginate, mineral oil, syrup, arabic gum, honey, methyl cellulose, milk, wallpaper paste, and combinations thereof. One of the ordinary skills in the art can readily determine the appropriate carrier to be used taking into consideration factors such as a particular bacterial strain, plant to which the inoculum is to be applied, type of soil, climate conditions, whether the inoculum is in liquid, solid or powder form, and the like.
[0158] The agriculturally compatible carrier can also include a fertilizer, a micronutrient fertilizer material, an insecticide, an herbicide, a plant growth regulator, a fungicide, a bactericide, a molluscicide, an algicide, a bacterial inoculant, a bacterial inoculant, or a combination thereof. Non-limiting examples of fertilizers, micronutrient fertilizers, insecticide, herbicides, fungicides, plant growth regulators, bacterial or bacterial inoculants are provided below. As way of example any of the bacterial strains of the current application may be mixed with an agriculturally compatible carrier.
[0159] In a particular embodiment, any of the compositions herein disclosed may be in the form of a liquid, a solid, a semi-solid, a gel, a slurry, a cell paste, tablets, capsules, granules, pellets, a powder such as dry powder or wettable powder, wettable granules, a fluid, a dry fluid, an emulsion, a suspension, a solution or a dispersion. Each possibility represents a separate embodiment of the present invention. A "cell paste" comprises a population of cells that has been centrifuged and / or filtered or otherwise concentrated. Non-limiting examples of the above provided compositions in practice are soluble powders, dry flowables, aqueous flowables, wettable dispersible granules, emulsifiable concentrates, aqueous suspensions, a fertilizer granule, a sprayable formulation, an agrochemical formulation.
[0160] In particular embodiments, a composition according to the present invention can be in the form of an aerosol; a bait for pollinators dispersion; a dust; a dry flowable; an emulsifiable; an emulsifiable concentrate; a flowable; a granule; a microencapsulated; a pellet; a soluble powder; a wettable powder; a water-dispersible granule. More specifically, the composition can be in the form of a grain bait; a bait concentrate; a capsule suspension for seed treatment; an encapsulated granule; a capsule suspension; a dispersible concentrate; a dispersible powder; a powder for dry seed treatment; an emulsifiable concentrate; an emulsion or an water-in-oil emulsion for seed treatment; an emulsion; an oil in water; a fine granule; a flowable concentrate for seed treatment; a granular bait; a microgranule; a flo-dust; a granule; a solution for seed treatment; a micro-emulsion; a microgranule; an oil dispersion; an oil miscible flowable concentrate; an oil miscible liquid; an oil dispersible powder; a paste; a seed coated with pesticide; a suspension concentrate; a suspo-emulsion; a water soluble granules; a soluble concentrate; a water soluble powder; a water soluble powder for seed treatment; an ultra-low volume suspension; a tablet; a technical material; a technical concentrate; a water- dispersible granular; a wettable powder; a wettable dispersible powder for slurry seed treatment.
[0161] The agricultural composition can be formulated in any form suitable for applying the composition to an insect, to a plant or a plant part thereof or to the plant habitat as is known in the art. According to certain embodiments, the agricultural composition is formulated in a form selected from the group consisting of an emulsion, a colloid, a dust, a granule, a pellet, a powder, a spray, pressurized form, a pressurizable form, and a solution. Each possibility represents a separate embodiment of the present invention. According to certain embodiments, the formulation further comprises at least one of a stabilizer, a tackifier, a preservative, a carrier, a surfactant, and a combination thereof. Each possibility represents a separate embodiment of the present invention.
[0162] According to certain embodiments, the concentration in the composition e.g., preparation, formulation, coated seed etc. is 102CFU to 109CFU / seed or 102CFU-109CFU / gram of the composition (e.g., powder) or 102CFU-109CFU / ml of a composition.
[0163] According to some embodiments, any of the bacterial species of the application is applied to plants or plant substrates in need of an insecticidal treatment in a liquid formulation at a concentration range of from about 102CFU / ml to about 109CFU / ml, particularly from about 103CFU / ml to about 108CFU / ml or from about 104CFU / ml to about 10sCFU / ml, more particularly from about 105CFU / ml to 107CFU / ml.
[0164] In dry formulations such as cell pastes, wettable powders, or spray dried formulations, any of the bacterial species of the application is applied at a concentration range of from about 102CFU / g to about 109CFU / g, particularly from about 103CFU / g to about 108CFU / g or from about 104CFU / g to about 10sCFU / g, more particularly from about 105CFU / g to 107CFU / g.
[0165] In another particular embodiment, any composition disclosed in current application - including the compositions comprising a quinomycin antibiotic, such as quinomycin A and / or quinomycin C, or comprising any of the bacterial species of the application or comprising a fermentation product of the culture of said bacterial species - is provided as an agricultural composition, more particularly an insecticidal composition or a composition for controlling insects, even more particularly a sprayable agricultural or insecticidal composition. Controlling insects refers to inhibiting, preventing, suppressing, reducing the growth and / or development of one or more unwanted insect species, more particularly target insect species from the Lepidoptera, Coleoptera, Trombidiformes and / or Thysanoptera order. The composition or "insecticidal composition" herein provided can include a further insecticide, if said insecticide is used to remove unwanted insects or prevent plant damage because the presence of insects. Non-limiting examples of a further insecticide are an organophosphate, a carbamate, a natural or synthetic pyrethroid, oils, botanical extracts, inorganic compounds, organochlorines, neonicotinoids, avermectins, organosulfur, organotins, an acaricide, an alkyl phthalate, boric acid, a borate, a fluoride, sulfur, a haloaromatic substituted urea, a hydrocarbon ester, a fatty acid, a biologically-based insecticide such as an insecticide comprising Bacillus thuringiensis or insecticidal compounds thereof, or a combination thereof.
[0166] Other non-limiting example of a further insecticide and insecticides that can be used in the various methods and compositions disclosed herein include imidacloprid, beta-cyfluthrin, cyantraniliprole, diazinon, lambda-cyhalothrin, methiocarb, pymetrozine, pyrifluquinazon, spinetoram, spirotetramat, thiodicarb, and Ti-435, carbamates, sodium channel modulators / voltage dependent sodium channel blockers, pyrethroids such as DDT, oxadiazines such as indoxacarb, acetylcholine-receptor agonists / antagonists, acetylcholine-receptor-modulators, nicotine, bensultap, cartap, chloronicotyinyls such as acetamiprid, bifenthrin, clothianidin, dinotefuran, imidac loprid, nitenpyram, nithiazine, thiacloprid, and thiamethoxam, spinosyns such as spinosad, cyclodiene organochlorines such as camphechlor, chlordane, endosulfan, gamma-HCH, HCH, heptachlor, lindane, methoxychlor, fiproles such as acetoprole, ethiprole, fipronil, vaniliprole, chloride-channel, 6.1 mectins such as avermectin, emamectin, emamectin-benzoate, ivermectin, and milbemycin, juvenile -hormone mimics such as diofenolan, epofenonane, fenoxycarb, hydroprene, kinoprene, methoprene, pyriproxyfen, and triprene, ecdysone agonists / disruptors, diacylhydrazine, chromafenozide, halofenozide, methoxyfenozide, tebufenozide, chitin biosynthesis inhibitors, benzoylureas such as bistrifluron, chlorfluazuron, diflubenzuron, fluazuron, flucycloxuron, flufenoxuron, hexaflumuron, lufenuron, novaluron, noviflumuron, penfluron, teflubenzuron, triflumuron, buprofezin, cyromazine, oxidative phosphorylation inhibitors, ATP disruptors, diafenthiuron, organotins such as azocyclotin, cyhexatin, fenbutatin-oxide, pyrroles such as chlorfenapyr, dinitrophenols such as binapacryl, dinobuton, dinocap, DNOC, site-1 electron transport inhibitors, METI's such as fenazaquin, fenpyroximate, pyrimidifen, pyridaben, tebufenpyrad, tolfenpyrad, hydramethyinon, dicofol, rotenone, acequinocyl, fluacrypyrim, spirodiclofen, spiromesifen, tetramic acids, carboxamides such as flonicamid, octopaminergic agonists such as amitraz, magnesium-stimulated ATPase inhibitors such as propargite, BDCA's such as N2-[l,l-dimethyl-2-(methylsulfonyl)ethyl]-3-iodo-NI-[2-methyl-4-[l,2,2,2-tetrafluoro-l- (trifluoromethyl)ethyl]phenyl]-l, 2-benzene, nereistoxin analogues such as thiocyclam hydrogen oxalate, and thiosultap sodium. Preferably the insecticide is one or more of chlorpyrifos and tefluthrin.
[0167] The composition, agricultural composition or insecticidal composition as herein provided can also comprise a fertilizer, a micronutrient fertilizer material, an herbicide, a plant growth regulator, an elicitor, a fungicide, a molluscicide, an algicide, a bacterial inoculant, a fungal inoculant, or a combination thereof.
[0168] The bacterial inoculant can comprise a bacterial inoculant of the family Glomeraceae, a bacterial inoculant of the family Claroidoglomeraceae, a bacterial inoculant of the family Acaulosporaceae, a bacterial inoculant of the family Sacculospraceae, a bacterial inoculant of the family Entrophosporaceae, a bacterial inoculant of the family Pacidsproraceae, a bacterial inoculant of the family Diversisporaceae, a bacterial inoculant of the family Paraglomeraceae, a bacterial inoculant of the family Archaeosporaceae, a bacterial inoculant of the family Geosiphonaceae, a bacterial inoculant of the family Ambisporacea, a bacterial inoculant of the family Scutellosproaceae, a bacterial inoculant of the family Dentiscultataceae, a bacterial inoculant of the family Racocetraceae, a bacterial inoculant of the phylum Basidiomycota, a bacterial inoculant of the phylum Ascomycota, a bacterial inoculant of the phylum Zygomycota, a bacterial inoculant of the genus Glomus or a combination thereof. The bacterial inoculant can include a bacterial inoculant of the genus Rhizobium, another bacterial inoculant of the genus Bradyrhizobium, bacterial inoculant of the genus Mesorhizobium, bacterial inoculant of the genus Azorhizobium, bacterial inoculant of the genus Allorhizobium, bacterial inoculant of the genus Burkholderia, bacterial inoculant of the genus Sinorhizobium, bacterial inoculant of the genus Kluyvera, bacterial inoculant of the genus Azotobacter, bacterial inoculant of the genus Pseudomonas, bacterial inoculant of the genus Azosprillium, bacterial inoculant of the genus Bacillus, bacterial inoculant of the genus Streptomyces, bacterial inoculant of the genus Paenibacillus, bacterial inoculant of the genus Paracoccus, bacterial inoculant of the genus Enterobacter, bacterial inoculant of the genus Alcaligenes, bacterial inoculant of the genus Mycobacterium, bacterial inoculant of the genus Trichoderma, bacterial inoculant of the genus Gliocladium, bacterial inoculant of the genus Klebsiella, or a combination thereof.
