Composition for preventing, ameliorating or treating central nervous system diseases comprising peptidomimetic containing hydrophilic arginine and hydrophobic histidine derivative
The peptidomimetic compound NIP001 addresses neuroinflammation and cognitive decline in neurodegenerative diseases by inhibiting inflammatory pathways and enhancing cognitive function, offering a promising treatment for conditions like Alzheimer's and Parkinson's.
Patent Information
- Application Number
- PCT/KR2025/095442
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-06-26
- Filing Date
- 2025-06-24
- Publication Date
- 2026-01-02
AI Technical Summary
Current treatments for neurodegenerative diseases such as Alzheimer's and Parkinson's are inadequate in addressing neuroinflammation and cognitive decline, with existing therapies failing to effectively modulate microglia-mediated inflammation and improve cognitive function.
A peptidomimetic compound (NIP001) containing a hydrophilic arginine and a hydrophobic histidine derivative is developed to inhibit neuroinflammation by suppressing the production of inflammatory mediators and cytokines, modulating the MAPK signaling pathway, and enhancing cognitive function through increased expression of BDNF and pCREB.
NIP001 effectively suppresses neuroinflammation, improves cognitive dysfunction, and enhances memory and learning in animal models of neurodegenerative diseases by inhibiting inflammatory pathways and promoting neuroprotective factors.
Smart Images

Figure KR2025095442_02012026_PF_FP_ABST
Abstract
Description
Composition for preventing, improving or treating central nervous system diseases comprising a peptidomimetic containing a hydrophilic arginine and a hydrophobic histidine derivative
[0001] The present invention relates to a composition for preventing, improving or treating a central nervous system disease, comprising a peptidomimetic compound (NIP001) containing a hydrophilic arginine and a hydrophobic histidine derivative.
[0002] Neuroinflammation plays a crucial role in the pathogenesis of neurodegenerative diseases such as Alzheimer's disease (AD), Mild Cognitive Impairment (MCI), Parkinson's disease (PD), and dementia. Neuroinflammation is a crucial defense mechanism against infectious agents and neuronal damage in the central nervous system (CNS), and prolonged, excessive inflammation can unexpectedly damage healthy neurons, leading to neurodegeneration (Amanollahi, M., et al., Molecular Neurobiology, 60(2): 923–959, 2023).
[0003] Microglia are key responders to infection and damage in the CNS and play a crucial role in regulating neuroinflammation. In response to neurotoxins such as LPS, microglia can release cytotoxic molecules, inflammatory cytokines such as TNF-α, IL-1β, and IL-6, inflammatory mediators such as iNOS and COX-2, and nitric oxide (NO). Therefore, modulating microglia-mediated inflammation could be used to prevent and treat neurodegenerative diseases.
[0004] Scopolamine interferes with cholinergic neurotransmission, causing cognitive decline and affecting learning and memory. Scopolamine administration reduces brain-derived neurotrophic factor (BDNF), an essential synaptic plasticity and memory learning, along with cAMP response element binding protein (cAMP) levels, which regulate BDNF (Balakrishnan, R., et al., Biomedicine & Pharmacotherapy, 165:115-106, 2023).
[0005]
[0006] Meanwhile, peptides, a core biomaterial, are the functional minimum units of proteins and consist of between 2 and 50 amino acids. Not only do they exhibit excellent efficacy in small quantities, but they are also non-toxic, making them widely used as key raw materials in pharmaceuticals, foods, and cosmetics. Peptides, in particular, are safe and effective for the human body, and their use is steadily increasing. Furthermore, the development of new materials is crucial for the sugar industry, as they can provide import substitution benefits.
[0007] Peptidomimetics, analogs of peptides, are key next-generation biomaterials that can dramatically overcome peptides' inherent weakness of stability in the body while maintaining their high efficacy. Since 2000, advances in synthetic technology have led to the commercialization and research of peptides, which had previously been unavailable. Furthermore, research into new drugs based on these peptides has steadily increased each year.
[0008] The peptide used in the present invention is derived from an antibacterial peptide sequence derived from red sea bream. Red sea bream contains a large amount of antibacterial peptides (AMPs), i.e., antibacterial peptides, and secretes these peptides to prevent bacterial infections in areas vulnerable to bacterial infection, such as the gills, gastrointestinal tract, and skin. In particular, chrysophsin-1 is an amphipathic α-helical antibacterial peptide produced by the gill cells of red sea bream. It is effective against both Gram-positive and Gram-negative bacteria and has a broad spectrum of antibacterial and anti-inflammatory effects. In addition, the C-terminal RRRH motif of chrysophsin-1 has the advantage of forming a non-helical hydrophilic domain that contributes to the formation of pores in the bacterial membrane.
[0009] Accordingly, in the present invention, a peptidomimetic compound (NIP001) with excellent anti-inflammatory efficacy was selected based on the C-terminal RRRH of chrysopsin-1 as a basic motif to develop a neuroinflammation inhibitor for the treatment of central nervous system diseases. The NIP001 compound of the present invention was confirmed to be able to effectively suppress neuroinflammation and effectively improve cognitive dysfunction induced by scopolamine, thereby completing the present invention.
[0010]
[0011] Accordingly, the purpose of the present invention is to provide a composition for preventing, improving or treating a central nervous system disease, which comprises a peptidomimetic containing a hydrophilic arginine and a hydrophobic histidine derivative as an active ingredient.
[0012] To achieve the above-mentioned purpose,
[0013] The present invention provides a pharmaceutical composition for preventing or treating a central nervous system disease, comprising a peptidomimetic compound represented by the following chemical formula 1 as an active ingredient.
[0014] In addition, the present invention provides a health functional food composition for preventing or improving central nervous system diseases, which comprises a peptidomimetic compound represented by the following chemical formula 1 as an active ingredient.
