Novel RNA therapeutics and uses thereof

Abstract

The present disclosure relates to novel therapeutic compounds, known as RNAi agents, that decrease expression of the HMGCR receptor (expressed by the HMGCR gene), thereby decreasing expression of mRNA and protein expression. Such RNAi agents are useful in the treatment of diseases and disorders involving the regulation of HMGCR expression and function, such as diseases and disorders that are risk factors for ASCVD (such as, dyslipidemia, such as hypercholesteremia).

Description

[0001] 31086_WO -1- NOVEL RNA THERAPEUTICS AND USES THEREOF SEQUENCE LISTING The present application is being filed along with a Sequence Listing in ST.26 XML format. The Sequence Listing is provided as a file titled “31086_WO” created 11- 5 June-2025 and is 14.1 megabytes in size. The Sequence Listing information in the ST.26 XML format is incorporated herein by reference in its entirety. BACKGROUND The present invention is directed to nucleic acids, including RNA molecules such 10 as therapeutic RNA molecules, such as RNAi agents targeting HMGCR mRNA, comprising a novel internucleotide linkage, termed a “2-propyl” linkage. Also disclosed herein are nucleotides and intermediates for making the same. These “2-propyl” nucleotides are termed “PrON” herein. The present invention is also directed to novel nucleosides comprising a PrON moiety. The present invention is also directed to 15 oligonucleotides, such as RNAi agents, comprising at least one PrON. The present invention relates to novel therapeutic compounds that decrease expression of the HMGCR (expressed by the HMGCR gene), thereby decreasing expression of HMGCR mRNA and HMGCR protein. Such RNAi agents are useful in the treatment of diseases or disorders involving the regulation of HMGCR expression and function (e.g., diseases or 20 disorders know as risk factors for atherosclerotic cardiovascular disease (ASCVD) such as dyslipidemia). HMGCR, 3-hydroxy-3-methylglutaryl-CoA reductase or HMGCo reductase, is the rate-limiting enzyme for the synthesis of cholesterol, which plays an important role in cell building and hormone production. HMGCR catalysis produces mevalonate, a 25 precursor for cholesterol biosynthesis. Non-sterol and sterols derived from mevalonate regulate HMGCR via a negative feedback mechanism. In mammalian cells, HMGCR is normally suppressed by cholesterol derived from the internalization and degradation of low-density lipoprotein (LDL) via the LDL receptor. Plasma cholesterol can become elevated because of genetics but is more often the 30 result of poor diet that is high in fats and / or sugars and a sedentary lifestyle. Cholesterol can deposit in arteries and is an important determinant of atherosclerosis and ischemia. Competitive inhibitors of HMGCR induce the expression of LDL receptors in the liver, 31086_WO -2- which in turn increases the catabolism of plasma LDL and lowers the plasma concentration of cholesterol. However, statins have multiple side effects, including insufficient lowering of cholesterol and / or LDL. Accordingly, more treatments are needed to lower cholesterol and to treat disease or disorders known as risk factors for (ASCVD) 5 (e.g., dyslipidemia). As RNA is relatively unstable, much effort has been expended in increasing stability and potency of potential therapeutic RNA molecules with cellular and organ safety. Organisms including humans harbor numerous threats to RNA durability, including exonucleases and endonucleases such as RNase H family endonucleases. These 10 enzymes degrade both natively-produced and exogenous RNA molecules. Low durability of RNA can result in low exposure of the therapeutic oligonucleotide to its intended target. Stability-enhancing modifications available in the art include phosphorothioate (PS) internucleotide linkages and extended nucleic acid (exNA) as described in 15 International Patent Publication No. WO2021 / 195533. As the field advances, however, more options for extending the half-life of therapeutic oligonucleotides, such as RNAi agents is needed. Further, modifications which reduce degradation products (e.g., metabolic byproducts of one or more molecular weights resulting from the delivery and processing of therapeutic oligonucleotides) are desired. 20 SUMMARY OF INVENTION In one aspect, provided herein are RNAi agents for reducing HMGCR gene expression, wherein the RNAi agent comprises at least one nucleotide including a modified internucleotide linkage. In one aspect, the present disclosure provides an oligonucleotide of Formula I: 25 wherein: R1is selected from the group consisting of H, OR2, NH2, SR2, F, and Cl, wherein R2is selected from the group consisting of H and C1-C20 alkyl, and 31086_WO -3- B is a nucleobase. In one embodiment, the present disclosure provides a double-stranded RNA molecule which includes a first oligonucleotide as described above, and a second oligonucleotide of 15 to 30 nucleotides in total length, wherein the first oligonucleotide 5 and the second oligonucleotide form a duplex region. In one aspect, the first oligonucleotide is an antisense strand of an RNAi agent, and the second oligonucleotide is a sense strand of an RNAi agent. In some embodiments, the present disclosure describes RNAi agents for reducing HMGCR gene expression, wherein the RNAi agent comprises a delivery moiety of 10 Formula II conjugated to R, wherein R is a double stranded RNA (dsRNA) comprising an antisense strand and a sense strand: wherein R is conjugated to connection point E of Formula II, optionally via a 15 linker, wherein the sense strand and the antisense strand form a duplex region, and wherein the antisense strand comprises a region of complementarity to a HMGCR mRNA target sequence of SEQ ID NO: 1, and wherein the sense and antisense strand each optionally comprise one or more modified nucleotides and one or more modified internucleotide linkages. In some embodiments, Formula II is conjugated to the sense 20 strand, optionally via a linker. In some embodiments, Formula II is conjugated to the 3’ terminal nucleotide of the sense strand, optionally via a linker. In some embodiments, the antisense strand is 15 to 50 nucleotides in length. In some embodiments, the sense strand is 15 to 50 nucleotides in length. In some embodiments, the antisense strand is between 18 and 23 nucleotides in length. In some 25 embodiments, the sense strand is between 18 and 21 nucleotides in length. In some 31086_WO -4- embodiments, the antisense strand is 23 nucleotides in length and the sense strand is 21 nucleotides in length. In some embodiments, the sense strand or the antisense strand comprises a sequence selected from Table 2, 3, 4A, and 4B, as disclosed herein. In some 5 embodiments, the sense strand and the antisense strand comprises a sequence selected from Table 2, 3, 4A, and 4B, as disclosed herein. In some embodiments, R is conjugated to Formula II via a linker. In some embodiments, the linker comprises a linker of Formula III having connection points A and B or the linker comprises Formula IV having connection points X and Y, and 10 wherein: B 15 20 Formula IV; a. Formula II at connection point E is conjugated to Formula III at connection point A and Formula III is conjugated to a phosphate group or a 25 phosphorothioate group at connection point B, and the phosphate group or phosphorothioate group is conjugated to R; or 31086_WO -5- b. Formula II at connection point E is conjugated to Formula IV at connection point X and Formula IV is conjugated to a phosphate group or phosphorothioate group at connection point Y, and the phosphate group or phosphorothioate group is further conjugated to R. 5 In another aspect, the present disclosure provides pharmaceutical compositions comprising the RNAi agent described herein and one or more pharmaceutically acceptable excipients. In another aspect, the present disclosure provides methods of treating a disease or disorder associated with ASCVD. In some embodiments, the disease or disorder is 10 dyslipidemia, primary dysbetalipoproteinemia, hypertriglyceridemia, or atherosclerosis. In some embodiments, the present disclosure provides a method of treating dyslipidemia, comprising administering to a patient an RNAi agent or a pharmaceutical composition thereof as described herein. In another aspect, the present disclosure provides an RNAi agent for the use in a 15 therapy. In some embodiments, the present disclosure provides an RNAi agent for use in treating a disease or disorder associated with ASCVD. In some embodiments, the present disclosure provides an RNAi agent for use in treating a disease or disorder wherein the disease or disorder is dyslipidemia, primary dysbetalipoproteinemia, hypertriglyceridemia, or atherosclerosis. 20 In another aspect, the present disclosure provides the use of an RNAi agent for the manufacture of a medicament for use in a therapy. In some embodiments, the present disclosure provides an RNAi agent for the manufacture of a medicament for use in treating a disease or disorder associated with ASCVD. In some embodiments, the present disclosure provides an RNAi agent for the manufacture of a medicament for use in 25 treating a disease or disorder, wherein the disease or disorder is dyslipidemia, primary dysbetalipoproteinemia, hypertriglyceridemia, or atherosclerosis. DETAILED DESCRIPTION HMGCR siRNAs and ASOs have been described, but none have progressed for 30 treatment in patients. Using the HMGCR RNAi agents herein to decrease expression of HMGCR can be employed to treat disease or disorders associated with ASCVD (e.g., dyslipidemia, primary dysbetalipoproteinemia, hypertriglyceridemia, or atherosclerosis). 31086_WO -6- Such siRNAs may exhibit one or more of, e.g., as compared to other liver targeted siRNAs such as HMGCR siRNAs comprising a different delivery ligand, a different sequence, a differently modified sequence, or as compared to treatment with a vehicle control: improved knockdown in the liver; improved tissue exposure, improved 5 exposure in liver hepatocytes; an improved durable response; an improved pharmacokinetic profile; fewer off target effects; and / or an improved toxicity profile. Other embodiments of the HMGCR RNAi agents herein may include one or more of fewer side effects as compared to statins or other standard of care; an improved toxicity profile; an improved safety profile; improved tolerability or compliance; and / or improved 10 liver function tests. Still other siRNAs herein may have other benefits, e.g., in combination with any of the preceding or as a stand-alone benefit, including improved and / or simplified synthesis, synthetic processes with fewer degradation products; or any combination thereof. The RNAi agents herein comprise a sense strand and an antisense strand, wherein 15 each is an oligonucleotide. In some embodiments, the RNAi agents described herein also comprise a delivery moiety. As used herein, “nucleotide” means an organic compound having a nucleoside (a nucleobase such as, for example, adenine, cytosine, guanine, thymine, or uracil; and a pentose sugar such as, for example, ribose or 2'-deoxyribose) and a phosphate group. A “nucleotide” can serve as a monomeric unit of nucleic acid 20 polymers such as deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). As used herein, “oligonucleotide” means a short nucleic acid compound (e.g., less than about 100 nucleotides in length). An oligonucleotide may be single-stranded (ss) or double stranded (ds). An oligonucleotide may or may not have duplex regions. As a set of non-limiting examples, an oligonucleotide may be, but is not limited to, a small 25 interfering RNA (siRNA), microRNA (miRNA), short hairpin RNA (shRNA), Dicer substrate interfering RNA (DsiRNA), or antisense oligonucleotide (ASO). As used herein, “ribonucleotide” means a nucleotide having a ribose as its pentose sugar, which contains a hydroxyl group at its 2' position. A modified ribonucleotide is a ribonucleotide having one or more modifications or substitutions of atoms other than 30 hydrogen at the 2' position, including modifications or substitutions in or of the nucleobase, sugar, or phosphate group. 31086_WO -7- As used herein, “modified internucleotide linkage” means an internucleotide linkage having one or more chemical modifications when compared with a reference internucleotide linkage having a phosphodiester bond. A modified internucleotide linkage can be a non-naturally occurring linkage. 5 As used herein, “modified nucleotide” refers to a nucleotide having one or more chemical modifications when compared with a corresponding reference nucleotide selected from: adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide, adenine deoxyribonucleotide, guanine deoxyribonucleotide, cytosine deoxyribonucleotide, and thymidine deoxyribonucleotide. A modified nucleotide 10 can be a non-naturally occurring nucleotide. A modified nucleotide can have, for example, one or more chemical modification in its sugar, nucleobase, and / or phosphate group. Additionally, or alternatively, a modified nucleotide can have one or more chemical moieties conjugated to a corresponding reference nucleotide. In some embodiments, the modified nucleotide comprises a butadiol moiety. 15 Disclosed herein is a butadiol moiety that can be incorporated into one or more nucleosides and / or nucleotides by replacing one or more sugar moieties. The modified nucleotides can be incorporated into an oligonucleotide, such as an RNAi agent, as a destabilizing agent in the RNAi agent. The butadiol moiety can be represented by the compounds of Formula A, A’, and / or A’’. se. . , , eobase. 31086_WO -8- Formula A’’. (S,S)-B wherein B is a nucleobase. The butadiol moiety can comprise a mixture of the (R,S) and (S,S) diastereomers (Formula A), the (R,S) diastereomer (Formula A’), or the (S,S) diastereomer (Formula 5 A’’). In some embodiments, the butadiol moiety can comprise the (R,R), (R,S), (S,S), and / or the (S,R) diastereomers. It has been surprisingly found that the introduction of (S,S)-butadiol into a nucleotide at position 8 in an oligonucleotide can improve the targeting selectivity of the oligonucleotide. In Formula A, A’, and A’’, the nucleobase, B, can be any nucleobase. The 10 nucleobase can be a naturally occurring nucleobase, a non-naturally occurring, artificial, or modified nucleobase, or a combination thereof. Suitable modified nucleobases can include hypoxanthine, xanthine, 7-methylguanine, inosine, xanthosine, 7- methylguanosine, 5,6-dihydrouracil, 5-methylcytosine, 5-hydoxymethylcytosine, dihydrouridine, 5-methylcytidine, and / or psuedouridine. Suitable naturally occurring 15 nucleobases can include adenine, guanine, cytosine, thymine, and / or uracil. In one aspect, the nucleobase is selected from the group consisting of adenine, cytosine, thymine, uracil, and guanine. In one aspect, the nucleobase is selected from the group consisting of adenine, cytosine, and uracil. In another aspect, the nucleobase is selected from the group consisting of cytosine and uracil. In another aspect, the nucleobase is 20 uracil. The present disclosure provides an RNAi agent comprising a butadiol moiety, wherein the nucleobase, B, can be selected from the group consisting of adenine, cytosine, thymine, uracil, and guanine. In an embodiment, the nucleobase is selected from the group consisting of adenine, cytosine, and uracil. In a further embodiment, the 25 nucleobase is selected from the group consisting of cytosine and uracil. In a further embodiment, the nucleobase is uracil. In a further embodiment, the butadiol modified nucleotide is at position 3, 4, 5, 6, 7, or 8 starting from the 5’ end. In a further embodiment, the butadiol modified nucleotide is at position 5, 6, 7, or 8 starting from the 5’ end. In a further embodiment, the butadiol modified nucleotide is at position 5, 6, or 8 31086_WO -9- starting from the 5’ end. In a further embodiment, the butadiol modified nucleotide is at position 5 starting from the 5’ end. In an embodiment, the oligonucleotide may be of the following formula: , 5 wherein X1 is a 5’ porti e nucleotides, X4 is a 3’ portion of the oligonucleotide, B is a nucleobase, and m and n are independently selected from any whole number from 0 to 40. Also disclosed herein is an oligonucleotide comprising a compound of the formula: , 10 wherein X1 is a 5’ portio g , 3 re nucleotides, X4 is a 3’ portion of the oligonucleotide, B is a nucleobase, and m and n are independently selected from any whole number from 0 to 40. Also disclosed herein is an oligonucleotide comprising a compound of the formula: , 15 wherein X1 is a 5’ portion of the oligonucleotide, X2 and X3 are nucleotides, X4 is a 3’ portion of the oligonucleotide, B is a nucleobase, and m and n are independently selected from any whole number from 0 to 40. Disclosed herein is an oligonucleotide of the formula: 31086_WO -10- wherein, each B is in re independently selected from any whole number from 0 to 20, X is O or S, R is independently selected from H, O-R1, F, Cl, and R1 is H, C1 to C20 alkyl, or C1 to C20 alkyl-O-C1 to C20 alkyl. 5 Also disclosed herein is an oligonucleotide of the formula:

[0002] 31086_WO -11- wherein, each B is indepe ndependently selected from any whole number from 0 to 20, X is O or S, R is independently selected from H, O-R1, F, Cl, and R1 is H, C1 to C20 alkyl, or C1 to C20 alkyl-O- C1 to C20 alkyl. 5

