Retroviral vectors

Optimized retroviral vectors encoding RLI address the short half-life issue of IL-15 by ensuring sustained expression and targeted delivery in cancer cells, enhancing treatment efficacy for glioblastoma through improved stability and synergistic chemotherapy.

WO2026006679A1PCT designated stage Publication Date: 2026-01-02RGT UNIV OF CALIFORNIA
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/035621
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-06-28
Filing Date
2025-06-27
Publication Date
2026-01-02

AI Technical Summary

Technical Problem

Interleukin-15 (IL-15) has a short half-life and requires high doses for effective anticancer immunotherapy, necessitating improved delivery methods to enhance its therapeutic efficacy.

Method used

Development of retroviral vectors encoding receptor-linker-IL-15 (RLI) with optimized sequences for stability and expression, including self-cleaving peptides and tissue-specific promoters, to target and express RLI in cancer cells, particularly glioblastoma cells.

Benefits of technology

The retroviral vectors provide sustained expression of RLI, enhancing cancer cell inhibition and enabling synergistic effects with chemotherapeutic agents like temozolomide, thereby improving treatment outcomes for glioblastoma.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025035621_02012026_PF_FP_ABST
    Figure US2025035621_02012026_PF_FP_ABST
Patent Text Reader

Abstract

Retroviral vectors with improved stability and that encode receptor-linker-IL-15 (RLI), as well as methods of their use, are provided.
Need to check novelty before this filing date? Find Prior Art

Description

RETROVIRAL VECTORSCROSS-REFERENCE TO RELATED PATENT APPLICATIONS

[0001] The present patent application claims benefit of priority to U.S. Provisional Patent Application No. 63 / 665,797, filed June 28, 2024, which is incorporated by reference for all purposes.STATEMENT AS TO RIGHTS TO INVENTIONS MADE UNDER FEDERALLY SPONSORED RESEARCH AND DEVELOPMENT

[0002] This invention was made with government support under Grant Number R01NS123808 awarded by the National Institute of Neurological Disorders and Stroke, National Institutes of Health. The government has certain rights in the invention.BACKGROUND OF THE INVENTION

[0003] Interleukin- 15 (IL-15) has potential for use in anticancer immunotherapy. However, IL- 15 has a short half-life and high doses are needed to achieve responses. Receptor-linker-IL-15 (RLI) is a fusion molecule of human IL- 15 covalently linked to the human IL-15Ra sushi + domain and has been used in clinical trials to treat cancer. See, e.g., Desbois M, et al., J. for ImmunoTherapy of Cancer 2020;8:e000632; PCT Publication W02007046006.BRIEF SUMMARY OF THE INVENTION

[0004] In some embodiments, a nucleic acid comprising a polynucleotide encoding receptor- linker-IL-15 (RLI) is provided. In some embodiments, the polynucleotide comprises a polynucleotide at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identical to SEQ ID NO: 1.

[0005] In some embodiments, a retroviral vector comprising a polynucleotide encoding receptor-linker-IL-15 (RLI) is provided. In some embodiments, the sequence is at least 90, 95, 98, 99 or 100% identical to SEQ ID NO: 1. In some embodiments, the polynucleotide lacks one or more canonical (AG) or non-canonical splice acceptor sequences compared to SEQ ID NO:2.