[0015] [Chemical Formula 1]
[0016]
[0017] In a preferred embodiment of the present invention, the compound: i) inhibits the production of inflammatory mediators including NO, iNOS, and COX-2;
[0018] ⅱ) Inhibition of MAPK signaling pathway through inhibition of phosphorylation of ERK, p38 or JNK;
[0019] ⅲ) Inhibition of the production of inflammatory cytokines including IL-6 and TNF-α; or
[0020] ⅳ) Neuroinflammation can be controlled by suppressing NF-κB activity through inhibition of IκB-α phosphorylation and p65 translocation.
[0021] In another preferred embodiment of the present invention, the compound inhibits the expression of inflammatory factors including iNOS or COX-2 in the hippocampus or cerebral cortex; or
[0022] ⅱ) Memory and cognitive function can be improved by increasing the expression of cognitive functional factors including BDNF or pCREB.
[0023] In another preferred embodiment of the present invention, the central nervous system disease may be a neuroinflammatory disease or memory impairment or cognitive dysfunction, and specifically, may be any one selected from the group consisting of multiple sclerosis, neuroblastoma, Parkinson's disease, Lou Gehrig's disease, Huntington's disease, Creutzfeldt-Jakob disease, post-traumatic stress disorder, depression, schizophrenia, amyotrophic lateral sclerosis, mild cognitive impairment, attention deficit disorder (ADHD), Alzheimer's disease, ischemic stroke, cerebrovascular dementia, and senile dementia.
[0024] In the present invention, it was confirmed that a peptidomimetic compound containing a hydrophilic arginine and a hydrophobic histidine derivative effectively suppresses an inflammatory response in microglial cells, and has an effect of improving cognitive function in mice induced with cognitive dysfunction by scopolamine. Therefore, it can be used as a target treatment for central nervous system diseases.
[0025] Figure 1 shows data confirming (A) the NO production inhibition rate and (B) cell survival rate when LPS-stimulated BV-2 cells were treated with a peptidomimetic compound (NIP001) at various concentrations.
[0026] Figure 2 shows data that quantifies the degree of inhibition of (A) iNOS mRNA and (B) iNOS protein expression when LPS-stimulated BV-2 cells were treated with a peptidomimetic compound (NIP001) at various concentrations.
[0027] Figure 3 shows data that quantifies the degree of inhibition of (A) COX-2 mRNA and (B) COX-2 protein expression when LPS-stimulated BV-2 cells were treated with a peptidomimetic compound (NIP001) at various concentrations.
[0028] Figure 4 shows (A) data measuring cytokine (TNF-α, IL-1β, IL-6) mRNA expression and (B) data quantifying the level of each mRNA expression when LPS-stimulated BV-2 cells were treated with a peptidomimetic compound (NIP001) at various concentrations.
[0029] Figure 5 shows data confirming the degree of phosphorylation inhibition of MAPK pathway-related factors when LPS-stimulated BV-2 cells were treated with a peptidomimetic compound (NIP001) at various concentrations. (A) is data confirming the degree of ERK protein expression and phosphorylation and quantifying the degree of phosphorylation, and (B) is data confirming the degree of JNK and p38 protein expression and phosphorylation.
[0030] Figure 6 shows data showing the degree of inhibition of expression and phosphorylation of (A) NF-κB (p65) and (B) IκB-α proteins when LPS-stimulated BV-2 cells were treated with a peptidomimetic compound (NIP001) at various concentrations, and the degree of phosphorylation was quantified.
[0031] Figure 7 is an image of the intracellular NF-κB (p65) location observed using a fluorescence microscope when LPS-stimulated BV-2 cells were treated with various concentrations of a peptidomimetic compound (NIP001).
[0032] Figure 8 is a schematic diagram showing an experimental method for an animal model of cognitive dysfunction induced by scopolamine.
[0033] Figure 9 shows data showing (A) the total number of arm entries and (B) the percentage of alteration in behavior when a Y-maze experiment was performed after treating a scopolamine-induced cognitive dysfunction animal model with a peptidomimetic compound (NIP001) at various concentrations.
[0034] Figure 10 shows data showing (A) the trajectory map of a mouse during a water maze test, and (B and C) the distance traveled and the mean escape latency to find a hidden platform in a water maze test, when a scopolamine-induced cognitive dysfunction animal model was treated with a peptidomimetic compound (NIP001) at various concentrations and then a water maze test (Morris Water Maze Test; MWM) was performed.
[0035] Figure 11 shows data confirming the degree of inhibition of iNOS and COX-2 protein production in the hippocampus when a peptidomimetic compound (NIP001) was treated at various concentrations in an animal model of scopolamine-induced cognitive dysfunction.
[0036] Figure 12 shows data quantifying (A) the degree of inhibition of p-CREB / BDNF protein production in the hippocampus and (B, C) the degree of expression of each protein when a peptidomimetic compound (NIP001) was treated at various concentrations in a scopolamine-induced cognitive dysfunction animal model.
[0037] Hereinafter, the present invention will be described in detail.
[0038]
[0039] The present invention relates to a pharmaceutical composition for preventing or treating a central nervous system disease, comprising a peptidomimetic compound (NIP001) represented by the following chemical formula 1 as an active ingredient.
[0040] From another consistent perspective, the present invention relates to a health functional food composition for preventing or improving central nervous system diseases, comprising a peptidomimetic compound (NIP001) represented by the following chemical formula 1 as an active ingredient.
[0041] [Chemical Formula 1]
[0042]
[0043] In the present invention, the peptidomimetic compound (NIP001) i) inhibits the production of inflammatory mediators including NO, iNOS, and COX-2;
[0044] ⅱ) Inhibition of MAPK signaling pathway through inhibition of phosphorylation of ERK, p38 or JNK;
[0045] ⅲ) Inhibition of the production of inflammatory cytokines including IL-6 and TNF-α; and / or
[0046] ⅳ) It can control neuroinflammation by inhibiting NF-κB activity through inhibition of IκB-α phosphorylation and inhibition of p65 translocation.