[0003] 31086_WO -12- Also disclosed herein is an oligonucleotide of the formula: 5 wherein, each B is independently a nucleobase, m and n are independently selected from any whole number from 0 to 20, X is O or S, R is independently selected from H, O-R1, F, Cl, and R1is H, C1to C20alkyl, or C1to C20alkyl-O- C1to C20alkyl. One or more butadiol moieties may be incorporated into any position in the RNAi agent. For instance, a butadiol moiety may be incorporated at position 22, or at position 10 23, or at both positions 22 and 23, to realize a potential increase in durability, particularly for the antisense strand of the RNAi agent. The butadiol may also be incorporated at position 1, or 2, or 9, or 10, or 11, or 12, or 13, or 14, or 15, or 16, or 17, or 18, or 19, or 20, or 21 of an oligonucleotide or RNAi agent. The term “percentage sequence identity” with respect to a reference nucleic acid 15 sequence is defined as the percentage of nucleotides, nucleosides, or nucleobases in a 31086_WO -13- candidate sequence that are identical with the nucleotides, nucleosides, or nucleobases in the reference nucleic acid sequence, after optimally aligning the sequences and introducing gaps or overhangs, if necessary, to achieve the maximum percent sequence identity. Alignment for purposes of determining percent nucleic acid sequence identity 5 can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software programs, for example, those described in Current Protocols in Molecular Biology (Ausubel et al., eds., 1987, Supp.30, section 7.7.18, Table 7.7.1), and including BLAST, BLAST-2, ALIGN, Clustal W2.0 or Clustal X2.0 or Megalign (DNASTAR) software. In one embodiment herein, sequence identity is 10 calculated use Clustal W2.0 or Clustal X2.0. In another embodiment, sequence identity is calculated using Clustal W2.0. In another embodiment, sequence identity is calculated using Clustal X2.0. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. Percentage of “sequence identity” 15 can be determined by comparing two optimally aligned sequences over a comparison window, where the fragment of the nucleic acid sequence in the comparison window may comprise additions or deletions (e.g., gaps or overhangs) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage can be calculated by determining the number of positions 20 at which the identical nucleotide, nucleoside, or nucleobase occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison, and multiplying the result by 100 to yield the percentage of sequence identity. The output is the percent identity of the subject sequence with respect to the query sequence. In some embodiments, percent 25 sequence identity is the percent of nucleotide residues that are identical between two strands using the PID3 calculation, which is the number of identical nucleotide residues divided by the total number of nucleotides of the shortest of the two sequences, multiplied by 100. See, e.g., Raghava, G., Barton, G.J. Quantification of the variation in percentage identity for protein sequence alignments. BMC Bioinformatics 7, 415 (2006). 30 As used herein, “phosphate analog” means a chemical moiety that mimics the electrostatic and / or steric properties of a phosphate group. In some embodiments, a phosphate analog is positioned at the 5' terminal nucleotide of an oligonucleotide in place 31086_WO -14- of a 5'-phosphate. A 5' phosphate analog can include a phosphatase-resistant linkage. Examples of phosphate analogs include, but are not limited to, 5' phosphonates, such as 5' methylene phosphonate (5'-MP) and 5'-(E)-vinylphosphonate (5'-VP). An oligonucleotide can have a phosphate analog at a 4'-carbon position of the sugar (referred to as a “4'- 5 phosphate analog”) at a 5'-terminal nucleotide. An example of a 4'-phosphate analog is oxymethylphosphonate, in which the oxygen atom of the oxymethyl group is bound to the sugar moiety (e.g., at its 4'-carbon) or analog thereof. See, e g., Intl. Patent Application Publication No. WO 2018 / 045317. Other modifications have been developed for the 5' end of oligonucleotides (see, e.g., Intl. Patent Application No. WO 2011 / 133871; US 10 Patent No.8,927,513; and Prakash et al. (2015) Nuc. Acids Res.43:2993-3011). As used herein, “region of complementarity” means a nucleotide sequence of a nucleic acid (e.g., a double stranded oligonucleotide) that is sufficiently complementary to an antiparallel nucleotide sequence to permit hybridization between the two sequences of nucleotides under appropriate hybridization conditions (e.g., in a phosphate buffer, in a 15 cell, etc.). In some embodiments, an oligonucleotide herein includes a targeting sequence having a region of complementary to a mRNA target sequence. As used herein, “duplex,” in reference to nucleic acids or oligonucleotides, such as a sense strand or an antisense strand means a structure formed through hydrogen bonds of complementary base pairing of two antiparallel sequences of nucleotides under suitable 20 conditions to promote such a structure. A duplex may form despite not having full complementarity between the two strands, or when an abasic nucleotide is present. RNA interference is a specialized cellular process that utilizes RISC for degrading RNA in a sequence dependent manner. As used herein, “RNAi agent” means an agent comprising either (a) a double stranded oligonucleotide having a sense strand (passenger) 25 and antisense strand (guide), in which the antisense strand or part of the antisense strand is used by the Argonaute 2 (Ago2) endonuclease in the cleavage of a target mRNA or (b) a single stranded oligonucleotide having a single antisense strand, where that antisense strand (or part of that antisense strand) is used by the Ago2 endonuclease in the cleavage of a target mRNA. In some embodiments, the RNAi agent described herein also 30 comprises a delivery moiety. In some embodiments, the RNAi agent described herein comprises one or more modified nucleotide. In some embodiments, the RNAi agent described herein comprises a butadiol modified nucleotide. In some embodiments, the 31086_WO -15- RNAi agent comprises at least one modified internucleotide linkage and at least one modified nucleotide. In some embodiments, the RNAi agent comprises at least one PrON and at least one butadiol modified nucleotide. As used herein, a bond illustrated as indicates a connection point as described 5 therein. For example, if a generic variable ., X, is stated to be attached at the connection point E as shown below, this is intended to show X is bonded to the atom of the connection point (see the scheme below). As us mou ary (for periods 10 of time and for the means of administration) to achieve the desired therapeutic result. An effective amount of a RNAi agent may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of the RNAi agent to elicit a desired response in the individual. An effective amount is also one in which any toxic or detrimental effects of the RNAi agent are outweighed by the therapeutically beneficial 15 effects. As used herein, “treatment” or “treating” refers to all processes wherein there may be a slowing, controlling, delaying, or stopping of the progression of the disorders or disease disclosed herein, or ameliorating disorder or disease symptoms, and need not indicate a total elimination of all disorder or disease symptoms. Treatment includes 20 administration of an RNAi agent or pharmaceutical composition thereof for treatment of a disease or condition in a mammal including a human. As used herein, the term “disease or disorder associated with ASCVD” refers to any disease or disorder that is a risk factor for ASCVD. Provided herein are RNAi agents for reducing HMGCR gene expression, wherein 25 the RNAi agent comprises a delivery moiety of Formula II conjugated to R, wherein R is a double stranded RNA (dsRNA) comprising an antisense strand and a sense strand: 31086_WO -16- wherein R is conjugated to connection point E of Formula II, optionally via a linker, wherein the sense strand and the antisense strand form a duplex region, and wherein the 5 antisense strand comprises a region of complementarity to a HMGCR mRNA target sequence of SEQ ID NO: 1, and wherein the sense and antisense strand each optionally comprise one or more modified nucleotides and one or more modified internucleotide linkages. Also provided here are RNAi agents for reducing HMGCR gene expression, 10 wherein the RNAi agent comprises a delivery moiety of Formula IIa conjugated to R, wherein R comprises an antisense strand and a sense strand: ormu a a, 15 wherein R is conjugated to Formula IIa via a linker, wherein the sense strand and the antisense strand form a duplex region, and wherein the antisense strand comprises a region of complementarity to a HMGCR mRNA target sequence of SEQ ID NO: 1, and wherein the sense and antisense strand each optionally comprise one or more modified nucleotides and one or more modified internucleotide linkages. 31086_WO -17- Disclosed herein are RNAi agents for reducing HMGCR gene expression, wherein the RNAi agents comprise a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a duplex region, and wherein the antisense strand comprises a region of complementarity of at least 15 nucleotides to the sequence as set 5 forth in SEQ ID NO: 1, and wherein the sense strand and / or the antisense strand each optionally comprise one or more modified nucleotides and / or modified internucleotide linkages. In further embodiments, the antisense strand comprises at least 15 nucleotides of a sequence in Table 2. In further embodiments, the antisense strand comprises at least 18 nucleotides of a sequence in Table 2. In further embodiments, the RNAi agent reduces 10 expression of the HMGCR gene in a liver cell, as compared to a control. In further embodiments, the RNAi agent reduces HMGCR gene expression by about 50% or greater in a cell expressing HMGCR, as compared to a control. In further embodiments, the RNAi agent reduces HMGCR gene expression by reducing the level of HMGCR mRNA transcript, the level of HMGCR protein, or both. 15 In further embodiments, the antisense strand is 15 to 50 nucleotides in length, and / or the sense strand is 15 to 50 nucleotides in length. In further embodiments, the sense and / or sense strand is independently 15 to 30 nucleotides in length. In further embodiments, the antisense strand is between 18 and 23 nucleotides in length. In further embodiments, the sense strand is between 18 and 21 nucleotides in length. 20 In further embodiments, the RNAi agent comprises an antisense strand that comprises at least 15 contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NOs: 2 to 387. In still further embodiments, the antisense strand comprises at least 18 contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NOs: 2 to 387. 25 In other further embodiments, the antisense strand comprises at least 18 contiguous nucleotides of a sequence selected from the group consisting of 18 contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NOs:2 to 387. In further embodiments, the antisense strand of the RNAi agent is 23 nucleotides in length. In still further embodiments, the sense strand is 21 nucleotides in length. In 30 another embodiment, the antisense strand comprises a sequence selected from the group consisting of 774 to 1159, 2318, and 2319 or a sequence having at least 90% sequence 31086_WO -18- identity thereto. In another embodiment, the sense and antisense strand comprise a sequence selected from the sequences set forth in Table 3. The sense strand and the antisense strand of the RNAi agents disclosed herein do not require full complementarity. Accordingly, in the RNAi agents disclosed herein, the 5 duplex region between the sense strand and the antisense strand comprises 0, 1, 2, or 3 mismatches between the sense strand and the antisense strand. In further embodiments, the duplex region between the sense strand and the antisense strand consists of 0, 1, 2, or 3 mismatches between the sense strand and the antisense strand. In further embodiments, the sense strand comprises a sequence selected from the 10 group consisting of SEQ ID NO: 388 to 773. In further embodiments, the sense strand and the antisense strand each independently comprise one or more modified nucleotides, such as 2’ fluoro modified nucleotides or 2’- O-methyl modified nucleotides. In still further embodiments of the RNAi agents disclosed herein, each nucleotide of the sense strand and each nucleotide of the antisense 15 strand is a modified nucleotide. In further embodiments, each nucleotide is a 2’ fluoro modified nucleotide or a 2’-O-methyl modified nucleotide. In further embodiments of the RNAi agents disclosed herein, the antisense strand is 23 nucleotides in length, each nucleotide of the antisense strand is a modified nucleotide, and 2’ fluoro modified nucleotides are present at 20 a. Positions 2, 3, 7, 14, and 16 from the 5’ end of the antisense strand; or b. Positions 2, 5, 7, 14, and 16 from the 5’ end of the antisense strand; or c. Positions 2, 3, 8, 14, and 16 from the 5’ end of the antisense strand; or d. Positions 2, 5, 8, 14, and 16 from the 5’ end of the antisense strand; or 25 e. Positions 2, 14, and 16 from the 5’ end of the antisense strand; or f. Positions 2, 6, 14, and 16 from the 5’ end of the antisense strand. In further embodiments, the nucleotides that are not 2’ fluoro modified nucleotides are 2’- O-methyl modified nucleotides. 30 In further embodiments of the RNAi agents disclosed herein, the sense strand and antisense strand each independently comprise one or more modified internucleotide linkages, and each modified internucleotide linkage is a phosphorothioate linkage. In 31086_WO -19- further embodiments, the sense strand and antisense strand each independently comprise four phosphorothioate linkages. In still further embodiments, the two terminal nucleotides at each of the 5’ and 3’ ends of each of the sense and antisense strand are phosphorothioate linkages. 5 In other embodiments, the 5’ nucleotide of the antisense strand comprises a phosphate group or a phosphate analog. As used herein, “phosphate analog” means a chemical moiety that mimics the electrostatic and / or steric properties of a phosphate group. In some embodiments, a phosphate analog is positioned at the 5' terminal nucleotide of an oligonucleotide in place of a 5'-phosphate. A 5' phosphate analog can 10 include a phosphatase-resistant linkage. Examples of phosphate analogs include, but are not limited to, 5' phosphonates, such as 5' methylene phosphonate (5'-MP) and 5'-(E)- vinylphosphonate (5'-VP). An oligonucleotide can have a phosphate analog at a 4'-carbon position of the sugar (referred to as a “4'-phosphate analog”) at a 5'-terminal nucleotide. An example of a 4'-phosphate analog is oxymethylphosphonate, in which the oxygen 15 atom of the oxymethyl group is bound to the sugar moiety (e.g., at its 4'-carbon) or analog thereof. See, e g., Intl. Patent Application Publication No. WO 2018 / 045317. Other modifications have been developed for the 5' end of oligonucleotides (see, e.g., Intl. Patent Application No. WO 2011 / 133871; US Patent No.8,927,513; and Prakash et al. (2015) Nuc. Acids Res.43:2993-3011). 20 In further embodiments of the RNAi agents disclosed herein, the antisense strand comprises a sequence selected from the group consisting of SEQ ID NOs: 1161, 1163, 1165, 1167, 1169, 1171, 1173, 1175, 1177, 1179, 1181, 1183, 1185, 1187, 1189, 1191, 1193, 1195, 1197, 1199, 1201, 1203, 1205, 1207, 1209, 1211, 1213, 1215, 1217, 1219, 1221, 1223, 1225, 1227, 1229, 1231, 1233, 1235, 1237, 1239, 1241, 1243, 1245, 1247, 25 1249, 1251, 1253, 1255, 1257, 1259, 1261, 1263, 1265, 1267, 1269, 1271, 1273, 1275, 1277, 1279, 1281, 1283, 1285, 1287, 1289, 1291, 1293, 1295, 1297, 1299, 1301, 1303, 1305, 1307, 1309, 1311, 1313, 1315, 1317, 1319, 1321, 1323, 1325, 1327, 1329, 1331, 1333, 1335, 1337, 1339, 1341, 1343, 1345, 1347, 1349, 1351, 1353, 1355, 1357, 1359, 1361, 1363, 1365, 1367, 1369, 1371, 1373, 1375, 1377, 1379, 1381, 1383, 1385, 1387, 30 1389, 1391, 1393, 1395, 1397, 1399, 1401, 1403, 1405, 1407, 1409, 1411, 1413, 1415, 1417, 1419, 1421, 1423, 1425, 1427, 1429, 1431, 1433, 1435, 1437, 1439, 1441, 1443, 1445, 1447, 1449, 1451, 1453, 1455, 1457, 1459, 1461, 1463, 1465, 1467, 1469, 1471, 31086_WO -20- 1473, 1475, 1477, 1479, 1481, 1483, 1485, 1487, 1489, 1491, 1493, 1495, 1497, 1499, 1501, 1503, 1505, 1507, 1509, 1511, 1513, 1515, 1517, 1519, 1521, 1523, 1525, 1527, 1529, 1531, 1533, 1535, 1537, 1539, 1541, 1543, 1545, 1547, 1549, 1551, 1553, 1555, 1557, 1559, 1561, 1563, 1565, 1567, 1569, 1571, 1573, 1575, 1577, 1579, 1581, 1583, 5 1585, 1587, 1589, 1591, 1593, 1595, 1597, 1599, 1601, 1603, 1605, 1607, 1609, 1611, 1613, 1615, 1617, 1619, 1621, 1623, 1625, 1627, 1629, 1631, 1633, 1635, 1637, 1639, 1641, 1643, 1645, 1647, 1649, 1651, 1653, 1655, 1657, 1659, 1661, 1663, 1665, 1667, 1669, 1671, 1673, 1675, 1677, 1679, 1681, 1683, 1685, 1687, 1689, 1691, 1693, 1695, 1697, 1699, 1701, 1703, 1705, 1707, 1709, 1711, 1713, 1715, 1717, 1719, 1721, 1723, 10 1725, 1727, 1729, 1731, 1733, 1735, 1737, 1739, 1741, 1743, 1745, 1747, 1749, 1751, 1753, 1755, 1757, 1759, 1761, 1763, 1765, 1767, 1769, 1771, 1773, 1775, 1777, 1779, 1781, 1783, 1785, 1787, 1789, 1791, 1793, 1795, 1797, 1799, 1801, 1803, 1805, 1807, 1809, 1811, 1813, 1815, 1817, 1819, 1821, 1823, 1825, 1827, 1829, 1831, 1833, 1835, 1837, 1839, 1841, 1843, 1845, 1847, 1849, 1851, 1853, 1855, 1857, 1859, 1861, 1863, 15 1865, 1867, 1869, 1871, 1873, 1875, 1877, 1879, 1881, 1883, 1885, 1887, 1889, 1891, 1893, 1895, 1897, 1899, 1901, 1903, 1905, 1907, 1909, 1911, 1913, 1915, 1917, 1919, 1921, 1923, 1925, 1927, 1929, 1931, 2321, 2322, 2323, 2324, 2325, 2326, 2327, 2328, 2329, 2330, 2331, 2332, 2333, 2334, 2335, 2336, 2337, 2338, or a sequence having at least 90% sequence identity thereto, wherein the 5’ terminal nucleotide of the antisense 20 strand comprises a 5’ a vinyl phosphonate, a phosphate, or a hydroxyl group. In other embodiments, the phosphate group listed at the 5’ end of the recited SEQ ID NO: is removed and replaced with an OH. In other embodiments, the phosphate group listed at the 5’ end of the recited SEQ ID NO: is replaced with a 5’ vinylphosphonate. In further embodiments of the RNAi agents disclosed herein, the antisense strand 25 comprises a sequence selected from the group consisting of SEQ ID Nos: 1932-2317 and 2339-2352 or a sequence having at least 90% sequence identity thereto. In further embodiments of the RNAi agents disclosed herein, the antisense strand comprises a sequence selected from the group consisting of SEQ ID Nos: 1932-2317 and 2339-2352 or a sequence having at least 95% sequence identity thereto. 30 In further embodiments the sense strand comprises a sequence selected from the group consisting of SEQ ID NOs: 1160, 1162, 1164, 1166, 1168, 1170, 1172, 1174, 1176, 1178, 1180, 1182, 1184, 1186, 1188, 1190, 1192, 1194, 1196, 1198, 1200, 1202, 1204, 31086_WO -21- 1206, 1208, 1210, 1212, 1214, 1216, 1218, 1220, 1222, 1224, 1226, 1228, 1230, 1232, 1234, 1236, 1238, 1240, 1242, 1244, 1246, 1248, 1250, 1252, 1254, 1256, 1258, 1260, 1262, 1264, 1266, 1268, 1270, 1272, 1274, 1276, 1278, 1280, 1282, 1284, 1286, 1288, 1290, 1292, 1294, 1296, 1298, 1300, 1302, 1304, 1306, 1308, 1310, 1312, 1314, 1316, 5 1318, 1320, 1322, 1324, 1326, 1328, 1330, 1332, 1334, 1336, 1338, 1340, 1342, 1344, 1346, 1348, 1350, 1352, 1354, 1356, 1358, 1360, 1362, 1364, 1366, 1368, 1370, 1372, 1374, 1376, 1378, 1380, 1382, 1384, 1386, 1388, 1390, 1392, 1394, 1396, 1398, 1400, 1402, 1404, 1406, 1408, 1410, 1412, 1414, 1416, 1418, 1420, 1422, 1424, 1426, 1428, 1430, 1432, 1434, 1436, 1438, 1440, 1442, 1444, 1446, 1448, 1450, 1452, 1454, 1456, 10 1458, 1460, 1462, 1464, 1466, 1468, 1470, 1472, 1474, 1476, 1478, 1480, 1482, 1484, 1486, 1488, 1490, 1492, 1494, 1496, 1498, 1500, 1502, 1504, 1506, 1508, 1510, 1512, 1514, 1516, 1518, 1520, 1522, 1524, 1526, 1528, 1530, 1532, 1534, 1536, 1538, 1540, 1542, 1544, 1546, 1548, 1550, 1552, 1554, 1556, 1558, 1560, 1562, 1564, 1566, 1568, 1570, 1572, 1574, 1576, 1578, 1580, 1582, 1584, 1586, 1588, 1590, 1592, 1594, 1596, 15 1598, 1600, 1602, 1604, 1606, 1608, 1610, 1612, 1614, 1616, 1618, 1620, 1622, 1624, 1626, 1628, 1630, 1632, 1634, 1636, 1638, 1640, 1642, 1644, 1646, 1648, 1650, 1652, 1654, 1656, 1658, 1660, 1662, 1664, 1666, 1668, 1670, 1672, 1674, 1676, 1678, 1680, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1706, 1708, 1710, 1712, 1714, 1716, 1718, 1720, 1722, 1724, 1726, 1728, 1730, 1732, 1734, 1736, 20 1738, 1740, 1742, 1744, 1746, 1748, 1750, 1752, 1754, 1756, 1758, 1760, 1762, 1764, 1766, 1768, 1770, 1772, 1774, 1776, 1778, 1780, 1782, 1784, 1786, 1788, 1790, 1792, 1794, 1796, 1798, 1800, 1802, 1804, 1806, 1808, 1810, 1812, 1814, 1816, 1818, 1820, 1822, 1824, 1826, 1828, 1830, 1832, 1834, 1836, 1838, 1840, 1842, 1844, 1846, 1848, 1850, 1852, 1854, 1856, 1858, 1860, 1862, 1864, 1866, 1868, 1870, 1872, 1874, 1876, 25 1878, 1880, 1882, 1884, 1886, 1888, 1890, 1892, 1894, 1896, 1898, 1900, 1902, 1904, 1906, 1908, 1910, 1912, 1914, 1916, 1918, 1920, 1922, 1924, 1926, 1928, 1930, 1270, 1282, 1800, 2320, or a sequence having at least 90% sequence identity thereto. In still further embodiments of the RNAi agents disclosed herein, the sense strand and antisense strand are a pair of oligonucleotide sequences selected from Table 4A, 4B, 30 or a sequence that is at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 percent identical to the sequence in Table 4A or 4B. In further embodiments, 1, 2, or 3 mismatches are introduced into the sense strand of the pair in 31086_WO -22- Table 4A or 4B. In further embodiments, 1, 2, or both terminal nucleotides of 5’ end of the antisense strand are changed. In some embodiments of the RNAi agents herein, the antisense strand comprises a first nucleic acid sequence that has at least 90% sequence identity to an antisense 5 sequence corresponding to a Duplex NO: in Table 4A or 4B, and the sense strand comprises a second nucleic acid sequence that has at least 90% sequence identity to a sense sequence corresponding to the same Duplex No: in Table 4A or 4B. For example, in one embodiment, the antisense strand comprises a first nucleic acid sequence that has at least 90% sequence identity to an antisense sequence corresponding to a Duplex NO: 10 387 in Table 4A, that is, a first nucleic acid sequence that has at least 90% sequence identity to SEQ ID NO: 1161, and the sense strand comprises a second nucleic acid sequence that has at least 90% sequence identity to a sense sequence corresponding to Duplex No: 387 in Table 4A, that is, SEQ ID NO: 1160. In further embodiments, the 5’ phosphate of the antisense strand is further modified / replaced, and is a 5’ 15 vinylphophonate or an OH group. A duplex, (e.g., a “Duplex No.:”), as shown herein, (see, e.g., Tables 4A and 4B), corresponds to a specific sense and antisense strand. In further embodiments, the 5’ terminal nucleotide of the antisense strand is substituted such that the final sequence contains a vinylphosphonate, a phosphate group, 20 or an OH group. For example, for antisense sequences of SEQ ID NOs 1161, 1163, 1165, 1167, 1169, 1171, 1173, 1175, 1177, 1179, 1181, 1183, 1185, 1187, 1189, 1191, 1193, 1195, 1197, 1199, 1201, 1203, 1205, 1207, 1209, 1211, 1213, 1215, 1217, 1219, 1221, 1223, 1225, 1227, 1229, 1231, 1233, 1235, 1237, 1239, 1241, 1243, 1245, 1247, 1249, 1251, 1253, 1255, 1257, 1259, 1261, 1263, 1265, 1267, 1269, 1271, 1273, 1275, 1277, 25 1279, 1281, 1283, 1285, 1287, 1289, 1291, 1293, 1295, 1297, 1299, 1301, 1303, 1305, 1307, 1309, 1311, 1313, 1315, 1317, 1319, 1321, 1323, 1325, 1327, 1329, 1331, 1333, 1335, 1337, 1339, 1341, 1343, 1345, 1347, 1349, 1351, 1353, 1355, 1357, 1359, 1361, 1363, 1365, 1367, 1369, 1371, 1373, 1375, 1377, 1379, 1381, 1383, 1385, 1387, 1389, 1391, 1393, 1395, 1397, 1399, 1401, 1403, 1405, 1407, 1409, 1411, 1413, 1415, 1417, 30 1419, 1421, 1423, 1425, 1427, 1429, 1431, 1433, 1435, 1437, 1439, 1441, 1443, 1445, 1447, 1449, 1451, 1453, 1455, 1457, 1459, 1461, 1463, 1465, 1467, 1469, 1471, 1473, 1475, 1477, 1479, 1481, 1483, 1485, 1487, 1489, 1491, 1493, 1495, 1497, 1499, 1501, 31086_WO -23- 1503, 1505, 1507, 1509, 1511, 1513, 1515, 1517, 1519, 1521, 1523, 1525, 1527, 1529, 1531, 1533, 1535, 1537, 1539, 1541, 1543, 1545, 1547, 1549, 1551, 1553, 1555, 1557, 1559, 1561, 1563, 1565, 1567, 1569, 1571, 1573, 1575, 1577, 1579, 1581, 1583, 1585, 1587, 1589, 1591, 1593, 1595, 1597, 1599, 1601, 1603, 1605, 1607, 1609, 1611, 1613, 5 1615, 1617, 1619, 1621, 1623, 1625, 1627, 1629, 1631, 1633, 1635, 1637, 1639, 1641, 1643, 1645, 1647, 1649, 1651, 1653, 1655, 1657, 1659, 1661, 1663, 1665, 1667, 1669, 1671, 1673, 1675, 1677, 1679, 1681, 1683, 1685, 1687, 1689, 1691, 1693, 1695, 1697, 1699, 1701, 1703, 1705, 1707, 1709, 1711, 1713, 1715, 1717, 1719, 1721, 1723, 1725, 1727, 1729, 1731, 1733, 1735, 1737, 1739, 1741, 1743, 1745, 1747, 1749, 1751, 1753, 10 1755, 1757, 1759, 1761, 1763, 1765, 1767, 1769, 1771, 1773, 1775, 1777, 1779, 1781, 1783, 1785, 1787, 1789, 1791, 1793, 1795, 1797, 1799, 1801, 1803, 1805, 1807, 1809, 1811, 1813, 1815, 1817, 1819, 1821, 1823, 1825, 1827, 1829, 1831, 1833, 1835, 1837, 1839, 1841, 1843, 1845, 1847, 1849, 1851, 1853, 1855, 1857, 1859, 1861, 1863, 1865, 1867, 1869, 1871, 1873, 1875, 1877, 1879, 1881, 1883, 1885, 1887, 1889, 1891, 1893, 15 1895, 1897, 1899, 1901, 1903, 1905, 1907, 1909, 1911, 1913, 1915, 1917, 1919, 1921, 1923, 1925, 1927, 1929, 1931, 2321, 2322, 2323, 2324, 2325, 2326, 2327, 2328, 2329, 2330, 2331, 2332, 2333, 2334, 2335, 2336, 2337, 2338, or a sequence having at least 90% sequence identity thereto, the 5’ phosphate group is replaced with an OH group. In further embodiments of the RNAi agents disclosed herein, the antisense strand 20 comprises a sequence selected from the group consisting of SEQ ID Nos: 1932-2317 and 2339-2352 or a sequence having at least 90% sequence identity thereto. In other embodiments disclosed herein are RNAi agents having a delivery moiety of Formula II conjugated to R: 31086_WO -24- wherein R comprises a sense strand and an antisense strand, wherein the antisense strand comprises at least 15 contiguous nucleotides that have complementarity to HMGCR mRNA target sequence of SEQ ID NO:1, and wherein the sense strand and the antisense strand form a region of complementarity of at least 15 nucleotides, and wherein the sense 5 strand and antisense strand are each independently 18 to 23 nucleotides in length, and optionally wherein the sense strand and antisense strand each independently comprise one or more modified nucleotides, and optionally wherein the sense strand and the antisense strand each independently comprise one or more modified internucleotide linkages, and wherein R is conjugated to Formula II via a linker. In further embodiments, the sense or 10 the antisense strand is selected from Table 2, 3, 4A or 4B disclosed herein. In other embodiments, the antisense or antisense strand of the RNAi agent has an antisense strand sequence and / or a sense strand sequence of at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to the corresponding sequence selected from a Table 2, 3, 4A or 4B 15 herein. In other embodiments, the RNAi agent disclosed herein comprises a linker. In further embodiments, R is conjugated to Formula II via a linker. In other further embodiments R is conjugated to Formula II via a linker. In further embodiments, the linker comprises a linker of Formula III having connection points A and B or the linker 20 comprises Formula IV having connection points X and Y, and wherein: B 25 Formula III; 31086_WO -25- Y Formu a IV; a. the RNAi agent comprises Formula II conjugated to Formula III at connection 5 point A and Formula III is conjugated to a phosphate group at connection point B, and the phosphate group is conjugated to R; or b. the RNAi agent comprises Formula II conjugated to Formula IV at connection point X and Formula IV is conjugated to a phosphate group at connection point Y, and the phosphate group is further conjugated to R. 10 In other embodiments wherein he RNAi agent comprises a linker, R is conjugated to Formula II via a linker, and the linker is a linker comprising Formula IV having connection points X and Y: Y 15 Formula IV; and wherein the RNAi agent comprises Formula II conjugated to Formula IV at connection point X and Formula IV is conjugated to a phosphate group at connection point Y, and the phosphate group is further conjugated to R. 20 In still other embodiments, the RNAi agent is capable of decreasing expression of the HMGCR gene in a liver cell. In other embodiments, the RNAi agents disclosed herein are for use in therapy. In some embodiments, the use is for the treatment of a disease or disorder associated with ASCVD. In further embodiments, the use is for the treatment of dyslipidemia, primary dysbetalipoproteinemia, hypertriglyceridemia, or atherosclerosis. 31086_WO -26- In some embodiments, the use is for the treatment of dyslipidemia. In some embodiments, the use is for the treatment of primary dysbetalipoproteinemia,. In some embodiments, the use is for the treatment of hypertriglyceridemia. In some embodiments, the use is for the treatment of atherosclerosis.In further embodiments, the dyslipidemia is 5 hypercholesteremia. In other embodiments, the use is to reduce the risk of one or more of myocardial infarction (MI), stroke, revascularization procedures, and angina. In other embodiments, the use to reduce such risk is in adult patients without cardiovascular heart disease (CHD), but with one or more risk factors for any one or more of the recited health events. In other embodiments, the use is to reduce the risk of MI and / or stroke, e.g., in 10 adult patients with type 2 diabetes without CHD, but with one or more risk factors. In other embodiments, the use is to reduce the risk of one or more of non-fatal MI, fatal and non-fatal stroke, revascularization procedures, hospitalization for CHF, and angina, in adult patients with CHD. In other embodiments, the use is to reduce one or more of elevated total-C, LDL-C, apo B, and TG levels, and / or to increase HDLC in adult patients 15 with primary hyperlipidemia (heterozygous familial and nonfamilial) and mixed dyslipidemia. In other embodiments, the use is to reduce elevated triglycerides (TG) in adult patients with hypertriglyceridemia and primary dysbetalipoproteinemia. In other embodiments, the use is to reduce total-C and LDL-C in patients with homozygous familial hypercholesterolemia (HoFH). In still other embodiments, the use is to reduce 20 one or more of elevated total-C, LDL-C, and apo B levels in pediatric patients, 10 years to 17 years of age, with heterozygous familial hypercholesterolemia (HeFH), e.g. after failing an adequate trial of diet therapy. In other embodiments, the use is for treatment of any of the preceding, after statin use failed to control one or more symptoms, e.g. failed to reduce one or more of elevated total-C, LDL-C, apo B, and / or failed to increase HDLC. 25 In other embodiments, the use is for the treatment of any of the preceding, in patients that are statin intolerant; in further embodiments, the use is for lowering LDL-C in patients that are statin intolerant. In further embodiments, the use is for any of the preceding uses, after alteration of diet failed to control one or more symptoms. In other further embodiments, the use is for any of the preceding uses, as an adjunct therapy to diet. 30 The RNAi agents may be formulated into pharmaceutical compositions. Accordingly, disclosed herein are pharmaceutical compositions comprising the RNAi agent disclosed herein, and one or more pharmaceutically acceptable excipients. 31086_WO -27- Pharmaceutical compositions can be prepared by methods well known in the art (e.g., Remington: The Science and Practice of Pharmacy, 23rd edition (2020), A. Loyd et al., Academic Press). In other embodiment are uses of the RNAi agents herein for the manufacture of a 5 medicament for the treatment of dyslipidemia or any of the uses recited in the preceding paragraph. In other embodiments are methods of treating dyslipidemia, in patients in need thereof, comprising administering an RNAi agent disclosed herein, or a pharmaceutical composition thereof. In other embodiments are methods of treating dyslipidemia, or any 10 of the uses recited above, in patients in need thereof, or a pharmaceutical composition thereof. In other embodiments are methods of treating a patient unable to achieve lipid levels following statin and / or diet therapy, comprising administering to the patient an RNAi agent disclosed herein, or a pharmaceutical composition thereof. The RNAi agent can be administered to the patient intravenously or subcutaneously. 15 RNAi dosage regimens may be adjusted to provide the optimum desired response (e.g., a therapeutic response). For example, a single bolus may be administered, several divided doses may be administered over time, or the dose may be proportionally reduced or increased as indicated by the exigencies of the therapeutic situation. Dosage values may vary with the type and severity of the condition to be alleviated. 20 It is further understood that for any particular subject, specific dosage regimens should be adjusted over time according to the individual need and the professional judgment of the person administering or supervising the administration of the compositions. In other embodiments are methods of decreasing HMGCR expression in a cell, comprising contacting the cell with an RNAi agent disclosed herein, and incubating the 25 cell for a time sufficient for decreasing the level of HMGCR mRNA by at least 50% as compared to an untreated or control treated cell. Disclosed herein are oligonucleotides including at least one PrON, including single- stranded RNA molecules, double-stranded RNA molecules, and RNAi agents. The 2- propyl internucleotide linker represents a departure from natural internucleotide linkages 30 and as such, may provide an RNA molecule in which it is included with lesser susceptibility to degradation by nucleases, and in turn, when used in the context of a therapeutic molecule, can possess higher durability than an oligonucleotide which does 31086_WO -28- not include a PrON, and better exposure to target mRNA. In some instances, the resistance to degradation conferred by PrON can reduce the number and type of metabolic byproducts (fragmented RNA molecules). In certain embodiments, an oligonucleotide of the present disclosure has one PrON. 5 In another embodiment, the oligonucleotide has two PrONs. In another embodiment, the oligonucleotide includes three PrONs, or four PrONs, or five PrONs. A PrON may be incorporated at the 5’ end of an oligonucleotide in one embodiment. In another embodiment, the PrON is incorporated or at the 3’ end of the oligonucleotide. In another embodiment, the PrON is incorporated at an internal portion of the oligonucleotide. A 10 PrON may be included in a duplex region of a double-stranded RNA in one embodiment. In another embodiment, the PrON or PrONs may be present in an overhang portion of the dsRNA. In an oligo nucleotide with multiple PrONs, the PrONs can be located in consecutive positions, or may instead be spaced apart (that is, separated by at least one non-PrON 15 nucleotide.) The introduction of the 2-propyl internucleotide linker gives rise to a stereocenter. In some instances, the PrON introduced into an oligonucleotide has the R stereochemical configuration. In another embodiment, the PrON included in an oligonucleotide has the S stereochemical configuration. In an embodiment wherein the oligonucleotide has 20 multiple PrONs, the stereochemical configuration of each PrON is selected independently. For example, in an oligonucleotide containing two PrONs, the configuration of the two PrONs in a 5’ to 3’ direction may be R / R, R / S, S / R, or S / S. In one instance, such an oligonucleotide has these two PrONs in consecutive positions, in some embodiments as a 3’ overhang in the antisense strand of a dsRNA duplex. 25 The PrON as envisaged herein can be used in an oligonucleotide with other modified internucleotide linkers, including but not limited to phosphorothioate linkers. The PrON can be used with other modified nucleotides as disclosed herein. Further provided herein is a pharmaceutical composition for use as a therapy, or for treatment of a disease or a condition, which includes an oligonucleotide as described 30 herein. In one embodiment, the pharmaceutical composition may include a salt of the oligonucleotide. RNA is a polyanion owing to the negative charges present on the phosphate groups of the backbone, and these charges may be balanced by provision of 31086_WO -29- positive charges, yielding a salt of the RNA. In one instance, the salt is a sodium salt. In another instance, the salt is a potassium salt. In another embodiment, the salt may include multiple different cationic species. 5 PREPARATIONS The compounds of the present disclosure may be prepared by following the schemes and preparations detailed below. These schemes and preparations are not limiting in their scope. Certain abbreviations are defined as follows: “1,2-DCE” refers to 1,2-10 dichloroethane; “DCM” refers to dichloromethane; “DIEA” refers to N,N- diisopropylethylamine; “DMF” refers to N,N-dimethylformamide; “DMAP” refers to 4- dimethylaminopyridine; “DMTCl” refers to 4,4’-dimethoxytrityl chloride; “DPP4” refers to dipeptidyl peptidase; “EDC” refers to 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide; “EtOAc” refers to ethyl acetate; “GalNAc” refers to N-acetylgalactosamine; “HATU” 15 refers to 1-[bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxid hexafluorophosphate; “HBTU” refers to O-(benzotriazol-1-yl)-N,N,N′,N′- tetramethyluronium hexafluorophosphate; “HOBt” refers to 1-hydroxybenzotriazole hydrate; “HPRT” refers to hypoxanthine-guanine phosphoribosyltransferase; “IPA” refers to isopropanol and isopropyl alcohol; “LDHA” refers to lactate dehydrogenase-A; 20 “MeCN” refers to acetonitrile; “MeOH” refers to methanol and methyl alcohol; “MWCO” refers to molecular weight cut-off; “NHS” refers to N-hydroxysuccinimide; “OD” refers to optical density; “PBS” refers to phosphate-buffered saline; “PhSiH3” refers to phenylsilane; “PTS” refers to portable endotoxin testing system; “RBF” refers to round bottom flask; “siRNA” refers to small interfering ribonucleic acid; “TEA” refers to 25 triethylamine; “TFA” refers to trifluoroacetic acid; “THF” refers to tetrahydrofuran; “TLC” refers to thin line chromatography; and “TMP” refers to 2,2,6,6- tetramethylpiperidine; “9-BBN” refers to 9-borabicyclo[3.3.1]nonane; “CAP A” refers to capping agent; “CPG” refers to controlled pore glass; “CV” refers to column volume; “EDCI HCl” refers to 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride; 30 “ES / MS” refers to electrospray mass spectrometry; “Et2O” refers to diethyl ether; “IBX” refers to 2-iodoxybenzoic acid; “LDHA” refers to lactate dehydrogenase-A; “MeCN” 31086_WO -30- refers to acetonitrile; “NMR” refers to nuclear magnetic resonance; “PE” refers to petroleum ether; and “TBDMS” refers to tert-butyldimethylsilyl. Scheme 1 AcO OAc AcO OAc O Step A O O 5 Scheme 1, s sing trimethylsilyl trifluoromethanesulfonate in a solvent such as 1,2-DCE to give compound (2). Scheme 2 10 31086_WO -31- Scheme 2, Step A depicts the condensation of compound (3) with compound (4) using a suitable base such as NaOH in a solvent such as DMSO to give compound (5). Step B shows the protection of compound (5) with benzyl chloroformate using a base such as sodium carbonate in a solvent such as DCM to give compound (6). Step C shows 5 the hydrolysis of compound (6) with formic acid to give triacid compound (7). Scheme 3 e using a base such as potassium carbonate in a solvent such as acetone to give compound 10 (9). Step B shows the O-alkylation of compounds (9) and (10) using tetrabutylammonium sulfate and sodium hydroxide to give compound (11). Step C shows the debenzylation of compound (11) using a suitable catalyst such as palladium hydroxide on carbon and hydrogen gas in a solvent such as MeOH to give compound (12).