[0006] In some embodiments, the polynucleotide comprises at least 1 , 2, 3, 4, 5, 6, 7, 8 ,9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or all of the underlined sequences as shown in:ATGGCTCCTCGGAGAGCCAGAGGCTGTAGAACACTTGGACTGCCTGCCTTGCTTCTC CTGCTGCTGCTCCGGCCACCTGCCACAAGAGGCATCACCTGTCCTCCTCCTATGAGC GTGGAACACGCTGATATCTGGGTGAAGTCCTACTCCCTGTACAGCAGAGAAAGATA CATCTGCAACAGCGGCTTCAAGCGGAAGGCCGGAACAAGCAGCCTGACAGAGTGTG TGCTGAACAAGGCTACCAACGTGGCCCACTGGACCACACCTAGCCTGAAGTGTATC AGAGACCCCGCTCTGGTGCATCAGCGACCTGCACCACCTTCTGGTGGATCCGGTGGC GGCGGTTCTGGCGGGGGCTCCGGAGGCGGAGGATCTCTGCAAAATTGGGTCAACGT CATCTCCGACCTGAAGAAGATCGAGGACCTGATTCAGAGCATGCATATCGACGCCA CACTGTACACCGAGAGCGACGTGCACCCTAGCTGTAAAGTGACCGCCATGAAGTGC TTTCTGCTGGAACTGCAAGTGATTAGCCTGGAATCCGGCGATGCCAGCATCCACGAC ACCGTGGAAAACCTGATCATCCTGGCCAACAACTCACTGTCTAGCAACGGCAACGT GACCGAGTCCGGCTGCAAGGAGTGCGAAGAGCTCGAGGAAAAGAATATCAAAGAG TTCCTGCAGAGCTTCGTGCACATCGTTCAAATGTTCATCAACACCAGCTGA (SEQ ID NO:1).

[0007] In some embodiments, the polynucleotide comprises SEQ ID NO: 1.

[0008] In some embodiments, the vector comprises SEQ ID NO:3 or a sequence at least 90, 95, 98, 99 or 100% identical to SEQ ID NO:3.

[0009] In some embodiments, the vector encodes a gag, pol and env gene product. In some embodiments, the vector encodes an env / RLI polypeptide, wherein the env / RLI polypeptide is separated by a self-cleaving peptide, a linker, or both. In some embodiments, a majority of amino acids in the linker are glycine and serine. In some embodiments, the linker encoding the linker comprises SEQ ID NO:4. In some embodiments, the self-cleaving peptide is selected from the group consisting of a T2A, P2A, E2A and F2A peptide.

[0010] In some embodiments, expression of the polynucleotide is under the control of a promoter. In some embodiments, the promoter is polynucleotide is expressed in cancer cells or expression of the polynucleotide is cancer-specific.

[0011] In some embodiments, methods of inhibiting (e g., inhibiting growth or division) or killing a cancer cell are provided. In some embodiments, the method comprises introducing the retroviral vector as described above or elsewhere herein into the cancer cell such that RLI is expressed in the cancer cell. In some embodiments, the cancer cell is a glioblastoma (GBM) cell. In some embodiments, the cancer cell is in a human and the introducing comprises administering the retroviral vector to the human.

[0012] Also provided is a pharmaceutical composition comprising a pharmaceutically- acceptable excipient and the retroviral vector as described above or elsewhere herein.

[0013] Also provided is a method of inhibiting a cancer cell, the method comprising, introducing a retroviral vector encoding receptor-linker-IL-15 (RLI) into the cancer cell such that RLI is expressed in the cancer cell and further contacting the cell with a chemotherapeutic agent. In some embodiments, the chemotherapeutic agent is temozolomide. In some embodiments, the cancer cell is a glioblastoma (GBM) cell. In some embodiments, the cancer cell is in a human and the introducing comprises administering the retroviral vector to the human. In some embodiments, the introducing comprises intra-tumoral administration of the retroviral vector. In some embodiments, the vector encodes a gag, pol and env gene product. In some embodiments, the vector encodes an env / RLI polypeptide, wherein the env / RLI polypeptide is separated by a self-cleaving peptide, a linker, or both.BRIEF DESCRIPTION OF THE DRAWINGS

[0014] FIG. 1 depicts a schematic of a retroviral replicating vector (RRV) encoding Gag, Pol and Env gene products as well as the RLI protein. A sequence encoding a T2A peptide separates the Env coding sequence from the RLI coding sequence. Long terminal repeats (LTRs) flank the vector sequence.