[0169] In a most particular embodiment, the composition or agricultural composition or insecticidal composition as provided herein is not harmful to bees.
[0170] The composition according to the present invention can be prepared according to various processes known to a person skilled in the art, for example by a method chosen among spray dry, extrusion, fluidized-bed granulation with dehydration, freeze-drying, emulsion process, suspension in mixture with one or more chemical compounds and / or biological agents and / or with one or more co- formulants, described before.
[0171] In another embodiment, the present invention provides a kit comprising (i) any of the agricultural compositions described above and herein, comprising any of the bacterial species, lysates, extracts, supernatants or fermentation products thereof as described herein; and (ii) a delivery system for applying said agricultural composition to an insect, to a plant or to a part thereof or to the plant growth medium and / or (iii) optionally instructions for using the agricultural composition.
[0172] According to certain embodiments, the instructions for using the agricultural composition comprise instructions for the amounts and frequency of applying the agricultural composition as to reduce or prevent damage caused to the plant by an insect pest.
[0173] APPLICATIONS
[0174] The bacteria or bacterial species of current application, spores thereof and / or fermentation products derived from a cell culture of said bacteria or bacterial species (e.g., extracts, supernatants or whole cell broths) or any of the compositions herein disclosed are effective in inhibiting the activity, growth, feeding, fertility, reproduction, survival and / or development of insect pests, more particularly of plant insect pests, in the field, greenhouses or plant growth cabinets. Therefore, in another aspect of the invention, the use is provided of any of the compositions herein disclosed as an insecticide or alternatively phrased for controlling (more precisely inhibiting or reducing) growth, activity, feeding, fertility, reproduction, survival and / or development of one or more insect species or target insect pests. Also provided is the use of quinomycin antibiotics as an insecticide, more particularly the use of quinomycin C for controlling (more precisely inhibiting or reducing) growth, activity, feeding, fertility, reproduction, survival and / or development of one or more insect species or target insect pests. Also provided is the use of any of the bacteria herein disclosed, of the extracts, supernatants, whole cell broths and / or other fermentation products derived from a culture of said bacterial species or of any composition herein described, for controlling growth, activity, feeding, fertility, reproduction, survival and / or development of one or more insect species or target insect pests or for inhibiting the activity, growth, feeding, fertility, reproduction, survival and / or development of one or more plant insect pests. Also provided is a method of inhibiting or reducing the activity, growth, feeding, fertility, reproduction, survival and / or development of one or more insect species, plant insect pests or target insects, wherein the method comprises the step of administering 1) any of the bacteria or bacterial species disclosed herein or a spore thereof, or 2) a fermentation product derived from a cell culture of said bacteria or bacterial species or 3) any of the compositions herein disclosed, particularly a composition comprising at least quinomycin C, to said one or more insect species, plant insect pests or target insects or to the substrate wherein said one or more insect species, plant insect pests or target insects are present. In a further particular embodiment, the method comprises a further step of determining or analyzing or measuring the efficacy of the application, i.e. the insecticidal effect of the application. In one embodiment, said determining the insecticidal effect of the application can be an assessment of the target insects on the plants or in the field. Non-limiting examples of said assessment comprise the use of traps, such as glue traps, sticky traps, sticky cards or glue plates, or visual scoring of the presence of dead insects. In another embodiment, evaluating the insecticidal effect can be an assessment of the plants or crops for which the application was performed. Non-limiting examples of said assessment comprise determining the plant damage caused by the insect, or analyzing certain plant parameters such as the presence of lesions, chlorosis, necrosis or wilting, to evaluate the absence or presence of stress and thus of the general fitness of the plant. Assessment of the insecticidal activity can also be done in vitro or in growth chamber or small contained cabinets, as explained in the Example section below and / or according to the knowledge and expertise of the person skilled in the art of entomology and / or biocontrol.
[0175] Also provided is a method of decreasing insect infestation in a crop or in an agricultural plant field comprising the step of applying to the crop or to the field an effective amount of any of the herein disclosed compositions, any of the bacteria herein disclosed or a fermentation product derived from a cell culture of any of the bacteria herein disclosed, optionally comprising the step of determining the effect of the application on the insect infestation.
[0176] Also provided is a method of treating plants that are infested with a target insect, comprising the step of spraying any of the insecticidal compositions herein disclosed to said plants and determining the effect of the spraying on the target insect and / or on the treated plants.
[0177] Also provided is a method of reducing plant damage risk, or of reducing insect damage risk to a plant or of promoting plant growth comprising the step of applying to the plant and / or substrate used for growing said plant an effective amount of any of the insecticidal compositions herein disclosed, optionally comprising the step of determining the effect of the application on the insect infestation, plant growth and / or plant damage.
[0178] As used herein, the phrase "inhibiting the growth, activity, feeding, fertility, reproduction, survival and / or development" of an insect pest or a target insect is interchangeably used with "having insecticidal activity". In the most extreme situation "having insecticidal activity" means "killing or destroying" the insect pest or target insect. In general, an effective amount of any of the insecticidal compositions herein disclosed (comprising e.g. the bacterial strain of the invention, its functional homologs and / or fermentation products thereof) is capable of killing, destroying, preventing, reducing, suppressing or controlling a population of target insects with at least about 3%, at least about 4%, at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% more as compared to the population of an insect of the same species not exposed to, not being in contact with or not consuming the effective amount of said insecticidal composition when grown under the same (e.g. identical) growth conditions; and / or when compared to the initial population of the target insects prior to being exposed to, contacted with or fed with said insecticidal composition.
[0179] The inhibitory activity can be direct (e.g. resulting from consumption of the insecticidal composition by the pest or from contact with the insecticidal composition), or indirect (i.e. resulting from application to the plant of the insecticidal composition according to the disclosure).
[0180] Methods of qualifying insecticidal activity of an agent are known in the art (e.g. Macintosh et al. 1990 J Invert Pathol 56; O'Callahan et al. 2012 Lacey, Lawrence A., ed. Manual of techniques in invertebrate pathology. Academic Press, Chapter IV), and are further described and exemplified herein. In addition, IC50 values can be determined to qualify effective concentration of the agent resulting in inhibiting growth and development of at least 50% of the insect population. For example, insecticidal activity can be measured by a decrease in insect biomass. Also assays for quantitating damage or disease resistance following insect infestation are commonly known in the art, see for example US5,614,395. Such techniques include, measuring over time, the average lesion diameter, the insect pest biomass, and the overall percentage of decayed plant tissues. For example, a plant having an insecticidal composition applied to its surface shows a decrease in tissue necrosis (i.e., lesion diameter) or a decrease in plant death following challenge with a pest when compared to a control plant that was not exposed to the insecticidal composition.
[0181] Any method as is known in the art can be used to contact the target insect, the plant or part thereof with any of the bioactive agents disclosed herein. According to certain embodiments, said method is selected from the group consisting of - but not limited to - immersing, dipping, spraying, coating, dusting, infiltrating, incubating and any combination thereof. According to some embodiments, wherein the application is to the aerial part of a plant, the application is mediated by moving vehicles (cars or agricultural vehicles), flying devices (e.g., planes or drones), and the like. According to some embodiments, any of the bacterial strains of the application and / or fermentation products derived thereof and / or any composition herein disclosed is not harmful or toxic to beneficial insects, more particularly to bees, even more particularly to honey bees (Apis mellifera).
[0182] The term, "target insect" or "target insect species" refers to an insect for which presence on a plant or crop or in the field or greenhouse is not desired and damages the plant or crop directly or indirectly with a reduced yield of the plant or crop as a result, and additionally to an insect which is susceptible to the effects of the bacteria, fermentation products or insecticidal compositions herein disclosed, exhibiting, for example, reduced growth, abnormal development, reduced fertility, reduced feeding or reduced survival when exposed to the bacteria, fermentation products or insecticidal compositions. According to certain embodiments, the target insect is an insect of an order selected from the group consisting of Lepidoptera, Coleoptera, Hemiptera, Trombidiformes, Mallophaga, Homoptera, Orthoptera, Thysanoptera, Dermaptera, Isoptera, Anoplura, Siphonatpera and Trichoptera. Each possibility represents a separate embodiment of the present invention.
[0183] In a more particular embodiment, the target insect is an insect from the group Lepidoptera. The order Lepidoptera comprises several families such as Papilionidae, Pieridae, Lycaenidae, Nymphalidae, Danaidae, Satyridae, Hesperiidae, Sphingidae, Saturniidae, Geometridae, Arctiidae, Noctuidae, Lymantriidae, Sesiidae, and Tineidae. In an even more particular embodiment, the target insect is an insect from the family Papilionidae, Pieridae, Lycaenidae, Nymphalidae, Danaidae, Satyridae, Hesperiidae, Sphingidae, Saturniidae, Geometridae, Arctiidae, Noctuidae, Lymantriidae, Sesiidae, or Tineidae.