[0047] In the present invention, the peptidomimetic compound (NIP001) inhibits the expression of inflammatory factors including iNOS or COX-2 in the hippocampus or cerebral cortex; or
[0048] ⅱ) Memory and cognitive function can be improved by increasing the expression of cognitive functional factors including BDNF or pCREB.
[0049]
[0050] In the present invention, the peptidomimetic compound (NIP001) may be included in the entire composition at a concentration of 5 to 500 μg / ml, preferably 10 to 100 μg / ml. If the extract is included at a concentration below the above concentration range, the effect may be minimal, and if the concentration range is exceeded, cytotoxicity may occur.
[0051]
[0052] In a specific embodiment of the present invention, H-Arg-Arg-His(Bis-cyclohexylpropyl)-NH2, a peptidomimetic compound (NIP001) with excellent anti-inflammatory efficacy, was synthesized using the C-terminal RRRH of chrysopsin-1 as a basic motif.
[0053] As a result of confirming the anti-inflammatory activity of the above NIP001 compound, it was confirmed that it exhibited the efficacy of inhibiting NO production in LPS-stimulated BV-2 cells (Fig. 1), inhibiting iNOS and COX-2 production (Figs. 2 and 3), inhibiting cytokine production (Fig. 4), inhibiting phosphorylation of factors related to the MAPK pathway (Fig. 5), inhibiting phosphorylation of NF-κB (p65) and IκB-α (Fig. 6), and inhibiting translocation of phosphorylated NF-κB (p-p65) to the nucleus (Fig. 7).
[0054] In another specific embodiment of the present invention, when the NIP001 compound was administered to a scopolamine-induced cognitive dysfunction mouse model, it was confirmed that memory and cognitive dysfunction induced by scopolamine were improved (Figs. 8 and 9). In addition, it was confirmed that cognitive function could be improved through inhibition of iNOS and COX-2 production in the cerebral hippocampus (Fig. 11) and activation of the BDNF-pCREB pathway (Fig. 12) by the NIP001 compound.
[0055] That is, the peptidomimetic compound (NIP001) containing the hydrophilic arginine and hydrophobic histidine derivatives of the present invention was confirmed to suppress neuroinflammation and improve memory and cognitive function impairment in an animal model induced with cognitive dysfunction (Alzheimer's disease), and therefore can be utilized as a composition for preventing, improving, or treating central nervous system diseases including neuroinflammatory diseases, memory impairment disorders, or cognitive dysfunction.
[0056]
[0057] In the present invention, the central nervous system disease may be any one selected from the group consisting of multiple sclerosis, neuroblastoma, Parkinson's disease, Lou Gehrig's disease, Huntington's disease, Creutzfeldt-Jakob disease, post-traumatic stress disorder, depression, schizophrenia, amyotrophic lateral sclerosis, mild cognitive impairment, attention deficit disorder (ADHD), Alzheimer's disease, ischemic stroke, cerebrovascular dementia, and senile dementia.
[0058]
[0059] In another aspect, the present invention relates to a pharmaceutical composition for preventing or treating an inflammatory disease, or a health functional food composition for preventing or improving an inflammatory disease, comprising a peptidomimetic compound (NIP001) represented by the following chemical formula 1 as an active ingredient.
[0060] [Chemical Formula 1]
[0061]
[0062] In the present invention, it was confirmed that inflammation was effectively suppressed by a peptidomimetic compound (NIP001), and therefore, it can be utilized as a composition for preventing, improving, or treating inflammatory diseases as well as central nervous system diseases.
[0063] The inflammatory disease may be any one selected from the group consisting of rheumatoid arthritis, neuroarthritis due to physical damage, inflammatory enteritis, ankylosing spondylitis, psoriasis, atherosclerosis, arteriosclerosis, asthma, acute pain, chronic pain, neuropathic pain, post-surgical pain, pain such as migraine and arthralgia, nerve damage, irritable bowel syndrome, endotoxin-induced shock, inflammatory bowel disease, and inflammatory lumbago.
[0064]
[0065] The pharmaceutical composition of the present invention can be formulated and used in various forms according to conventional methods. For example, it can be formulated in oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, and syrups, and can be formulated and used in the forms of topical preparations, suppositories, and sterile injectable solutions. Depending on each dosage form, pharmaceutically acceptable carriers, excipients, and diluents may be further included. In addition, it can be formulated and used in the forms of topical preparations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, and aerosols, and sterile injectable solutions according to conventional methods.
[0066] The carrier, excipient and diluent include lactose, dextrose, sucrose, oligosaccharide, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methyl hydroxy benzoate, propyl hydroxy benzoate, talc, magnesium stearate, mineral oil, etc. When formulating or formulating the pharmaceutical composition, it is prepared using diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants and surfactants that are commonly used.
[0067] Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations are prepared by mixing the composition with at least one excipient, such as starch, calcium carbonate, sucrose, lactose, gelatin, etc. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid preparations for oral administration include suspensions, oral solutions, emulsions, syrups, etc., and in addition to commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, flavoring agents, and preservatives may be included. Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, suppositories, etc. Non-aqueous solvents and suspending agents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. Suppository bases include witepsol, macrogol, Tween 61, cocoa butter, laurin, and glycerogelatin.