[0015] FIG. 2 provides graphs of virus spread in two cell models for glioblastoma.

[0016] FIG. 3 shows ELISA-measured RLI production in uninfected, empty vector-infected and RLI-encoding vector-infected cells.

[0017] FIG. 4 displays the RLI coding sequence and indications where changes were made to provide improved stability and expression. FIG. 4 discloses SEQ ID NOS 8-10, respectively, in order of appearance.

[0018] FIG. 5 DEPICTS A GEL PICTURE SHOWING AN AMPLIFICATION PRODUCT OF RLI AS DESCRIBED IN THE EXAMPLEDEFINITIONS

[0019] As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural reference unless the context clearly dictates otherwise.

[0020] “About” is used to provide flexibility to a numerical range endpoint by providing that a given value may be “slightly above” or “slightly below” the endpoint without affecting the desired result.

[0021] The use herein of the terms "including," "comprising," or "having," and variations thereof, is meant to encompass the elements listed thereafter and equivalents thereof as well as additional elements. Embodiments recited as "including," "comprising,” or "having" certain elements are also contemplated as "consisting essentially of and "consisting of those certain elements. As used herein, “and / or” refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations where interpreted in the alternative (“or”).

[0022] As used herein, “retroviruses” are RNA viruses wherein the viral genome is RNA. When a host cell is infected with a retrovirus, the genomic RNA is reverse transcribed into a DNA intermediate which is integrated very efficiently into the chromosomal DNA of infected cells. The integrated DNA intermediate is referred to as a provirus. Retroviruses are enveloped single-stranded RNA viruses that typically infect mammals, such as, for example, bovines, monkeys, sheep, and humans, as well as avian species. Retroviruses are unique among RNA viruses in that their multiplication involves the synthesis of a DNA copy of the RNA which is then integrated into the genome of the infected cell.

[0023] The Retroviridae family consists of three groups: the spumaviruses (or foamy viruses) such as the human foamy virus (HFV); the lentiviruses, as well as visna virus of sheep; and the oncoviruses (although not all viruses within this group are oncogenic). The term "retrovirus" is used in its conventional sense to describe a genus of viruses containing reverse transcriptase.Retroviruses include lentiviruses. The lentiviruses include the "immunodeficiency viruses" which include human immunodeficiency virus (HIV) type 1 and type 2 (HIV-1 and HIV-2) and simian immunodeficiency virus (SIV). The oncoviruses are further subdivided into groups A, B, C and D on the basis of particle morphology, as seen under the electron microscope during viral maturation.

[0024] Retroviruses are defined by the way in which they replicate their genetic material. During replication the RNA is converted into DNA. Following infection of the cell a doublestranded molecule of DNA is generated from the two molecules of RNA which are carried in the viral particle by the molecular process known as reverse transcription. The DNA form becomes covalently integrated in the host cell genome as a provirus, from which viral RNAs are expressed with the aid of cellular and / or viral factors. The expressed viral RNAs are packaged into particles and released as infectious virion.

[0025] The retrovirus particle is composed of two identical RNA molecules. Each wild-type genome has a positive sense, single-stranded RNA molecule, which is capped at the 5' end and polyadenylated at the 3' tail. The diploid virus particle contains the two RNA strands complexed with gag proteins, viral enzymes (pol gene products) and host tRNA molecules within a 'core' structure of gag proteins. Surrounding and protecting this capsid is a lipid bilayer, derived from host cell membranes and containing viral envelope (env) proteins. The env proteins bind to a cellular receptor for the virus and the particle typically enters the host cell via receptor-mediated endocytosis and / or membrane fusion. After the outer envelope is shed, the viral RNA is copied into DNA by reverse transcription. This is catalyzed by the reverse transcriptase enzyme encoded by the pol region and uses the host cell tRNA packaged into the virion as a primer for DNA synthesis. In this way the RNA genome is converted into the more complex DNA genome. The double-stranded linear DNA produced by reverse transcription may, or may not, have to be circularized in the nucleus. The provirus now has two identical repeats at either end, known as the long terminal repeats (LTR). The termini of the two LTR sequences produces the site recognized by a pol product, the integrase protein, which catalyzes integration, such that the provirus is always joined to host DNA two base pairs (bp) from the ends of the LTRs. A duplication of cellular sequences is seen at the ends of both LTRs. Integration is thought to occuressentially at random within the target cell genome. However, by modifying the long-terminal repeats it is possible to control the integration of a retroviral genome.