[0184] Larvae of the order Lepidoptera include, but are not limited to
[0185] - armyworms, cutworms, loopers and heliothines in the family Noctuidae: Spodoptera frugiperda (fall armyworm); S. exigua (beet armyworm); S. litura (tobacco cutworm, cluster caterpillar); S. exempta (black armyworm); S. eridania (Southern armyworm); Mamestra configurata (bertha armyworm); M. brassicae (cabbage moth); Agrotis ipsilon (black cutworm); A. orthogonia (western cutworm); A. subterranea (granulate cutworm); Alabama argillacea (cotton leaf worm); Trichoplusia ni (cabbage looper); Pseudoplusia includens (soybean looper); Anticarsia gemmatalis (velvetbean caterpillar); Hypena scabra (green cloverworm); Heliothis virescens (tobacco budworm); Pseudaletia unipuncta (armyworm); Athetis mindara (rough skinned cutworm); Euxoa messoria (darksided cutworm); Earias insulana (spiny bollworm); E. vittella (spotted bollworm); Helicoverpa armigera (American bollworm); H. zea (corn earworm or cotton bollworm); Melanchra picta (zebra caterpillar); Egira (Xylomyges) curialis (citrus cutworm); Striacosta albicosta (Western bean cutworm) - borers, casebearers, webworms, coneworms, and skeletonizers from the family Pyralidae: Ostrinia nubilalis (European corn borer); Amyelois transitella (naval orangeworm); Anagasta kuehniella (Mediterranean flour moth); Cadra cautella (almond moth); Chilo suppressalis (rice stem borer); C. partellus, (sorghum borer); Corcyra cephalonica (rice moth); Crambus caliginosellus (corn root webworm); C. teterrellus (bluegrass webworm); Cnaphalocrocis medinalis (rice leaf roller); Desmia funeralis (grape leaffolder); Diaphania hyalinata (melon worm); D. nitidalis (pickleworm); Diatraea grandiosella (southwestern corn borer), D. saccharalis (surgarcane borer); Eoreuma loftini (Mexican rice borer); Ephestia elutella (tobacco (cacao) moth); Galleria mellonella (greater wax moth); Herpetogramma licarsisalis (sod webworm); Homoeosoma electellum (sunflower moth); Elasmopalpus lignosellus (lesser cornstalk borer); Achroia grisella (lesser wax moth); Loxostege sticticalis (beet webworm); Orthaga thyrisalis (tea tree web moth); Maruca testulalis (bean pod borer); Plodia interpunctella (Indian meal moth); Scirpophaga incertulas (yellow stem borer); Udea rubigalis (celery leaftier); and
[0186] - leafrollers, budworms, seed worms and fruit worms in the family Tortricidae: Acleris gloverana (Western blackheaded budworm); A. variana (Eastern blackheaded budworm); Archips argyrospila (fruit tree leaf roller); A. rosana (European leaf roller); and other Archips species, Adoxophyes orana (summer fruit tortrix moth); Cochylis hospes (banded sunflower moth); Cydia latiferreana (filbertworm); C. pomonella (coding moth); Platynota flavedana (variegated leafroller); P. stultana (omnivorous leafroller); Lobesia botrana (European grape vine moth); Spilonota ocellana (eyespotted bud moth); Endopiza viteana (grape berry moth); Eupoecilia ambiguella (vine moth); Bonagota salubricola (Brazilian apple leafroller); Grapholita molesta (oriental fruit moth); Suleima helianthana (sunflower bud moth); Argyrotaenia spp.; Choristoneura spp.
[0187] Selected other target insects in the order Lepidoptera include, but are not limited to Alsophila pometaria (fall cankerworm); Anarsia I ineatella (peach twig borer); Anisota senatoria (orange striped oakworm); Antheraea pernyi (Chinese Oak Tussah Moth); Bombyx mori (Silkworm); Bucculatrix thurberiella (cotton leaf perforator); Colias eurytheme (alfalfa caterpillar); Cydalima perspectalis (box tree moth); Datana integerrima (walnut caterpillar); Dendrolimus sibiricus (Siberian silk moth), Ennomos subsignaria (elm spanworm); Erannis tiliaria (linden looper); Euproctis chrysorrhoea (browntail moth); Harrisina americana (grapeleaf skeletonizer); Hemileuca oliviae (range caterpillar); Hyphantria cunea (fall webworm); Keiferia lycopersicella (tomato pinworm); Lambdina fiscellaria fiscellaria (Eastern hemlock looper); L. fiscellaria lugubrosa (Western hemlock looper); Leucoma salicis (satin moth); Lymantria dispar (gypsy moth); Manduca quinquemaculata (five spotted hawk moth, tomato hornworm); M. sexta (tomato hornworm, tobacco hornworm); Operophtera brumata (winter moth); Paleacrita vernata (spring cankerworm); Papilio cresphontes (giant swallowtail orange dog); Phryganidia californica (California oakworm); Phyllocnistis citrella (citrus leafminer); Phyllonorycter blancardella (spotted tentiform leafminer); Pieris brassicae (large white butterfly); P. rapae (small white butterfly); P. napi (green veined white butterfly); Platyptilia carduidactyla (artichoke plume moth); Plutella xylostella (diamondback moth); Pectinophora gossypiella (pink bollworm); Pontia protodice (Southern cabbageworm); Sabulodes aegrotata (omnivorous looper); Schizura concinna (red humped caterpillar); Sitotroga cerealella (Angoumois grain moth); Thaumetopoea pityocampa (pine processionary caterpillar); Tineola bisselliella (webbing clothesmoth); Tuta absoluta (tomato leafminer); Yponomeuta padella (ermine moth); Heliothis subflexa; Malacosoma spp. and Orgyia spp.
[0188] According to particular embodiments of the invention, the target insect is of the genera Spodoptera, Helicoverpa, Trichoplusia, Ostrinia or Agrotis. Examples include but are not limited to the species Spodoptera exigua, Spodoptera littoralis and Spodoptera frugiperda, Helicoverpa zea and Helicoverpa armigera, Trichoplusia ni, Ostrinia nubilalis and Agrotis ipsilon.
[0189] In another particular embodiment, the target insect is an insect from the group Coleoptera. Of interest are:
[0190] - larvae and adults of the order Coleoptera including weevils from the families Anthribidae, Bruchidae and Curculionidae, including, but not limited to Anthonomus grandis (boll weevil); Lissorhoptrus oryzophilus (rice water weevil); Sitophilus granarius (granary weevil); S. oryzae (rice weevil); Hypera punctata (clover leaf weevil); Cylindrocopturus adspersus (sunflower stem weevil); Smicronyx fulvus (red sunflower seed weevil); S. sordidus (gray sunflower seed weevil); Sphenophorus maidis (maize billbug);
[0191] - flea beetles, cucumber beetles, rootworms, leaf beetles, potato beetles and leafminers in the family Chrysomelidae, including, but not limited to: Leptinotarsa decemlineata (Colorado potato beetle); Diabrotica virgifera virgifera (western corn rootworm); D. barberi (northern corn rootworm); D. undecimpunctata howardi (southern corn rootworm); Chaetocnema pulicaria (corn flea beetle); Phyllotreta cruciferae (Crucifer flea beetle); Phyllotreta striolata (stripped flea beetle); Colaspis brunnea (grape colaspis); Oulema melanopus (cereal leaf beetle); Zygogramma exclamationis (sunflower beetle);
[0192] - beetles from the family Coccinellidae, including, but not limited to: Epilachna varivestis (Mexican bean beetle);
[0193] - chafers and other beetles from the family Scarabaeidae, including, but not limited to: Popillia japonica (Japanese beetle); Cyclocephala borealis (northern masked chafer, white grub); C. immaculata (southern masked chafer, white grub); Rhizotrogus majalis (European chafer); Phyllophaga crinita (white grub); Ligyrus gibbosus (carrot beetle); - carpet beetles from the family Dermestidae; wireworms from the family Elateridae, Eleodes spp., Melanotus spp.; Conoderus spp.; Limonius spp.; Agriotes spp.; Ctenicera spp.; Aeolus spp.; bark beetles from the family Scolytidae and beetles from the family Tenebrionidae.
[0194] According to some embodiments, the target insect is of the genus Spodoptera. In more particular embodiment, the target insect is the Beet Armyworm (Spodoptera exigua) and the plant is from a plant family selected from the group consisting of: Poaceae, Malvaceae, Liliaceae, Amaranthaceae, Fabaceae, Solanaceae, Chenopodiaceae, Brassicaceae, Solanaceae, Cyperaceae, Juglandaceae, Asteraceae, Cucurbitaceae, Rutaceae, Euphorbiaceae, Convolvulaceae, Caryophyllaceae, Apiaceae, Polygonaceae, Rosaceae, Iridaceae, Musaceae, Geraniaceae, Platanaceae, Apocynaceae, Portulacaceae, Rosaceae, Ericaceae, Violaceae, Vitaceae, and Zingiberaceae. Each possibility represents a separate embodiment of the present invention. In other particular embodiments, the target insect is the Fall armyworm (Spodoptera frugiperda) and the plant is from a plant family selected from the group consisting of: Amaranthaceae, Apiaceae, Apocynaceae, Asteraceae, Brassicaceae, Caryophyllaceae, Chenopodiaceae, Convolvulaceae, Cucurbitaceae, Cyperaceae, Euphorbiaceae, Fabaceae, Geraniaceae, Iridaceae, Juglandaceae, Liliaceae, Malvaceae, Musaceae, Platanaceae, Poaceae, Poaceae, Polygonaceae, Portulacaceae, Rosaceae, Rutaceae, Solanaceae, Ericaceae, Violaceae, Vitaceae, and Zingiberaceae. Each possibility represents a separate embodiment of the present invention.
[0195] According to some embodiments of the invention, the target insect is of the genus Diabrotica or Chrysodeixis. Examples include, but are not limited to the species Diabrotica speciosa, Diabrotica barberi, Diabrotica balteata, Diabrotica undecimpunctata, Diabrotica virgifera, Chrysodeixis includens, Chrysodeixis celebensis, Chrysodeixis eriosoma, Chrysodeixis argitifera, Chrysodeixis acuta illuminata, Chrysodeixis minutus and Chrysodeixis chalcites. According to a particular embodiment, the target insect is the Western corn rootworm (Diabrotica virgifera virgifera) and the plant is from a plant family selected from the group consisting of: Poaceae, Asteraceae, Cucurbitaceae, and Fabaceae. Each possibility represents a separate embodiment of the present invention.