[0068] The term "administration" as used herein means providing the pharmaceutical composition of the present invention to a subject by any suitable method. The pharmaceutical composition of the present invention may be administered in a therapeutically effective amount, which is an amount of an active ingredient or pharmaceutical composition that induces a biological or medical response in a tissue, animal, or human as contemplated by a researcher, veterinarian, physician, or other clinician, i.e., an amount that induces alleviation of the symptoms of the disease or disorder being treated. It will be apparent to those skilled in the art that the therapeutically effective dosage and frequency of administration of the pharmaceutical composition of the present invention will vary depending on the desired effect. Therefore, the optimal dosage to be administered can be readily determined by those skilled in the art and can be adjusted according to various factors, including the type of disease, the severity of the disease, the content of the active ingredient and other ingredients contained in the composition, the type of formulation, the patient's age, weight, general health, sex, and diet, the time of administration, the route of administration, the excretion rate of the composition, the treatment period, and concurrently used drugs. The pharmaceutical composition of the present invention may be administered to a subject by various routes. For example, it can be administered intravenously, intraperitoneally, intramuscularly, intraarterially, orally, intracardiacly, intramedullary, intrathecally, transdermally, enterally, subcutaneously, sublingually, or topically, but is not limited thereto. The pharmaceutical composition of the present invention can be administered in an amount of 1 to 10,000 mg / kg / day, and can be administered once a day or divided into several doses.
[0069]
[0070] The health functional food composition of the present invention can be used as a health functional food, food additive, or dietary supplement. When the composition of the present invention is used as a food additive, it can be appropriately used according to conventional methods, such as by adding it as is or mixing it with other foods or food ingredients.
[0071] In addition, the mixing amount of the health functional food composition may be appropriately changed depending on the intended use (prevention, health, or therapeutic treatment). For example, when manufacturing food or beverages, the composition of the present invention is added in an amount of 15% by weight or less, preferably 10% by weight or less, based on the raw material. However, when consumed for long-term purposes for health and hygiene or health control, the composition may be added in an amount below the above range, and since there are no safety issues, the active ingredient may be used in an amount exceeding the above range.
[0072] There is no particular limitation on the type of the above food, but examples of foods to which the composition of the present invention can be added include meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, dairy products including ice cream, various soups, beverages, tea, drinks, alcoholic beverages, vitamin complexes, etc., and include all health foods in the conventional sense.
[0073] When the health functional food composition of the present invention is manufactured into a beverage, it may contain various flavoring agents or additional ingredients such as natural carbohydrates, as in conventional beverages. The natural carbohydrates may include monosaccharides such as glucose and fructose; disaccharides such as maltose and sucrose; natural sweeteners such as dextrin and cyclodextrin; and synthetic sweeteners such as saccharin and aspartame. The natural carbohydrates are contained in an amount of 0.01 to 10 wt%, preferably 0.01 to 0.1 wt%, based on the total weight of the food composition of the present invention.
[0074] The health functional food composition of the present invention may include various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc., and may include fruit pulp for the production of natural fruit juice, fruit juice drinks, and vegetable drinks, but is not limited thereto. These components may be used independently or in combination. The proportion of the above additives is not particularly limited, but is preferably included within the range of 0.01 to 0.1 wt% with respect to the total weight of the food composition of the present invention.
[0075] Hereinafter, the present invention will be described in more detail through examples.
[0076] These examples are intended solely to illustrate the present invention, and it will be apparent to those skilled in the art that the scope of the present invention is not to be construed as being limited by these examples.
[0077]
[0078] [Example 1]
[0079] Manufacturing of peptidomimetic compound (NIP001)
[0080] 1-1: Preparation of H-His(Bis-cyclohexylpropyl)-NH-resin (Rink Amide AM)
[0081] Rink Amide AM resin (substitution ratio = 0.70 mmol / g, 100 mmole) and N,N-dimethylformamide (N,N-dimethylformamide; 1000 mL, hereinafter referred to as DMF) were placed in a solid-phase synthesis reactor equipped with a filter membrane, and the resin was allowed to swell for 10 minutes, after which the solvent was removed through the filter membrane under reduced pressure. Fmoc-His(Bis-cyclohexylpropyl)-OH (molecular weight = 626.85 g / mol, 188.06 g, 300 mmol, 3.0 equivalents) and Oxyma (molecular weight = 142.11 g / mol, 46.90 g, 330 mmole) were dissolved in 1000 mL of DMF and then added. DIC (molecular weight = 126.2 g / mol, 41.7 g, 330 mmole) was added dropwise to the mixed reaction solution and stirred gently at room temperature for 5 hours. After washing the resin twice with 1000 mL of DMF, 1000 mL of a 20% piperidine / DMF solution was added and stirred for 15 minutes, the reaction solution was removed by filtration under reduced pressure, and the resin was treated once more in the same manner. After washing the resin a total of 6 times with 1000 mL of DMF, H-His(Bis-cyclohexylpropyl)-NH-resin (Rink Amide AM) represented by the following chemical formula A was obtained (substitution ratio: 0.7 mmol / g, yield >99%).
[0082] [Chemical Formula A]
[0083]
[0084] 1-2: Preparation of H-Arg(Pbf)-His(Bis-cyclohexylpropyl)-NH-resin (Rink Amide AM)
[0085] Fmoc-Arg(Pbf)-OH (molecular weight = 648.8 g / mol, 194.64 g, 300 mmol, 3.0 equivalents) and Oxyma (molecular weight = 142.11 g / mol, 46.90 g, 330 mmole) dissolved in 1000 mL of DMF were added to a reactor containing H-His(Bis-cyclohexylpropyl)-NH-resin (Rink Amide AM) (100 mmole). DIC (molecular weight = 126.2 g / mol, 41.7 g, 330 mmole) was added dropwise to the mixed reaction solution and stirred gently at room temperature for 5 hours. After washing the resin twice with 1000 mL of DMF, 1000 mL of a 20% piperidine / DMF solution was added and stirred for 15 minutes. After removing the reaction solution by filtration under reduced pressure, the resin was treated once more in the same manner, and the resin was washed a total of 6 times with 1000 ㎖ of DMF, H-Arg(Pbf)-His(Bis-cyclohexylpropyl)-NH-resin (Rink Amide AM) represented by the following chemical formula B was obtained (yield >99%).