[0026] Transcription, RNA splicing and translation of the integrated viral DNA is mediated by host cell proteins. Efficient infectious transmission of retroviruses requires the expression on the target cell of receptors which specifically recognize the viral envelope proteins, although viruses may use receptor-independent, nonspecific routes of entry at low efficiency. In addition, the target cell type must be able to support all stages of the replication cycle after virus has bound and penetrated.

[0027] As used herein, "a viral vector" refers to a gene therapy vector used to deliver a polynucleotide construct to a cell. It is understood that the term viral vector encompasses recombinant vector particles or virions (i.e., viral particles comprising at least one capsid or envelope protein and an encapsidated recombinant viral vector) and recombinant vector plasmids.

[0028] As used herein, a "recombinant viral vector" refers to a viral vector, for example, a retroviral vector comprising a nucleic acid sequence that is not normally present in the viral vector (i.e., a polynucleotide heterologous to the viral vector). Other vectors include, but are not limited to adenoviral vectors, adeno-associated viral vectors and herpes simplex vectors. In general, the heterologous nucleic acid is flanked by at least one, and generally by two, long terminal repeat sequences (LTRs), for example, a 5’ LTR and a 3’LTR. As used herein, the retroviral vector can be a derivative of a murine, simian or human retrovirus. Examples of retroviral vectors in which a transgene (e.g., a heterologous polynucleotide sequence) can be inserted include, but are not limited to lentivirus, Moloney murine leukemia virus (MoMuLV), Harvey murine sarcoma virus (HaMuSV), murine mammary tumor virus (MuMTV), Rous Sarcoma Virus (RSV), and foamy virus.

[0029] The term “nucleic acid” or “nucleotide” refers to deoxyribonucleic acids (DNA) or ribonucleic acids (RNA) and polymers thereof, for example, polynucleotides, in either single- or double-stranded form. The nucleic acid molecule may be derived from a variety of sources, including DNA, cDNA, synthetic DNA, RNA, or combinations thereof. Such nucleic acid sequences may comprise genomic DNA which may or may not include naturally occurring introns. Moreover, such genomic DNA may be obtained in association with promoter regions,introns, or poly A sequences. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions), alleles, orthologs, SNPs, and complementary sequences as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and / or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19:5081 (1991); Ohtsuka et al., J. Biol. Chem. 260:2605-2608 (1985); and Rossolini et al., Mol. Cell. Probes 8:91-98 (1994)).

[0030] The term “gene” or “transgene” can refer to the segment of DNA (e.g. a polynucleotide sequence) involved in producing or encoding a polypeptide chain. It may include regions preceding and following the coding region (leader and trailer) as well as intervening sequences (introns) between individual coding segments (exons). Alternatively, the term “gene” or “transgene” can refer to the segment of DNA involved in producing or encoding a non-translated RNA, such as an rRNA, tRNA, guide RNA (e.g., a single guide RNA), or micro RNA.

[0031] As used herein the phrase “heterologous” refers to what is not normally found in nature. The term "heterologous nucleotide sequence" refers to a nucleotide sequence not normally found in a given wild-type viral genome, or a cell in nature. As such, a heterologous nucleotide sequence may be: (a) foreign to its host cell (i.e., is exogenous to the cell) or viral genome; (b) naturally found in the host cell (i.e., endogenous) but present at an unnatural quantity in the cell (i.e., greater or lesser quantity than naturally found in the host cell); or (c) be naturally found in the host cell or viral genome but positioned outside of its natural locus.