[0196] According to some embodiments, the target insect is the Southern green stink bug (Nezara viridula) and the plant is from a plant family selected from the group consisting of: Anacardiaceae, Asteraceae, Brassicaceae, Caprifoliaceae, Chenopodiaceae, Convolvulaceae, Cucurbitaceae, Euphorbiaceae, Fabaceae, Juglandaceae, Lauraceae, Magnoliaceae, Malvaceae, Oleaceae, Passifloraceae, Pedaliaceae, Poaceae, Proteaceae, Rosaceae, Rutaceae, Scrophulariaceae, Solanaceae, and Sterculiaceae. Each possibility represents a separate embodiment of the present invention. According to some embodiments, the target insect is the Cabbage Looper (Trichoplusia ni) and the plant is from a plant family selected from the group consisting of: crucifers, beet, cantaloupe, celery, cucumber, lima bean, lettuce, parsnip, pea, pepper, potato, snap bean, spinach, squash, sweet potato, tomato, watermelon, chrysanthemum, hollyhock, snapdragon, sweet pea, cotton, tobacco, Chenopodium album, Lactuca spp. (wild lettuce), Taraxacum officinale (dandelion), and Rumex crispus (curly dock). Each possibility represents a separate embodiment of the present invention.
[0197] According to some embodiments, the target insect is the Diamondback Moth (Plutella xylostella) and the plant is from a plant family selected from the group consisting of: Malvaceae, Brassicaceae, Capparaceae, Asteraceae and Fabaceae. Each possibility represents a separate embodiment of the present invention.
[0198] According to some embodiments, the target insect is the Soybean Looper (Chrysodeixis includens) and the plant is from a plant family selected from the group consisting of: Amaranthaceae, Apiaceae, Araceae, Araliaceae, Asteraceae, Begoniaceae, Brassicaceae, Caryophyllaceae, Chenopodiaceae, Convolvulaceae, Cucurbitaceae, Euphorbiaceae, Fabaceae, Geraniaceae, Gesneriaceae, Hydrangeaceae, Lamiaceae, Lauraceae, Liliaceae, Malvaceae, Passifloraceae, Piperaceae, Poaceae, Polygonaceae, Portulacaceae, Rubiaceae, and Solanaceae. Each possibility represents a separate embodiment of the present invention.
[0199] The methods and compositions provided herein can also be used against insect pests of the order Trombidiformes including, but are not limited to, plant feeding mites, including six-spooted spider mite (Eutetranychus sexmaculatus), Texas citrus mite (Eutetranychus banksi), Citrus red mite (Panonychus citri), European red mite (Panonychus ulmi), McDaniel mite (Tetranychus mcdanieli), Pacific spider mite (Tetranychus pacificus), Strawberry spider mite (Tetranychus urticae), Spruce spider mite (Oligonychus ununguis), Sugi spider mite (Oligonychus nondonensisi), and Tetranychus evansi. According to particular embodiments, the target insect is of the genus Tetranychus.
[0200] The methods and compositions provided herein can also be used against insect pests of the order Hemiptera including, but not limited to, Lygus spp., including Lygus spp. including Lygus hesperus, Lygus lineolaris, Lygus pratensis, Lygus rugulipennis, and Lygus pabulinus, Calocoris norvegicus, Orthops compestris, Plesiocoris rugicollis, Cyrtopeltis modestus, Cyrtopeltis notatus, Spanagonicus albofasciatus, Diaphnocoris chlorinonis, Labopidicola allii, Pseudatomoscelis seriatus, Adelphocoris rapidus, Poecilocapsus lineatus, Blissus leucopterus, Nysius spp. including Nysius ericae and Nysius raphanus, Nezara viridula, Acrosternum hilare, Euschistus spp. including Euschistus servus and Euschistus heros, Dichelops spp. including Dichelops melacantus and Dichelops furcatus, Halyomorpha halys, Lipaphis erysimi, Aphis gossypii, Macrosiphum avenae, Myzus persicae, Acyrthosiphon pisum, Aphidoidea spp, Eurygaster spp., Coreidae spp., Pyrrhocoridae spp., Blostomatidae spp., Reduviidae spp., Cimicidae spp. Aleurocanthus woglumi, Aleyrodes proletella, Bemisia spp. including Bemisia argentifolii and Bemisia tabaci, and Trialeurodes vaporariorum.
[0201] The methods and compositions provided herein can also be used against insect pests of the order Thysenoptera including, but not limited to, thrips species, including Frankliniella spp., for example Western Flower thrips (Frankliniella occidentalis (Pergande)); Thrips spp., for example Thrips tabaci; Scirtothrips spp., for example Scirtothrips dorsalis; Klambothrips spp., for example Klambothrips myopori; Echinothrips spp., for example Echinothrips americanus; and Megalurothrips spp., for example Megalurothrips usitatus.
[0202] Insect pests also include insects selected from the orders Diptera, Hymenoptera, Mallophaga, Homoptera, Hemiptera, Orthroptera, Thysanoptera, Dermaptera, Isoptera, Anoplura, Siphonaptera, and Trichoptera.
[0203] According to some embodiments of the invention, the target insect is of the genus selected from the group consisting of Spodoptera, Diabrotica, Tetranychus and Leptinotarsa.
[0204] Since insects damage cultivated crops, thereby negatively influencing the yield and general fitness of said cultivated crops, also the use of one or more of the bacteria, fermentation products or insecticidal compositions herein disclosed is provided for increasing or improving crop yield.
[0205] According to certain embodiments, by having insecticidal activity, the bacterial species of the invention, its functional homologues or any fermentation product thereof or any compositions herein provided inhibits or reduces plant infestation by at least one of the target insect species, or controls, inhibits, reduces, suppresses, decreases insect damage to a plant of interest, or protects the plant or crop of interest that is under attack of the target insect or that can be used as host plant by the target insect. Hence, "having insecticidal activity" thus also refers to the capability of protecting a plant of interest from insect damage that can be manifested as an increase of 0.1%, 0.2%, 0.3%, 0.5%, 0.75%, 1%, 1.5%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 12%, 15%, 17%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or more in health, growth, multiplication, fertility, vigor, strength, or yield of the plant of interest as compared to a control plant in a control situation. The control plant is of the same species, has the same genetic background as the plant of interest and is grown under the same conditions at the plant of interest, exposed to the same quantity of the same insect but is not treated with the bacterial species of the invention, its functional homologues or any fermentation product thereof or any compositions of the application. "Having insecticidal activity" can also refer to the capability of reducing the insect damage to a plant (i.e. damage of a plant of interest induced by the insect) or reducing the symptoms observed in or on the plant of interest associated with the presence of the insect with at least 0.1% 0.2% 0.3% 0.5% 0.75% 1% 1.5% 2% 3% 4% 5%, 6% 7% 8% 9% 10% 12% 15% 17% 20% 25% 30% 35% 40% 50% 60% 70% 80% 90% or 100% compared to a control situation (i.e. a control plant infested by the same insect in the same conditions but that has not been treated with the bacterial strain of the invention, its functional analogue or any fermentation product thereof or any composition herein provided).
[0206] Symptoms associated with the presence of an insect in or on a plant or its habitat are known to a person skilled in the art. Typically, a score scale is set for a certain symptom associated with the presence of the insect based on symptom description and / or severity. Optionally, a specific score scale is set for a combination of certain symptoms and a plant species. The use of score scales simplifies the comparison of symptoms in plants subjected to various treatments.
[0207] Examples of plants of interest (also referred herein as "target plants") include, but are not limited to corn (Zea mays), Brassica sp. (e.g., B. napus, B. rapa, B. juncea), particularly those Brassica species useful as sources of seed oil, alfalfa (Medicago sativa), rice (Oryza sativa), rye (Secale cereale), sorghum (Sorghum bicolor, Sorghum vulgare), millet (e.g., pearl millet (Pennisetum glaucum), proso millet (Panicum miliaceum), foxtail millet (Setaria italica), finger millet (Eleusine coracana)), wheat (Triticum aestivum), sunflower (Helianthus annuus), safflower (Carthamus tinctorius), soybean (Glycine max), tobacco (Nicotiana tabacum), potato (Solanum tuberosum), peanuts (Arachis hypogaea), cotton (Gossypium barbadense, Gossypium hirsutum), sweet potato (Ipomoea batatus), cassava (Manihot esculenta), coffee (Coffea spp.), coconut (Cocos nucifera), pineapple (Ananas comosus), citrus trees (Citrus spp.), cocoa (Theobroma cacao), tea (Camellia sinensis), banana (Musa spp.), avocado (Persea americana), fig (Ficus casica), guava (Psidium guajava), mango (Mangifera indica), olive (Olea europaea), papaya (Carica papaya), cashew (Anacardium occidentale), macadamia (Macadamia integrifolia), almond (Prunus amygdalus), sugar beets (Beta vulgaris), sugarcane (Saccharum spp.), oats, barley, vegetables, ornamentals, and conifers.
[0208] Vegetables include tomatoes (Lycopersicon esculentum), lettuce (e.g., Lactuca sativa), green beans (Phaseolus vulgaris), lima beans (Phaseolus limensis), peas (Lathyrus spp.), and members of the genus Cucumis such as cucumber (C. sativus), cantaloupe (C. cantalupensis), and musk melon (C. melo).