[0004] 31086_WO -32- Scheme 4 HO O H O O O N O O O O , p p p g p using HBTU and a base such as DIEA in a solvent such as DMF to give compound (13). 5 Step B shows the acidic deprotection of compound (13) with p-toluenesulfonic acid 31086_WO -33- monohydrate in a solvent such as MeOH to give compound (14). Step C shows the addition of compound (14) to compound (2) using trimethylsilyl trifluoromethanesulfonate in a solvent such as 1,2-DCE to give compound (15). Step D shows the deprotection of compound (15) using a catalyst such as palladium on carbon 5 and a gas such as hydrogen in a solvent such as MeOH to give compound (16). Step E shows the amide coupling between compounds (16) and (17) using HBTU and a base such as DIEA in a solvent such as DMF to give compound (18). Step F shows the hydrogenation of compound (18) using palladium on carbon in a solvent such as MeOH to give compound (19). 10 Scheme 5 suitable base such as DIEA in a solvent such as DCM to give compound (21). Step B shows an amide coupling between compound (21) and piperidin-4-yl methanol using 15 HBTU and HOBt with TMP in a solvent such as DCM to give compound (22). The deprotection of compound (22) with 20% piperidine in DMF to give compound (23) is shown in step C.

[0005] 31086_WO -34- Scheme 6 AcOOAcO O H AcO O O N AcO OAcNHAcOOO O O O O , p p p g p s (19) and (23) using HBTU and HOBt with an appropriate base such as DIEA in a solvent such as DMF 31086_WO -35- to give compound (24). Step B shows the formation of compound (25) by adding succinic anhydride to compound (24) in an appropriate solvent such as DCM with a base system of TEA and DMAP. Step C depicts the loading of compound (25) onto resin with 2-(1H- benzotriazol-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate and a base such as 5 DIEA in a solvent system such as MeCN and DCM to give compound (26). Scheme 7 Scheme 7, Step A depicts a coupling reaction between compounds (19) and (27) using a reagent such as EDCI·HCl in a solvent such as DCM to give compound (28). 10 31086_WO -36- Scheme 8 compound (29), the conditions of which will be known by one skilled in the art. Step B 5 shows the conversion of compound (30) to compound (31) by protection of the 3’ alcohol using TBDMSCl in an appropriate solvent such as DMF. For step C, the DMT group was removed from compound (31) to give compound (32), the conditions of which will be known by one skilled in the art. Step D depicts the oxidation of compound (32), using IBX in an appropriate solvent such as EtOAc, to provide compound (33). Conversion of 10 compound (33) to compound (34) via a Wittig reaction, in step E, was accomplished using methyltriphenylphosphonium bromide in an appropriate solvent such as THF. Hydroboration of compound (34) in step F, using 9-BBN in an appropriate solvent such as THF, gave compound (35) which was then oxidized in step G, using IBX and an appropriate solvent such as MeCN, to provide compound (36). A Grignard reaction, 15 depicted in step H, was used to convert compound (36) to compound (37) using 31086_WO -37- methylmagnesium bromide in an appropriate solvent such as THF. DMT protection of compound (37), depicted in Step I, provided compound (38) using DMTCl, 2, 4, 6-TMP, and AgNO3 in an appropriate solvent such as DCM. The TBDMS group was removed from compound (38) to provide compound (39), the conditions of which will be known 5 by one skilled in the art. Scheme 9 Scheme 9, step A depicts the SFC purification of compound (39) to give 10 compounds (40) and (41) as diastereomers. In step B, the 3’ alcohol of compound (40) was phosphitylated with 3-((chloro(diisopropylamino)phosphaneyl)oxy)propanenitrile in an appropriate solvent such as DCM to provide compound (42). Step C, using the same conditions as step B, provided compound (43) from compound (41). 15 Scheme 10 31086_WO -38- 31086_WO -39- Scheme 10, steps A-C depict the formation of compound (47) through several steps beginning with compounds (19) and (44). The steps are essentially analogous to those found in Scheme 6, steps A-C. 5 Synthesis of PrON compounds Scheme 11 compound (1), the conditions of which will be known by one skilled in the art. Step B 10 shows the conversion of compound (2) to compound (3) by protection of the 3’ alcohol using TBDMSCl in an appropriate solvent such as DMF. For step C, the DMT group was removed from compound (3) to give compound (4), the conditions of which will be known by one skilled in the art. Step D depicts the oxidation of compound (4), using IBX in an appropriate solvent such as EtOAc, to provide compound (5). Conversion of 15 compound (5) to compound (6) via a Wittig reaction, in step E, was accomplished using methyltriphenylphosphonium bromide in an appropriate solvent such as THF. Hydroboration of compound (6) in step F, using 9-BBN in an appropriate solvent such as THF, gave compound (7) which was then oxidized in step G, using IBX and an appropriate solvent such as ACN, to provide compound (8). A Grignard reaction, 31086_WO -40- depicted in step H, was used to convert compound (8) to compound (9) using methylmagnesium bromide in an appropriate solvent such as THF. DMT protection of compound (9), depicted in Step I, provided compound (10) using DMTCl, 2, 4, 6-TMP, and AgNO3in an appropriate solvent such as DCM. The TBDMS group was removed 5 from compound (10) to provide compound (11), the conditions of which will be known by one skilled in the art. Scheme 12 10 compounds (12) and (13) as diastereomers. In step B, the 3’ alcohol of compound (12) was phosphitylated with 3-((chloro(diisopropylamino)phosphaneyl)oxy)propanenitrile in an appropriate solvent such as dichloromethane to provide compound (14). Step C, using the same conditions as step B, provided compound (15) from compound (13). 15 Preparation 1 1-((2R,3R,4R,5R)-5-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4-hydroxy-3- methoxytetrahydrofuran-2-yl)pyrimidine-2,4(1H,3H)-dione 31086_WO -41- DIEA (50.1 g, 67.5 m -methoxyphenyl)-phenyl- methyl]-4- methoxy-benzene (72.2 g, 213 mmol) were added to a solution of 1- ((2R,3R,4R,5R)-4-hydroxy-5-(hydroxymethyl)-3-methoxytetrahydrofuran-2- 5 yl)pyrimidine-2,4(1H,3H)-dione (50.0 g, 194 mmol) dissolved in DCM (500 mL). The mixture was stirred at ambient temperature for 15 hours. The reaction mixture was quenched with water (500 ml) and the organic layer was removed. The aqueous layer was extracted three times with DCM (200 ml). The organic layers were combined, dried over sodium sulfate, filtered, and concentrated under reduced pressure to give a residue. 10 The residue was purified by silica gel flash chromatography, eluting with 0% to 100% EtOAc / PE, to give the title compound (100 g, 82%) as a yellow solid. ES / MS (m / z): 583.3 (M+23). Preparation 2 15 1-((2R,3R,4R,5R)-5-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4-((tert- butyldimethylsilyl)oxy)-3-methoxytetrahydrofuran-2-yl)pyrimidine-2,4(1H,3H)-dione Imidazole (216 g, 3. chlorosilane (47.96 g, 52.9 mL,20 318 mmol) were added to a solution of 1-((2R,3R,4R,5R)-5-((bis(4- 31086_WO -42- methoxyphenyl)(phenyl)methoxy)methyl)-4-hydroxy-3-methoxytetrahydrofuran-2- yl)pyrimidine- 2,4(1H,3H)-dione (100.0 g, 159 mmol) in DMF (500 mL). The mixture was stirred under nitrogen at 50 °C for 15 hours. After cooling to ambient temperature, the mixture was quenched with water (1 L). The aqueous layer was extracted three times 5 with EtOAc (800 ml). The organic layers were combined, dried over sodium sulfate, filtered, and concentrated under reduced pressure to give a residue. The residue was purified by silica gel flash chromatography, eluting with 0% to 100% EtOAc / PE, to give the title compound (99 g, 86%) as a yellow solid. ES / MS (m / z): 697.4 (M+23). 10 Preparation 3 1-((2R,3R,4R,5R)-4-((tert-butyldimethylsilyl)oxy)-5-(hydroxymethyl)-3- methoxytetrahydrofuran-2-yl)pyrimidine-2,4(1H,3H)-dione TFA (59.0 g, 40 ml, 52 solution of 1-((2R,3R,4R,5R)-5-15 ((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4-((tert-butyldimethylsilyl)oxy)-3- methoxytetrahydrofuran-2-yl)pyrimidine-2,4(1H,3H)-dione (99.0 g, 136 mmol) dissolved in DCM (1000 mL). The mixture was stirred under nitrogen at ambient temperature for 2 hours, cooled to 0 °C in an ice bath, and then quenched by the addition of aqueous sodium bicarbonate (300 mL). The aqueous was then extracted 3 times with DCM (200 20 mL) and the organic layers were combined, dried over sodium sulfate, filtered, and concentrated under reduced pressure to give a residue. The residue was purified by silica gel flash chromatography, eluting with 0% to 80% EtOAc / PE, to give the title compound (30 g, 57%) as a yellow solid. ES / MS (m / z): 373.1 (M+1). 25 Preparation 4 (2S,3S,4R,5R)-3-((tert-butyldimethylsilyl)oxy)-5-(2,4-dioxo-3,4-dihydropyrimidin- 1(2H)-yl)-4-methoxytetrahydrofuran-2-carbaldehyde 31086_WO -43- IBX (43.8 g, 156 mmol n of 1-((2R,3R,4R,5R)-4-((tert- butyldimethylsilyl)oxy)-5-(hydroxymethyl)-3-methoxytetrahydrofuran-2-yl)pyrimidine- 2,4(1H,3H)- dione (30.0 g, 78.1 mmol) in EtOAc (400 mL). The mixture was stirred 5 under nitrogen at 80 °C for 5 hours. The reaction mixture was then cooled to ambient temperature, filtered, and concentrated under reduced pressure to give to give the title compound (33 g, 86%) as a pink solid. ES / MS (m / z): 371.1 (M+1). Preparation 5 10 1-((2R,3R,4R,5R)-4-((tert-butyldimethylsilyl)oxy)-3-methoxy-5-vinyltetrahydrofuran-2- yl)pyrimidine-2,4(1H,3H)-dione N-Butyllithium (14.6 g, 5M in hexane) was added to a solution of methyltriphenylphosphonium bromide (81.4 g, 228 mmol) in THF (600 mL) 15 under nitrogen at -70 °C. The solution was warmed to 0 °C, stirred for 30 minutes, and (2S,3S,4R,5R)-3-((tert-butyldimethylsilyl)oxy)-5-(2,4-dioxo-3,4-dihydropyrimidin- 1(2H)-yl)-4-methoxytetrahydrofuran-2-carbaldehyde (37.5 g, 75.9 mmol) dissolved in THF (300 mL) was then added. The mixture was then warmed to ambient temperature and stirred under nitrogen for 16 hours. After quenching with saturated ammonium 20 chloride (1200 ml) the mixture was further diluted with water (500 ml). The aqueous was extracted 3 times with EtOAc (1000 ml) and the organic layers were combined, washed with brine (800 ml), dried over sodium sulfate, and then reduced to residue. The residue was purified by silica gel flash chromatography, eluting with 0% to 50% EtOAc / PE, to give the title compound (16 g, 56%) as a white solid. ES / MS (m / z): 369.6 (M+1). 25 31086_WO -44- Preparation 6 1-((2R,3R,4R,5R)-4-((tert-butyldimethylsilyl)oxy)-5-(2-hydroxyethyl)-3- methoxytetrahydrofuran-2-yl)pyrimidine-2,4(1H,3H)-dione 5 1-((2R,3R,4R,5R)-4-((t xy)-3-methoxy-5- vinyltetrahydrofuran-2-yl)pyrimidine-2,4(1H,3H)-dione (11.1 g, 28.6 mmol) was dissolved in THF (200 mL) under nitrogen and the solution was cooled to 0 °C. 9-BBN in THF (45.2 g, 143 mmol, 0.5M in THF) was added to the solution and it was stirred at 0 °C for 30 minutes. The mixture was then warmed to ambient temperature. After stirring 10 for 16 hours, the solution was cooled to 0 °C and MeOH (12 mL) was added dropwise. When gas evolution had ceased, water (6.0 mL) was added followed by a mixture of sodium hydroxide (2.29 g, 28.6 mL, 57.2 mmol) and hydrogen peroxide (22.7 g, 20.5 ml, 200 mmol). The ice bath was then removed, and the mixture was stirred vigorously at ambient temperature for 2 hours. Aqueous sodium sulfite (400 mL) was then added, and 15 the mixture was extracted 3 times with EtOAc (500 mL). The organic layers were then combined, washed 2 times with brine (200 ml), dried over sodium sulfate, and then reduced to residue. The residue was purified by silica gel flash chromatography, eluting with 0% to 50% EtOAc / PE, to give the title compound (8.6 g, 78%) as a colorless oil. ES / MS (m / z): 387.2 (M+1). 20 Preparation 7 2-((2R,3R,4R,5R)-3-((tert-butyldimethylsilyl)oxy)-5-(2,4-dioxo-3,4-dihydropyrimidin- 1(2H)-yl)-4-methoxytetrahydrofuran-2-yl)acetaldehyde 31086_WO -45- 1-((2R,3R,4R,5R)-4-((tert-butyldimethylsilyl)oxy)-5-(2-hydroxyethyl)-3- methoxytetrahydrofuran-2-yl)pyrimidine-2,4(1H,3H)- dione (12.0 g, 22.4 mmol) was dissolved in MeCN (150 mL) and IBX (12.5 g, 44.7 mmol) was added. After stirring at 80 °C for 1 hour, the mixture was filtered through a Celite pad and concentrated to 5 residue. The residue was purified by silica gel flash chromatography, eluting with 0% to 60% EtOAc / PE, to give the title compound (8.4 g, 86%) as a white solid. ES / MS (m / z): 385.1 (M+1). Preparation 8 10 1-((2R,3R,4R,5R)-4-((tert-butyldimethylsilyl)oxy)-5-(2-hydroxypropyl)-3- methoxytetrahydrofuran-2-yl)pyrimidine-2,4(1H,3H)-dione Methylmagnesium bro 9.3 mmol, 3M in THF) was added to a solution of 2-((2R,3R,4R,5R)-3-((tert-butyldimethylsilyl)oxy)-5-(2,4-dioxo-3,4- 15 dihydropyrimidin-1(2H)-yl)-4-methoxytetrahydrofuran-2- yl)acetaldehyde (3.20 g, 7.32 mmol) in THF (100 mL) at 0 °C under nitrogen. The solution was stirred at 0 °C for 1 hour. The reaction mixture was quenched by the addition of aqueous saturated ammonium chloride (150 mL) and then diluted with water (100 mL). The aqueous was extracted with EtOAc (200 mL). The organic layer was washed with brine (100 mL), 20 dried over sodium sulfate, filtered, and then reduced to residue. The residue was purified by silica gel flash chromatography, eluting with 20% to 60% EtOAc / PE to give the title compound (1.8 g, 61%) as a colorless oil. ES / MS (m / z): 401.1 (M+1). Preparation 9 25 1-((2R,3R,4R,5R)-5-(2-(bis(4-methoxyphenyl)(phenyl)methoxy)propyl)-4-((tert- butyldimethylsilyl)oxy)-3-methoxytetrahydrofuran-2-yl)pyrimidine-2,4(1H,3H)-dione 31086_WO -46- Silver nitrate (15. idine (14.6 g, 15.9 mL, 119 mmol), and 4,4'-(chloro(phenyl)methylene)bis(methoxybenzene) (20.2 g, 59.7 mmol) were added to a solution of 1-((2R,3R,4R,5R)-4-((tert-butyldimethylsilyl)oxy)-5-((RS)-2- 5 hydroxypropyl)-3-methoxytetrahydrofuran-2-yl)pyrimidine-2,4(1H,3H)-dione (5.90 g, 11.9 mmol) in DCM (120 mL) at 0 °C. The ice bath was removed, and the mixture was stirred at ambient temperature for 16 hours under nitrogen. The reaction mixture was quenched by the addition of water (200 mL) and the aqueous was then extracted three times with EtOAc (200 mL). The organic layers were then combined, washed 2 times 10 with brine (200 ml), dried over sodium sulfate, and then reduced to residue. The residue was purified by silica gel flash chromatography, eluting with 0% to 70% EtOAc / PE, to give the title compound (11 g, 74%) as an orange solid. ES / MS (m / z): 725.3 (M+23). Preparation 10 15 1-((2R,3R,4R,5R)-5-(2-(bis(4-methoxyphenyl)(phenyl)methoxy)propyl)-4-hydroxy-3- methoxytetrahydrofuran-2-yl)pyrimidine-2,4(1H,3H)-dione Tetrabutylammon . g, . . mmol, 1M in THF) was added to a solution of 1-((2R,3R,4R,5R)-5-(2-(bis(4- 31086_WO -47- methoxyphenyl)(phenyl)methoxy)propyl)-4-((tert-butyldimethylsilyl)oxy)-3- methoxytetrahydrofuran-2-yl)pyrimidine-2,4(1H,3H)-dione (10.0 g, 9.70 mmol) in THF (100 mL) and the mixture was stirred at ambient temperature under nitrogen. After 30 minutes of stirring, the reaction mixture was concentrated under reduced pressure to give 5 a residue. The residue was purified by silica gel flash chromatography, eluting with 0% to 100% EtOAc / PE, to give the title compound (5.0 g, 80%) as a white solid. ES / MS (m / z): 587.2 (M-1). Preparation 11 10 1-((2R,3R,4R,5R)-5-((S)-2-(bis(4-methoxyphenyl)(phenyl)methoxy)propyl)-4-hydroxy- 3-methoxytetrahydrofuran-2-yl)pyrimidine-2,4(1H,3H)-dione and 1-((2R,3R,4R,5R)-5- ((R)-2-(bis(4-methoxyphenyl)(phenyl)methoxy)propyl)-4-hydroxy-3- methoxytetrahydrofuran-2-yl)pyrimidine-2,4(1H,3H)-dione 15 1-((2R,3R,4R,5R)-5-(2-(bis(4-methoxyphenyl)(phenyl)methoxy)propyl)-4- hydroxy-3-methoxytetrahydrofuran-2-yl)pyrimidine-2,4(1H,3H)-dione (5.00 g, 8.15 mmol) was purified by SFC (Condition: CO2-EtOH; Column: Daicel Chiralpak IBN 250 20 mm X 50 mm X 10 um; Begin B: 50%; End B: 50%; Gradient Time(min): 150 min; Flowrate: 200mL / min.) to give 1-((2R,3R,4R,5R)-5-((S)-2-(bis(4- methoxyphenyl)(phenyl)methoxy)propyl)-4-hydroxy-3-methoxytetrahydrofuran-2- yl)pyrimidine-2,4(1H,3H)-dione (first eluting isomer, 1.85 g, 38%) and 1- ((2R,3R,4R,5R)-5-((R)-2-(bis(4-methoxyphenyl)(phenyl)methoxy)propyl)-4-hydroxy-3- 25 methoxytetrahydrofuran-2-yl)pyrimidine-2,4(1H,3H)-dione (second eluting isomer, 3.01 31086_WO -48- g, 61%) as white solids. ES / MS (m / z): 587.2 (M-1). Relative stereochemistry was verified by x-ray crystallography. Preparation 12 5 (2R,3R,4R,5R)-2-((S)-2-(bis(4-methoxyphenyl)(phenyl)methoxy)propyl)-5-(2,4-dioxo- 3,4-dihydropyrimidin-1(2H)-yl)-4-methoxytetrahydrofuran-3-yl (2-cyanoethyl) diisopropylphosphoramidite 10 1-((2R,3R,4R,5R) henyl)methoxy)propyl)-4- hydroxy-3-methoxytetrahydrofuran-2-yl)pyrimidine-2,4(1H,3H)-dione (1.85 g, 3.14 mmol) was dissolved in a mixture of DIEA (1.22 g, 1.64 mL, 9.43 mmol) in DCM (25 mL) and the solution was chilled to 0 °C in an ice bath. 3- ((chloro(diisopropylamino)phosphaneyl)oxy)propanenitrile (1.64 g, 1.54 mL, 6.91 mmol) 15 was then added dropwise and the ice bath was removed. The mixture was stirred at ambient temperature for 1.5 hours and the solvent was then removed under vacuum at 25 °C to leave a residue. The residue was purified by silica gel flash chromatography, eluting with 0% to 100% EtOAc / hexanes (eluents contain 1% TEA) to give the title compound (1.54 g, 62%) as an off-white foam.31P NMR (DMSO) δ 148.90, 148.80; 20 ES / MS (m / z): 789.4 (M+1). Preparation 13 31086_WO -49- (2R,3R,4R,5R)-2-((R)-2-(bis(4-methoxyphenyl)(phenyl)methoxy)propyl)-5-(2,4-dioxo- 3,4-dihydropyrimidin-1(2H)-yl)-4-methoxytetrahydrofuran-3-yl (2-cyanoethyl) diisopropylphosphoramidite 5 1-((2R,3R,4R,5R) henyl)methoxy)propyl)-4- hydroxy-3-methoxytetrahydrofuran-2-yl)pyrimidine-2,4(1H,3H)-dione (3.01 g, 5.11 mmol) was dissolved in a mixture of DIEA (1.98 g, 2.67 mL, 15.3 mmol) in DCM (40 mL) and the solution was chilled to 0 °C in an ice bath. 3- 10 ((chloro(diisopropylamino)phosphaneyl)oxy)propanenitrile (2.66 g, 2.51 mL, 11.2 mmol) was then added dropwise and the ice bath was removed. The mixture was stirred at ambient temperature for 1.5 hours and the solvent was then removed under vacuum at 25 °C to leave a residue. The residue was purified by silica gel flash chromatography, eluting with 0% to 100% EtOAc / hexanes (eluents contain 1% TEA) to give the title 15 compound (3.8 g, 95%) as an off-white foam.31P NMR (DMSO) δ 149.06, 148.99; ES / MS (m / z): 789.4 (M+1).