[0032] A “promoter” is defined as one or more a nucleic acid control sequences that direct transcription of a nucleic acid. As used herein, a promoter includes necessary nucleic acid sequences near the start site of transcription, such as, in the case of a polymerase II type promoter, a TATA element. A promoter also optionally includes distal enhancer or repressor elements, which can be located as much as several thousand base pairs from the start site of transcription.

[0033] A nucleic acid is “operably linked” when it is placed into a functional relationship with another nucleic acid sequence. For example, a promoter or enhancer is operably linked to acoding sequence if it affects the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation.

[0034] “Polypeptide,” “peptide,” and “protein” are used interchangeably herein to refer to a polymer of amino acid residues. As used herein, the terms encompass amino acid chains of any length, including full-length proteins, wherein the amino acid residues are linked by covalent peptide bonds.

[0035] As used herein, the phrase “introducing” in the context of introducing a nucleic acid or a viral vector refers to the translocation of the nucleic acid sequence or viral vector from outside a cell to inside the cell. In some cases, introducing refers to infecting a cell or a population of cells with a viral vector or viral particle carrying one or more non-viral nucleic acids. In some cases, translocation of the nucleic acid from outside the cell to inside the nucleus of the cell occurs. Various methods of such translocation are contemplated, including but not limited to, viral infection, electroporation, transfection, transduction, contact with nanowires or nanotubes, receptor mediated internalization, translocation via cell penetrating peptides, liposome mediated translocation, and the like.

[0036] As used herein, a “cell” can be in vivo, ex vivo or in vitro, and includes any cell or populations of cells that can be infected by a virus, (e g., a retrovirus), for example, a human cell. As used herein, the term “cell” includes non-dividing cells, dividing cells, and cells exhibiting uncontrolled proliferation. A used herein, a non-dividing cell refers to a cell that does not go through mitosis. Dividing cells are cells that undergo active mitosis, or meiosis. Such dividing cells include stem cells, skin cells (e.g., fibroblasts and keratinocytes), gametes, and other dividing cells known in the art. Dividing cells include cells associated with cell proliferative disorders, for example, neoplastic cells.

[0037] The term “identity” or “substantial identity”, as used in the context of a polynucleotide sequence described herein (for example, SEQ ID NO: 1), refers to a sequence that has at least 60% sequence identity to a reference sequence. Alternatively, percent identity can be any integer from 60% to 100%. Exemplary embodiments include at least: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, as compared to a reference sequence using the programs described herein; preferably BLAST using standard parameters, as described below.

[0038] For sequence comparison, typically one sequence acts as a reference sequence to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters can be used, or alternative parameters can be designated. The sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.

[0039] A “comparison window”, as used herein, includes reference to a segment of any one of the number of contiguous positions selected from the group consisting of from 20 to 600, about 20 to 50, about 20 to 100, about 50 to about 200 or about 100 to about 150, in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned. Methods of alignment of sequences for comparison are well-known in the art. Optimal alignment of sequences for comparison may be conducted by the local homology algorithm of Smith and Waterman Add. APL. Math. 2:482 (1981), by the homology alignment algorithm of Needleman and Wunsch J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson and Lipman Proc. Natl. Acad. Sci. (U.S.A.) 85: 2444 (1988), by computerized implementations of these algorithms (e.g., BLAST), or by manual alignment and visual inspection.

[0040] Algorithms that are suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al. (1990) J. Mol. Biol. 215: 403-410 and Altschul et al. (1977) Nucleic Acids Res. 25: 3389-3402, respectively. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (NCBI) web site. The algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al, supra). These initial neighborhood word hits acts as seeds for initiating searches to find longer HSPs containing them. The word hits are then extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (rewardscore for a pair of matching residues; always >0) and N (penalty score for mismatching residues; always <0). Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a word size (W) of 28, an expectation (E) of 10, M=l, N=-2, and a comparison of both strands.