[0209] Ornamentals include box (Buxus spp.), azalea (Rhododendron spp.), hydrangea (Macrophylla hydrangea), hibiscus (Hibiscus rosasanensis), roses (Rosa spp.), tulips (Tulipa spp.), daffodils (Narcissus spp.), petunias (Petunia hybrida), carnation (Dianthus caryophyllus), poinsettia (Euphorbia pulcherrima), and chrysanthemum. In specific embodiments, plants of interest for the present invention are crop plants (for example corn, alfalfa, sunflower, Brassica, soybean, cotton, safflower, peanut, sorghum, wheat, millet, tobacco, etc.). In other embodiments, plants of interest for the present invention are corn and soybean plants. In yet other embodiments, plants of interest for the present invention include Buxus species. In another aspect of the application also a method of producing an insecticidal composition is provided, comprising the steps of growing any of the bacteria described herein under standard bacterial growth conditions to establish a liquid bacterial cell culture; and collecting or harvesting the bacterial culture and / or any fermentation product derived from said bacterial cell culture, wherein said fermentation product comprises an effective amount of at least quinomycin C; and optionally adding at least one surfactant to said harvested bacterial culture and / or fermentation product to obtain an insecticidal composition. In a particular embodiment, said fermentation product can be an extract, an extract fraction, a supernatant, a supernatant fraction, a filtrate or a whole cell broth.
[0210] EXAMPLES
[0211] Example 1. Microbial extracts
[0212] A microbial collection comprising 5100 bacterial and bacterial strains was used as starting point to screen for microbial active compounds with insecticidal activity. The fermentation broths of all used microbial strains were extracted by adding an equal volume of acetone. After incubation while shaking followed by centrifugation, DMSO was added to the supernatant and the extract was concentrated to 2xWBE (whole broth equivalent) under heated nitrogen. All extracts contain a final concentration of 20% DMSO.
[0213] Example 2. Screening for insecticidal effects of microbial extracts
[0214] Discovery screen
[0215] To identify microbial strains with insecticidal activity, the extracts produced in Example 1 were screened using a Spodoptera exigua bioassay. In brief, 24-deep-well plates were filled with 2 ml general purpose lepidopteran diet (in 2% agar). 50 pl of the undiluted extract samples was pipetted on top of the diet. A commercial product comprising live spores and toxins of Bacillus thuringiensis spp. aizawai (Bt) (commercially available under the trademark Xentari) was used as positive control at lmg / ml, while the negative control was a 20% DMSO solution in double deionized water. After drying of the plates, five 6 to 7 days old S. exigua larvae were placed in each well, the plates were closed with a silicone mat and incubated at 25°C under a I ight / dark regime of 16h / 8h. After four days of incubation, the number of insects in a well was counted and their growth and development scored compared to the control treatment. Based on these analyses, 155 candidate extracts were selected.
[0216] In vitro bio-assays
[0217] Validation of the obtained hits was performed using two independent production batches of the extracts. The same extract production method as described in Example 1 was used. The extracts were screened on first and second instar larvae using an optimized bioassay procedure. Twelve-well plates were filled with 3 ml general purpose lepidopteran diet (in 2% agar) on top of which 50 pl of the undiluted extract material (containing 20% DMSO) was added. Four replicates of each extract and controls were included in the test. The Bacillus thuringiensis spp. aizawai preparation as described above at a concentration of 1 mg / ml was included as positive control, and 20% DMSO in double ionized water as negative control. In each well, five larvae were added, the plates were closed with a transparent pressure seal, pierced with an insect pin to ensure aeration, and incubated in the growth chamber at 25°C under a I ight / dark regime of 16h / 8h. Mortality and larval stage was assessed at 6- and 8-days post infestation. Of the 155 candidates, only 30 extracts showed a statistically significant difference in mortality and / or growth delay compared to the control. Part of the data is shown in Figure
[0218] 1. These 30 leads were selected for further evaluation in in-planta bioassays.
[0219] In-planta bioassays
[0220] In-planta assays were performed using a new batch of extracts from the 30 selected leads, prepared using the production method as described in Example 1.
[0221] After confirming the activity of the new extract batch in an in vitro assay (as described in Example 2, data not shown), the effect of the extracts was investigated on BBCH14 stage sweet pepper plants (var. Mazurka RZ) infested with Spodoptera exigua larvae. First, the sweet pepper plants were sprayed with 2ml of 4x diluted extract or with a control sample. The commercial product Xentari comprising live spores and toxins of Bacillus thuringiensis spp. aizawai was used as positive control at a concentration of 1 mg / ml, while 5% DMSO was used as negative control. Twelve plants were sprayed per treatment. After 60 minutes drying in the chemical flow, each plant was infested with five L2 staged Spodoptera exigua larvae. The plants were stored in the growth chamber at 25°C under a light / dark regime of 16h / 8h. A physical barrier was placed between plants of different treatments to prevent unlimited migration of the larvae. From 5 days until 12 days after infestation, plant damage was scored. Six extracts demonstrated an increased level of plant protection compared to the negative control. A representative image of the insecticidal effect of several extracts is shown in Figure 2.
[0222] Example 3. Microbial species identification
[0223] Based on the results described above, extract Bl.02 was selected for further analysis. The strain with strain ID M25D9 that produced the Bl.02 extract was morphologically classified as a Streptomyces strain. To phylogenetically characterize strain M25D9, genomic DNA was prepared for whole genome sequencing. The strain was grown on solid nutrient broth medium (5 g / l peptone, 3 g / l yeast extract, 5 g / l sodium chloride, 15 g / l agar, adjusted to pH 7.2) and after a 7-day incubation at 28°C harvested for genomic DNA extraction using the DNeasy PowerSoil Pro Kit (QIAGEN) according to the manufacturer's standard operating procedure (DNeasy PowerSoil Pro Kit Handbook). The DNA yield was evaluated by fluorometric means using Qubit dsDNA HS (ThermoFisher Scientific) and the integrity of the DNA assessed in a 1% (w / v) agarose-TAE (Tris-acetate-EDTA) electrophoresis gel with SYBR-safe (ThermoFisher Scientific). The extracted DNA was submitted for Whole Genome Sequencing (WGS) at a commercial provider for both long read (Oxford Nanopore Technologies) and short read (Illumina) sequencing. The genomic sequences were assembled using a hybrid approach which combines long read sequencing (assembled using Flye by Kolmogorov et al 2019 Nature Biotech 37) and short read sequencing (using Pilon by Walker et al 2014 PLoS One 9(11): ell2963). Full length 16S rRNA sequences were extracted in silico using barrnap (Seemann), which itself relies on "nhmmer", a tool which uses hidden Markov models to search for specific gene signatures. 16S rRNA sequences were queried against the RefSeq 16S rRNA reference database using the platform provided by NCBI, standard settings for "high similarity" searches were used. Multiple sequence alignments were performed using Muscle (Edgar 2004 Nucleic Acid Research 32).
[0224] The sequence searches revealed that the 16S rDNA sequence of strain M29D9 shows the highest similarity, more particularly 99.28%, to that of Streptomyces collinus. However based on the whole genome sequence analysis, it is proposed to classify M25D9 as Streptomcyes sasae.
[0225] Example 4. Growth chamber trials
[0226] In a next step, growth chamber trials were set up. Sweet pepper plants at the BBCH15-16 stage were treated preventively with the extract derived from S. sasae strain M25D9 or with one of the controls, using a spray boom. The extract was diluted 4 times with tap water. Altacor was selected as chemical positive control and Xentari (Bacillus thuringiensis spp. Aizawai) as biological positive control. Untreated plants and plants treated with 5% DMSO were included as negative control.
[0227] After the spray treatment, the plants were left to dry and were infested with five Spodoptera exigua larvae in the second larval stage per plant. The plants were incubated in the growth chamber at 25°C under a light / dark regime of 16h / 8h under a completely randomized factorial design with 20 plant per treatment. At 1, 3, 5 and 7 days after the application, the % affected plant area due to insect feeding was assessed as well as the mortality of the Spodoptera exigua larvae. The % affected area was determined using a relative visual scale ranging from 8 (severe damage) to 0 (no damage). The results that are shown in Figures 3 and 4 are in line with the above. Compared to the untreated and DMSO negative controls, the pepper plants treated with the extract derived from S. sasae strain M25D9 (Bl.02) showed a significant lower damage on all assessed time points (Figure 3). Also, the M25D9 extract induced a significant increase in mortality of the S. exigua larvae compared to the negative controls (Figure 4).
[0228] Example 5. A broad insecticidal activity of S. sasae strain M25D9
[0229] To explore whether the insecticidal activity of the M25D9 strain was specific to S. exigua larvae or whether the M25D9 extract has broader insecticidal activity, various agriculturally relevant arthropods pest insects were tested.
[0230] First, the effect of the Bl.02 extract was tested on Tetranychus urticae spider mites. Adulticidal bioassays using the "London" reference population were conducted using a standard method that is based on direct spraying of a test solution on plant leaf disks infested with the insect pest (Khajehali et al. 2011, Khalighi et al. 2013). Briefly, 25-35 young adult female mites were transferred to the upper side of 9 cm2square-cut kidney bean leaf discs on wet cotton wool, which were then sprayed with 1 ml of spray fluid at 1 bar pressure in a custom build spray tower. After determining DMSO toxicity via preliminary experiments, tests were conducted using 1:5 dilutions of the BL02 extract. As a control treatment (blank), 4% DMSO was used. For treatments and control, four replicates were sprayed. After spraying, the plates were placed in a climatically controlled room at 25 ± 0.5°C, 60% relative humidity (RH) and 16 / 8 h (I ight / dark) photoperiod. Mortality was assessed 24 h and 72 h after spraying. Mites were scored "dead" if they did not move their own body length within 10 s after prodding with a fine brush. Mites were scored "drowned" if they were in the water barrier surrounding the leaf disk. A dramatic effect on the mortality of spider mites could be observed when the leaf disks were treated with the extract from strain M25D9 (Figure 5).
[0231] Second, the effect of the Bl.02 extract was tested on Frankliniella occidentalis thrips. Thrips were sedated using CO2 and transferred to the upper side of 16 cm2round-cut kidney bean leaf disks placed on 1.5% agar inside a petri dish closed with a meshed lid. The petri dishes were kept on ice to keep the thrips immobile until spraying. Leaf disks with thrips were then sprayed with 3 ml solution using a custom-built spray tower (at 0.5 bar). After determining DMSO toxicity via preliminary experiments, tests were conducted using 1:5 dilutions of the Bl.02 extract. As a control treatment (blank), 4% DMSO was used, while also a water control was included. For treatments and controls, at least four replicates were sprayed. After spraying, the plates were kept at room temperature. Mortality was assessed 24 h, 48 and 72 h after spraying. Compared to the controls, a clear increase in mortality of the western flower thrips on leaf disk treated with Bl.02 could be observed (Figure 6).