[0006] 31086_WO -50- Preparation 14 (6,7-Diacetoxy-2-methyl-5,6,7,7a-tetrahydro-3aH-pyrano[3,2-d]oxazol-5-yl)methyl acetate 5 To a suspension of (5-ac -triacetoxy-tetrahydropyran-2-yl)methyl acetate (25.0 g, 62.9 mmol) in 1,2-DCE (120 mL) was added trimethylsilyl trifluoromethanesulfonate (18.4 mL, 94.3 mmol). The mixture was heated to 50 °C and stirred for 16 hours under nitrogen atmosphere. After this time, the cooled mixture was poured into cold saturated aqueous NaHCO3 and extracted three times with DCM. The 10 organic layer was washed successively with saturated aqueous NaHCO3solution and saturated aqueous NaCl solution, dried over MgSO4, filtered, and concentrated in vacuo. The resulting residue was purified by silica gel flash chromatography, eluting with 0-5% MeOH / DCM, to give the title compound as thick, yellow oil (12.7 g, 61%). ES / MS m / z: 330 (M+H). 15 Preparation 15 Di-tert-butyl 3,3'-((2-amino-2-((3-(tert-butoxy)-3-oxopropoxy)methyl)propane-1,3- diyl)bis(oxy))dipropionate 31086_WO -51- Tris(hydroxymethyl)aminomethane (7.0 g, 57 mmol) was dissolved in fresh dimethyl sulfoxide (11 mL) and cooled to 15 °C under a nitrogen atmosphere. While stirring, 5N sodium hydroxide (1.2 mL, 6.0 mmol) was added, followed by tert-butyl acrylate (30 mL, 203 mmol) as a slow stream. The mixture was stirred at ambient 5 temperature. After 8 hours, an additional 5N sodium hydroxide (1.2 mL, 6.0 mmol) and tert-butyl acrylate (15 mL, 101 mmol) were added and stirring continued for another 8 hours. The mixture was concentrated under reduced pressure (50 °C and 2 mbar) for 1 hour. The residue was diluted with water and saturated aqueous NaCl solution, then extracted three times with EtOAc. The organic layer was dried over MgSO4, filtered, and 10 concentrated in vacuo to give the title compound as a colorless, viscous oil (24.72 g, 85%). ES / MS m / z: 506 (M+H). Preparation 16 Di-tert-butyl 3,3'-((2-(((benzyloxy)carbonyl)amino)-2-((3-(tert-butoxy)-3- 15 oxopropoxy)methyl)propane-1,3-diyl)bis(oxy))dipropionate To di-tert-butyl 3,3'-((2-amino-2-((3-(tert-butoxy)-3-oxopropoxy)methyl)propane- 1,3-diyl)bis(oxy))dipropionate (24.7 g, 48.9 mmol) and sodium carbonate (25% aqueous, 20 180 mL) in DCM (300 mL) was added benzyl chloroformate (22 mL, 151 mmol) as a slow stream. The mixture was stirred at ambient temperature for 4 hours. After this time, the mixture was diluted with water, stirred for 5 minutes and the layers separated. The aqueous layer was extracted two times with DCM. The combined organic layer was washed with 31086_WO -52- saturated aqueous NaCl solution, dried over Na2SO4, filtered and concentrate in vacuo. The crude residue was purified by silica gel flash chromatography, eluting with 0-60% EtOAc in hexanes to give the title compound as thick, colorless oil (19.1 g, 61.1%). ES / MS m / z: 640 (M+H). 5 Preparation 17 3,3'-((2-(((Benzyloxy)carbonyl)amino)-2-((2-carboxyethoxy)methyl)propane-1,3- diyl)bis(oxy))dipropionic acid 10 Di-tert-butyl amino)-2-((3-(tert-butoxy)-3- oxopropoxy)methyl)propane-1,3-diyl)bis(oxy))dipropionate (19.1 g, 29.9 mmol) was stirred in formic acid (100 mL) at ambient temperature for 16 hours. After this time, the mixture was concentrated in vacuo (50 °C and 2 mbar) to give the title compound as a thick oil (15.07 g, 94.2%). ES / MS m / z: 472 (M+H). 15 Preparation 18 3-(Dibenzylamino)propan-1-ol To a mixture of benzyl b . , 136 mmol) and 3-amino-1-propanol 20 (5.00 mL, 64.7 mmol) in acetone (200 mL) was added potassium carbonate (45.0 g, 322.3 mmol). The mixture was stirred for 16 hours under nitrogen atmosphere. After this time, 31086_WO -53- the mixture was filtered and the filter cake washed with acetone. The filtrate was concentrated in vacuo. The crude residue was purified by silica gel flash chromatography, eluting with 0-80% EtOAc in hexanes to give the title compound as light, yellow liquid (7.9 g, 48%). ES / MS m / z: 256 (M+H). 5 Preparation 19 N,N-Dibenzyl-3-(3-((tetrahydro-2H-pyran-2-yl)oxy)propoxy)propan-1-amine 10 Tetrabutylammonium sulfate (50 mass% in H2O) (42 mL, 36 mmol) was added to a mixture of 3-(dibenzylamino)propan-1-ol (7.9 g, 31 mmol) and 2-(3- bromopropoxy)tetrahydro-2H-pyran (6.5 mL, 38 mmol) in 5N sodium hydroxide (120 mL). The mixture was stirred at 70 °C for 24 hours. Additional tetrabutylammonium sulfate (50 mass% in H2O) (42 mL, 36 mmol) and 2-(3-bromopropoxy)tetrahydro-2H-pyran (6.5 15 mL, 38 mmol) were added and stirred for a further 24 hours. After cooling to ambient temperature, the mixture was diluted with saturated aqueous NaCl solution and extracted three times with EtOAc. The organic layer was washed with saturated aqueous NaCl solution, dried over Na2SO4, filtered and concentrated in vacuo. The crude residue was purified by silica gel flash chromatography, eluting with 0-50% EtOAc in hexanes to give 20 the title compound as yellow liquid (7.6 g, 62%). ES / MS m / z: 398 (M+H). Preparation 20 3-(3-((Tetrahydro-2H-pyran-2-yl)oxy)propoxy)propan-1-amine 25 Palladium hydroxid pended in MeOH (225 mL) in a Parr shaker. A solution of N,N-dibenzyl-3-(3-((tetrahydro-2H-pyran-2- 31086_WO -54- yl)oxy)propoxy)propan-1-amine in MeOH (225 mL) was added. The shaker was sealed and purged with nitrogen gas, followed by hydrogen gas. The mixture was stirred at ambient temperature under 60 psi of hydrogen gas. After 8 hours, the mixture was filterd over a small pad of diatomaceous earth and the filter cake washed with MeOH. The filtrate 5 was concentrated in vacuo to give the title compound as a yellow liquid (3.95 g, 96%). GC / MS m / z: 218. Preparation 21 Benzyl (9,19-dioxo-14-((3-oxo-3-((3-(3-((tetrahydro-2H-pyran-2-10 yl)oxy)propoxy)propyl)amino)propoxy)methyl)-1,27-bis((tetrahydro-2H-pyran-2- yl)oxy)-4,12,16,24-tetraoxa-8,20-diazaheptacosan-14-yl)carbamate 3,3'- yl)propane-1,3- diyl)bis(oxy))dipropionic acid (2.00 g, 4.20 mmol) and 3-(3-((tetrahydro-2H-pyran-2- 15 yl)oxy)propoxy)propan-1-amine (3.95 g, 18.2 mmol) were dissolved in DMF (50 mL). HBTU (4.90 g, 13.0 mmol) and DIEA (5.00 mL, 27.3 mmol) were added and the mixture stirred at ambient temperature. After 16 hours, the mixture was diluted with ice water and extracted two times with DCM. The organic layer was washed with saturated aqueous NaCl, dried over MgSO4 filtered, and concentrated in vacuo. The crude residue was 20 purified by silica gel flash chromatography, eluting with 0-20% MeOH in DCM to give the title compound as a thick, yellow oil (3.5 g, 77%). ES / MS m / z: 1092 (M+23). Preparation 22 Benzyl (1,27-dihydroxy-14-((3-((3-(3-hydroxypropoxy)propyl)amino)-3- 31086_WO -55- oxopropoxy)methyl)-9,19-dioxo-4,12,16,24-tetraoxa-8,20-diazaheptacosan-14- yl)carbamate p-Tolu added to a solution 5 of benzyl (9,19-dioxo-14-((3-oxo-3-((3-(3-((tetrahydro-2H-pyran-2- yl)oxy)propoxy)propyl)amino)propoxy)methyl)-1,27-bis((tetrahydro-2H-pyran-2- yl)oxy)-4,12,16,24-tetraoxa-8,20-diazaheptacosan-14-yl)carbamate (3.5 g, 3.3 mmol) in MeOH (50 mL). The mixture was stirred at 60 °C for 30 minutes, cooled to ambient temperature then concentrated in vacuo. The residue was diluted with saturated aqueous 10 NaHCO3 solution and extracted three times with chloroform. The organic layer was washed successively with saturated aqueous NaHCO3and saturated aqueous NaCl solution, dried over MgSO4, filtered and concentrated in vacuo to give the title compound as a thick, yellow oil (2.57 g, 96%). ES / MS m / z: 409 ([M+2H] / 2). 15 Preparation 23 [5-Acetamido-6-[3-[3-[3-[3-[3-[3-[3-[3-acetamido-4,5-diacetoxy-6- (acetoxymethyl)tetrahydropyran-2-yl]oxypropoxy]propylamino]-3-oxo-propoxy]-2-[[3- [3-[3-[3-acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydropyran-2- yl]oxypropoxy]propylamino]-3-oxo-propoxy]methyl]-2-20 (benzyloxycarbonylamino)propoxy]propanoylamino]propoxy]propoxy]-3,4-diacetoxy- tetrahydropyran-2-yl]methyl acetate 31086_WO -56- AcOOAcO H AcO O O N To 14-((3-((3-(3- hydroxypropoxy)propyl)amino)-3-oxopropoxy)methyl)-9,19-dioxo-4,12,16,24-tetraoxa- 8,20-diazaheptacosan-14-yl)carbamate (2.5 g, 3.1 mmol) in 1,2-dichloroethane (30 mL) 5 was added 4 Å molecular sieves (3 g), (6,7-diacetoxy-2-methyl-5,6,7,7a-tetrahydro-3aH- pyrano[3,2-d]oxazol-5-yl)methyl acetate (0.3M in 1,2-dichloroethane, 30 mL, 9 mmol) and trimethylsilyl trifluoromethanesulfonate (0.2 mL, 1.02 mmol). The mixture was stirred for 16 hours at ambient temperature under nitrogen atmosphere. After this time, the mixture was diluted with saturated aqueous NaHCO3 solution and extracted three times with 10 chloroform. The organic layer was dried over MgSO4, filtered and concentrated in vacuo. The residue was purified by silica gel flash chromatography, eluting with 0-20% MeOH in DCM, to give the title compound as colorless foam (850 mg, 15%). ES / MS m / z: 903 ([M+2H] / 2). 15 Preparation 24 [5-Acetamido-6-[3-[3-[3-[3-[3-[3-[3-[3-acetamido-4,5-diacetoxy-6- (acetoxymethyl)tetrahydropyran-2-yl]oxypropoxy]propylamino]-3-oxo-propoxy]-2-[[3- [3-[3-[3-acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydropyran-2- yl]oxypropoxy]propylamino]-3-oxo-propoxy]methyl]-2-amino- 20 propoxy]propanoylamino]propoxy]propoxy]-3,4-diacetoxy-tetrahydropyran-2-yl]methyl acetate 31086_WO -57- [5-Acet y-6- (acetoxymethyl)tetrahydropyran-2-yl]oxypropoxy]propylamino]-3-oxo-propoxy]-2-[[3- [3-[3-[3-acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydropyran-2- 5 yl]oxypropoxy]propylamino]-3-oxo-propoxy]methyl]-2- (benzyloxycarbonylamino)propoxy]propanoylamino]propoxy]propoxy]-3,4-diacetoxy- tetrahydropyran-2-yl]methyl acetate (0.85 g, 0.47 mmol) was combined with palladium on carbon (50% wet) (0.1 g, 0.047 mmol) in MeOH (10 mL). Two drops of glacial acetic acid was added. The mixture was stirred under 1 atmosphere of hydrogen gas. After 2 hours, the 10 mixture was filtered over a small pad of diatomaceous earth and the cake washed with MeOH. The filtrate was concentrated in vacuo to give the title compound as a colorless foam (726 mg, 92%). ES / MS m / z: 836 ([M+2H] / 2). Preparation 25 15 Benzyl 12-[[2-[3-[3-[3-[3-acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydropyran-2- yl]oxypropoxy]propylamino]-3-oxo-propoxy]-1,1-bis[[3-[3-[3-[3-acetamido-4,5- diacetoxy-6-(acetoxymethyl)tetrahydropyran-2-yl]oxypropoxy]propylamino]-3-oxo- propoxy]methyl]ethyl]amino]-12-oxo-dodecanoate 31086_WO -58- To 12-benzyloxy-12-oxo-dodecanoic acid (0.100 g, 0.312 mmol) in DMF (2 mL) was added HBTU (0.121 g, 0.313 mmol) and DIEA (0.18 mL, 0.982 mmol). The mixture was stirred for 5 minutes then [5-acetamido-6-[3-[3-[3-[3-[3-[3-[3-[3-acetamido-4,5- diacetoxy-6-(acetoxymethyl)tetrahydropyran-2-yl]oxypropoxy]propylamino]-3-oxo- 5 propoxy]-2-[[3-[3-[3-[3-acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydropyran-2- yl]oxypropoxy]propylamino]-3-oxo-propoxy]methyl]-2-amino- propoxy]propanoylamino]propoxy]propoxy]-3,4-diacetoxy-tetrahydropyran-2-yl]methyl acetate (0.400 g, 0.239 mmol) in DMF (2 mL) was added. The mixture was stirred at ambient temperature for 2 hours. After this time, the mixture was diluted with water and 10 extracted three times with chloroform. The organic layer was washed successively with saturated aqueous NaHCO3 and saturated aqueous NaCl solution, dried over MgSO4, filtered and concentrated in vacuo. The residue was purified by silica gel flash chromatography, eluting with 0-30% MeOH in DCM, to give the title compound as a colorless foam (176 mg, 37%). ES / MS m / z: 988 ([M+2H] / 2). 15 Preparation 26 12-[[2-[3-[3-[3-[3-Acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydropyran-2- yl]oxypropoxy]propylamino]-3-oxo-propoxy]-1,1-bis[[3-[3-[3-[3-acetamido-4,5- diacetoxy-6-(acetoxymethyl)tetrahydropyran-2-yl]oxypropoxy]propylamino]-3-oxo- 20 propoxy]methyl]ethyl]amino]-12-oxo-dodecanoic acid . , . tion of benzyl 12-[[2-[3-[3-[3-[3-acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydropyran- 2-yl]oxypropoxy]propylamino]-3-oxo-propoxy]-1,1-bis[[3-[3-[3-[3-acetamido-4,5-25 diacetoxy-6-(acetoxymethyl)tetrahydropyran-2-yl]oxypropoxy]propylamino]-3-oxo- 31086_WO -59- propoxy]methyl]ethyl]amino]-12-oxo-dodecanoate (0.176 g, 0.0892 mmol) in MeOH (3 mL). The mixture was stirred under 1 atmosphere of hydrogen gas. After 18 hours, the mixture was filtered through a short pad of diatomaceous earth and the filter cake rinsed with MeOH. The filtrate was concentrated in vacuo to give the title compound as a colorless 5 foam (158 mg, 94%). ES / MS m / z: 943 ([M+2H] / 2). Preparation 27 N-(((9H-Fluoren-9-yl)methoxy)carbonyl)-O-(bis(4-methoxyphenyl)(phenyl)methyl)-L- serine 10 To a stirring so 9-ylmethoxycarbonylamino)-3- hydroxy-propanoic acid (40 g, 0.122 mol) in dry DCM (400 mL) was added DIEA (64 mL, 0.366 mol) at 0 °C under inert atmosphere. To this, a solution of DMTCl (49.6 g, 0.146 mol) in DCM (200 mL) was added slowly. The resulting mixture was brought to ambient temperature and stirred for 16 hours. After this time, the reaction mixture was diluted with 15 water (12.5 vol) and extracted with DCM (25 vol). The organic layer was dried over anhydrous sodium sulphate, filtered, and concentrated in vacuo. The crude obtained was washed with 10% EtOAc / hexane (12.5 vol) and dried under vacuum to give the title compound as a pale brown solid (62 g, crude). This material was taken to next step without any further purification. TLC: 5% MeOH / DCM (Rf: 0.5) UV, 254 nM. 20 Preparation 28 (9H-Fluoren-9-yl)methyl (S)-(3-(bis(4-methoxyphenyl)(phenyl)methoxy)-1-(4- (hydroxymethyl)piperidin-1-yl)-1-oxopropan-2-yl)carbamate 31086_WO -60- To a stirring sol l)methoxy)carbonyl)-O-(bis(4- methoxyphenyl)(phenyl)methyl)-L-serine (62 g, 0.103 mol) in DCM (750 mL) was added slowly HBTU (78.3 g, 0.206 mol), HOBt (27.9 g, 0.206 mol), and piperidin-4-yl methanol 5 (15.4 g, 0.134 mol) followed by TMP (15 mL, 0.113 mol) at 0 °C under inert atmosphere. The resulting mixture was brought to ambient temperature and stirred for 4 hours. After this time, the reaction mixture was diluted with water (8 vol) and extracted with DCM (15 vol). The organic layer was dried over anhydrous sodium sulphate, filtered, and concentrated in vacuo. The resulting residue was purified by silica gel flash 10 chromatography, eluting with 20-40% EtOAc / hexane and 1% MeOH / DCM, to give the title compound (40 g, 52% over two steps).1H NMR (DMSO-d6) δ 7.88 (br d, J = 7.5 Hz, 2H), 7.79 - 7.59 (m, 3H), 7.45 - 7.12 (m, 13H), 6.92 - 6.76 (m, 4H), 4.79 - 4.44 (m, 2H), 4.32 (br d, J = 11.4 Hz, 2H), 4.20 (br s, 2H), 3.71 (s, 6H), 3.21 (br s, 4H), 2.99 - 2.79 (m, 1H), 2.69 ( br s, 2H), 1.81 - 1.43 (m, 3H), 1.08 - 0.73 (m, 2H). 15 Preparation 29 (S)-2-Amino-3-(bis(4-methoxyphenyl)(phenyl)methoxy)-1-(4-(hydroxymethyl)piperidin- 1-yl)propan-1-one 31086_WO -61- A solution of 20% piper ) was added slowly to (9H-fluoren- 9-yl)methyl (S)-(3-(bis(4-methoxyphenyl)(phenyl)methoxy)-1-(4- (hydroxymethyl)piperidin-1-yl)-1-oxopropan-2-yl)carbamate (40 g, 0.055 mol) at 0 °C 5 under inert atmosphere. The resulting reaction mixture was stirred at ambient temperature for 1 hour. After this time, the mixture was diluted with water (15 vol) and extracted with EtOAc (30 vol). The organic layer was dried over anhydrous sodium sulphate, filtered, and concentrated in vacuo. The resulting residue was purified by silica gel flash chromatography, eluting with 1-8% MeOH / DCM, to give the title compound as an off- 10 white solid (13 g, 47%). ES / MS m / z 1009.5 (2M+H). Preparation 30 N~1~-{1,27-Bis[(2-Acetamido-3,4,6-tri-o-acetyl-2-deoxyhexopyranosyl)oxy]-14-({3-[(3- {3-[(2-acetamido-3,4,6-tri-o-acetyl-2-deoxyhexopyranosyl)oxy]propoxy}propyl)amino]-15 3-oxopropoxy}methyl)-9,19-dioxo-4,12,16,24-tetraoxa-8,20-diazaheptacosan-14-yl}- n~12~-{(2s)-3-[bis(4-methoxyphenyl)(phenyl)methoxy]-1-[4-(hydroxymethyl)piperidin- 1-yl]-1-oxopropan-2-yl}dodecanediamide

[0007] 31086_WO -62- yl]oxypropoxy]propylamino]-3-oxo-propoxy]-1,1-bis[[3-[3-[3-[3-acetamido-4,5- diacetoxy-6-(acetoxymethyl)tetrahydropyran-2-yl]oxypropoxy]propylamino]-3-oxo- 5 propoxy]methyl]ethyl]amino]-12-oxo-dodecanoic acid (500 mg, 266 μmol) was added to a solution of (Z)-2-(1H-benzo[d][1,2,3]triazol-1-yl)-1,1,3-trimethylisouronium hexafluorophosphate(V) (107 mg, 292 μmol), 1-hydroxy-1H-benzotriazole (39.5 mg, 292 μmol), and DIEA (228 μL, 1.33 mmol) dissolved in DMF (6 ml). The solution was stirred at ambient temperature for 15 minutes, (S)-2-amino-3-(bis(4- 10 methoxyphenyl)(phenyl)methoxy)-1-(4-(hydroxymethyl)piperidin-1-yl)propan-1-one (147 mg, 292 μmol) was then added, and stirring at ambient temperature was continued for 16 hours. The mixture was diluted with EtOAc and the organic was washed with saturated aqueous NaCl, dried over sodium sulfate, and concentrated in vacuo to give an oil. The oil was purified by silica gel flash chromatography, using 0-20% MeOH / EtOAc (w / 1% 15 triethylamine added), to give the title compound as an off-white foam (418 mg, 66%). ES / MS m / z: 1183.8 ([M-2H] / 2). Preparation 31 4-((1-((S)-30-(((2S,3S,4S,5S,6S)-3-Acetamido-4,5-diacetoxy-6-20 (acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)-17,17-bis((3-((3-(3-(((2S,3S,4S,5S,6S)-3- acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2- yl)oxy)propoxy)propyl)amino)-3-oxopropoxy)methyl)-2-((bis(4- methoxyphenyl)(phenyl)methoxy)methyl)-4,15,22-trioxo-19,27-dioxa-3,16,23- triazatriacontanoyl)piperidin-4-yl)methoxy)-4-oxobutanoic acid 31086_WO -63- bis[(2-acetamido-3,4,6-tri-o-acetyl-2-deoxyhexopyranosyl)oxy]-14-({3-[(3-{3-[(2- acetamido-3,4,6-tri-o-acetyl-2-deoxyhexopyranosyl)oxy]propoxy}propyl)amino]-3- 5 oxopropoxy}methyl)-9,19-dioxo-4,12,16,24-tetraoxa-8,20-diazaheptacosan-14-yl}- n~12~-{(2s)-3-[bis(4-methoxyphenyl)(phenyl)methoxy]-1-[4-(hydroxymethyl)piperidin- 1-yl]-1-oxopropan-2-yl}dodecanediamide (1.40 g, 591 μmol), 4-dimethylaminopyridine (217 mg, 1.77 mmol), and triethylamine (412 μL, 2.95 mmol) dissolved in DCM (20 ml). The mixture was stirred at ambient temperature for 16 hours then purified directly by silica 10 gel flash chromatography, eluting with 0-10% MeOH / DCM (w / 1% triethylamine added), to give the title compound as an off-white foam (1.23 g, 84%). ES / MS m / z: 1234.0 ([M- 2H] / 2). Preparation 32 15 Resin loading

[0008] 31086_WO -64- diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)-17,17-bis((3-((3-(3- (((2S,3S,4S,5S,6S)-3-acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2- 5 yl)oxy)propoxy)propyl)amino)-3-oxopropoxy)methyl)-2-((bis(4- methoxyphenyl)(phenyl)methoxy)methyl)-4,15,22-trioxo-19,27-dioxa-3,16,23- triazatriacontanoyl)piperidin-4-yl)methoxy)-4-oxobutanoic acid (1.23 g, 499 μmol) was added to a solution of 2-(1H-benzo[d][1,2,3]triazol-1-yl)-1,1,3,3-tetramethylisouronium hexafluorophosphate(V) (391 mg, 1.030 mmol) and DIEA (264 μL, 1.52 mmol) in 10 acetonitrile (50 ml) and the mixture was shaken at ambient temperature for 15 minutes. After this time, native amino LCAA 500 Å controlled-pore glass (CPG) resin (3.91 g, 123 µmol / g loading, purchased from ChemGenes) was added and the mixture was shaken at ambient temperature for 16 hours. The cartridge was drained by suction filtration and the CPG was washed by shaking with DCM (50 mL) for 10 minutes. The cartridge was drained 15 and the washing and draining procedure was repeated with 10% MeOH / DCM (50 mL) and Et2O (50 mL). After draining, a solution of CAP A (50 ml) was added to the cartridge and shaken at ambient temperature for 2 hours. The cartridge was then drained and the washing and draining procedure above was repeated using DCM (50 mL), 10% MeOH / DCM (50 mL) and diethyl ether (50 mL). The cartridge was drained one final time, and the resin 20 dried under vacuum for 30 minutes. The resin loading was determined using a standard trityl assay. The resin loading was calculated to be 64.1 µmol / g. Preparation 33 31086_WO -65- (2,5-Dioxopyrrolidin-1-yl) 12-[[2-[3-[3-[3-[3-acetamido-4,5-diacetoxy-6- (acetoxymethyl)tetrahydropyran-2-yl]oxypropoxy]propylamino]-3-oxo-propoxy]-1,1- bis[[3-[3-[3-[3-acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydropyran-2- yl]oxypropoxy]propylamino]-3-oxo-propoxy]methyl]ethyl]amino]-12-oxo-dodecanoate yl]oxypropoxy]propylamino]-3-oxo-propoxy]-1,1-bis[[3-[3-[3-[3-acetamido-4,5- diacetoxy-6-(acetoxymethyl)tetrahydropyran-2-yl]oxypropoxy]propylamino]-3-oxo- propoxy]methyl]ethyl]amino]-12-oxo-dodecanoic acid (158 mg, 0.0839 mmol) and N- 10 hydroxysuccinimide (15 mg, 0.128 mmol) were dissolved in DCM (1 mL). EDCI·HCl (25 mg, 0.128 mmol) was added and the resulting mixture stirred at ambient temperature for 6 hours. The mixture was loaded directly on a column and purified by silica gel flash chromatography, eluting with 0-40% MeOH in DCM. The desired fractions were concentrated in vacuo. The residue was dissolved in DCM and filtered through glass wool 15 to remove insoluble particulates. The filtrate was concentrated in vacuo to give the title compound as a colorless foam (114 mg, 69%). ES / MS m / z: 990 ([M+2H] / 2). Preparation 34 19-[(2-Acetamido-3,4,6-tri-o-acetyl-2-deoxyhexopyranosyl)oxy]-n-(3-{3-[(2-acetamido-20 3,4,6-tri-o-acetyl-2-deoxyhexopyranosyl)oxy]propoxy}propyl)-6-({3-[(3-{3-[(2- acetamido-3,4,6-tri-o-acetyl-2-deoxyhexopyranosyl)oxy]propoxy}propyl)amino]-3- oxopropoxy}methyl)-6-{12-[(2s,4r)-2-{[bis(4-methoxyphenyl)(phenyl)methoxy]methyl}- 4-hydroxypyrrolidin-1-yl]-12-oxododecanamido}-11-oxo-4,8,16-trioxa-12- azanonadecan-1-amide 31086_WO -66- 12-[[2-[3-[3-[3-[3-Acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydropyran-2- yl]oxypropoxy]propylamino]-3-oxo-propoxy]-1,1-bis[[3-[3-[3-[3-acetamido-4,5- 5 diacetoxy-6-(acetoxymethyl)tetrahydropyran-2-yl]oxypropoxy]propylamino]-3-oxo- propoxy]methyl]ethyl]amino]-12-oxo-dodecanoic acid (500 mg, 266 μmol) was added to a solution of (Z)-2-(1H-benzo[d][1,2,3]triazol-1-yl)-1,1,3-trimethylisouronium hexafluorophosphate(V) (111 mg, 292 μmol), 1-hydroxy-1H-benzotriazole (39.5 mg, 292 μmol), and diisopropylethylamine (172 mg, 228 μL, 1.33 mmol) dissolved in DMF (610 mL). The solution was stirred at ambient temperature for 15 minutes, (3R,5S)-5-((bis(4- methoxyphenyl) (phenyl)methoxy)methyl)pyrrolidin-3-ol (123 mg, 292 μmol) was then added, and stirring at ambient temperature was continued for 16 hours. The mixture was diluted with EtOAc and the organic was washed with saturated aqueous NaCl, dried over sodium sulfate, and concentrated in vacuo to give an orange foam. The foam was 15 purified by silica gel flash chromatography, using 0-20% MeOH / EtOAc (w / 1% triethylamine added), to give the title compound as tan foam (313 mg, 52%). ES / MS (m / z): 11414 (M-2H / 2). Preparation 35 20 4-(((3R,5S)-1-(1-(((2R,3R,4R,5R,6R)-3-Acetamido-4,5-diacetoxy-6- (acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)-14,14-bis((3-((3-(3-(((2R,3R,4R,5R,6R)- 3-acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2- yl)oxy)propoxy)propyl)amino)-3-oxopropoxy)methyl)-9,16-dioxo-4,12-dioxa-8,15- diazaheptacosan-27-oyl)-5-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)pyrrolidin-3- 25 yl)oxy)-4-oxobutanoic acid 31086_WO -67- Succinic anhydride (27.4 mg, 274 μmol) was added to a solution of 19-[(2- acetamido-3,4,6-tri-o-acetyl-2-deoxyhexopyranosyl)oxy]-n-(3-{3-[(2-acetamido-3,4,6-tri- 5 o-acetyl-2-deoxyhexopyranosyl)oxy]propoxy}propyl)-6-({3-[(3-{3-[(2-acetamido-3,4,6- tri-o-acetyl-2-deoxyhexopyranosyl)oxy]propoxy}propyl)amino]-3-oxopropoxy}methyl)- 6-{12-[(2s,4r)-2-{[bis(4-methoxyphenyl)(phenyl)methoxy]methyl}-4-hydroxypyrrolidin- 1-yl]-12-oxododecanamido}-11-oxo-4,8,16-trioxa-12-azanonadecan-1-amide (313 mg, 137 μmol), 4- dimethylaminopyridine (50.1 mg, 410 μmol), and triethylamine (13.8 mg, 10 19.1 μL, 137 μmol) dissolved in DCM (5 mL) and the mixture was stirred at ambient temperature for 16 hours. The mixture was purified directly by silica gel flash chromatography, using 0- 10% MeOH / DCM (w / 1% triethylamine added), to give the title compound as an off-white foam (274 mg, 84%). ES / MS (m / z): 1191.2 (M-2H / 2).