[0041] The BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul, Proc. Nat'l. Acad. Sci. USA 90:5873-5787 (1993)). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.01, more preferably less than about 10-5, and most preferably less than about 10-20.DETAILED DESCRIPTION OF THE INVENTION

[0042] The inventors have discovered improved retroviral vectors that encode the receptor- linker-IL-15 (RLI) fusion protein. The improved retroviral vectors include changes in the coding and non-coding regions for RLI, resulting in a vector with, for example, improved stability. The retroviral vectors, and polynucleotides encoding RLI, can be expressed in cancer cells, for example glioblastoma cells.

[0043] RLI is an IL- 15 superagonist (RLI for “receptor-linker-IL-15”), composed of the amino-terminal (amino acids 1-77, sushi+) domain of the IL-15Ra coupled via a linker to IL-15. See, e.g., Desbois, et al., J Immunother Cancer. 2020; 8(1): e000632; Mortier E, et al., J Biol Chem 2006;281 : 1612-9. 10.1074. RLI is a potent superagonist of the IL-15RPy complex and increases the half-life of IL-15 by mimicking IL-15 transpresentation. See, e.g., Bessard, et al., Mol Cancer Ther 2009;8:2736-45. 10.1158. RLI is also described in, e.g. PCT Publication W02007046006.

[0044] The disclosure provides retroviral vectors encoding RLI and having improved stability and / or expression, e.g., compared to vectors comprising SEQ ID NO:2. Exemplary polynucleotides encoding RLI can include at least one change in SEQ ID NO: 1 that is not the corresponding location in SEQ ID NO:2. In some embodiments, the RLI-coding sequence comprises a polynucleotide at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identical to SEQ ID NO: 1. In some embodiments, for example, the RLI-encoding sequence comprises one or more change relative to SEQ ID NO:2 to remove a canonical or non-canonical splice acceptor or donor site. In some embodiments, codons are optimized for expression in a target cell, e.g., in a human cell. In some embodiments, the RLI-encoding sequence has fewer ATTTA sequences compared to SEQ ID NO:2, or has no ATTTA sequences.

[0045] The RLI-coding polynucleotides described herein can be inserted into any vector as desired. In some embodiments, the vector is a viral vector. Exemplary viral vectors include but are not limited to adenovirus vectors (e.g., Ad2, Ad5, Ad7), adeno-associated viral vectors, herpes simplex viral vectors, retroviral vectors, pox viral vectors (such as vaccinia and avian poxvirus vectors, such as the fowlpox and canarypox vectors), lentiviral vectors, alphavirus vectors, poliovirus vectors, measles vectors, and other positive and negative stranded RNA viruses, viroids, and virusoids, or portions thereof. In some embodiments, the retroviruses are selected from the group consisting of lentivirus, murine leukemia virus (MLV), Moloney murine leukemia virus (MoMLV), and foamy virus.

[0046] In some embodiments, the retroviral vector is a replicating retroviral vector. Replicating retroviral vectors have viral genes necessary for replication. Thus, replicating retroviral vectors can replicate and spread in dividing host cells, leading to persistent expression of genetic information contained in the replicating retroviral vector. An exemplary vector comprises SEQ ID NO:3 or a polynucleotide comprising a sequence at least 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical to SEQ ID NO:3 and encoding a gag, poly and env polypeptide as well as the RLI polypeptide.