[0232] A third additional insect that was tested was the Colorado potato beetle Leptinotarsa decemlineata. Potato leaf disks (1.8 cm2) were submerged during 30 minutes in 1:20 dilutions of the test solution or were treated with 1% DMSO as blank control. The leaf disks were placed on humid cotton wool placed inside 6-well plates. Controls without leaf disks (starvation control) and with untreated leaf disks were included. After the surface of the treated leaf disks was dry, a single Colorado potato beetle larva (L2 stage) was added to each leaf disk. The larvae were allowed to feed on the leaf disks during 48 hours, after which the larvae from all test conditions were transferred to untreated leaf disks. Leaf damage was monitored after 24h and 48h (i.e. to treated leaf only), while mortality was recorded at 1, 2, 3 and 6 days. A clear protective effect of the potato leaves could be observed of the BI.02 extract compared to the controls (Figure 7).
[0233] Example 6. Bee toxicity test
[0234] The extract sample derived from Streptomyces sasae strain M25D9 was tested in a bee toxicity study according to the OECD 213 and 214 GUIDELINES FOR THE TESTING OF CHEMICALS, designed to assess respectively, oral and contact toxicity of pesticides and other chemicals to adult worker honeybees. To assess oral toxicity, adult worker honeybees were exposed to two doses of the test substance (i.e. an 1 / 4 or an 1 / 8 dilution of the extract) dispersed in sucrose solution. Once consumed, the bees were fed a normal diet, i.e. the same diet without the test substance. Honeybees fed with sucrose solution and sucrose solution comprising 5% and 2.5% DMSO were included as negative control.
[0235] To assess contact toxicity, adult worker honeybees were exposed to two doses of the test substance (i.e. an 1 / 2 or an 1 / 4 diluted extract) dissolved in sucrose solution, by direct application to the thorax (droplets). An sucrose solution containing 10% and 5% DMSO was included as negative control. For both the oral and contact toxicity tests, mortality was recorded daily during at least 48 hours and compared to control values. If the mortality rate for the test substance at 48h was higher than that at 24h whilst control mortality remained at an accepted level, i.e. <10%, the test was extended until 96h. In both the oral toxicity test and the contact toxicity test, no effect of Bl.02 could be observed on honeybees (data not shown).
[0236] Example 7. Fractionation screen
[0237] In order to identify the active insecticidal compound produced by the M25D9 strain, the whole cell broth extract of the culture was fractionated upon which the several obtained extracts were tested for their activity. First, the bacterial strain M25D9 was propagated in a commercial bacterial growth medium and the whole cell broth extract was prepared as described in Example 1. Next, 10 ml of whole cell fermentation broth extract was added to an equal volume of acetone. After 2 h of incubation while shaking, the acetone extract was filtered and concentrated under reduced pressure. The aqueous residue was loaded onto a SP207ss resin column for a solid-phase extraction (SPE) and eluted with acetone. The extract was evaporated, the residue solved in 100% DMSO and subsequently filtered at 0.2 pm prior to semi-preparative fractionation to constitute a HPLC head. An aliquot of the flow- through was kept for its possible evaluation of activity if not retained by the SPE resin. Subsequently, 100 mg material per extract was subjected to semi-preparative reversed phase HPLC (Zorbax SB-C8 column, 21.2 x 250 mm, 7 pm, 20 mL / min, UV detection at 210 and 280 nm) eluting with CH3CN: H2O, in a linear gradient of acetonitrile (AcN) specific for each sample, and a wash step of 100% acetonitrile to yield a collection of 80 fractions. Those 80 different fractions were then tested for insecticidal activity after evaporation of the organic solvent and preparation of an aliquot per fraction at a concentration of 100 mg / ml in 20% of DMSO in water.
[0238] All 80 fractions of the extract of M25D9 were tested in two technical repeats using the in vitro diet assay as described under Example 2. Fractions 58 until 66 showed a very strong and highly similar insecticidal activity as was found with the full extract (data not shown), indicating that said fractions comprise the active compound that is responsible for the insecticidal effect of the M25D9 extract. Example 8. Identification of insecticidal compound
[0239] The active fractions 59 and 65 from the experiments described in the previous example were selected as representative samples for the active fractions and were analyzed via Liquid Chromatography-High Resolution Mass Spectrometry (LC-HRMS) using an HPLC machine (detection at 210 nm) interfaced to a mass spectrometer. A Zorbax SB-C8 column (2.1 x 30 mm; 3.5 pm particle size) was used for the separation. Two solvents were used as mobile phase: solvent A (water:AcN 90:10) and solvent B (water:AcN 10:90), both with 13 mM ammonium formate and 0.01% TFA. The retention time and exact mass of the detected components were compared against HR-MS databases. Based thereon, the compounds present in the insecticidal extracts of the M25D9 bacterial culture revealed to be quinomycin A and quinomycin C. The chemical structure of both quinomycins is shown in Figure 8.
[0240] To confirm that quinomycin A and / or quinomycin C is the microbial active ingredient in the extract of a cell culture of the bacterial strain M25D9, the pure compounds were ordered at a commercial provider and tested in a dose-response experiment in an insect diet assay. The following concentrations were prepared in 10% DMSO: 100 pg / ml, 50 pg / ml, 25 pg / ml, 12.5 pg / ml, 6.25 pg / ml and 3.125 pg / ml. 50 pl of these dilutions were added on top of 3 ml general purpose lepidopteran diet (in 2% agar) in twelve-well plates. Four replicates of each extract together with a 10% DMSO negative control were included in the test. In each well, five larvae were added, the plates were closed with a transparent pressure seal, pierced with an insect pin to ensure aeration, and incubated in the growth chamber at 25°C under a I ight / dark regime of 16h / 8h. Mortality and larval stage were assessed at day 6.
[0241] The results are shown in Figure 9. For both compounds a clear dose-response effect is observed. Compared to the DMSO negative control, quinomycin A solutions of 100 mg / l induced mortality in more than 80% of the Spodoptera larvae (Figure 9A). At lower concentrations between 50 and 12.5 mg / l no mortality was observed but instead a significant growth delay in 90% of the larvae was seen. At a concentration of 6.25 mg / l a drop in the % of larvae that showed a growth delay can be observed (Figure 9A), while at a concentration of 3.125 mg / l there is a second drop in that percentage. The latter concentration induced a growth delay in 30% of the treated Spodoptera larvae.
[0242] For quinomycin C very similar results were obtained, although quinomycin C was found to be surprisingly more effective. In contrast to quinomycin A, a quinomycin C treatment at 50 mg / l still induced mortality in 100% of the larvae (Figure 9B). Also at the lowest concentration tested (i.e. 3.125 mg / l), quinomycin C induced a growth delay in 60% of the treated Spodoptera larvae, which is double to what was observed with quinomycinA. These experiments with the pure chemical compounds confirm the fractionation and dereplication studies and indicate that quinomycin A and quinomycin C both separately and together are responsible for the insecticidal activity of the M25D9 extracts.
[0243] Example 9. Close relatives of M25D9 show a similar insecticidal activity and mode of action
[0244] To know whether the observed insecticidal activity of strain M25D9 was a unique strain-specific feature or was shared among M25D9 relatives, the 16S rDNA sequence of M25D9 was blasted against proprietary and public bacterial collections. We could identify 13 related strains and based on their 16S rDNA sequence we constructed a phylogenetic tree (Figure 10).
[0245] Next, the activity of their extracts (as prepared in Example 1) was tested on mortality and growth delay of Spodoptera larvae. Interestingly, the insecticidal activity as observed with the M25D9 extract and Bt control could also be observed in the extracts of M12E4, M12E5, M11C5 and public NBRC13863 strain. The extract of strain M12E3 hardly caused any mortality among the treated larvae but induced a significant growth delay in almost all treated larvae (Figure 11). The extract of the other tested strains did not have a significant effect on Spodoptera larvae, not on morality and not on growth delay (Figure 11).
[0246] Although the 16S rDNA sequence is sometimes evaluated solely as phylogenetic tool, a clear correlation could be found between the insecticidal activity of the close relatives of M25D9 and the % identity of their 16S rDNA sequences to that of M25D9 (Table 2). Strains comprising a 16S sequence with 99.50% or more identity to the 16S sequence of M25D9 were found to have insecticidal activity, while strains having a 16S sequence with only 99.20% or lower identity did not show any insecticidal activity. For those strains of which we had the whole genome sequence, we were also able to calculate the Average Nucleotide Identity (ANI). Based on those ANIb values, a similar correlation as observed using the 16S rDNA sequence was found: only those strains most closely related to M25D9 and thus having a high ANIb value (i.e. more than 90.00%) possess insecticidal activity, while the less related strain having a ANIb value of less than 85.00% were found to be not active in the performed bioassays (Table 2).
[0247] Using the pure compounds as HPLC standard, we also measured the quinomycin A and C concentrations in the extracts of M25D9 and its 13 close relatives. In all extracts with insecticidal activity a significant amount of quinomycin A and C was present (Table 2). The lowest quinomycin concentration (A+C) of 26.4 mg / l was measured in strain M12E3 which also demonstrated the lowest activity against Spodoptera larvae. The highest concentration of 122 mg / l was found in the extract of M25D9.
[0248] To summarize, the inventors of current application found that a subcluster within the Streptomyces species produces quinomycin antibiotics, more precisely quinomycin A and C. This subcluster is represented by strain M25D9 and comprises Streptomyces species having at least 99.50% identity to M25D9 on 16S rDNA level and at least 90.00% sequencing identity on whole genome level as measured by ANIb values.