[0086] [Chemical Formula B]
[0087]
[0088] 1-3: Manufacturing of H-Arg(Pbf)-Arg(Pbf)-His(Bis-cyclohexylpropyl)-NH-resin (Rink Amide AM)
[0089] Fmoc-Arg(Pbf)-OH (molecular weight = 648.8 g / mol, 194.64 g, 300 mmole) and Oxyma (molecular weight = 142.11 g / mol, 46.90 g, 330 mmole) dissolved in 1000 mL of DMF were added to a reactor containing H-Arg(Pbf)-His(Bis-cyclohexylpropyl)-NH-resin(Rink Amide AM) (100 mmole). DIC (molecular weight = 126.2 g / mol, 41.7 g, 330 mmole) was added dropwise to the mixed reaction solution, and the mixture was stirred gently at room temperature for 5 hours. After washing the resin twice with 1000 ml of DMF, 1000 ml of a 20% piperidine / DMF solution was added and stirred for 15 minutes. The reaction solution was removed by vacuum filtration, and the resin was treated once more in the same manner. After washing the resin a total of 6 times with 1000 ml of DMF, H-Arg(Pbf)-Arg(Pbf)-His(Bis-cyclohexylpropyl)-NH-resin (Rink Amide AM) represented by the following chemical formula C was obtained (yield >99%).
[0090] [Chemical Formula C]
[0091]
[0092] 1-4: Preparation of Crude H-Arg-Arg-His(Bis-cyclohexylpropyl)-NH₂
[0093] H-Arg(Pbf)-Arg(Pbf)-His(Bis-cyclohexylpropyl)-NH-resin (Rink Amide AM) was placed in a reactor, and 3 liters of cooled TFA / TIPS / water (95 / 2.5 / 2.5) solution was slowly poured in, followed by stirring at room temperature for 3 hours. The reaction solution was slowly added dropwise to 12 liters of cooled diethyl ether to precipitate the peptide. After stirring at room temperature for 30 minutes, the peptide was recovered by filtration, and the solvent was removed under reduced pressure. After drying in a vacuum dryer for 5 hours, 63.5 g of white crude H-Arg-Arg-His(Bis-cyclohexylpropyl)-NH₂ represented by the following chemical formula 1 was obtained (molecular weight 716.0 g / mol, crude peptide purity 73.7%, yield 88.7%).
[0094] [Chemical Formula 1]
[0095]
[0096] 1-5: H-Arg-Arg-His(Bis-cyclohexylpropyl)-NH2 production
[0097] 63.5 g of Crude H-Arg-Arg-His(Bis-cyclohexylpropyl)-NH₂ obtained in the above <Example 1-4> was dissolved in purified water and then filtered through a 0.46 μm membrane. The filtrate was repeatedly injected into industrial HPLC (230 nm, 500 ml / min, 10 micron C18 column, increasing the initial concentration of acetonitrile in 0.1% TFA from 13% to 70% within 20 minutes), and the main fraction was fractionated to obtain 29.53 g (yield: 46.5%, purity: 99.39%) of the tripeptide represented by the above chemical formula 1. The obtained compound was named NIP001.
[0098]
[0099] [Example 2]
[0100] Confirmation of the inhibitory effect of NIP001 compound on NO production in LPS-stimulated microglia.
[0101] The degree of inhibition of nitric oxide (NO) production and cytotoxicity of the peptidomimetic compound (NIP001) according to the present invention were measured.
[0102] Mouse-derived BV-2 microglial cells were cultured in DMEM medium supplemented with 10% (v / v) FBS and 1% (v / v) penicillin / streptomycin at 37°C in 5% CO2.
[0103] To perform the NO assay, seed 5 x 10 cells in a microplate. 4 After seeding with a dog / well, LPS (200 ng / ml) and NIP001 compound (12.5, 25, 50 μM) were added and cultured for 24 h. Then, 50 μl of each supernatant was mixed with Griess reagent (1% sulfanilamide / 0.1% N-(1-naphthyl)-ethylenediamine dihydrochloride / 2.5% H3PO4), and the absorbance was measured colorimetrically at 550 nm using an ELISA plate reader, and the nitrite concentration was calculated by referring to a standard curve of sodium nitrite generated by known concentrations.
[0104]
[0105] To assess cytotoxicity, cell viability was measured using the MTT assay. Specifically, after performing the NO assay, 30 μL of 0.5 mg / mL MTT was added to the cells in a microplate. After incubation for 2 hours, formazan crystals were dissolved in 100 μL of DMSO, and the absorbance was measured at 540 nm.
[0106]
[0107] As a result, as shown in Fig. 1, it was confirmed that the NIP001 compound inhibited NO production in a concentration-dependent manner without cytotoxicity.
[0108]
[0109] [Example 3]
[0110] Inhibition of inflammatory mediator production and cytokine production by NIP001 compound in LPS-stimulated microglia
[0111] In the present invention, we attempted to confirm whether the expression of inflammatory mediators iNOS and COX-2, and cytokines TNF-α, IL- 1β, and IL-6 was inhibited by the NIP001 compound.
[0112]
[0113] 3-1: Checking mRNA expression level
[0114] First, 5 × 10 BV-2 microglia were seeded in a 6-well plate. 4 After dividing the cells to a cell count of 10 / ml, 24 hours later, the NIP001 compound was treated at various concentrations (12.5, 25, 50 μM) for 1 hour, and then LPS (100 ng / ml) was treated for 6 hours.