[0009] 31086_WO -68- Preparation 36 CPG loading 5 In a resin loading cartridge, 2-(1H-benzo[d][1,2,3]triazol-1-yl)-1,1,3,3- tetramethylisouronium hexafluorophosphate(V) (87.3 mg, 230 μmol) and N,N- diisopropylethylamine (44.6 mg, 60.1 μL, 345 μmol) were added to a solution of 4- (((3R,5S)-1-(1-(((2R,3R,4R,5R,6R)-3-acetamido-4,5-diacetoxy-6- (acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)-14,14-bis((3-((3-(3-(((2R,3R,4R,5R,6R)-10 3-acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2- yl)oxy)propoxy)propyl)amino)-3-oxopropoxy)methyl)-9,16-dioxo-4,12-dioxa-8,15- diazaheptacosan-27-oyl)-5-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)pyrrolidin-3- yl)oxy)-4-oxobutanoic acid (274 mg, 115 μmol) dissolved in a mixture of acetonitrile (10 mL) and DMF (1 mL). The mixture was shaken at ambient temperature for 15 minutes. 15 After this time, Native amino LCAA 500A CPG (1.15 g, 123 µmol / g loading, purchased from ChemGenes) was added and the mixture was shaken at ambient temperature for 16 hours. The cartridge was drained by suction filtration and the CPG was washed by shaking with DCM (10 mL) for 10 minutes. The cartridge was drained and the washing and draining procedure was repeated with 10% MeOH / DCM (10 mL) and Et2O (10 mL). 20 After draining, a solution of CAP A (10 mL) was added to the cartridge, and it was shaken at ambient temperature for 2 hours. The cartridge was then drained and the washing and draining procedure above was repeated using DCM (10 mL), 10% MeOH / DCM (10 mL) and diethyl ether (10 mL). The cartridge was drained one final time, and the CPG was dried under vacuum for 45 minutes. The resin loading was 31086_WO -69- determined using a standard trityl assay. The resin loading was calculated to be 42.9 µmol / g. Synthesis of butadiol compounds 5 Scheme 1 s asymmetric epoxidation protocol, the conditions of which will be known by one skilled in the art. Step B shows the conversion of compound (2) to compound (3) using Mitsunobu 10 reaction conditions with 4-nitrobenzoic acid, the conditions of which will be known by one skilled in the art. Step C shows hydrolysis of compound (3) in a solvent such as dichloromethane using a base such as cesium carbonate to afford compound (4) which was then protected with DMT to afford compound (6) in step E. Step D was performed in a manner essentially analogous to the method of step E to provide compound (5). 15 Scheme 2 Sc eme , step , compoun (5) was treate w t compoun (7) an us ng a ase such as NaH in a suitable solvent such as DMF to provide compound (8). In step B, the 31086_WO -70- secondary alcohol of compound (8) was phosphitylated with 3- ((bis(diisopropylamino)phosphaneyl)oxy)propanenitrile in an appropriate solvent such as DCM to provide compound (9). The scheme was repeated starting with compound (6) to provide the other 5 diastereomer. Scheme 3 Scheme 3, step A was performed in a manner essentially analogous to the method 10 in step A of Scheme 2 to give compound (11). Step B was performed in a manner essentially analogous to the method in step B of Scheme 2 to give compound (12). The scheme was repeated starting with compound (6) to provide the other diastereomer. Scheme 4 15 Scheme 4, step A was performed in a manner essentially analogous to the method in step A of Scheme 2 to give compound (14). For Step B, compound (14) was treated with 1,1-dimethoxy-N,N-dimethylmethanamine in an appropriate solvent such as DMF 31086_WO -71- and heated to provide compound (15). Step C was performed in a manner essentially analogous to the method in step B of Scheme 2 to give compound (16). The scheme was repeated starting with compound (6) to provide the other diastereomer. 5 Scheme 5 od in step A of Scheme 2 to give compound (18). In step B the benzyl protecting group was removed using catalytic hydrogenation with Pd / C in an appropriate solvent such as 10 EtOAc to provide compound (19). Step C was performed in a manner essentially analogous to the method in step B of Scheme 4 to give compound (20). Step D was performed in a manner essentially analogous to the method in step B of Scheme 2 to give compound (21). The scheme was repeated starting with compound (6) to provide the other diastereomer. 15 1 ol bi-Blocks, CAS number 598-32-3. 20 Preparation 2 (R)-1-((S)-Oxiran-2-yl)ethan-1-ol 31086_WO -72- 4Å molecular sieves (20 g) wer to a dry three-neck RBF under nitrogen. DCM (160 mL) was added and the suspension was cooled to -23 °C. (-)-DIPT (1.00 mL, 4.88 mmol) was added, followed by Ti(Oi-Pr)4 (1.20 mL, 4.2 mmol). t-BuOOH (18.2 mL, 5 100 mmol) was added slowly. Using a mechanical stirrer, the reaction was stirred for 30 minutes.3-Buten-2-ol (6.00 g, 83.2 mmol) was added dropwise via addition funnel as a solution in DCM (20 mL). The reaction was allowed to stir for 64 hours at -23 °C. The reaction was quenched by the addition of dimethyl sulfide (7 mL). The reaction flask was removed from the cold bath and allowed to warm to ambient temperature. A solution of 10 acetone / water (100 mL / 40 mL) was added, and the suspension was stirred for 1 hour. The reaction was filtered through a pad of diatomaceous earth, washing with DCM. The filtrate was dried over Mg2SO4and filtered. The solution of crude product was carefully concentrated in vacuo. The resulting solution was purified via silica gel flash chromatography eluting with 0-10% MeOH in DCM to give the title compound as a 15 colorless oil (3.15 g, 43%).1H NMR (CDCl3) δ 4.01(m, 1H), 3.02 (m, 1H), 2.79 (dd, J = 5.0, 3.0 Hz, 1H), 2.73 (dd, J = 4.8, 4.4 Hz, 1H), 1.85 (m, 1H), 1.26 (d, J = 6.4 Hz, 3H). Preparation 3 (S)-1-((S)-Oxiran-2-yl)ethyl 4-nitrobenzoate 20 To a dry RBF was added l)ethan-1-ol (3.00 g, 34 mmol) under nitrogen. DCM was added (60 mL), followed by 4-nitrobenzoic acid (2.85 g, 17.0 mmol) and triphenylphosphine (4.47 g, 17.0 mmol). The solution was cooled to 0 °C, and DIAD (2.65 mL, 13.6 mmol) was added slowly as a solution in DCM (5 mL). After 25 stirring for 10 minutes, the cold bath was removed and the reaction was stirred at ambient temperature for 2 hours. The reaction was concentrated in vacuo and the resulting solution was purified via silica gel flash chromatography eluting with 0-30% EtOAc in hexanes to give the title compound as a white solid (1.72 g, 64%).1H NMR (CDCl3) δ 31086_WO -73- 8.30 (d, J = 9.2 Hz, 2H), 8.23 (d, J = 9.2 Hz, 2H), 5.02 (quintet, J = 6.4 Hz, 1H), 3.25 (m, 1H), 2.91 (dd, J = 4.4, 4.4 Hz, 1H), 2.72 (dd, J = 4.8, 2.8 Hz, 1H), 1.48 (d, J = 6.4 Hz, 3H). 5 Preparation 4 (S)-1-((S)-Oxiran-2-yl)ethan-1-ol To a dry RBF was added (S)-1-((S)-oxiran-2-yl)propyl 4-nitrobenzoate (1.72 g, 7.25 mmol) under nitrogen. DCM was added (10 mL), followed by cesium carbonate 10 (2.60 g, 7.98 mmol). MeOH (1.5 mL, 36.3 mmol) was added and the reaction was stirred for 2 hours. The suspension was filtered and carefully concentrated in vacuo. The resulting residue was purified via silica gel flash chromatography eluting with 0-10% MeOH in DCM in hexanes to give the title compound as a colorless oil (0.614 g, 96%). 1H NMR (CDCl3) δ 3.63 (m, 1H), 2.97 (m, 1H), 2.82 (dd, J = 4.8, 4.0 Hz, 1H), 2.71 (dd, J 15 = 4.8, 2.4 Hz, 1H), 1.88 (br s, 1H), 1.35 (d, J = 6.4 Hz, 3H). Preparation 5 (S)-2-((S)-1-(Bis(4-methoxyphenyl)(phenyl)methoxy)ethyl)oxirane 20 To a dry RBF was added yl)ethan-1-ol (0.614 g, 6.97 mmol) under nitrogen. DCM was added (35 mL) and the solution was cooled to 0°C.2,4,6- trimethylpyridine (5.53 mL, 41.8 mmol) was added, followed by 4,4'- (chloro(phenyl)methylene)bis(methoxybenzene) (3.31 g, 9.76 mmol). AgNO3(1.54 g, 9.06 mmol) was added slowly in 5 portions over 10 minutes. The cold bath was removed 25 and the reaction was allowed to stir at ambient temperature for 3 hours. The reaction was diluted with EtOAc (15 mL) and quenched with water (3 mL). The suspension was stirred 31086_WO -74- for 10 minutes and then filtered through a pad of diatomaceous earth, washing with DCM. The organic layer was separated and dried over sodium sulfate, filtered, and concentrated in vacuo. The resulting solution was purified via silica gel flash chromatography eluting with 0-30% EtOAc in hexanes (eluants contain 1% TEA) to give the title compound as a 5 colorless oil (2.40 g, 88%).1H NMR (CDCl3) δ 7.52 (d, J = 8.0 Hz, 2H), 7.41 (m, 4H), 7.30-7.19 (m, 3H), 6.82 (d, J = 8.8 Hz, 4H), 3.79 (s, 6H), 3.62 (quintet, J = 6.4 Hz, 1H), 2.85 (m, 1H), 2.61 (dd, J = 4.8, 4.4 Hz, 1H), 2.51 (dd, J = 4.8, 2.8 Hz, 1H), 0.72 (d, J = 6.4 Hz, 3H).

[0010] 31086_WO -75- Table 1: Preparation 6 synthesized in a manner essentially analogous to that of Preparation 5 Preparation Structure Preparation Name1H NMR (CDCl3) 6 (S)-2-((R)-1-(Bis(4- δ 7.54 (d, J = 7.2 Hz, 2H), 7.43 84 ), , z, p 5 1-((2S,3R)-3-(Bis(4-methoxyphenyl)(phenyl)methoxy)-2-hydroxybutyl)pyrimidine- 2,4(1H,3H)-dione To a dry RBF was a ione (0.517 g, 4.61 mmol) under nitrogen. DMF was added (5 mL), followed by NaH (46 mg, 1.15mmol, 60% 10 dispersion in mineral oil). The suspension was stirred for 1.5 hours. (S)-2-((R)-1-(bis(4- methoxyphenyl)(phenyl)methoxy)ethyl)oxirane (1.50 g, 3.84 mmol) was added as a solution in DMF (5 mL). The reaction was heated to 110 °C and stirred for 48 hours. The reaction was cooled to ambient temperature and diluted with EtOAc (20 mL) and washed with a solution of 5% NaCl in water (2 x 50 mL). The organic layer was separated and 15 concentrated in vacuo. The resulting solution was purified via silica gel flash chromatography eluting with 0-100% EtOAc in hexanes (eluants contain 1% TEA) to give the title compound as a white foam (1.32 g, 68%). ES / MS (m / z): 501.3 (M-H). 31086_WO -76- Table 2: Preparations below synthesized in a manner essentially analogous to that of Preparation 7. Preparation Structure Preparation Name ES / MS (m / z) - 31086_WO -77- 12 (2S,3S)-1-(6-Amino-9H- 526.3 purin-9-yl)-3-(bis(4- (M+H). - - Preparation 15 (2S,3R)-3-(Bis(4-methoxyphenyl)(phenyl)methoxy)-1-(2,4-dioxo-3,4-dihydropyrimidin- 1(2H)-yl)butan-2-yl (2-cyanoethyl) diisopropylphosphoramidite , oxyphenyl)(phenyl)methoxy)- 2-hydroxybutyl)pyrimidine-2,4(1H,3H)-dione (1.32 g, 2.63 mmol) under nitrogen. DCM 31086_WO -78- was added (13 mL), followed by 2H-tetrazole (4.09 mL, 1.84 mmol, 0.45 M in MeCN). 3-((bis(diisopropylamino)phosphaneyl)oxy)propanenitrile (0.918 mL, 2.89 mmol) was added. The reaction was stirred for 20 hours. The reaction was concentrated in vacuo. The resulting solution was purified via silica gel flash chromatography eluting with 0-100% 5 EtOAc in hexanes (eluants contain 1% TEA) to give the title compound as a colorless foam (1.32 g, 71%).31P NMR (CDCl3) δ 149.87, 149.43; ES / MS (m / z): 701.4 (M-H). Table 3: Preparations below synthesized in a manner essentially analogous to that of Preparation 15. Preparation Structure Preparation Name 16 (2S3S)-3-(Bis(4-31P NMR ) 6, R ) 1, 31086_WO -79- 18 (2S,3S)-1-(4-Benzamido-2-31P NMR oxopyrimidin-1(2H)-yl)-3-(bis(4- (CDCl3) 4, R ) 3, R ) 5, R ) 2, 31086_WO -80- 22 (2S,3S)-3-(Bis(4-31P NMR ) 5, . p (E)-N'-(9-((2S,3R)-3-(Bis(4-methoxyphenyl)(phenyl)methoxy)-2-hydroxybutyl)-9H- purin-6-yl)-N,N-dimethylformimidamide 5 To a dry RBF w 9-yl)-3-(bis(4- methoxyphenyl)(phenyl)methoxy)butan-2-ol (2.04 g, 3.88 mmol) under nitrogen. DMF was added (15 mL), followed by 1,1-dimethoxy-N,N-dimethylmethanamine (2.75 mL, 20.6 mmol). The suspension was heated to 60 °C and stirred for 1.5 hours. The reaction 10 was cooled to ambient temperature and diluted with EtOAc (20 mL) and washed with a solution of 5% NaCl in water (2 x 70 mL). The organic layer was separated and concentrated in vacuo. The resulting solution was purified via silica gel flash chromatography eluting with 0-20% MeOH in EtOAc (eluants contain 1% TEA) to give the title compound as a light-yellow foam (1.58g, 70%). ES / MS (m / z): 581.4 (M+H). 15 Table 4: Preparations below synthesized in a manner essentially analogous to that of Preparation 23. 31086_WO -81- Preparation Structure Preparation Name ES / MS (m / z): Preparation 27 2-Amino-9-((2S,3R)-3-(bis(4-methoxyphenyl)(phenyl)methoxy)-2-hydroxybutyl)-1,9- dihydro-6H-purin-6-one 31086_WO -82- In a dry RBF, (2S, H-purin-9-yl)-3-(bis(4- methoxyphenyl)(phenyl)methoxy)butan-2-ol (1.82 g, 2.88 mmol) and Pd / C (0.92 g, 10% on carbon) were suspended in EtOAc (72 mL). The reaction flask was purged with 5 nitrogen, followed by hydrogen. The reaction mixture was stirred under an atmosphere of hydrogen for 3 hours. The reaction mixture was filtered through diatomaceous earth, washing with 5:1 DCM / MeOH. The solution was concentrated in vacuo to give the title compound as a white solid (1.32 g, 85%). ES / MS (m / z): 542.2 (M+H). Table 5: Preparations below synthesized in a manner essentially analogous to that of 10 Preparation 27. Preparation Structure Preparation Name ES / MS H) EXAMPLE 1 Synthesis of oligonucleotides 15 The sense strand and antisense strand of an RNAi agent including at least one PrON can be synthesized using any nucleic acid polymerization methods known in the art, for example, solid-phase synthesis by employing phosphoramidite chemistry 31086_WO -83- methodology (e.g., Current Protocols in Nucleic Acid Chemistry, Beaucage, S.L. et al. (Edrs.), John Wiley & Sons, Inc., New York, NY, USA), H-phosphonate, phosphortriester chemistry, or enzymatic synthesis. Automated commercial synthesizers can be used, for example, MerMade™ 12 from LGC Biosearch Technologies, or other 5 synthesizers from BioAutomation or Applied Biosystems. Phosphorothioate linkages can be introduced using a sulfurizing reagent such as phenylacetyl disulfide or DDTT (((dimethylaminomethylidene) amino)-3H-l,2,4-dithiazaoline-3-thione). It is well known to use similar techniques and commercially available modified amidites and controlled- pore glass (CPG) products to synthesize modified oligonucleotides or conjugated 10 oligonucleotides. Purification methods can be used to exclude the unwanted impurities from the final oligonucleotide product. Commonly used purification techniques for single stranded oligonucleotides include reverse-phase ion pair high performance liquid chromatography (RP-IP-HPLC), capillary gel electrophoresis (CGE), anion exchange HPLC (AX-HPLC), 15 and size exclusion chromatography (SEC). After purification, oligonucleotides can be analyzed by mass spectrometry and quantified by spectrophotometry at a wavelength of 260 nm. The sense strand and antisense strand can then be annealed to form a duplex. In other embodiments disclosed herein are RNAi agents having a formula of R-L- D, wherein R is a double stranded RNA (dsRNA) comprising a sense strand and an 20 antisense strand, wherein the antisense strand is complementary to target mRNA, wherein L is a bond or a linker, and wherein D is a delivery moiety of Formula II: . In some embodiments, the RNAi agent disclosed herein comprises a linker. In 25 further embodiments, R is conjugated to Formula II via a linker. In other further embodiments R is conjugated to Formula II via a linker. In further embodiments, the 31086_WO -84- linker comprises a linker of Formula III having connection points A and B or the linker comprises Formula IV having connection points X and Y, and wherein: O B N H 5 a. the RNAi agent comprises Formula II conjugated to Formula III at connection point A and Formula III is conjugated to a phosphate group at connection point B, and the 10 phosphate group is conjugated to R; or b. the RNAi agent comprises Formula II conjugated to Formula IV at connection point X and Formula IV is conjugated to a phosphate group at connection point Y, and the phosphate group is further conjugated to R. In an embodiment in which the RNAi agent of Formula II includes a linker, and 15 the linker is of Formula IV, -L-D has the structure of Formula V: HO O Y , 31086_WO -85- wherein dsRNA R is connected to Formula V at connection point Y via a phosphate or phosphate analog. The delivery moiety of Formula II may be made by synthetic steps and schemes as described in United States Patent Application No.18 / 573,794, filed December 22, 2023, 5 or International Patent Publication No. WO2022 / 271806, each of which is incorporated herein by reference in its entirety. Briefly, for the synthesis of GalNAc-conjugated sense strands, a sense strand may first ne synthesized using standard phosphoramidite chemistry. A stock solution of the desired GalNAc ligand-NHS ester (10 mmol / L in acetonitrile; 1 eq) is prepared. Borate 10 buffer (10% v / v; 20x) is added to oligonucleotide sense strand in an Eppendorf tube, then GalNAc ligand (5 eq) is added. The mixture is shaken at ambient temperature for 16 hours. After this time, the mixture is transferred to a 15 mL falcon tube, ammonium hydroxide (28 mass%) is added, and the mixture is shaken at ambient temperature for 2 hours. The ammonia is then removed in vacuo. The residue is purified by ion-exchange 15 chromatography. Conditions: Solvent A: 15% MeCN / 20 mM NaH2PO4, Solvent B: 15%MeCN / 20mM NaH2PO4, 1M NaBr; 35-55%B over 5 CV at 8 mL / min, column temperature 60 °C. The desired fractions are pooled and desalted by spin-filtration using an Eppendorf centrifuge or desalting column. After desalting, the material is recovered and OD and volume are measured to obtain concentration. 20 Alternatively, and particularly in the case of a delivery moiety including a linker of Formula IV, oligo synthesis may be conducted on a MerMade™ 12 instrument using standard phosphoramidite chemistry and GalNAc functionalized CPG. Sense strands are synthesized from the prefunctionalized GalNAc solid support and antisense strands are synthesized using standard support preloaded with the first nucleotide of the oligo 25 sequence. Antisense strands are prepared using CPG with a universal support or linker. Oligos are cleaved and deprotected by shaking the CPG in ammonium hydroxide solution (28% by mass) at 40 degrees for approximately 16 hours, filtered to remove CPG, and then purified by ion exchange chromatography using conditions described above. Such deprotection likewise converts the OAc precursor groups of the galactose 30 moieties of the delivery moiety to hydroxyl groups. Cleavage from the CPG also yields a 3’ hydroxyl at the 3’ end of the newly-made RNA strand. Desalting, annealing, and endotoxin testing are conducted. 31086_WO -86- To generate the siRNA duplexes of a sense and antisense strand, the following procedures may be performed. To a tube (such as a Falcon tube) containing oligonucleotide sense strand-GalNAc conjugate, the corresponding antisense oligonucleotide (1 eq) is added and vortexed for 10 seconds before spin-filtering through 5 100K MWCO Amicon filter unit to remove particulates. The filtrate is recovered and concentrated in vacuo on a Genevac evaporator. The residue is reconstituted in 1x PBS, filtered through 0.2 µ filter, and OD and volume are measured to obtain concentration. In further embodiments of the RNAi agents disclosed herein, the sense strand and antisense strand each independently comprise one or more modified internucleotide 10 linkages, and each modified internucleotide linkage is a phosphorothioate linkage. In further embodiments, the sense strand and antisense strand each independently comprise four phosphorothioate linkages. In still further embodiments, the two terminal nucleotides at each of the 5’ and 3’ ends of each of the sense and antisense strand are phosphorothioate linkages. 15 In certain embodiments, the delivery moiety may instead be a compound comprising Formula VI: wherein Formula VI may be conjugated to an oligonucleotide directly or via a linker, 20 wherein the linker or oligonucleotide is conjugated to the delivery moiety at connection point E. 31086_WO -87- In an embodiment, the linker comprises a linker of Formula VII having connection points A and B; or of Formula VIII having connection points C and D; or of Formula IX having connection points E and F: 5 10 15 wherein connection point A or connection point C or connection point E are conjugated to Formula VI. In another aspect, the delivery moiety may comprise a compound of Formula X:

[0011] 31086_WO -88- In another embodiment, the delivery moiety may comprise a compound of Formula XI: In another embodiment, the delivery moiety may comprise a compound of Formula XII:

[0012] 31086_WO -89- In another embodiment, the delivery moiety may comprise a compound of Formula XIII: 5 o ua . 31086_WO -90- In another embodiment, the delivery moiety may comprise a compound of Formula XIV: 5 Formula XIV. In another embodiment, the delivery moiety may comprise a compound of Formula XV: 10 In another embodiment, the delivery moiety may comprise a compound of Formula XVI: 31086_WO -91- In another embodiment, the delivery moiety may comprise a compound of Formula XVII: 5 In , of 10 Formula XVIII: 31086_WO -92- It will be appreciated that any of the delivery moieties disclosed herein may be conjugated to an oligonucleotide directly, via any linker disclosed herein, by any 5 combination of linkers disclosed herein, and by other linkers. For example, the delivery moiety D of Formula Xa may be conjugated to the linker of Formula IX, to yield a linker-delivery moiety L-D of Formula XIX: 10 In some embodiments, the linker-delivery moiety L-D of Formula XIX may be conjugated to a nucleic acid, such as via a phosphate group at the 3’ end of the nucleic acid, at connection point F. For example the oxygen at connecting point In another embodiment, the delivery moiety of Formula VI may be conjugated to the linker of Formula VIII, to yield a linker-delivery moiety L-D of Formula XX: 31086_WO -93- In some embodiments, the linker-delivery moiety L-D of Formula XX may be conjugated to a nucleic acid, such as via a phosphate group at the 3’ end of the nucleic 5 acid, at connection point F. It will be appreciated that the linkers as shown herein may be depicted in different ways, and will form covalent bonds with the delivery moiety and / or the nucleic acid of the RNAi agent in conventional ways. For example, when a linker is depicted with an oxygen atom at the connection point, and is to be conjugated to a phosphate group of a 10 nucleic acid, it will be understood that the oxygen of the linker will take the place of an oxygen atom of the nucleic acid. When a linker is not shown with an oxygen atom at the connection point, an oxygen atom of the nucleic acid may in some embodiments covalently bind the linker at the depicted position, and so forth. In certain embodiments, the 5’ nucleotide of the antisense strand comprises a 15 phosphate group or a phosphate analog. In some embodiments, at least one of the sense strand and the antisense strand can include at least one abasic moiety of the formula: , wherein “5’” and “3’” indicate the dir ec on o he sequences. 20 In some embodiments, at least one of the sense strand and the antisense strand can include at least one inverted abasic (iAb) moiety of the formula: 31086_WO -94- , wherein “5’” and “3’” indicate the di e sequences. In other embodiments, the RNAi agents herein comprise a modified nucleotide at the 5’ end of the antisense strand oligonucleotide of Formula J, Formula K, or Formula L 5 that comprises a further modification of the phosphate group to a phosphate analog. In a further embodiment, the further modification is a phosphate analog that is 5’-(E)- vinylphosphonate. In other embodiments of the RNAi agent disclosed herein, the sense strand or the antisense strand has a further modification that is an abasic moiety. 10 The RNAi agent can further comprise a delivery moiety which targets the RNAi agent to a particular cell, tissue, and / or organ of the patient or subject. By delivering oligonucleotides to a desired cell or tissue of the patient, gene expression can be regulated in the location where it is most beneficial. In one aspect, the delivery moiety can be a lipophilic delivery moiety. 15 In one aspect, the delivery moiety may be a GalNAc delivery moiety; that is, a moiety comprising at least one N-acetylgalactosamine (GalNAc). Such a moiety can target the asialoglycoprotein receptor on hepatic cells, thereby increasing delivery to the liver. In one embodiment, the delivery moiety can include one, two, three, or four GalNAc moieties. Suitable delivery moieties are described in WO 2022 / 271806. 20 In a particular, embodiment, the delivery moiety can also be described by a compound of Formula M. OH HO O H Z 31086_WO -95- Formula M. Delivery Moiety In a moiety of Formula M, L is the delivery moiety linker or a bond (that is, where an additional linker is not present), and Z is the RNA molecule. In another aspect, the delivery moiety can be described by a compound of Formula 5 M’: . For Formula M’, L may be a linker or a bond, and Z is the RNAi molecule. The delivery moiety can be connected to the RNAi agent at the 3’ or 5’ end. The 10 delivery moiety can be attached to the RNAi agent through a delivery moiety linker. The delivery moiety linker can be any suitable organic linker. The delivery moiety linker can be described by a compound of Formula N. HO O 15 Formula N. Delivery moiety linker. In another embodiment, the linker may be described by Formula N’: 31086_WO -96- In another embodiment, the linker may be described by Formula N’’: 5 which in certain embodiments may be of Formula N’’-a or of Formula N’’-b: 10 In an embodiment, an RNAi agent as described herein may have the structure: 31086_WO -97- wherein Z is the RNA molecule. In another embodiment, an RNAi agent as described herein may have the structure: 5 Example 2: Conjugation of the delivery moiety For the synthesis of GalNAc-conjugated sense strands, a sense strand with a 3’ 10 C6-NH2 functional group was first synthesized using standard phosphoramidite chemistry. A stock solution of GalNAc ligand-NHS ester (10 mmol / L in acetonitrile; 1 eq) was prepared. Borate buffer (10% v / v; 20x) was added to oligonucleotide C6-NH2 sense strand in an Eppendorf tube, then GalNAc ligand (5 eq) was added. The mixture was shaken at ambient temperature for 16 hours. After this time, the mixture was 15 transferred to a 15 mL falcon tube, ammonium hydroxide (28 mass%) was added, and the mixture was shaken at ambient temperature for 2 hours. The ammonia was then removed in vacuo. The residue was purified by ion-exchange chromatography. Conditions: Solvent A: 15% MeCN / 20 mM NaH2PO4, Solvent B: 15%MeCN / 20mM NaH2PO4, 1M NaBr; 35- 55%B over 5 CV at 8 mL / min, column temperature 60 °C. The desired fractions were 20 pooled and desalted by spin-filtration using an Eppendorf centrifuge or desalting column. After desalting, the material was recovered and OD and volume were measured to obtain concentration. Alternatively, conjugation to the 3’ position of the sense strand through immobilizing the GalNAc ligand on microporous polystyrene resin or controlled pore 31086_WO -98- glass and synthesized using established solid phase oligonucleotide synthesis methods with 5’-CE ß-cyanoethyl) phosphoramidites. Alternatively, the GalNAc ligand was converted to a suitable phosphoramidite and delivered to the 5’ position of the sense strand using standard phosphoramidite chemistry. 5 Example 3: General procedure for oligo synthesis using GalNAc-functionalized CPG Oligo synthesis was conducted on a MerMade™ 12 instrument using 10 phosphoramidite chemistry. Sense strands were synthesized from the prefunctionalized GalNAc solid support and antisense strands were synthesized using standard support preloaded with the first nucleotide of the oligo sequence. Oligos were cleaved and deprotected using concentrated ammonium hydroxide solution (28% by mass) and purified by ion exchange chromatography using conditions described above. Desalting, 15 annealing, and endotoxin testing were conducted. The sequence of antisense oligonucleotides were designed using 15 to 50 nucleotides of the following HMGCR transcript (SEQ ID NO: 1), where T nucleotides were replaced by U nucleotides, and where one or more nucleotides and one or more internucleotide linkages were optionally further modified as described herein. 20 Example 4 Incorporation of PrON into nucleic acids As mentioned previously, PrON can be incorporated into oligonucleotides of the 25 present disclosure using standard phosphoramidite chemistry and conventional nucleic acid synthesis methods. A nucleic acid may incorporate as many PrON as there are nucleotides in the molecule. In one aspect, an oligonucleotide incorporates 1-5 PrON, inclusive, or 1 PrON, or 2 PrONs, or 3 PrONs, or 4 PrONs, or 5 PrONs. The PrONs may be consecutive, that is 30 in adjacent positions and bonded to one another, or they may be spaced out throughout the length of the oligonucleotide. The PrON may be at the 5’ end of an oligonucleotide, or at the 3’ end of the oligonucleotide, or at any internal position. In one example, for an 31086_WO -99- RNAi agent which is a duplex RNA including a sense strand and an antisense strand, the PrON may be at the 3’ end of the antisense strand, such as in an overhang (that is, not within a duplex region of the dsRNA molecule). When a PrON is incorporated into an oligonucleotide, it may be incorporated with 5 a random stereochemistry (that is, R or S) by using a racemic mixture of precursor compounds such as phosphoramidites, or it may done in with specific stereochemistry, such as by using the enantiopure phosphoramidite having the S internucleotide linkage of Preparation 12 above, or the R internucleotide linkage of Preparation 13. In some instances, multiple PrONs may be included in a single oligonucleotide, such as two 10 consecutive positions at the 3’ end of an oligonucleotide which may serve as an antisense strand of a double-stranded RNAi agent. In these cases, the nucleobase may be any nucleobase listed herein, such as, for example, uracil. In some embodiments, the oligonucleotide in which PrON is incorporated may have a 5’ phosphate, or a 5’ hydroxyl, or a 5’ vinyl phosphate group. 15 The sequences listed in tables 4A, and 4B may be modified to incorporate PrON at any position. In specific embodiments, the antisense sequences in these tables may be modified in order to incorporate one or more PrON. In a specific embodiment, the 23- nucleotide antisense strands listed in these tables) may have their two 3’ nucleotides substituted for PrON with the same or different nucleobases. For instance, in SEQ ID 20 NO: 6 of Table 2A, the guanine and uracil at the 3’ end can each be substituted by PrON bearing uracil as a nucleobase at positions 22 and 23. The PrON can have any stereochemical configuration, such as: R-PrON at position 22 and R-PrON at position 23; or R-PrON at position 22 and S-PrON at position 23; or 25 S-PrON at position 22 and R-PrON at position 23; or S-PrON at position 22 and S-PrON at position 23. The skilled artisan will readily appreciate that other modifications can be made along with incorporation of PrON in such molecules. 30 Homo sapiens HMGCR Cell Death Receptor (HMGCR) transcript, E ID 1 31086_WO -100- ccttccgctc cgcgactgcg ttaactggag ccaggctgag cgtcggcgcc ggggttcggt ggcctctagt gagatctgga ggatccaagg attctgtagc tacaatgttg tcaagacttt ttcgaatgca tggcctcttt gtggcctccc atccctggga agtcatagtg gggacagtga cactgaccat ctgcatgatg tccatgaaca tgtttactgg taacaataag atctgtggtt 5 ggaattatga atgtccaaag tttgaagagg atgttttgag cagtgacatt ataattctga caataacacg atgcatagcc atcctgtata tttacttcca gttccagaat ttacgtcaac ttggatcaaa atatattttg ggtattgctg gccttttcac aattttctca agttttgtat tcagtacagt tgtcattcac ttcttagaca aagaattgac aggcttgaat gaagctttgc cctttttcct acttttgatt gacctttcca gagcaagcac attagcaaag tttgccctca 10 gttccaactc acaggatgaa gtaagggaaa atattgctcg tggaatggca attttaggtc ctacgtttac cctcgatgct cttgttgaat gtcttgtgat tggagttggt accatgtcag gggtacgtca gcttgaaatt atgtgctgct ttggctgcat gtcagttctt gccaactact tcgtgttcat gactttcttc ccagcttgtg tgtccttggt attagagctt tctcgggaaa gccgcgaggg tcgtccaatt tggcagctca gccattttgc ccgagtttta gaagaagaag 15 aaaataagcc gaatcctgta actcagaggg tcaagatgat tatgtctcta ggcttggttc ttgttcatgc tcacagtcgc tggatagctg atccttctcc tcaaaacagt acagcagata cttctaaggt ttcattagga ctggatgaaa atgtgtccaa gagaattgaa ccaagtgttt ccctctggca gttttatctc tctaaaatga tcagcatgga tattgaacaa gttattaccc taagtttagc tctccttctg gctgtcaagt acatcttctt tgaacaaaca gagacagaat 20ctacactctc attaaaaaac cctatcacat ctcctgtagt gacacaaaag aaagtcccagacaattgttg tagacgtgaa cctatgctgg tcagaaataa ccagaaatgt gattcagtag aggaagagac agggataaac cgagaaagaa aagttgaggt tataaaaccc ttagtggctg aaacagatac cccaaacaga gctacatttg tggttggtaa ctcctcctta ctcgatactt catcagtact ggtgacacag gaacctgaaa ttgaacttcc cagggaacct cggcctaatg 25aagaatgtct acagatactt gggaatgcag agaaaggtgc aaaattcctt agtgatgctgagatcatcca gttagtcaat gctaagcata tcccagccta caagttggaa actctgatgg aaactcatga gcgtggtgta tctattcgcc gacagttact ttccaagaag ctttcagaac cttcttctct ccagtaccta ccttacaggg attataatta ctccttggtg atgggagctt gttgtgagaa tgttattgga tatatgccca tccctgttgg agtggcagga cccctttgct 30 tagatgaaaa agaatttcag gttccaatgg caacaacaga aggttgtctt gtggccagca ccaatagagg ctgcagagca ataggtcttg gtggaggtgc cagcagccga gtccttgcag atgggatgac tcgtggccca gttgtgcgtc ttccacgtgc ttgtgactct gcagaagtga aagcctggct cgaaacatct gaagggttcg cagtgataaa ggaggcattt gacagcacta gcagatttgc acgtctacag aaacttcata caagtatagc tggacgcaac ctttatatcc 35 gtttccagtc caggtcaggg gatgccatgg ggatgaacat gatttcaaag ggtacagaga aagcactttc aaaacttcac gagtatttcc ctgaaatgca gattctagcc gttagtggta actattgtac tgacaagaaa cctgctgcta taaattggat agagggaaga ggaaaatctg ttgtttgtga agctgtcatt ccagccaagg ttgtcagaga agtattaaag actaccacag aggctatgat tgaggtcaac attaacaaga atttagtggg ctctgccatg gctgggagca 31086_WO -101- taggaggcta caacgcccat gcagcaaaca ttgtcaccgc catctacatt gcctgtggac aggatgcagc acagaatgtt ggtagttcaa actgtattac tttaatggaa gcaagtggtc ccacaaatga agatttatat atcagctgca ccatgccatc tatagagata ggaacggtgg gtggtgggac caacctacta cctcagcaag cctgtttgca gatgctaggt gttcaaggag 5 catgcaaaga taatcctggg gaaaatgccc ggcagcttgc ccgaattgtg tgtgggaccg taatggctgg ggaattgtca cttatggcag cattggcagc aggacatctt gtcaaaagtc acatgattca caacaggtcg aagatcaatt tacaagacct ccaaggagct tgcaccaaga agacagcctg aatagcccga cagttctgaa ctggaacatg ggcattgggt tctaaaggac taacataaaa tctgtgaatt aaaaaagctc aatgcattgt cttgtggagg atgaatagat 10 gtgatcactg agacagccac ttggtttttg gctctttcag agaggtctca ggttctttcc atgcagactc ctcagatctg aacacagttt agtgctttac atgctgtgct ctttgaagag atttcaacaa gaatattgta tgttaaagca tcagagatgg taatctacag ctcacctctg aaggcaaata taagctggga aaaaagtttt gatgaaattc ttgaagttca tggtgatcag tgcaattgac cttctccctc actcctgcca gttgaaaatg gatttttaaa ttatactgta 15 gctgatgaaa ctcctgattt tgtagttaat ttattaagtc tgggatgtag aacttcaaga agtaagagct aagttctaag ttcatgtttg taaattaata cttcatttgg tgctggtcta ttttgatttt ggggggtaat cagcattatt cttcagaagg ggacctgttt tcttcaaggg aagaaacact cttattccca aactacagaa taatgtgtta aacatgctaa atagttctat caggaaaaca aatcactgta tttatctccg caggctattt gttcagagag gccttttgtt 20taaatataaa tgtttaaata taaatgtttg tctggattgg ctataacatg tctttcagcattaggctttt aagaaacaca gggttttgta ttctttacta aagatatcag agctcttaat gttgcttaga tgagggtgac tgtcaagtac aagcaagact gggaccttag aaatcattgt agaaacacag ttttgaaaga aaaataccat gtctctaagc caactttaat tgcttaaaag acatttttat ttagttgaaa aatctagttt tttttgtaaa ctgtatcaaa tctgtatatg 25ttgtaataaa acttatgcta gtttattgga agtgttcaag aaataaaaat caacttgtgtactgataaaa tactctagcc tgggccagag aagataatgt tctttaatgt tgtccaggaa accctggctt gcttgccgag cctaatgaaa gggaaagtca gctttcagag ccagtgaagg agccacgtga atggccctag aactgtgcct agttcctgtg gccaggaggt tggtgactga aacattcaca cagggctctt tgatggaccc acgaacgctc ttagctttct cagggggtca 30 gcagagttat tgaatcttaa ttttttttaa tgtacaagtt ttgtataaat aataaagaac tccttatttt gtattacatc taatgcttca agtgttgctc ttggaaagct gatgatgtct cttgtagaag atggactctg aaaaacattc caggaaacca tggcagcatg gagagcctct tagtgattgt gtctgcattg ttattgtgga agatttacct tttctgttgt acgtaaagct taaattgctt ttgttgtgac tttttagcca gtgacttttt ctgagctttt catggaagtg 35 gcagtgaaaa atatgttgag tgttcatttt agtgactgta attaatatct tgctggatta atgttttgta caattactaa attgtataca ttttgttata gaatactttt ttctagtttc agtaaataat gaaaaggaag ttaataccaa 31086_WO -102- Exemplary antisense strand sequences of 18 nucleotides in length are shown in Table 2 below, which may be optionally further modified and synthesized and incorporated into the RNAi agents, as described herein. 5 Table 2. Antisense 18 mers of HMGCR RNAi agents SEQ ID: Antisense 18 Mer 2 AGUCUUGACAACAUUGUA 31086_WO -103- 28 CAUAAUCAUCUUGACCCU 29 AGACAUAAUCAUCUUGAC 31086_WO -104- 60 AUUAAAGUAAUACAGUUU 61 UCCAUUAAAGUAAUACAG 31086_WO -105- 92 AGCCAGGGUUUCCUGGAC 93 GCAAGCCAGGGUUUCCUG 31086_WO -106- 124 CUUACUUCAUCCUGUGAG 125 GCAAUAUUUUCCCUUACU 31086_WO -107- 156 GCUUUCCCGAGAAAGCUC 157 CGGCUUUCCCGAGAAAGC 31086_WO -108- 188 UACUUGACAGCCAGAAGG 189 GUGUAGAUUCUGUCUCUG 31086_WO -109- 220 AUGAGUUUCCAUCAGAGU 221 CACGCUCAUGAGUUUCCA 31086_WO -110- 252 AUCCCAUCUGCAAGGACU 253 ACGAGUCAUCCCAUCUGC 31086_WO -111- 284 GAUAUAAAGGUUGCGUCC 285 GGAUAUAAAGGUUGCGUC 31086_WO -112- 316 AUGUUUGCUGCAUGGGCG 317 GACAAUGUUUGCUGCAUG 31086_WO -113- 348 GGAUUAUCUUUGCAUGCU 349 UUCGGGCAAGCUGCCGGG 31086_WO -114- 380 AAAUAAGGAGUUCUUUAU 381 AAAAUAAGGAGUUCUUUA

[0013] 31086_WO -115- Table 3. Exemplary full-length sense and antisense strands of HMGCR RNAi agents Start Position on R 3 31086_WO -116- 22 409 UCCAAUUUGGCAGCUCAGCCA 795 UGGCUGAGCUGCCAAAUUGGACG 794 31086_WO -117- 48 435 UGCUUGUGACUCUGCAGAAGA 821 UCUUCUGCAGAGUCACAAGCACG 1898 31086_WO -118- 74 461 AGAUGCUAGGUGUUCAAGGAA 847 UUCCUUGAACACCUAGCAUCUGC 2560 31086_WO -119- 100 487 AAUGUUGUCAAGACUUUUUCA 873 UGAAAAAGUCUUGACAACAUUGU 104 31086_WO -120- 126 513 GUAAGGGAAAAUAUUGCUCGA 899 UCGAGCAAUAUUUUCCCUUACUU 561 31086_WO -121- 152 539 AACUACUUCGUGUUCAUGACA 925 UGUCAUGAACACGAAGUAGUUGG 714 31086_WO -122- 178 565 GCUCACAGUCGCUGGAUAGCA 951 UGCUAUCCAGCGACUGUGAGCAU 909 31086_WO -123- 204 591 UGCAAAAUUCCUUAGUGAUGA 977 UCAUCACUAAGGAAUUUUGCACC 1478 31086_WO -124- 230 617 GAUUAUAAUUACUCCUUGGUA 1003 UACCAAGGAGUAAUUAUAAUCCC 1650 31086_WO -125- 256 643 AGAUGGGAUGACUCGUGGCCA 1029 UGGCCACGAGUCAUCCCAUCUGC 1859 31086_WO -126- 282 669 AUUUGCACGUCUACAGAAACA 1055 UGUUUCUGUAGACGUGCAAAUCU 1985 31086_WO -127- 308 695 AUAGGAGGCUACAACGCCCAA 1081 UUGGGCGUUGUAGCCUCCUAUGC 2340 31086_WO -128- 334 721 GCACCAUGCCAUCUAUAGAGA 1107 UCUCUAUAGAUGGCAUGGUGCAG 2488 31086_WO -129- 360 747 UAAGUCUGGGAUGUAGAACUA 1133 UAGUUCUACAUCCCAGACUUAAU 3215 31086_WO -130- 386 773 UUAAUGUUUUGUACAAUUACA 1159 UGUAAUUGUACAAAACAUUAAUC 4438

[0014] 31086_WO -131- Table 4A. HMGCR-GalNAc RNAi agents, modified sense and antisense strands Duplex NO: SEQ ID NO: Modified Sequence 11 * * A A A f f f A A A * * A 31086_WO -132- 1200 mC*mG*mUmCmCmAmAmUfUfUfGmGmCmAmGmCmUmCmA*mG*mA 407 1201 PmU*fC*mUmGfAmGfCmUmGmCmCmAmAfAmUfUmGmGmAmCmG*mA*mC * * * * 31086_WO -133- 1244 mC*mU*mUmGmCmAmGmAfUfGfGmGmAmUmGmAmCmUmC*mG*mA 429 1245 PmU*fC*mGmAfGmUfCmAmUmCmCmCmAfUmCfUmGmCmAmAmG*mG*mA * * * * 31086_WO -134- 1288 mU*mA*mUmAmUmAmUmCfAfGfCmUmGmCmAmCmCmAmU*mG*mA 451 1289 PmU*fC*mAmUfGmGfUmGmCmAmGmCmUfGmAfUmAmUmAmUmA*mA*mA * * * * 31086_WO -135- 1332 mU*mU*mAmCmUmAmAmAfGfAfUmAmUmCmAmGmAmGmC*mU*mA 473 1333 PmU*fA*mGmCfUmCfUmGmAmUmAmUmCfUmUfUmAmGmUmAmA*mA*mG * * * * 31086_WO -136- 1376 mU*mA*mUmAmUmUmUmAfCfUfUmCmCmAmGmUmUmCmC*mA*mA 495 1377 PmU*fU*mGmGfAmAfCmUmGmGmAmAmGfUmAfAmAmUmAmUmA*mC*mA * * * * 31086_WO -137- 1420 mA*mA*mAmUmAmUmUmGfCfUfCmGmUmGmGmAmAmUmG*mG*mA 517 1421 PmU*fC*mCmAfUmUfCmCmAmCmGmAmGfCmAfAmUmAmUmUmU*mU*mC * * * * 31086_WO -138- 1464 mA*mU*mUmAmGmAmGmCfUfUfUmCmUmCmGmGmGmAmA*mA*mA 539 1465 PmU*fU*mUmUfCmCfCmGmAmGmAmAmAfGmCfUmCmUmAmAmU*mA*mC * * * * 31086_WO -139- 1508 mU*mG*mAmUmUmAmUmGfUfCfUmCmUmAmGmGmCmUmU*mG*mA 561 1509 PmU*fC*mAmAfGmCfCmUmAmGmAmGmAfCmAfUmAmAmUmCmA*mU*mC * * * * 31086_WO -140- 1552 mA*mG*mAmGmAmAmAmGfGfUfGmCmAmAmAmAmUmUmC*mC*mA 583 1553 PmU*fG*mGmAfAmUfUmUmUmGmCmAmCfCmUfUmUmCmUmCmU*mG*mC * * * * 31086_WO -141- 1596 mA*mA*mAmCmUmCmUmGfAfUfGmGmAmAmAmCmUmCmA*mU*mA 605 1597 PmU*fA*mUmGfAmGfUmUmUmCmCmAmUfCmAfGmAmGmUmUmU*mC*mC * * * * 31086_WO -142- 1640 mU*mG*mUmCmUmUmGmUfGfGfCmCmAmGmCmAmCmCmA*mA*mA 627 1641 PmU*fU*mUmGfGmUfGmCmUmGmGmCmCfAmCfAmAmGmAmCmA*mA*mC * * * * 31086_WO -143- 1684 mG*mC*mCmCmAmGmUmUfGfUfGmCmGmUmCmUmUmCmC*mA*mA 649 1685 PmU*fU*mGmGfAmAfGmAmCmGmCmAmCfAmAfCmUmGmGmGmC*mC*mA * * * * 31086_WO -144- 1728 mG*mG*mAmCmGmCmAmAfCfCfUmUmUmAmUmAmUmCmC*mG*mA 671 1729 PmU*fC*mGmGfAmUfAmUmAmAmAmGmGfUmUfGmCmGmUmCmC*mA*mG * * * * 31086_WO -145- 1772 mC*mA*mUmAmGmGmAmGfGfCfUmAmCmAmAmCmGmCmC*mC*mA 693 1773 PmU*fG*mGmGfCmGfUmUmGmUmAmGmCfCmUfCmCmUmAmUmG*mC*mU * * * * 31086_WO -146- 1816 mC*mA*mGmCmUmGmCmAfCfCfAmUmGmCmCmAmUmCmU*mA*mA 715 1817 PmU*fU*mAmGfAmUfGmGmCmAmUmGmGfUmGfCmAmGmCmUmG*mA*mU * * * * 31086_WO -147- 1860 mC*mA*mGmCmUmUmGmCfCfCfGmAmAmUmUmGmUmGmU*mG*mA 737 1861 PmU*fC*mAmCfAmCfAmAmUmUmCmGmGfGmCfAmAmGmCmUmG*mC*mC * * * * 31086_WO -148- 1904 mG*mA*mGmUmUmAmUmUfGfAfAmUmCmUmUmAmAmUmU*mU*mA 759 1905 PmU*fA*mAmAfUmUfAmAmGmAmUmUmCfAmAfUmAmAmCmUmC*mU*mG * * * * 31086_WO -149- 2320 (iAb)*mC*mUmGmUmAmUmUmAfCfUfUmUmAmAmUmGmGmAmA*mG*mA 1169 2323 PmU*fC*mUmUfCmCfAmUmUmAmAmAmGfUmAfAmUmAmCmAmG*sPrON*rPrON * * * * m indicates 2’O-methyl modified ribose on the listed nucleotide f indicates 2’F modified ribose on the listed nucleotide * indicates a phosphorothioate bond (in place of a phosphodiester bond) 5 Table 4B. HMGCR-GalNAc RNAi agents, modified sense and antisense strands Duplex 31086_WO -150- 1934 mU*fA*mAmCfAmUfGmUmUmCmAmUmGfGmAfCmAmUmCmAmU*mG*mC 1166 mA*mU*mAmUmUmUmAmCfUfUfCmCmAmGmUmUmCmCmA*mG*mA 776 31086_WO -151- 1954 mU*fA*mAmUfGmGfCmUmGmAmGmCmUfGmCfCmAmAmAmUmU*mG*mG 1206 mU*mU*mGmGmCmAmGmCfUfCfAmGmCmCmAmUmUmUmU*mG*mA 796 31086_WO -152- 1974 mU*fC*mGmAfGmUfCmAmUmCmCmCmAfUmCfUmGmCmAmAmG*mG*mA 1246 mU*mG*mCmGmUmCmUmUfCfCfAmCmGmUmGmCmUmUmG*mU*mA 816 31086_WO -153- 1994 mU*fG*mCmUfUmCfCmAmUmUmAmAmAfGmUfAmAmUmAmCmA*mG*mU 1286 mU*mU*mAmUmAmUmAmUfCfAfGmCmUmGmCmAmCmCmA*mU*mA 836 31086_WO -154- 2014 mU*fA*mAmGfAmUfGmUmCmCmUmGmCfUmGfCmCmAmAmUmG*mC*mU 1326 mA*mU*mUmGmGmCmAmGfCfAfGmGmAmCmAmUmCmUmU*mG*mA 856 31086_WO -155- 2034 mU*fU*mGmUfUmCfAmUmGmGmAmCmAfUmCfAmUmGmCmAmG*mA*mU 1366 mU*mA*mAmGmAmUmCmUfGfUfGmGmUmUmGmGmAmAmU*mU*mA 876 31086_WO -156- 2054 mU*fC*mUmUfAmCfUmUmCmAmUmCmCfUmGfUmGmAmGmUmU*mG*mG 1406 mG*mA*mAmGmUmAmAmGfGfGfAmAmAmAmUmAmUmUmG*mC*mA 896 31086_WO -157- 2074 mU*fA*mCmAfUmGfGmUmAmCmCmAmAfCmUfCmCmAmAmUmC*mA*mC 1446 mA*mU*mUmGmGmAmGmUfUfGfGmUmAmCmCmAmUmGmU*mC*mA 916 31086_WO -158- 2094 mU*fA*mAmUfUmGfGmAmCmGmAmCmCfCmUfCmGmCmGmGmC*mU*mU 1486 mC*mC*mGmCmGmAmGmGfGfUfCmGmUmCmCmAmAmUmU*mU*mA 936 31086_WO -159- 2114 mU*fC*mAmGfAmGfGmGmAmAmAmCmAfCmUfUmGmGmUmUmC*mA*mA 1526 mA*mA*mAmUmGmAmUmCfAfGfCmAmUmGmGmAmUmAmU*mU*mA 956 31086_WO -160- 2134 mU*fC*mAmCfUmAfAmGmGmAmAmUmUfUmUfGmCmAmCmCmU*mU*mU 1566 mU*mG*mCmAmAmAmAmUfUfCfCmUmUmAmGmUmGmAmU*mG*mA 976 31086_WO -161- 2154 mU*fC*mAmCfCmAfCmGmCmUmCmAmUfGmAfGmUmUmUmCmC*mA*mU 1606 mG*mA*mAmAmCmUmCmAfUfGfAmGmCmGmUmGmGmUmG*mU*mA 996 31086_WO -162- 2174 mU*fC*mUmGfGmCfAmCmCmUmCmCmAfCmCfAmAmGmAmCmC*mU*mA 1646 mG*mU*mGmGmAmGmGmUfGfCfCmAmGmCmAmGmCmCmG*mA*mA 1016 31086_WO -163- 2194 mU*fU*mGmGfAmAfGmAmCmGmCmAmCfAmAfCmUmGmGmGmC*mC*mA 1686 mC*mC*mCmAmGmUmUmGfUfGfCmGmUmCmUmUmCmCmA*mC*mA 1036 31086_WO -164- 2214 mU*fG*mAmUfAmUfAmAmAmGmGmUmUfGmCfGmUmCmCmAmG*mC*mU 1726 mU*mG*mGmAmCmGmCmAfAfCfCmUmUmUmAmUmAmUmC*mC*mA 1056 31086_WO -165- 2234 mU*fU*mUmGfUmAfGmCmCmUmCmCmUfAmUfGmCmUmCmCmC*mA*mG 1766 mG*mG*mAmGmCmAmUmAfGfGfAmGmGmCmUmAmCmAmA*mC*mA 1076 31086_WO -166- 2254 mU*fU*mUmGfCmUfUmCmCmAmUmUmAfAmAfGmUmAmAmUmA*mC*mA 1806 mU*mU*mAmCmUmUmUmAfAfUfGmGmAmAmGmCmAmAmG*mU*mA 1096 31086_WO -167- 2274 mU*fU*mAmUfCmUfUmUmGmCmAmUmGfCmUfCmCmUmUmGmA*mA*mC 1846 mC*mA*mAmGmGmAmGmCfAfUfGmCmAmAmAmGmAmUmA*mA*mA 1116 31086_WO -168- 2294 mU*fU*mAmUfUmUfCmUmUmGmAmAmCfAmCfUmUmCmCmAmA*mU*mA 1886 mU*mG*mGmAmAmGmUmGfUfUfCmAmAmGmAmAmAmUmA*mA*mA 1136 31086_WO -169- 2314 mU*fC*mCmAfCmUfUmCmCmAmUmGmAfAmAfAmGmCmUmCmA*mG*mA 1926 mA*mG*mCmUmUmUmUmCfAfUfGmGmAmAmGmUmGmGmC*mA*mA 1156 31086_WO -170- 2351 mU*fA*mGmUfAmAfUmAmCmAmGmUmUfUmGfAmAmCmUmAmC*rPrON*sPrON 1270 mG*mU*mAmGmUmUmCmAfAfAfCmUmGmUmAmUmUmAmC*mU*mA 1200 31086_WO -171- 2371 mU*fC*mUmUmCmC(ssbdA)mUmUmAmAmAmGfUmAfAmUmAmCmAmG*mU*mU 1220 1282 mC*mU*mGmUmAmUmUmAfCfUfUmUmAmAmUmGmGmAmA*mG*mA f indicates 2’F modified ribose on the listed nucleotide * indicates a phosphorothioate bond (in place of a phosphodiester bond) 5 “rsbd” indicates R,S-butadiol “ssbd” indicates S,S-butadiol. Example 4: In vitro knockdown of human HMGCR in Hep3B cells with cholesterol-conjugated 10 HMGCR siRNA Knockdown of human HMGCR expression by the cholesterol-conjugated HMGCR siRNA was assayed using the following procedure: On day 1, Hep3B cells (ATCC) were added to Corning 96-well plates at 5,000 cells per well in growth media, on 15 day 2, the culture media was replaced with ACCELL Media (Dharmacon) and siRNA were added directly to the well. For single point (SP) screening, 1µM (1,000 nM) of cholesterol-conjugated siRNA was used. To generate concentration / dose response curves final concentrations of 1000, 200, 40, 8, 1.6, 0.32, and 0.064 nM of cholesterol- conjugated siRNA concentration was used. 20 Treated cells were lysed and followed with gene expression by using the TaqManTMFast Advanced Cells-to-Ct Kit (Invitrogen). The cell lysates were used immediately for cDNA synthesis using Fast Advanced RT Master Mix (Invitrogen) and using the following steps in a thermocycler: 37 °C for 30 minutes, 95 °C for 5 minutes, and 4 °C hold. Quantitative Polymerase Chain Reaction (qPCR) was performed via TaqManTMGene Expression 25 Assay (Invitrogen) using the following cycles temperatures and times: 50 °C for 2 minutes, 95 °C for 20 seconds, 40 cycles of 95 °C for 1 seconds and 60 °C for 20 seconds. 31086_WO -172- The human HMGCR levels were normalized to human Rplp0 (Life Technologies) and represent the relative knockdown of human HMGCR mRNA expression as compared to vehicle-treated control cells. IC50 values were calculated using a 4-parameter fit model using XLFit®. 5