[0249] Table 2. Summary of key features of strain M25D9 and its close relatives, more particularly the % identity between M25D9 and its close relatives on 16S rDNA level (16S rDNA) and whole genome level (ANIb), the presence / absence of the quinomycin biosynthetic gene cluster (BGC), the bio-insecticide (Bl) activity and the concentration in mg / l of quinomycin A (A), quinomycin C (C) and quinomycin A and C (A + C) measured in the extracts of M25D9 and close relatives. ND, not detected.
[0250] Example 10. Quinomycin production in M25D9 via a novel quinomycin biosynthetic gene cluster.
[0251] As a final confirmation that strain M25D9 and its insecticidal close relatives have the inherent capacity to produce quinoxaline antibiotics such as quinomycin A and C, the whole genome was analysed for the presence of the responsible biosynthetic gene cluster. In short, whole genome sequencing using Oxford Nanopore Technologies (ONT) and the de novo assembly of the obtained sequences was performed as explained in Example 3. Open reading frames (ORFs) were subsequently extracted from the assemblies using prodigal (Hyatt et al. 2010 BMC Bioinformatics 11). The ONT assembly of strain M25D9 consists of 3 contigs of 10,530,229 bp total length, with a GC content of 70.92%. In total, 9361 ORFs were identified in this assembly. Biosynthetic gene clusters (BGCs) were detected in the M25D9 assembly using the antiSMASH software (Blin et al. 2023 Nucleic Acids Research, doi: 10.1093 / nar / gkad344), coupled with manual analysis and curation. AntiSMASH is a software package used for identification, annotation and analysis of secondary metabolite biosynthesis gene clusters in microbial genome sequences (Medema et al., Nucleic Acids Research, 2011, 39, Web server issue, W339-W346). This revealed the presence of a BGC related to quinoxaline antibiotics production. To the best of our knowledge only 2 similar clusters have been identified so far, i.e. the triostin A biosynthetic gene cluster from Streptomyces triostinicus described by Praseuth et al. (2008 Biotechnol Prog 24) and the echinomycin gene cluster from S. lasaliensis described by Watanabe et al. (2006 Nat Chem Biol 2). In total 20 ORFs were identified in the quinomycin cluster from M25D9. These were alphabetically named qmcA to qmcT according to their consecutive location in the genome. The physical clustering of the ORFs which is a characteristic of biosynthetic gene clusters can be appreciated from the ordinal number of the ORFs listed in Table 3. The ordinal number (indicated as "Position" in Table 3) refers to the sequential indexing or numbering of the ORFs as they are present within the genome sequence. For example, while qmcA starts on the -1 strand at base 7,664,260 it received the ordinal number or position 6846 because it is the 6846thORF starting from the 5' end of the genome. Accordingly, the next ORF in line from 5' to 3' end of the genome, i.e. qmcB, starting at base 7,666,225 on the +1 strand, is given position (or ordinal number) 6847.
[0252] Table 3 provides an overview of the 20 ORFs identified in the quinomycin cluster from M25D9, their ordinal number in the genome (position) and the number of amino acids of the encoded polypeptides (#AA). QXC, quinoxaline-2-carboxylic acid.
[0253] Interestingly, compared to the published triostin (trs) cluster from S. triostinicus and echinomycin
[0254] (ecm) cluster from S. lasaliensis, it was found that the quinomycin (qmc) gene cluster from M25D9 comprises one additional ORF, i.e. qmcH (Table 4). Its position in the cluster aligns with a location between trsO and trsN or between ecm4 and ecml7in the trs and ecm clusters respectively. The qmcH ORF codes for an antibiotic biosynthesis mono-oxygenase enzyme.
[0255] A comparison on amino acid level of the polypeptides encoded by the ORFs of the three clusters revealed that the quinomycin gene cluster identified in M25D9 is most similar to the gene cluster from
[0256] S. triostinicus (Table 4).
[0257] Table 4 provides an overview of the 20 ORFs identified in the quinomycin cluster from M25D9 and the % identity on amino acid level of the polypeptides that they encode compared to the S. triostinicus trs cluster and the S. lasaliensis ecm cluster.
[0258] Next, the presence of the M25D9 quinomycin gene cluster was investigated in a subset of closely related strains of which a whole genome sequence was available, by performing a blastp analysis of its protein sequences (Altschul et al. 1990 Mol. Biol. 215). Table 5 lists the positions, the % amino acid sequence identity and the % coverage of the different ORFs in the close relatives of which the extracts showed insecticidal activity, i.e. M12E3, M12E4, M11C5 and NBRC13836. From the sequence analyses it is clear that these relatives: 1) all have the corresponding ORFs in their genome, and 2) that the % sequence identity and % coverage are very high. The sequence identity varies between 90 and 99%, while the coverage was at least 98%. Moreover, from the positions of the ORFs in the genomes of the different relatives it is clear that all ORFs are physically located together and thus form one gene cluster. Tabel 5 demonstrates that all ORFs from the quinomycin gene cluster identified in M25D9 are also present in the quinomycin-producing close relatives of M25D9. The ORFs are physically located together and encode polypeptides that have high sequence identity to the corresponding M25D9 ORFs. The same analysis was done for the close relatives of which the extracts were not active against insects, i.e. M3F2, DSM40128 and DSM102002. Fully in line with the above results, these relatives do not possess the quinomycin biosynthetic cluster (Table 6). The sequence identities that were found were extremely low (i.e. on average 40%) and importantly the ORFs that showed some sequence similarity were not physically located together. The positions of the identified ORFs are completely random. Tabel 6 demonstrates that the quinomycin gene cluster identified in M25D9 is not present in the nonactive close relatives of M25D9. Example 11. Effect of quinomycin antibiotics on plants
[0259] The research that forms the basis of the results herein described, is performed to develop biological alternatives to the current chemical plant protection agents. Besides an inhibitory effect on growth, reproduction or survival of target insects, a biological insecticide should preferably not induce any phytotoxicity. To investigate this, several concentrations of quinomycin A and quinomycin C were tested in a leaf disk assay. Briefly, yellow mustard seeds were sown in plastic trays in a growth chamber (25°C; 60% RH%; light / dark regime of 16h / 8h). At plant stage BBCH 12, leaf disk of 10 mm were cut from the first pair of true leaves. The leaf disks were placed individually, with the apical side facing up, in a well of a 48-well plate, containing 1 ml of 2% agar. The leaf disks were subsequently treated with quinomycin A and C separately at 2 pg / ml, 1 pg / ml, 0.5 pg / ml, 0.1 pg / ml and 0.01 pg / ml. Also 3 negative controls were included: DMSO (5%), m ill iQ water and an untreated control. The treatments were administered by pipetting a 2 pl droplet on the leaf disks' apical side. All treatments (n=6) contained Tween20 at a final concentration of 0.18% to avoid running off of the droplets. The multiwell plates were then transferred to the growth chamber using the same conditions as above.
[0260] Three days after the treatment, the leaf disks were visually scored. The leaf disks of the untreated and milliQ control were healthy with no or insignificant chlorosis (Figure 12). On the leaf disks that received a droplet of DMSO, the contours of the droplet were slightly visible but no chlorosis or necrosis could be observed. The droplets of quinomycin A at the highest concentration of 2 pg / ml clearly induced a local chlorosis that was less pronounced at the 1 pg / ml concentration and faded out from the 0.5 pg / ml concentration downwards. Surprisingly, even at the highest concentration, quinomycin C hardly induced any local phytotoxic effect. Also at lower concentrations, the quinomycin C treatments induced less pronounced effects compared to quinomycin A (Figure 12).
[0261] The above results demonstrated that quinomycin C has an improved agricultural profile compared to quinomycin A. Quinomycin C is not only more effective against insects compared to quinomycin A (see Figure 9), it also has fewer negative effects on plant tissue (Figure 12).
[0262] Experimental procedures
[0263] General lepidoptera diet: Frontier #F9772
[0264] The lepidoptera diet used herein comprised 30 g / l soya bean meal, 74 g / l chick pea meal, 20 g / l casein, 33.3 g / l yeast extract, 6.67 g / l Wesson's salt, 1.77 g / l sorbic acid, 3.57 g / l L-ascorbic acid, 0.56 cholesterol, 2.93 g / l methyl-4-hydroxybenzoate (Nipagin), 6.33 g / l Vanderzandt vitamin mix and 19.8 g / l agar. SEQUENCE LISTING
[0265] Throughout the description and examples, reference is made to the following sequences:
[0266] SEQ ID No. 1: Nucleotide sequence of 16S rDNA from strain M25D9
[0267] SEQ ID No. 2: forward primer 27F SEQ ID No. 3: reverse primer 1492R
[0268] SEQ ID No. 4: Nucleotide sequence of 16S rDNA from strain M11C5
[0269] Table 7 provides an overview of the amino acid sequences (SEQ ID No. 5 -SEQ ID No. 104) of the polypeptides encoded by the different ORFs of the quinomycin gene cluster in strains M25D9, M12E3, M12E4, M11C5 and NBRC13836.
[0270] SEQ ID No. 105: Nucleotide sequence of 16S rDNA from strain M12E3
[0271] SEQ ID No. 106: Nucleotide sequence of 16S rDNA from strain M12E4
[0272] SEQ ID No. 107: Nucleotide sequence of 16S rDNA from strain M12E5
Claims
CLAIMSAn insecticidal composition comprising a bio-active agent, wherein said bio-active agent comprises a compound of Formula I(Formula I) or a stereoisomer thereof.
2. The insecticidal composition according to claim 1, wherein said bio-active agent further comprises a compound of Formula II(Formula II) or a stereoisomer thereof.
3. The insecticidal composition according to any one of the previous claims, wherein said bio-active agent is a microorganism, a spore thereof, and / or a fermentation product derived from a cell culture of said microorganism.The insecticidal composition according to claim 3, wherein the microorganism is a bacterium.
5. The insecticidal composition according to claim 4, wherein the bacterium comprises a 16S rDNA sequence having at least 99.50% sequence identity to SEQ. ID No. 1 and wherein said bacterium, said spore or said fermentation product has insecticidal activity.