[0115] Total RNA was then extracted from cells using the easy-BLUE reagent according to the manufacturer's instructions. The total RNA concentration was measured using a Nanodrop device (MOLECULAR DEVICES, USA). Subsequently, cDNA was synthesized using a reverse transcription kit (Applied Biosystems, USA), and PCR amplification was performed using the primers listed in Table 1 (biotech, Korea).
[0116] Primer Sequence Name Seqence (5' -> 3') Sequence Number iNOS Forward GAGGTACTCAGCGTGCTCCA Sequence Number 1 Reverse AGGGAGAGAAAGGGAGAGAGG Sequence Number 2 COX-2 Forward TGAGTGGTAGCCAGCAAAGC Sequence Number 3 Feverse CTGCAGTCCAGGTTCAATGG Sequence Number 4 IL-1β Forward CAAGGAGAACCAAGCAACGA Sequence Number 5 Reverse TTGGCCGAGGACTAAGGAGT Sequence Number 6 IL-6 Forward GGAGGCTTAATTACACATGTT Sequence Number 7 Reverse TGATTTCAAGATGAATTGGAT Sequence Number 8 TNF-α Forward AGGGAGAAGTGGTCAGGTTGC Sequence Number 9 Reverse CAGCCTGGTCACCAAATCAG Sequence Number 10 GAPDH Forward ACCACAGTCCATGCCATCAC Sequence Number 11ReverseCCACCACCCTGTTGCTGTAG SEQ ID NO: 12
[0117] 3-2: Checking the level of protein expression
[0118] BV-2 cells were cultured in the same manner as in <Example 3-1> above, and then treated with NIP001 compound at various concentrations (12.5, 25, 50 μM) for 1 hour, followed by treatment with LPS (100 ng / ml) for 30 minutes.
[0119] Cells were washed twice with cold PBS and homogenized using lysis buffer (1x RIPA lysis buffer containing a cocktail of protease and phosphatase inhibitors (1:1)). The homogenized samples were centrifuged at 13.00 rpm for 15 min at 4°C, and the supernatant was collected and measured using a BSA protein assay kit (Thermo Fisher). The same protein (20 μg / 10 μl) was electrophoresed on an 8–15% SDS-PAGE (sodium dodecyl sulfate-polyacrylamide electrophoresis) gel and then transferred to a PVDF (polyvinylidene-difluoride) membrane (Millipore, USA).
[0120] To prevent nonspecific binding, the membranes were incubated with 5% skim milk at room temperature for 1 hour, and then primary antibodies, anti-COX-2 (#12282, Cell Signaling), anti-iNOS (#610431, BD), and anti-β-actin antibodies (#AC004, Cell Signaling), were added and incubated overnight at 4°C. Secondary antibodies, anti-mouse or anti-rabbit (1:10,000), were then added and incubated at room temperature. The membranes were visualized according to the protocol of the enhanced chemiluminescence detection system (LAS 500; GE Healthcare Bio-Sciences AB, Sweden), and protein bands were detected and quantified for relative intensities using ImageJ software.
[0121]
[0122] As a result, as shown in Figures 2 and 3, the mRNA and protein expression of iNOS and COX-2 were inhibited in a concentration-dependent manner of the NIP001 compound. In addition, as shown in Figure 4, it was confirmed that the mRNA expression of the cytokines TNF-α, IL-1β, and IL-6 was inhibited in a concentration-dependent manner of the NIP001 compound.
[0123]
[0124] [Example 4]
[0125] Confirmation of the inhibitory effect of NIP001 on the MAPK signaling pathway in LPS-stimulated microglia.
[0126] In the present invention, it was confirmed that the MAPK signal pathway was inhibited by the NIP001 compound.
[0127] Western blot was performed using the proteins isolated in the above <Example 3-2>, and anti-p38 (#9212S, cell signaling), anti-p-p38 (#9211S, cell signaling), anti-JNK (#9252, cell signaling), anti-p-JNK (#9251, cell signaling), anti-ERK (#9102, cell signaling), anti-p-ERK (#9101, cell signaling), and anti-β-actin antibody (#AC004, Cell signaling) were used as primary antibodies.
[0128]
[0129] As a result of confirming the effect of the NIP001 compound on the phosphorylation of MAPKs, as shown in Fig. 5, when BV-2 microglial cells were treated with LPS, the phosphorylation of ERK, p38, and JNK was significantly increased, but it was confirmed that the phosphorylation of ERK was selectively inhibited in a concentration-dependent manner of the NIP001 compound.
[0130] In contrast, the NIP001 compound did not participate in the JNK pathway, and although p38 was found to be reduced at high concentrations on the band, it did not reach statistical significance.
[0131]
[0132] [Example 5]
[0133] Confirmation of the inhibitory effect of NIP001 compound on NF-κB activation in LPS-stimulated microglia.
[0134] In the present invention, it was confirmed that nuclear translocation of the transcription factor NF-κB was inhibited by the NIP001 compound.
[0135] Western blot was performed using the proteins isolated in the above <Example 3-2>, and anti-IκB (#4812, cell signaling), anti-NFκB / p65 (#8242, cell signaling), and anti-β-actin antibodies (#AC004, Cell signaling) were used as primary antibodies.
[0136]
[0137] As a result, as shown in Fig. 6, in cells treated with LPS, phosphorylation of NF-κB (p65) increased, whereas phosphorylation of p65 decreased in a concentration-dependent manner of the NIP001 compound. In addition, phosphorylation of IκB-α also increased when treated with LPS, but it was confirmed that phosphorylation of IκB-α was inhibited in a concentration-dependent manner of the NIP001 compound.