[0047] In some embodiments, the RLI polypeptide is expressed as a fusion with the retroviral vector env polypeptide and is cleaved post-translationally to generate separate env and RLI polypeptides. In some embodiments, a “self-cleaving” peptide sequence can be encoded by the vector between the env and RLI polypeptide sequences in the fusion such that the peptide will becleaved, separating the env and RLI polypeptides. Exemplary self-cleaving peptides can include but are not limited to the T2A, P2A, E2A, or F2A sequences. Optionally a linker, e.g., a Gly-Ser linker (for example Gly-Ser-Gly or other sequences having as a majority of amino acids Gly + Ser) can be used at the N or C terminus of the self-cleaving peptide sequence. An exemplary T2A coding sequence is SEQ ID NO:5. An exemplary Gly-Ser linker coding sequence is SEQ ID NO:4.

[0048] In other embodiments, the nucleic acid may be administered as a non-viral vector, including, but not limited to, as a plasmid, in a nanoparticle, (e.g., a lipid nanoparticle), or in a liposome.

[0049] In any of the compositions provided herein, a promoter can be operably linked to a coding sequence for RLI as described herein, optionally also encoding a second protein, optionally with a self-cleaving peptide sequence between the second protein and RLI. The second protein can be at the amino terminus of the carboxyl terminus of RLI. Promoters used to control expression of RLI be a constitutive promoter (e g., SV40, EF1A, RSV, CMV, etc.) or an inducible promoter (e g., tetracycline (lida et al. I. Virol., 70(9): 6054-9), GAL4 target upstream activating sequence (Osterwalder et al., PNAS 98(22): 12596-12601 (2001), Cumate inducible expression system (Seo and Dannert, Appl. Microbiol. BiotechnoL 103(1): 303-313 (2019)) or a tissue or cell-specific promoter (e.g., a cancer-specific promoter). In any of the retroviral vectors provided herein, a promoter can be contained within an LTR sequence, for example, in the 5’ or 3’ LTR sequence or adjacent to the heterologous polynucleotide sequence, for example, adjacent to the 3’ end of a polynucleotide sequence. Any of the 3 ’LTR sequences, for example, a retroviral 3 ’LTR sequence (e.g., a MMLV 3 ’LTR sequence) can be modified to reduce or disrupt native promoter function in the 3 ’LTR, for example, by deleting one or more sequences in the 3 ’LTR and / or inserting one or more sequences, for example, one or more nucleic acid sequences comprising a GAL4 binding site, in the 3 ’LTR. An exemplary GAL4 binding site is provided herein as consensus sequence (CGGNnCCG), wherein N is any nucleotide (A, C, T or G).

[0050] The promoter can also be a cell-specific or tissue-specific promoter. When using a cell- or tissue-specific promoter, viral replication occurs primarily, but not exclusively, in a particular cell or tissue. For example, viral replication can occur in at least 90%, 95%, or 99% of the targeted cell or tissue. It will be understood, however, that tissue-specific promoters mayhave a detectable amount of background or base activity in those tissues where they are mostly silent. The degree to which a promoter is selectively activated in a target tissue can be expressed as a selectivity ratio (activity in a target tissue / activity in a control tissue). In this regard, a tissuespecific promoter useful in the practice of the present invention typically has a selectivity ratio of greater than about 5. Preferably, the selectivity ratio is greater than about 15.

[0051] Examples of tissue-specific promoters include, but are not limited to, liver-specific promoters (e.g., APOA2, SERPINA1, CYP3A4, MIR122), pancreatic-specific promoters (e.g., insulin, insulin receptor substrate 2, pancreatic and duodenal homeobox 1, Aristaless-like homeobox 3, and pancreatic polypeptide), cardiac-specific promoters (e.g., myosin, heavy chain 6, myosin, light chain 2, troponin I type 3, natriuretic peptide precursor A, solute carrier family 8), central nervous system promoters (e.g., glial fibrillary acidic protein, internexin neuronal intermediate filament protein, Nestin, myelin-associated oligodendrocyte basic protein, myelin basic protein, tyrosin hydroxylase, and Forkhead box A2), skin-specific promoters (e.g., Filaggrin, Keratin 14 and transglutaminase 3), pluripotent and embryonic germ layer promoters (e.g., POU class 5 homeobox 1, Nanog homeobox, Nestin, and MicroRNA 122). In some embodiments, the tissue-specific promoter is in the U3 region of the LTR of the retroviral genome, including for example cell- or tissue-specific promoters and enhancers to neoplastic cells (e.g., tumor cell-specific enhancers and promoters), and inducible promoters (e.g., tetracycline).