[0015] 31086_WO -173- Table 5. Percent Inhibition of human HMGCR expression in Hep3B cells In vitro knockdown of hHMGCR In vitro knockdown of hHMGCR in Hep3B cells in Hep3B cells 31086_WO -174- 415 9.14 416 13.65 31086_WO -175- 448 52.15 939.10 61.38 449 4.08 31086_WO -176- 481 5.65 482 0.43 31086_WO -177- 514 21.16 515 1.21 31086_WO -178- 547 5.49 548 8.41 31086_WO -179- 580 9.70 581 13.88 31086_WO -180- 613 20.99 614 19.61 31086_WO -181- 646 2.61 647 6.41 31086_WO -182- 679 42.03 680 16.55 31086_WO -183- 712 29.77 713 15.73 31086_WO -184- 745 57.11 380.40 64.50 746 34.00 Table 5: shows the result of a single dose screen in Hep3B cells by free uptake with the indicated cholesterol conjugated HMGCR siRNA. Data are expressed as percent of message knockdown relative to untreated cells. The IC50 and percent maximum 31086_WO -185- knockdown of top hits from single point screening followed by concentration / dose response curves are included as well.

[0016] 31086_WO -186- EXAMPLE 5: In vitro knockdown of HMGCR in wildtype mouse primary hepatocytes (MPH) and Hep3B cells with GalNAc-conjugated HMGCR siRNA 5 Knockdown of mouse HMGCR expression by the GalNAc-conjugated HMGCR siRNA was assayed using the following procedure: mouse primary hepatocytes (MPH) were freshly isolated from a wildtype mouse, added to Corning® plates at 15,000 per well, and siRNA were added directly to the well. For Hep3B (ATCC) cells, transfection reagent RNAiMAX (Life Technologies) at 0.3 µL / well was mixed with siRNA in 10 Corning® plates before adding cells at 20,000 per well. To generate concentration / dose response curves final concentrations of 1000, 333, 111, 37, 12, 4, 1.37, 0.46, 0.15, 0.05, and 0.017 nM of GalNAc-conjugated siRNA concentration was used for MPH. For Hep3B, concentration / dose response curves final concentrations of 10, 3.33, 1.11, 0.37, 0.12, 0.04, 0.014, 0.005, 0.002, 0.0005, and 0.0002 nM of GalNAc-conjugated siRNA 15 concentration was used. Treated cells were lysed and RNA was isolated using the Quick-RNA 96 Kit (Zymo Research) directly into the 96 well plate. The eluted RNA was used immediately or stored frozen. cDNA was synthesized using Fast Advanced RT Master Mix (Invitrogen) and using the following steps in a thermocycler: 37 °C for 30 minutes, 95 °C 20 for 5 minutes, and 4 °C hold. Polymerase Chain Reaction (PCR) was performed via TaqManTMRT PCR (Life Technologies) using the following cycles temperatures and times: 50 °C for 2 minutes, 95 °C for 10 minutes, 40 cycles of 95 °C for 15 seconds and 60 °C for 1 minute. The mouse or human HMGCR levels were normalized to mouse (for MPH) or 25 human (for Hep3B) Rplp0 (Life Technologies) and represent the relative knockdown of mouse or human HMGCR mRNA expression as compared to vehicle-treated control cells. IC50 values are calculated using a 4-parameter fit model using XLFit®. 31086_WO -187- Table 6. In vitro knockdown of HMGCR in wildtype mouse primary hepatocytes (MPH) and Hep3B cells with GalNAc-conjugated HMGCR siRNA In vitro knockdown of In vitro knockdown of hHMGCR in mHmgcr in MPH Hep3B / RNAiMAX 31086_WO -188- 774 2.347 76.53 1121 30.5 62.42 op hits from and Hep3B cells by transfection reagent, RNAiMAX, with the indicated HMGCR siRNA. Data are expressed as percent of HMGCR message knockdown relative to untreated cells. 5 EXAMPLE 6 In vivo Single dose Screen mouse HMGCR KD GalNAc-siRNA were tested in male C57bl / 6 mice (n=7) (Taconic farms). Mice were 10 assigned to groups with similar body weight. Either PBS or GalNAc-siRNA test article, at a dose of 5mg / kg, was administered subcutaneously to mice. Seven days post subcutaneous injection, blood was collected from all mice. Fourteen days post subcutaneous injection mice were euthanized under isoflurane anesthesia. Blood was collected by cardiac puncture. Liver was collected from the mice and frozen in liquid 15 nitrogen. Livers were homogenized in TriZolTM(Invitrogen) using Lysing Matrix D bead tubes on a FastPrep-24 (MP Bio). Chloroform was added and the aqueous phase was mixed with ethanol to precipitate the RNA. RNA was isolated on columns using PureLinkTMPro96 Total RNA purification kit (Invitrogen) according to manufacturer’s protocol and quantified on a NanoDrop (Thermo Fisher). Equal amounts (1ug) of RNA 20 were reverse transcribed to cDNA using High-Capacity cDNA Reverse Transcription kit (Life Technologies) on MastercyclerTMNexus (Eppendorf). Thermocycler settings were 25°C for 10 min, 37°C for 2 hrs, then 85°C for 5 min. Template cDNA was combined with TaqmanTMUniversal Master Mix and Assays on Demand primer / probe sets and RT- PCR was performed on the QuantStudioTMPro7 (Thermo Fisher) with the following 25 parameters: 50°C for 2min, 95°C for 10min then 40 cycles of 95°C for 15 sec and 60°C 31086_WO -189- for 1 min. Fold changes (FC) were calculated as follows: the CT value of mouse Rplp0 was subtracted from CT value of mouse HMGCR to obtain the delta CT value. Then the delta delta CT value was calculated by subtracting the delta CT value of the untreated sample (average of PBS control) from the delta CT value of each test sample. Fold 5 change was calculated by taking the log base 2 of the negative delta delta CT value. mRNA percent Knockdown (KD) was calculated by subtracting the fold change from the fold change of the PBS group and then multiplying by 100. Data was shown in Table 7. Table 7. In vivo single dose Screen mouse HMGCR KD Duplex Dose 2-week % NO: mg / kg KD 31086_WO -190- 707 5 34.5 706 5 31.1 EXAMPLE 7 In vivo durability 8-week mouse HMGCR KD 5 GalNAc-siRNA were tested in male mice C57 / BL6 mice (n=9) (Taconic Farms). Body weight of mice was measured and mice were assigned to groups with similar body weight. PBS or test article GalNAc-siRNA, at doses of 0.3, 1.75 and 10 mg / kg were administered subcutaneously to mice. At 2 weeks post siRNA administration, 3 mice from each group were euthanized under isoflurane anesthesia, blood was collected. Liver 10 was collected from the mice and frozen in liquid nitrogen. Blood was collected from the remaining mice (n=6 / group) at 2, 4, and 6-weeks post siRNA administration under isoflurane anesthesia. At 8 weeks post siRNA administration, the remaining mice (n=6) were euthanized under isoflurane anesthesia. Blood and liver were collected from mice. Livers were processed and mRNA percent KD was calculated as described in the in vivo 15 single dose screen. Table 8. In vivo durability 8-week mouse HMGCR KD Duplex Dose 2-week % 8-week % 31086_WO -191- 734 0.3 18 0 734 1.75 1 38 EXAMPLE 8: In vivo with AAV8 Single dose Screen human HMGCR KD 5 GalNAc-siRNA were tested in male C57bl / 6 mice (n=7) (Taconic farms). The siRNAs were tested in a single study. Mice were dosed by retro-orbital injection with an adeno-associated virus (AAV) vector containing a plasmid with a TBGS1 promoter and the coding sequence and 3’UTR for human HMGCR (NM_000859.3) (Vector BioLabs). The body weight of mice was measured about 4 weeks post AAV administration. Mice 10 were assigned to groups with similar body weight. Either PBS or GalNAc-siRNA test article, at a dose of 5 mg / kg, was administered subcutaneously to mice. Seven days post subcutaneous injection, blood was collected from the retro-orbital sinus from all mice. Fourteen days post subcutaneous injection mice were euthanized under isoflurane anesthesia. Blood was collected by cardiac puncture. Liver was collected from the mice 15 and frozen in liquid nitrogen. Human HMGCR mRNA was quantified as described here. 31086_WO -192- All reagents mentioned in the following sections come from the QuantiGeneTMSingleplex assay kit made by Invitrogen. Approximately 10mg of liver was weighed into a 96 well cluster tube plate.300 µL of homogenizing buffer with proteinase k was added to each liver sample and homogenized on the Qiagen homogenizer for 12 minutes. The 5 plate was centrifuged at 3500 rpm for 10 minutes and then heated at 60 °C for 30 minutes, with a vortexing step every 10 minutes. Samples were centrifuged again at 3500 rpm for 10 minutes and then diluted or used neat in the following steps. The working probe set for each gene of interest was prepared in separate tubes by combining the following reagents, in the order listed and scaled according to the number of wells to be 10 run with required overage: nuclease-free water (25.4 µL), Lysis mixture (33.3 µL), Blocking Reagent (1 µL), QuantiGeneTMSingleplex Probe Set (0.3 µL) per 1 well. The capture plate was prepared by dispensing 60 µL of the working probe sets into each well of the plate. Probes sets for mGAPDH (SB-10001) and hHMGCR (SA-11011) were aliquoted into the plate separately and then 60 µL of neat liver homogenate was added to 15 the hHMGCR working set in the plate while 60 µL of the 20-fold dilution of RNA isolate was added to the mGAPDH probe set which was previously aliquoted into the capture plate. Introduction of bubbles was avoided, and the plate was not mixed. An adhesive seal was placed tightly on the plate and then it was incubated at 55±1 °C for 20.5 hours in order to hybridize the probes to the RNA targets. After 20.5 hours, 200 µL of 1X wash 20 buffer was added to the capture plate and then inverted to remove the wash. The plate was then washed two more times with 300 µL of wash buffer for each wash. Next, 100 µL of pre-amplifier solution was added to the plate. It was sealed and incubated at 55±1 °C for 60 minutes. After 1 hour, the wash procedure above was repeated and 100 µL of amplifier solution was added to the plate. It was sealed and incubated at 55±1 °C for 60 minutes. 25 After the 1-hour incubation, the wash steps were performed again and then 100 µL of label probe was added. It was sealed and incubated at 50±1 °C for 60 minutes. The wash steps were performed one additional time and then 100 µL of substrate was added at room temperature and incubated for 5 minutes while being protected from light. The plate was then read on a luminometer with the integration time set to 0.2 seconds. Gene knockdown 30 was calculated by first dividing hHMGCR chemiluminescent signal by mGAPDH signal. The fold change from the PBS (control) group was calculated by dividing all groups by the average signal of the control group. Then % hHMGCR gene knockdown was 31086_WO -193- calculated by subtracting the average control group fold change from all groups followed by dividing all of those group by the average signal from the control group. Table 9. In vivo with AAV8 single dose screen human HMGCR KD Duplex Dose 2 Week NO: mg / kg % KD 5 EXAMPLE 9: In vitro knockdown of mouse HMGCR in wild type mouse primary hepatocytes(MPH) with PrON modified GalNAc-conjugated HMGCR siRNA 10 Mouse primary hepatocytes (MPH) were freshly isolated from wildtype mouse and plated on collagen-I 96-well plates (Corning, Part #: 354649) at 15,000 cells per well and various concentration of GalNAc-conjugated HMGCR siRNA (that is, an RNAi agent conjugated with Formula V as shown above on the 5’ end of the sense strand) with chemical modification were added in 10 µL of 10X siRNA duplexes in Opti-MEM per 15 well. Dose response experiments were done at 1000, 333, 111, 37, 12, 4, 1.37, 0.46, 0.15, 0.05, and 0.017 nM final siRNA duplex concentration. Cells were incubated for 24-48 hours prior to RNA isolation. Treated cells were lysed directly into the 96 well cell plate and RNA was isolated using the Quick-RNA 96 Kit (Zymo Research, Part #: R1052). The eluted RNA was used 20 immediately or stored frozen. cDNA was synthesized using Fast Advanced RT Master Mix (Invitrogen, Part #: A39110) and using the following steps in a thermocycler: 37oC 31086_WO -194- for 30 minutes, 95oC for 5 minutes, and 4oC hold. Polymerase Chain Reaction (PCR) was performed via TaqMan® RT PCR (Life Technologies, Part #: 4326708) using the following cycles temperatures and times: 50oC for 2 minutes, 95oC for 10 minutes, 40 cycles of 95oC for 15 seconds and 60oC for 1 minute. 5 The mouse HMGCR levels were normalized to mouse Rplp0 (Life Technologies) and represented the relative knockdown of mouse HMGCR mRNA expression as compared to vehicle-treated control cells. IC50 values were calculated using a 4-parameter fit model using XLFit®. Results are presented in Table 10 below. 10 Table 10. IC50 (nM) and Percent knockdown of mouse HMGCR expression in wildtype mouse primary hepatocytes (MPH) Duplex IC50 (nM)% maximum EXAMPLE 10 LC-MS quantification of PrON modified siRNA in liver tissue 15 31086_WO -195- To study the durability and the target exposure of RNAi agents containing PrON, approximately 100 mg frozen liver were homogenized in lysis buffer (Thermo Scientific) at 100 mg / mL tissue concentration in a Geno / Grinder®. Pooled blank liver homogenates were spiked with standards to generate calibration standards. The standard curve range in 5 liver was 4.48–50,000 ng / g. All the lysed liver samples were loaded onto equilibrated WAX SPE 96-well plate cartridges (WatersTM). The SPE cartridges were washed two- times with 0.2 mL of 50 mM ammonium acetate in 50:50 (v / v) water / Acetonitrile (pH 5.5). Samples were eluted with 0.075 mL of 50:50 (v / v) 0.1 M ammonium bicarbonate / Acetonitrile (pH = 9.5). The eluents were dried under nitrogen for 1–2 h at 10 40°C. The dried samples were resuspended in 200 μL of 10:90 (v:v) dimethylsulfoxide:water. A volume of 20 μL was subjected to LC-HRMS (Liquid chromatography-High resolution mass spectrometry) for qualification analysis. The LC– MS mobile phases used were as follows: Mobile Phase A: 15mM TEA (Triethanolamine), 100mM HFIP (1,1,1,3,3,3-Hexafluoroisopropanol) in water; Mobile 15 Phase B: 15mM TEA, 100mM HFIP in methanol. The typical gradient started with 5% mobile phase B, progressed to 40% B over 4 min and increased to 98% B in 0.25 min. The column was washed with mobile phase B for 0.5 min. The column was re- equilibrated with 5% B for 1.0 min. The flow rate was 0.25 mL / min; column temperature was 80°C. The Exploris™ mass spectrometer was set at full scan monitoring mode and 20 negative ionization mode. dsRNA NO: 448, which does not include PrON, was tested alongside dsRNA NO: 1161, which is the same sequence except the nucleotides in the 3’ overhang are replaced by PrONs. Results are shown in Tables 11 and 12 below. Table 11 shows that no degradation products of the PrON-containing dsRNA are detected even at 8 weeks, whereas 25 measurable degradation products of the no-PrON oligonucleotides are seen. Table 12 shows that 8-week exposure values for PrON-containing nucleotides exceed even 2-week exposure values for the no-PrON control sequence. Table 11. % of AS N-1 to total products detected D l x 31086_WO -196- 1162 Non detected Non detected Duplex NO: 2w 8w 5 HMGCR siRNA in vivo methods Mouse two-week experiment GalNAc-siRNAs were tested in male C57bl / 6 mice (Taconic farms). Body weight of mice were measured within one week prior to dosing test article or vehicle. Mice were 10 assigned to groups with similar body weights. Either PBS or GalNAc-siRNA test article, at a dose such as 5mg / kg, was administered subcutaneously to mice. Seven days post subcutaneous injection, blood was collected from all mice. Fourteen days post subcutaneous injection mice were euthanized under isoflurane anesthesia, and blood was collected. Liver was collected from the mice and frozen in liquid nitrogen. Livers were15 homogenized in TriZolTM(Invitrogen) using Lysing Matrix D bead tubes on a FastPrep- 24TM(MP Bio). Chloroform was added and the aqueous phase was mixed with ethanol to precipitate the RNA. RNA was isolated on column using PureLinkTMPro96 Total RNA purification kit (Invitrogen) according to manufacturer’s protocol and quantified on a NanoDropTM(ThermoFisher). Equal amounts (1ug) of RNA were reverse transcribed to 20 cDNA using High-Capacity cDNA Reverse Transcription kit (Life Technologies) on Mastercycler® Nexus (Eppendorf). Thermocycler settings are 25°C for 10 min, 37°C for 2 hrs, then 85°C for 5 min. Template cDNA was combined with TaqmanTMUniversal Master Mix and Assays on Demand primer / probesets and RT-PCR was performed on the QuantStudioTMPro7 (ThermoFisher) with the following parameters: 50°C for 2min, 95°C 25 for 10min then 40 cycles of 95°C for 15sec and 60°C for 1min. Fold changes (FC) were 31086_WO -197- calculated as follows: the CT value of mouse Rplp0 was subtracted from CT value of mouse HMGCR to obtain the delta CT value. Then the delta delta CT value wascalculated by subtracting the delta CT value of the untreated sample (average of PBS control) from the delta CT value of each test sample. Fold change was calculated by 5 taking the log base 2 of the negative delta CT value. Percent mRNA remaining was calculated multiplying the fold change by 100. Data is shown in Table 13. Mouse eight-week experiment GalNAc-siRNAs were tested in male C57bl / 6 mice (Taconic farms). Mice were weighed within approximately one week prior to dosing test article or vehicle. Body 10 weights of mice were measured and mice were assigned to groups with similar body weight. At the beginning of study (Day 0) either PBS or test article GalNac-siRNA, at doses such as 1.75 or 10mg / kg were administered subcutaneously to mice. At 2 weeks post siRNA administration, three or four mice from each group were euthanized under isoflurane anesthesia, blood was collected, and serum was stored at -80°C for future 15 analysis. Liver was collected from the mice and frozen in liquid nitrogen. Blood was collected from the remaining mice (n=6 / group) at 2, 4, and 6 weeks post siRNA administration under isoflurane anesthesia. Serum was prepared from blood and stored at -80°C for potential future analysis. At 8 weeks post siRNA administration, the remaining mice were euthanized under isoflurane anesthesia. Blood and liver were collected from 20 mice. Livers were homogenized in TriZolTM(Invitrogen) using Lysing Matrix D bead tubes on a FastPrep-24TM(MP Bio). Chloroform was added and the aqueous phase was mixed with ethanol to precipitate the RNA. RNA was isolated on column using PureLinkTMPro96 Total RNA purification kit (Invitrogen) according to manufacturer’s protocol and quantified on a NanoDropTM(ThermoFisher). Equal amounts (1ug) of RNA 25 were reverse transcribed to cDNA using High-Capacity cDNA Reverse Transcription kit (Life Technologies) on Mastercycler® Nexus (Eppendorf). Thermocycler settings are 25°C for 10 min, 37°C for 2 hrs, then 85°C for 5 min. Template cDNA was combined with TaqmanTMUniversal Master Mix and Assays on Demand primer / probesets and RT- PCR was performed on the QuantStudioTMPro7 (ThermoFisher) with the following 30 parameters: 50°C for 2min, 95°C for 10min then 40 cycles of 95°C for 15sec and 60°C for 1min. Fold changes (FC) were calculated as follows: the CT value of mouse Rplp0 was subtracted from CT value of mouse HMGCR to obtain the delta CT value. Then the 31086_WO -198- delta delta CT value was calculated by subtracting the delta CT value of the untreated sample (average of PBS control) from the delta CT value of each test sample. Fold change was calculated by taking the log base 2 of the negative delta delta CT value. Percent mRNA remaining was calculated multiplying the fold change by 100. Data is 5 shown in Table 13. Sterol Panel In a 2.0mL TrueTaper® SiliGuard plate was added 1mL of 50:50 dichloromethane:methanol.30 µL of serum or plasma was added to the wells.10µL of 10 internal standard mix was added at a concentration of 1 µg / mL. Then 20 µL of 10 mg / mL Butylated Hydroxytoluene solution was added to minimize oxidation. The plate was vortexed for several seconds and a heat sealing aluminum foil was added to the plate. The plate was placed in a sonication bath set to 35°C for 10 minutes. After sonication, the plate was centrifuged at 3300 RPM for 10 minutes at room temperature. The samples 15 were transferred to a new 2.0mL TrueTaper® SiliGuard plate without disrupting the white protein layer at the bottom of the plate.100uL of 10N KOH solution was added to the new plate and sealed with heat sealing aluminum foil. The plate was placed in the sonication bath, set to 35°C for 90 minutes.500uL of DPBS was added to each well and vortexed for several seconds. The plate was centrifuged and 300uL of the bottom 20 dichloromethane layer was removed to 96-well V-bottom plate with SiliGuard. The plate was dried under a stream of nitrogen.75uL of 90% methanol was added to all wells. The plate was vortexed on a mixer for 5 minutes at 900 RPM after heat sealing. Plates were run on a Agilent Infinity II autosampler coupled to a SCIEX 6500 Triple Quad system and all analytes were monitored using multiple reaction monitoring (MRM). 25 Table 13. Dose response 2 week 8 week 2 week 8 week Day 0 2 week 4 week 6 week 8 week 10 / k 10 / k 10 / k 10 / k 10 / k 10 / k 10 / k 10 / k 10 / kg rol 6 % % 31086_WO -199- 1164 -32.6 -59.9 127210 34799 5.15% -59.05% -56.52% -72.71% -27.28% 1163 -68.4 -48.2 108109 27044 8.32% -70.24% -70.01% -76.13% -45.15% In vitro knockdown of HMGCR in Hep3B cells with Butanediol-Modified HMGCR siRNA by Transfection 5 Knockdown of HMGCR expression by the butanediol-modified HMGCR siRNA was assayed using the following procedure: transfection reagent RNAiMAX (Life Technologies) at 0.3µl / well was mixed with siRNA in Corning plates before adding Hep3B (ATCC) cells at 20,000 per well. To generate concentration / dose response curves final concentrations of 10, 3.33, 1.11, 0.37, 0.12, 0.04, 0.014, 0.005, 0.002, 0.0005, and 10 0.0002 nM of butanediol-modified siRNA concentration was used. Treated cells were lysed and RNA was isolated using the Quick-RNA 96 Kit (Zymo Research) directly into the 96 well plate. The eluted RNA was used immediately or stored frozen. cDNA was synthesized using Fast Advanced RT Master Mix (Invitrogen) and using the following steps in a thermocycler: 37oC for 30 minutes, 95oC 15 for 5 minutes, and 4oC hold. Polymerase Chain Reaction (PCR) was performed via TaqMan RT PCR (Life Technologies) using the following cycles temperatures and times: 50oC for 2 minutes, 95oC for 10 minutes, 40 cycles of 95oC for 15 seconds and 60oC for 1 minute. The human HMGCR levels were normalized to human RPLP0 (Life 20 Technologies) and represent the relative knockdown of human HMGCR mRNA expression as compared to vehicle-treated control cells. IC50 values are calculated using a 4-parameter fit model using XLFit. The data demonstrate strong potency of butadiol-containing RNAi agents, particularly when the butadiol is incorporated at position 6 (counting from the 5’ end of the antisense 25 strand). Table 14: shows the result of IC50 with percent maximum knockdown in Hep3B cells by transfection reagent, RNAiMAX, with the indicated HMGCR siRNA. Data are expressed as percent of HMGCR message knockdown relative to untreated cells. 31086_WO -200- Table 14: HMGCR IC50 with percent maximum knockdown in Hep3B cells Delivery Attachment dsRNA No. Moiety Point IC50 / nM %KD 31086_WO -201- GalNAc 3’ Sense 1213 Strand 0.369 91.53 HMGCR siRNA in vivo methods in mice GalNAc-siRNAs were tested in male C57bl / 6 mice (Taconic farms) seven to ten 5 weeks of age. Mice were weighed within approximately one week prior to dosing test article or vehicle. Body weights of mice were measured and mice were assigned to groups with similar body weight. At the beginning of study (Day 0) either PBS or test article GalNac-siRNA, at doses such as 5mg / kg were administered subcutaneously to mice. Ten animals were included in each group. At 2 weeks post siRNA administration, 10 three mice from each group were euthanized under isoflurane anesthesia, liver was collected from the mice and frozen in liquid nitrogen. At 8 weeks post siRNA administration, the remaining seven mice were euthanized under isoflurane anesthesia. Liver was collected from mice. Livers were homogenized in TriZol 31086_WO -202- (Invitrogen) using Lysing Matrix D bead tubes using a FastPrep-24 (MP Bio).^ Chloroform was added and the aqueous phase was mixed with ethanol to precipitate the RNA.^ RNA was isolated on column using PureLink Pro96 Total RNA purification kit (Invitrogen) according to manufacturer’s protocol and quantified using a NanoDrop 5 (ThermoFisher).^ Equal amounts (1ug) of RNA were reverse transcribed to cDNA using High-Capacity cDNA Reverse Transcription kit (Life Technologies) using Mastercycler Nexus (Eppendorf). Thermocycler settings were 25°C for 10 minutes, 37°C for 2 hours, then 85°C for 5 minutes.^ Template cDNA was combined with Taqman Universal Master Mix and Assays on Demand primer / probesets and RT-PCR was performed using the 10 QuantStudio Pro7 (ThermoFisher) with the following parameters: 50°C for 2minutes, 95°C for 10minutes then 40 cycles of 95°C for 15 seconds and 60°C for 1 minute.^ Fold changes (FC) were calculated as follows: the CT value of mouse Rplp0 was subtracted from CT value of mouse HMGCR to obtain the delta CT value. Then the delta delta CT value was calculated by subtracting the delta CT value of the untreated sample (average 15 of PBS control) from the delta CT value of each test sample. Fold change was calculated by taking the log base 2 of the negative delta delta CT value. Percent mRNA remaining was calculated multiplying the fold change by 100. Data is shown in Table 15. The data demonstrate good knockdown in vivo by RNAi agents in which butadiol is incorporated at position 6 of the antisense strand. 20 Table 15: HMGCR 2 week, mRNA reduction at 5mg / kg dsRNA No Fold Change %KD