[0138]
[0139] To observe the degree of nuclear translocation of NF-κB in cells, immunofluorescence staining was performed according to a known method (Azam, S., et al., International Journal of Molecular Sciences, 23(17):9923, 2022). Specifically, the cells were treated with the NIP001 compound and LPS in the same manner as in <Example 3-1>, fixed with acetone for 30 seconds, and then washed three times with phosphate-buffered saline (PBS).
[0140] Cells were blocked with 2% BSA solution and incubated at room temperature for 30 minutes. The samples were then incubated with the primary antibody (anti-p-NF-κB) at 4°C. The following day, the cells were washed three times with PBS, counterstained with the secondary antibody (chicken anti-rabbit secondary antibody; CAR-594; A21201, Invitrogen) for 2 hours at room temperature, and then stained with DAPI (2 μg / mL). Images were captured using a fluorescence microscope and analyzed with NIS-Elements software (BR-2.01.00, NY 11747-3064, USA).
[0141]
[0142] As a result of measuring the intracellular distribution pattern of NF-κB protein using immunofluorescence staining, as shown in Fig. 7, in the control group not treated with LPS, NF-κB expression was mostly found in the cytoplasm, but in the LPS-treated group, the expression of NF-κB p65 subunit was significantly reduced in the cytoplasm and increased in the nucleus. In other words, it was confirmed that NF-κB was translocated into the nucleus by LPS treatment.
[0143] In contrast, in the NIP001 compound pretreatment group, LPS-induced nuclear translocation of NF-κB was significantly inhibited. These results suggest that treatment with the NIP001 compound inhibits the NF-κB pathway, a major inflammatory signaling pathway induced by LPS, by inhibiting LPS-induced nuclear translocation of NF-κB protein.
[0144]
[0145] [Example 6]
[0146] Confirmation of the cognitive function improvement efficacy of the NIP001 compound in an animal model of scopolamine-induced cognitive impairment.
[0147] 6-1: Animal preparation and drug administration
[0148] Male C57BL / 6 mice (8 weeks old, weighing 27 g, n=6) were purchased from Korea Biolink, Republic of Korea, and all experiments were approved by the Institutional Animal Care and Use Committee (IACUC) of Konkuk University.
[0149] All animals were acclimated for 7 days, housed in a controlled environment and lighting (12 / 12 dark / light cycle) with free access to food and water.
[0150] Mice were randomly divided into groups of 6 each, and the NIP001 compound and Donepezil (DNZ) dissolved in saline were administered to the animals for 9 days, and scopolamine (2 mg / kg) was injected on days 8 and 9.
[0151] Group 1) Control group (untreated group)
[0152] Group 2) Scopolamine 2 mg / kg administration group
[0153] Group 3) NIP001 compound 5 mg / kg + scopolamine 2 mg / kg administration group
[0154] Group 4) NIP001 compound 10 mg / kg + scopolamine 2 mg / kg administration group
[0155] Group 5) DNZ (donepezil) 5 mg / kg + scopolamine 2 mg / kg administration group (positive control group)
[0156]
[0157] Nine days after administration of the NIP001 compound, spatial learning and memory functions of scopolamine-injected mice were investigated using the Y-maze test and the Morris water maze test (MWM).
[0158]
[0159] 6-2: Y-maze experiment
[0160] To examine the spatial cognitive abilities of laboratory animals, a Y-maze test was conducted. This test consisted of three identical passages (A, B, and C; 6 cm wide, 28 cm long, and 18 cm high) with the ends of the Y closed, and the angle between the passages was maintained at 120 degrees. Mice were placed at the end of one of the three passages and allowed to move freely through the Y-shaped passage for 8 minutes. A mouse was recognized as having entered the passage completely with its tail. The number and order of entry into each passage were measured by a camera installed on the ceiling, and spontaneous alternation was assessed using a video tracking device. Spontaneous alternation was defined as sequential entry into the three passages, i.e., ABC, BCA, CAB, etc., and alternation (%) was calculated using the following formula.
[0161] % spontaneous alteration = (actual number of changes / total number of entries - 2) × 100
[0162]
[0163] As a result, as shown in Figure 9, when comparing the total number of visits to each branch of all groups in the Y-maze (total entry), no significant difference was observed.
[0164] In contrast, significant changes in alterative behavior were observed in the NIP001-administered group, and the same results were observed in the positive control group, donepezil. This increase in spontaneous alterative behavior in mice suggests that memory impaired by scopolamine was restored by NIP001 administration.
[0165]
[0166] 6-3: Morris water maze test
[0167] The Morris water maze test is a behavioral experiment that measures spatial learning and memory. A platform (diameter 10 cm, height 30 cm) is installed inside a cylindrical water tank (diameter 120 cm, height 45 cm), and the movement of mice is observed using a video tracking device. During this experiment, the water temperature is maintained at 25℃ (±1℃), and water is filled up to 2 cm above the platform. After dividing the platform into four equal parts (areas A, B, C, and D), the mouse is introduced three times a day from the area where the platform is (areas A) in three directions (areas B, C, and D) to find the hidden platform.
[0168] In each area, differently shaped landmarks were installed to help the mice identify and remember the location of the platform. The order of the acquisition direction was changed every day and the experiment was conducted sequentially for a total of 5 days. If the mouse found the platform and stayed on the platform for more than 10 seconds, the time it took to find it was determined as the escape latency. The average value calculated from 3 trials per day was used as the average escape latency. If the escape latency exceeded 120 seconds, it was set to 120 seconds. Mice that did not find it within 120 seconds were sent to the platform and stayed there for 10 seconds to memorize the surrounding objects. On the 5th day, the last day of training, the platform was removed to check whether the mouse accurately remembered the location of the platform, and the time the mouse spent finding and staying on the platform (time spent in the platform quadrant) was measured.