6. The insecticidal composition according to claim 4 or 5, wherein said bacterium has an AverageNucleotide Identity (ANI) of at least 90% to the Streptomyces strain M25D9 of which arepresentative culture has been deposited under the Budapest Treaty at the Polish Collection of Microorganisms on 2ndApril 2024 with accession number B / 00529.
7. The insecticidal composition according to any one of claims 3-6, wherein the microorganism or bacterium comprises a quinomycin biosynthetic gene cluster.
8. The insecticidal composition according to claim 7 , wherein the quinomycin biosynthetic gene cluster comprises one or more open reading frames (ORFs) encoding polypeptides sufficient to direct the synthesis of one or more quinomycin antibiotics, the ORFs being physically clustered together in the genome of said microorganism or bacterium, wherein the polypeptides have at least 50% sequence identity to one or more sequences from the list consisting of SEQ ID NO: 5- 24.
9. The insecticidal composition according to claim 7, wherein the quinomycin biosynthetic gene cluster comprises the ORFs qmcA, qmcB, qmcC, qmcD, qmcE, qmcF, qmcG, qmcH, qmcl, qmcJ, qmcK, qmcL, qmcM, qmcN, qmcO, qmcP, qmcQ, qmcR, qmcS and qmcT, the ORFs being physically clustered together in the genome of said microorganism or bacterium, wherein the ORFs encode polypeptides having at least 50% sequence identity to the corresponding amino acid sequences depicted in SEQ ID NO: 5-24.
10. The insecticidal composition according to any one of claims 4-9, wherein the bacterium is the Streptomyces strain M25D9 of which a representative culture has been deposited under the Budapest Treaty at the Polish Collection of Microorganisms on 2ndApril 2024 with accession number B / 00529, or the Streptomyces strain M11C5 of which a representative culture has been deposited under the Budapest Treaty at the BCCM-LMG on 3rdJune 2025 with accession number LMG P-34075, or a functional homologue thereof.
11. The insecticidal composition according to claim 10, wherein the functional homologue is a Streptomyces species having at least 95% sequence identity on whole genome level compared to the strain M25D9 or to the strain M11C5, wherein the functional homologue comprises the biosynthetic gene cluster as defined in any one of claims 7-9 and wherein the functional homologue produces the compound of Formula I or a stereoisomer thereof.
12. The insecticidal composition according to any one of claims 3-11, wherein the fermentation product derived from a cell culture of said microorganism or bacterium or of said functional homologue is selected from the list consisting of an extract, an extract fraction, a supernatant, a supernatant fraction, a filtrate and a whole cell broth.
13. The insecticidal composition according to any one of claims 4-12, wherein the bacterium is present at a concentration of about 102CFU to about 109CFU per ml or gram, particularly fromabout 103CFU to about 108CFU per ml or gram, or from about 104CFU to about 10sCFU per ml or gram, more particularly from about 105CFU to 107CFU per ml or gram.
14. The insecticidal composition according to any one of the previous claims, further comprising an agricultural compatible carrier.
15. The insecticidal composition according to claim 14, wherein the agricultural compatible carrier is selected from the list consisting of: a dispersant, a surfactant, an additive, a thickener, an anticaking agent, residue breakdown, a composting formulation, a granular application, diatomaceous earth, a coloring agent, a stabilizer, a preservative, a polymer, a coating, and combinations thereof.
16. The insecticidal composition according to any one of the previous claims, wherein said composition is in a liquid, semisolid, solid or gaseous form and / or wherein said composition is in a dosage form of a tablet, capsule, powder, wettable powder, spray dried formulation, granulate, aerosol, paste, syrup, suspension, emulsion or solution.
17. The insecticidal composition according to any one of the previous claims, wherein the composition is a sprayable composition.
18. The insecticidal composition according to any one of the previous claims, wherein the insecticidal composition is effective against a lepidopteran insect pest, a coleopteran insect pest, a Thysanoptera insect pest and / or a spider mite pest.
19. The insecticidal composition according to any one of claims 3-18, wherein said microorganism or bacterium is resistant to a biocide selected from an herbicide, a fungicide, a pesticide, insecticide, or a crop protection chemical and / or wherein the growth of said microorganism or bacterium is compatible with one or more agricultural chemicals selected from the list consisting of safeners, surfactants, stickers, spreaders, UV protectants, and suspension and dispersal aids.
20. The insecticidal composition according to any one of claims 3-19, wherein the microorganism or bacterium or the fermentation product derived from a cell culture of said microorganism or bacterium is not harmful to bees.
21. The insecticidal composition according to any one of claims 1 or 3-20, wherein the bio-active agent is the sole insecticidal agent and wherein said sole insecticidal agent is the compound of Formula I or a stereoisomer thereof.
22. The insecticidal composition according to any one of claims 2-20, wherein the sum of concentrations of the compounds of Formula I or a stereoisomer thereof and Formula II or a stereoisomer thereof is at least 20 mg / l.
23. A kit comprising (i) the insecticidal composition according to any one of the previous claims; and (ii) a delivery system for applying said insecticidal composition to an insect, to a plant or to a partthereof or to the plant growth medium, and optionally (iii) instructions for using the insecticidal composition.
24. A biosynthetic gene cluster comprising open reading frames (ORFs) qmcA, qmcB, qmcC, qmcD, qmcE, qmcF, qmcG, qmcH, qmcl, qmcJ, qmcK, qmcL, qmcM, qmcN, qmcO, qmcP, qmcQ, qmcR, qmcS and qmcT, the ORFs encoding polypeptides for the production of one or more quinomycin antibiotics, wherein the polypeptides have at least 50% sequence identity to the amino acid sequences depicted in SEQ ID NO: 5-24.
25. The biosynthetic gene cluster according to claim 24, wherein the polypeptides have at least 90% sequence identity to the amino acid sequences depicted in SEQ ID NO: 5-24.
26. A vector or expression cassette or host cell comprising the biosynthetic gene cluster according to claim 24 or 25.
27. The host cell according to claim 26, wherein the ORFs are physically clustered together in the genome of the host cell.
28. An isolated bacterium comprising a 16S rDNA sequence having at least 99.50% sequence identity to SEQ ID NO: 1.
29. The isolated bacterium according to claim 28 further comprising the biosynthetic gene cluster according to any one of claims 24-25.
30. The isolated bacterium according to claim 28 or 29, wherein the bacterium is strain M25D9 or a functional homologue thereof, wherein a representative culture of M25D9 has been deposited under the Budapest Treaty at the Polish Collection of Microorganisms on 2ndApril 2024 with accession number B / 00529.
31. The isolated bacterium according to claim 30, wherein said functional homologue is a Streptomyces bacterium: comprising a 16S rDNA as depicted in SEQ ID NO: 1; having an average nucleotide identity to strain M25D9 of at least 95%; and comprising a quinomycin biosynthetic gene cluster.
32. The isolated bacterium according to claim 31, wherein the functional homologue: is directly or indirectly obtained by induced or spontaneous mutation of strain M25D9; and produces the compound of Formula I or a stereoisomer thereof.
33. The isolated bacterium according to claims 28 or 29, wherein the bacterium is strain M11C5 or a functional homologue thereof, wherein a representative culture of M11C5 has been deposited under the Budapest Treated at BCCM / LMG on 3rdJune, 2025 under Accession No. LMG P-34075.
34. The isolated bacterium according to claim 33, wherein the functional homologue is a Streptomyces bacterium: comprising a 16S rDNA as depicted in SEQ. ID NO: 4; having an average nucleotide identity to strain M11C5 of at least 95%; and comprising a quinomycin biosynthetic gene cluster.
35. The isolated bacterium according to claim 34, wherein the functional homologue:- is directly or indirectly obtained by induced or spontaneous mutation of strain M11C5; and- produces the compound of Formula I or a stereoisomer thereof.
36. A composition comprising the isolated bacterium according to any one of claims 28-35, wherein the isolated bacterium is lyophilized, freeze-dried or in a form selected from dried cells, dehydrated cells, devitalized cells, inactivated cells, frozen cells or cells in artificial suspension or in a dry powder.
37. A cell culture of the isolated bacterium according to any one of claims 28-35.
38. The cell culture according to claim 37, wherein the cell culture is an enriched culture or a biologically pure culture.
39. A product derived from the cell culture according to claims 37 or 38, wherein the product is selected from the list consisting of a spore, an extract, an extract fraction, a whole cell broth, a supernatant, a supernatant fraction and a filtrate.
40. The product according to claim 39, wherein the product comprises the compound of Formula I or a stereoisomer thereof.
41. The product according to claim 40, wherein the product further comprises the compound of Formula II or a stereoisomer thereof and wherein the sum of concentrations of the compounds of Formula I and Formula II or of its stereoisomers is at least 20 mg / l.
42. Use of a compound of Formula I(Formula I) or a stereoisomer thereof,for controlling an insect pest population or for protecting a crop against an insect pest.
43. Use of the biosynthetic gene cluster according to any one of claims 24-25 for the production of one or more quinomycin antibiotics.
44. Use of the isolated bacterium according to any one of claims 28-35, the composition according to claim 36, the culture according to claim 37 or 38 or the product according to any one of claims39-41, for controlling an insect pest population or for protecting a crop against an insect pest.
45. A method of controlling an insect pest population or of controlling insect damage to a plant comprising the step of applying to said plant or plant part thereof the insecticidal composition according to any of claims 1-22.
46. The method according to claim 45, further comprising a step of determining the effect of the application of the insecticidal composition.
47. The use according to any one of claims 42-44 or the method according to any one of claims 45- 46, wherein the insect is of an order selected from the group consisting of Lepidoptera, Coleoptera, Trombidiformes, and Thysanoptera.
48. The use according to any one of claims 42-44 or the method according to any one of claims 45-46, wherein the insect is of the genus Spodoptera, Diabrotica, Tetranychus, Frankliniella or Leptinotarsa.
Citation Information
Patent Citations
Chemically regulatable and anti-pathogenic DNA sequences and uses thereof
US5614395A