Claims

31086_WO -203- What is claimed is:

1. An HMGCR RNAi agent, or a salt thereof, wherein the RNAi agent comprises an antisense strand and a sense strand, wherein the antisense strand and the sense strand form a duplex region, wherein the antisense strand comprises the formula: O B ,R1is selected from the group consisting of H, OR2, NH2, SR2, F, and Cl; R2is H or C1-C20alkyl; B is a nucleobase; 10 wherein the antisense strand optionally comprises at least one of an abasic moiety and an inverted abasic moiety; wherein the antisense strand comprises at least 15 nucleotides of SEQ ID NO: 1, or a sequence having 90% sequence identity thereto, or 15 nucleotides of an antisense strand sequence as set forth in Table 2, 3, 4A or 4B, or a sequence having 90% sequence 15 identity thereto.

2. The HMGCR RNAi agent, or a salt thereof, of claim 1, comprising the formula: , wherein,20 each X1 is an independently selected nucleotide; each X2is an independently selected nucleotide; Q is PO2X5, wherein X5is O or S, or, when n is 0, Q may be H; and31086_WO -204- m and n are each independently selected from any integer from 0 to 24, such that the sum of m+n is between 14 and 24 inclusive; wherein each B is independently selected. 5 3. The HMGCR RNAi agent, or salt thereof, of claim 1 or claim 2, wherein the sense strand is 15 to 25 nucleotides in length.

4. The HMGCR RNAi agent, or salt thereof, of any one of claims 1-3, wherein the antisense strand is between 18 and 23 nucleotides in length. 10 5. The HMGCR RNAi agent, or salt thereof, of any one of claims 1-4, wherein the sense strand is between 18 and 21 nucleotides in length.

6. The HMGCR RNAi agent, or salt thereof, of any one of claims 1-5, wherein the 15 antisense strand is 23 nucleotides in length and the sense strand is 21 nucleotides in length.

7. The HMGCR RNAi agent, or salt thereof, of any one of claims 1-6, wherein the region of complementarity is at least 18 nucleotides in length. 20 8. The HMGCR RNAi agent, or salt thereof, of any one of claims 1-7, wherein the duplex region between the sense strand and the antisense strand comprises 0, 1, or 2 mismatches between the sense strand and the antisense strand. 25 9. The HMGCR RNAi agent, or salt thereof, of any one of claims 1-8, wherein the duplex region between the sense strand and the antisense strand comprises 0 mismatches between the sense strand and the antisense strand.

10. The HMGCR RNAi agent, or salt thereof, of any one of claims 1-9, wherein the 30 antisense strand comprises 15 contiguous nucleotides of any one of SEQ ID NO: 1 or a sequence of Table 2, 3, 4A, or 4B.31086_WO -205- 11. The HMGCR RNAi agent, or salt thereof, of any one of claims 1-10, wherein the antisense strand comprises 18 contiguous nucleotides of any one of SEQ ID NO: 1 or a sequence of Table 2, 3, 4A, or 4B. 5 12. The HMGCR RNAi agent, or salt thereof, of any one of claims 1-11, wherein the sense strand is selected from Table 2, 3, 4A, or 4B, or a sequence having at least 90% sequence identity thereto, or a sense strand sequence set forth in Table 3, or a sequence having 90% sequence identity thereto. 10 13. The HMGCR RNAi agent, or salt thereof, of claim 2, wherein the antisense strand comprises the formula: .

14. The HMGCR RNAi agent,m 2 or claim 13, wherein the antisense strand comprises the formula: 15 .

15. The HMGCR RNAi agent,, m 2 or claim 13, wherein the antisense strand comprises the formula: .

16. The HMGCR RNAi agent,or sa t t ereo , o c a m 2 or claim 13, wherein the 20 antisense strand comprises the formula:31086_WO -206- .

17. The HMGCR RNAi agent, or salt thereof, of claim 2 or claim 13, wherein the antisense strand comprises the formula: .

18. The HMGCR RNAi agent, or salt thereof, of claim 17, wherein the antisense strand comprises the formula: .31086_WO -207- 19. The HMGCR RNAi agent, or salt thereof, of claim 16, wherein the antisense strand comprises the formula: .

20. The HMGCR RNAi agent16, wherein the antisense 5 strand comprises the formula: .

21. The HMGCR RNAi agent, , one of claims 1-20, wherein X5is O. 10 22. The HMGCR RNAi agent, or salt thereof, of any one of claims 1-20, wherein X5is S.

23. The HMGCR RNAi agent, or salt thereof, of any one of claims 1-13, wherein the antisense strand comprises the formula:31086_WO -208- .

24. The HMGCR RNAi agent, or aim 23, wherein the antisensestrand comprises the formula: .

525. The HMGCR RNAi agent, or salt thereof, of any one of claims 23 or claim 24, wherein the antisense strand comprises the formula: .10 26. The HMGCR RNAi agent, or salt thereof, of any one of claims 23 or claim 24, wherein the antisense strand comprises the formula: .31086_WO -209- 27. The HMGCR RNAi agent, or salt thereof, of any one of claims 23 or claim 24, wherein the antisense strand comprises the formula: .5 28. The HMGCR RNAi agent, or salt thereof, of claim 25, wherein the antisense strand comprises the formula: .

29. The HMGCR RNAi agent, or salt thereof, of claim 25, wherein the antisense 10 strand comprises the formula: .

30. The HMGCR RNAi agent, or salt thereof, of claim 16, wherein the antisense strand comprises the formula:31086_WO -210- .

31. The HMGCR RNAi agent16, wherein the antisense strand comprises the formula: .

532. The HMGCR RNAi agent, or salt thereof, of claim 17, wherein the antisense strand comprises the formula:10 33. The HMGCR RNAi agent, or salt thereof, of any one of claims 1-32, wherein m and n are independently selected from any whole number from 0-20.31086_WO -211- 34. The HMGCR RNAi agent, or salt thereof, of any one of claims 1-33, wherein X1is selected from phosphate and vinyl phosphonate. 5 35. The HMGCR RNAi agent, or salt thereof, of any one of claims 1-34, wherein each B is independently selected from the group consisting of hypoxanthine, xanthine, 7- methylguanine, inosine, xanthosine, 7-methylguanosine, 5,6-dihydrouracil, 5- methylcytosine, 5-hydoxymethylcytosine, dihydrouridine, 5-methylcytidine, pseudouridine, adenine, guanine, cytosine, thymine, and uracil. 10 36. The HMGCR RNAi agent, or salt thereof, of any one of claims 1-35, wherein each B is independently selected from the group consisting of adenine, guanine, cytosine, thymine, and uracil. 15 37. The HMGCR RNAi agent, or salt thereof, of any one of claims 1-36, wherein each B is uracil.

38. The HMGCR RNAi agent, or salt thereof, of any one of claims 1-37, wherein the antisense strand is 15 to 30 nucleotides in total length. 20 39. The HMGCR RNAi agent, or salt thereof, of any one of claims 1-38, wherein the antisense strand is 18 to 30 nucleotides in total length.

40. The HMGCR RNAi agent, or salt thereof, of any one of claims 1-39, wherein the 25 antisense strand is 18 to 23 nucleotides in total length.

41. The HMGCR RNAi agent, or salt thereof, of any one of claims 1-40, comprising at least one modification selected from the group consisting of 2’-O-methoxy, 2’-O- methyl, 2’-fluoro, phosphorothioate, 2’-deoxy, abasic site, and inverted abasic site. 30 42. The HMGCR RNAi agent, or salt thereof, of claim 41, wherein the antisense strand comprises 2’-fluoro modified nucleotide at the following positions:31086_WO -212- a. 2, 3, 7, 14, and 16 from the 5’ end; b. 2, 5, 7, 14, and 16 from the 5’ end; c. 2, 3, 8, 14, and 16 from the 5’ end; d. 2, 5, 8, 14, and 16 from the 5’ end; or 5 e. 2, 6, 14, and 16 from the 5’ end, and 2’O-methyl modified nucleotide at all the other positions of the antisense strand.

43. The HMGCR RNAi agent, or salt thereof, of any one of claims 1-42, wherein the 10 sense strand and antisense strand each independently comprise one or more modified internucleotide linkages, and wherein each modified internucleotide linkage is a phosphorothioate linkage.

44. The HMGCR RNAi agent, or salt thereof, of claim 1-43, wherein the sense strand 15 and antisense strand each independently comprise four phosphorothioate linkages.

45. The HMGCR RNAi agent, or salt thereof, of any one of claims 1-44, wherein the 5’ terminal nucleotide of the antisense strand comprises an OH group, a phosphate group, a vinyl phosphonate, or a phosphate analog. 20 46. The HMGCR RNAi agent, or salt thereof, of claim 45, wherein the 5’ terminal nucleotide of the antisense strand is further modified to replace the 5’ phosphate group with an OH group. 25 47. The HMGCR RNAi agent, or salt thereof, of any one of claims 1-46, wherein the antisense strand has a 3’ overhang of 1 or 2 nucleotides.

48. The HMGCR RNAi agent, or salt thereof, of any one of claims 1-47, further comprising a delivery moiety conjugated to the RNAi agent, optionally via a linker. 30 49. The HMGCR RNAi agent, or salt thereof, of claim 48, wherein the delivery moiety is at the 5’ end of the sense strand.31086_WO -213- 50. The HMGCR RNAi agent, or salt thereof, of claim 48 or claim 49, wherein the delivery moiety is a GalNAc delivery moiety. 5 51. The HMGCR RNAi agent, or salt thereof, of claim 49 or claim 50, wherein the delivery moiety comprises the formula: , wherein E ithe sense strand, 10 optionally via a linker.

52. The HMGCR RNAi agent, or salt thereof, of any one of claims 48-51, wherein the linker comprises the formula: B 15wherein the delivery moiety is conjugated to the linker at connection point A, and the duplex RNA is conjugated to the linker at connection point B.

53. The HMGCR RNAi agent, or salt thereof, of any one of claims 48-51, wherein the 20 linker comprises the formula:31086_WO -214- Ywherein the delivery moiety is conjugated to the linker at connection point C, and the duplex RNA is conjugated to the linker at connection point D. 5 54. The HMGCR RNAi agent, or salt thereof, of claim 49 or claim 50, wherein the delivery moiety comprises the formula of: HOOHO H OO NO E wherein E isa po nt at w c t e e very mo ety s conjugate to t e sense strand. 10 55. The HMGCR RNAi agent, or salt thereof, of claim 1, wherein the sense strand and the antisense strand comprise a pair of nucleic acid sequences selected from the group consisting of: the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1270, 15 1282, 1800, and 2320, and the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2321-2352.

56. The HMGCR RNAi agent, or salt thereof, of claim 1, wherein the sense strand and the antisense strand comprise a pair of nucleic acid sequences selected from the group 20 consisting of:31086_WO -215- the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1282, and the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2321; the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1282, and the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2322; 5 the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1282, and the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2323; the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1282, and the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2324; the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1282, and 10 the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2325; the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1282, and the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2326; the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 2320, and the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2321; 15 the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 2320, and the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2322; the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 2320, and the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2323; the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 2320, and 20 the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2324; the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1800, and the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2327; the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1800, and the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2328; 25 the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1800, and the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2329; the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1800, and the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2330; the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1270, and 30 the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2331; the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1270, and the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2332;31086_WO -216- the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1270, and the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2333; the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1270, and the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2334; 5 the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1282, and the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2335; the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1282, and the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2336; the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1282, and 10 the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2337; the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1282, and the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2338; the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1282, and the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2339; 15 the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1282, and the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2340; the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1282, and the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2341; the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1282, and 20 the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2342; the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1282, and the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2343; the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1282, and the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2344; 25 the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 2320, and the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2339; the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 2320, and the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2340; the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 2320, and 30 the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2341; the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 2320, and the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2342;31086_WO -217- the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1800, and the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2345; the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1800, and the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2346; 5 the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1800, and the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2347; the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1800, and the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2348; the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1270, and 10 the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2349; the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1270, and the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2350; the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1270, and the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2351; and 15 the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1270, and the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2352.

57. The HMGCR RNAi agent, or salt thereof, of claim 1, wherein the antisense strand comprises a sequence selected from the group consisting of SEQ ID NOs: 2 to 387. 20 58. The HMGCR RNAi agent, or salt thereof, of claim 1, wherein the antisense strand has a nucleotide sequence selected from the group consisting of SEQ ID NOs: 774 to 1159, or a sequence having at least 90% sequence identity thereto. 25 59. The HMGCR RNAi agent, or salt thereof, of claim 1, wherein the sense strand is selected from the group consisting of SEQ ID NOs: 388 to 773, or a sequence having at least 90% sequence identity thereto.

60. The HMGCR RNAi agent, or salt thereof, of any one of claims 1-59, for use in 30 therapy.31086_WO -218- 61. The HMGCR RNAi agent, or salt thereof, of any one of claims 1-59, for use in the treatment of a disease or disorder associated with ASCVD.

62. The HMGCR RNAi agent, or salt thereof, for use of claim 61, wherein the disease 5 or disorder associated with ASCVD is dyslipidemia, primary dysbetalipoproteinemia, hypertriglyceridemia, or atherosclerosis.

63. The HMGCR RNAi agent, or salt thereof, for use according to claim 62, wherein the disease or disorder associated with ASCVD is dyslipidemia. 10 64. A pharmaceutical composition comprising the HMGCR RNAi agent, or salt thereof, of any one of claims 1 to 59, and one or more pharmaceutically acceptable excipients. 15 65. Use of the HMGCR RNAi agent, or salt thereof, of any one of claims 1-59, in the manufacture of a medicament for the treatment of a disease or disorder, wherein the disease or disorder is dyslipidemia, primary dysbetalipoproteinemia, hypertriglyceridemia, or atherosclerosis. 20 66. The use of claim 65, wherein the disease or disorder is dyslipidemia, primary dysbetalipoproteinemia, hypertriglyceridemia, or atherosclerosis.

67. A method of treating a disease or disorder associated with ASCVD, comprising administering to a subject in need thereof a therapeutically effective amount of the 25 HMGCR RNAi agent, or salt thereof, of any one of claims 1-59.

68. The method of claim 67, wherein the disease or disorder associated with ASCVD is dyslipidemia. 30 69. A method of decreasing HMCGR expression in a cell, comprising contacting the cell with the HMGCR RNAi agent, or salt thereof, of any one of claims 1-59.31086_WO -219- 70. The method of claim 68, wherein the method further comprises incubating the cell for a time sufficient for decreasing the level of HMGCR mRNA by at least 50% as compared to an untreated cell. 5 71. An HMGCR RNAi agent, or a salt thereof, wherein the RNAi agent comprises an antisense strand and a sense strand, wherein the antisense strand and the sense strand form a duplex region, wherein the antisense strand comprises one or more butadiol modified nucleotide, wherein the one or more butadiol modified nucleotide comprises a nucleobase; 10 wherein the antisense strand comprises at least 15 nucleotides of SEQ ID NO: 1, or a sequence having 90% sequence identity thereto, or 15 nucleotides of an antisense strand sequence as set forth in Table 2, 3, 4A or 4B, or a sequence having 90% sequence identity thereto. 15 72. The HMGCR RNAi agent, or the salt thereof, of claim 71, wherein each nucleobase is independently selected from the group consisting of hypoxanthine, xanthine, 7-methylguanine, inosine, xanthosine, 7-methylguanosine, 5,6-dihydrouracil, 5- methylcytosine, 5-hydoxymethylcytosine, dihydrouridine, 5-methylcytidine, psuedouridine, adenine, guanine, cytosine, thymine, and uracil. 20 73. The HMGCR RNAi agent, or the salt thereof, of claim 71 or 72, wherein each nucleobase is independently selected from the group consisting of adenine, guanine, cytosine, thymine, and uracil. 25 74. The HMGCR RNAi agent, or the salt thereof, of any one of claims 71 to 73, wherein the nucleobase in the butadiol modified nucleotide is independently selected from the group consisting of adenine, cytosine, and uracil.

75. The HMGCR RNAi agent, or the salt thereof, of any one of claims 71 to 74, 30 wherein the nucleobase in the butadiol modified nucleotide is independently selected from the group consisting of cytosine and uracil.31086_WO -220- 76. The HMGCR RNAi agent, or the salt thereof, of any one of claims 71 to 75, wherein the nucleobase in the butadiol modified nucleotide is uracil.

77. The HMGCR RNAi agent, or the salt thereof, of any one of claims 71 to 76, 5 wherein the sense strand is 15 to 25 nucleotides in total length and the antisense strand is 15 to 30 nucleotides in total length.

78. The HMGCR RNAi agent, or the salt thereof, of any one of claims 71 to 77, wherein the sense strand is between 18 and 23 nucleotides in total length and the 10 antisense strand is 18 to 30 nucleotides in total length.

79. The HMGCR RNAi agent, or the salt thereof, of any one of claims 71 to 78, wherein the sense strand is between 18 and 21 nucleotides in total length and the antisense strand is 18 to 23 nucleotides in total length. 15 80. The HMGCR RNAi agent, or the salt thereof, of any one of claims 71 to 79, wherein the antisense strand is 23 nucleotides in total length.

81. The HMGCR RNAi agent, or the salt thereof, of any one of claims 71 to 80, 20 wherein the butadiol modified nucleotide is at position 3, 4, 5, 6, 7, or 8 starting from the 5’ end.

82. The HMGCR RNAi agent, or the salt thereof, of any one of claims 71 to 81, wherein the butadiol modified nucleotide is at position 5, 6, 7, or 8 starting from the 5’ 25 end.

83. The HMGCR RNAi agent, or the salt thereof, of any one of claims 71 to 82, wherein the butadiol modified nucleotide is at position 5, 6, or 8 starting from the 5’ end. 30 84. The HMGCR RNAi agent, or the salt thereof, of any one of claims 71 to 83, wherein the butadiol modified nucleotide is at position 5 starting from the 5’ end.31086_WO -221- 85. The HMGCR RNAi agent, or salt thereof, of claim 84, wherein the antisense strand comprises 2’-fluoro modified nucleotide at the following positions: b. 2, 3, 7, 14, and 16 from the 5’ end; c. 2, 5, 7, 14, and 16 from the 5’ end; 5 d. 2, 3, 8, 14, and 16 from the 5’ end; e. 2, 5, 8, 14, and 16 from the 5’ end; f. 2, 14, and 16 from the 5’ end; or g. 2, 6, 14, and 16 from the 5’ end, and 2’O-methyl modified nucleotide at all the other positions of the antisense 10 strand.

86. The HMGCR RNAi agent, or salt thereof, of claim 71, wherein the sense strand and the antisense strand comprise a pair of nucleic acid sequences selected from the group consisting of: 15 the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1270 and 1282, and the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2354-2373.

87. The HMGCR RNAi agent, or salt thereof, of claim 71, wherein the sense strand and 20 the antisense strand comprise a pair of nucleic acid sequences selected from the group consisting of: the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1270, and the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2354; the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1270, and 25 the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2355; the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1270, and the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2356; the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1270, and the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2357; 30 the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1270, and the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2358;31086_WO -222- the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1270, and the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2359; the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1270, and the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2360; 5 the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1270, and the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2361; the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1270, and the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2362; the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1270, and 10 the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2363; the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1282, and the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2364; the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1282, and the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2365; 15 the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1282, and the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2366; the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1282, and the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2367; the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1282, and 20 the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2368; the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1282, and the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2369; the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1282, and the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2370; 25 the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1282, and the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2371; the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1282, and the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2372; the sense strand comprises a first nucleic acid sequence of SEQ ID NO: 1282, and 30 the antisense strand comprises a second nucleic acid sequence of SEQ ID NO: 2373.31086_WO -223- 88. The HMGCR RNAi agent, or salt thereof, of any one of claims 71-87, for use in therapy.

89. The HMGCR RNAi agent, or salt thereof, of any one of claims 71-87, for use in 5 the treatment of a disease or disorder associated with ASCVD.

90. The HMGCR RNAi agent, or salt thereof, for use of claim 89, wherein the disease or disorder associated with ASCVD is dyslipidemia, primary dysbetalipoproteinemia, hypertriglyceridemia, or atherosclerosis. 10 91. The HMGCR RNAi agent, or salt thereof, for use according to claim 62, wherein the disease or disorder associated with ASCVD is dyslipidemia.

92. A pharmaceutical composition comprising the HMGCR RNAi agent, or salt 15 thereof, of any one of claims 71-87, and one or more pharmaceutically acceptable excipients.

93. Use of the HMGCR RNAi agent, or salt thereof, of any one of claims 71-87, in the manufacture of a medicament for the treatment of a disease or disorder, wherein the 20 disease or disorder is dyslipidemia, primary dysbetalipoproteinemia, hypertriglyceridemia, or atherosclerosis.

94. The use of claim 93, wherein the disease or disorder is dyslipidemia, primary dysbetalipoproteinemia, hypertriglyceridemia, or atherosclerosis. 25 95. A method of treating a disease or disorder associated with ASCVD, comprising administering to a subject in need thereof a therapeutically effective amount of the HMGCR RNAi agent, or salt thereof, of any one of claims 71-87. 30 96. The method of claim 95, wherein the disease or disorder associated with ASCVD is dyslipidemia, primary dysbetalipoproteinemia, hypertriglyceridemia, or atherosclerosis.31086_WO -224- 97. A method of decreasing HMCGR expression in a cell, comprising contacting the cell with the HMGCR RNAi agent, or salt thereof, of any one of claims 71-87. 5 98. The method of claim 97, wherein the method further comprises incubating the cell for a time sufficient for decreasing the level of HMGCR mRNA by at least 50% as compared to an untreated cell.