[0169]
[0170] As a result, as shown in Figure 10, when scopolamine was administered, the search time and distance significantly increased, whereas in the group administered NIP001, the search time and distance significantly decreased. This suggests that NIP001 is helpful in improving memory.
[0171]
[0172] [Example 7]
[0173] Confirmation of inhibition of neuroinflammation and activation of the BDNF-pCREB pathway by the NIP001 compound in an animal model of scopolamine-induced cognitive impairment.
[0174] In the present invention, the hippocampus was isolated from the mouse brain of the above <Example 6-1> and treated with RIPA buffer (150 mM NaCl, 0.5% Triton X-100, 50 mM Tris-HCl, pH 7.4, 25 mM NaF, 20 mM EGTA, 1 mM DTT, 1 mM Na3VO4, protease inhibitor cocktail) at 4°C. Then, after dissolving at 4°C for 20 minutes, centrifugation (15,000 g, 15 minutes) was performed to obtain a supernatant, and the protein was quantified using the Bradford assay or BCA assay. Thereafter, Western blotting was performed using the method of the above <Example 3-2>.
[0175] As a result, as shown in Fig. 11, the expression of iNOS protein, a neuroinflammation marker, increased in the hippocampus of the mouse brain administered with scopolamine, but a significant decrease in the iNOS protein expression was observed in the group administered with NIP001. This confirmed that NIP001 regulates neuroinflammation in the mouse brain induced by scopolamine.
[0176] In addition, as shown in Fig. 12, it was confirmed that p-CREB and BDNF expression was low in the hippocampus of the mouse brain administered with scopolamine, whereas p-CREB and BDNF expression was significantly increased by NIP001 administration, which means that the BDNF-CREB pathway is activated by NIP001, thereby improving cognitive function.
[0177] Attached electronic file of sequence list (PCT250006_seq.xml)
Claims
1. A pharmaceutical composition for preventing or treating a central nervous system disease, comprising a peptidomimetic compound represented by the following chemical formula 1 as an active ingredient: [Chemical Formula 1] 2. In paragraph 1, The compound: i) inhibits the production of inflammatory mediators including NO, iNOS and COX-2; ⅱ) Inhibition of MAPK signaling pathway through inhibition of phosphorylation of ERK, p38 or JNK; ⅲ) Inhibition of the production of inflammatory cytokines including IL-6 and TNF-α; or ⅳ) A pharmaceutical composition for preventing or treating a central nervous system disease, characterized in that it controls neuroinflammation by inhibiting NF-κB activity through inhibition of IκB-α phosphorylation and inhibition of p65 translocation.
3. In paragraph 1, The compound may i) inhibit the expression of inflammatory factors including iNOS or COX-2 in the hippocampus or cerebral cortex; or ⅱ) A pharmaceutical composition for preventing or treating a central nervous system disease, characterized by improving memory and cognitive function by increasing the expression of cognitive functional factors including BDNF or pCREB.
4. In paragraph 1, A pharmaceutical composition for preventing or treating a central nervous system disease, characterized in that the central nervous system disease may be a neuroinflammatory disease or memory impairment or cognitive dysfunction, and specifically, is any one selected from the group consisting of multiple sclerosis, neuroblastoma, Parkinson's disease, Lou Gehrig's disease, Huntington's disease, Creutzfeldt-Jakob disease, post-traumatic stress disorder, depression, schizophrenia, amyotrophic lateral sclerosis, mild cognitive impairment, attention deficit disorder (ADHD), Alzheimer's disease, ischemic stroke, cerebrovascular dementia, and senile dementia.
5. A health functional food composition for preventing or improving central nervous system diseases, comprising a peptidomimetic compound represented by the following chemical formula 1 as an active ingredient: [Chemical Formula 1] 6. In paragraph 5, The compound: i) inhibits the production of inflammatory mediators including NO, iNOS and COX-2; ⅱ) Inhibition of MAPK signaling pathway through inhibition of phosphorylation of ERK, p38 or JNK; ⅲ) Inhibition of the production of inflammatory cytokines including IL-6 and TNF-α; or ⅳ) A health functional food composition for preventing or improving central nervous system diseases, characterized in that it controls neuroinflammation by inhibiting NF-κB activity through inhibition of IκB-α phosphorylation and inhibition of p65 translocation.
7. In paragraph 5, The compound may i) inhibit the expression of inflammatory factors including iNOS or COX-2 in the hippocampus or cerebral cortex; or ⅱ) A health functional food composition for preventing or improving central nervous system diseases, characterized by improving memory and cognitive function through increasing the expression of cognitive functional factors including BDNF or pCREB.
8. In paragraph 5, The central nervous system disease may be a neuroinflammatory disease or a memory disorder or a cognitive dysfunction, and specifically, a health functional food composition for preventing or improving a central nervous system disease, characterized in that it is any one selected from the group consisting of multiple sclerosis, neuroblastoma, Parkinson's disease, Lou Gehrig's disease, Huntington's disease, Creutzfeldt-Jakob disease, post-traumatic stress disorder, depression, schizophrenia, amyotrophic lateral sclerosis, mild cognitive impairment, attention deficit disorder (ADHD), Alzheimer's disease, ischemic stroke, cerebrovascular dementia, and senile dementia.
9. A pharmaceutical composition for preventing or treating inflammatory diseases, comprising a peptidomimetic compound represented by the following chemical formula 1 as an active ingredient: [Chemical Formula 1] 10. A health functional food composition for preventing or improving inflammatory diseases, comprising a peptidomimetic compound represented by the following chemical formula 1 as an active ingredient: [Chemical Formula 1]
Citation Information
Patent Citations
Novel Peptide having Antimicrobial Activity and Anti-inflammatory Activity
KR1020140034451A
Novel Mimetic Peptide and Composition for Alzheimer's disease
KR102475326B1
KR20230050889A