[0052] Provided herein is a method for transducing a target cell, e.g., a cell, with a vector (optionally a retroviral vector) as described herein that encodes RLI, where the method comprises contacting the target cell with the retroviral vector. In any of the methods for transfecting a target cell, viral DNA that can produce viral particles in the transfected cells (for example, a recombinant retroviral polynucleotide or viral particles comprising a recombinant retroviral polynucleotide) can be delivered to the cells. In some embodiments, the cell is a mammalian cell, e.g., a human cell. In any of the methods provided herein, the cell can be contacted in vitro, ex vivo or in vivo.

[0053] Also provided are methods for treating a disease in a subject in need thereof comprising administering a therapeutically effective amount of the retroviral vector or pharmaceuticalcompositions thereof to the subject, e.g., a human subject. In some methods, cells are removed from the subject, modified ex vivo using any of the recombinant virus systems described herein and administered to the subject after modification. In some methods, the modified cells are expanded before administration to the subject.

[0054] In any of the methods provided herein, the subject can be a subject diagnosed with a disease, for example, a cell proliferative disorder. In some embodiments, the cell proliferative disorder is glioblastoma (GBM).

[0055] “Treating” refers to any indicia of success in the treatment or amelioration or prevention of the disease, condition, or disorder, including any objective or subjective parameter such as abatement; remission; diminishing of symptoms or making the disease condition more tolerable to the patient; slowing in the rate of degeneration or decline; preventing a relapse, or making the final point of degeneration less debilitating. For example, a method for treating cancer is considered to be a treatment if there is a 10% reduction in one or more symptoms of the cancer in a subject as compared to a control. Thus the reduction can be a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any percent reduction in between 10% and 100% as compared to native or control levels. It is understood that treatment does not necessarily refer to a cure or complete ablation of the disorder or symptoms of the disorder.

[0056] Any of the methods provided herein can be used to treat a cell proliferative disorder. The term "cell proliferative disorder" refers to a condition characterized by an abnormal number of cells. The condition can include both hypertrophic (the continual multiplication of cells resulting in an overgrowth of a cell population within a tissue) and hypotrophic (a lack or deficiency of cells within a tissue) cell growth or an excessive influx or migration of cells into an area of a body. The cell populations are not necessarily transformed, tumorigenic or malignant cells, but can include normal cells as well.

[0057] In some cases, the cell proliferative disorder is cancer. As used herein, cancer is a disease characterized by the rapid and uncontrolled growth of aberrant cells. Cancer cells can spread locally or through the bloodstream and lymphatic system to other parts of the body. The cancer can be a solid tumor. In some embodiments, the cancer is a blood or hematological cancer, such as a leukemia (e.g., acute leukemia; acute lymphocytic leukemia; acute myelocytic leukemias, such as myeloblastic, promyelocytic, myelomonocytic, monocytic, erythroleukemialeukemias and myelodysplastic syndrome; chronic myelocytic (granulocytic) leukemia; chronic lymphocytic leukemia; hairy cell leukemia), polycythemia vera, or lymphomas (e.g., Hodgkin's disease or non-Hodgkin's disease lymphomas (e.g., diffuse anaplastic lymphoma kinase (ALK) negative, large B-cell lymphoma (DLBCL); diffuse anaplastic lymphoma kinase (ALK) positive, large B-cell lymphoma (DLBCL); anaplastic lymphoma kinase (ALK) positive, ALK+anaplastic large-cell lymphoma (ALCL), acute myeloid lymphoma (AML))), multiple myelomas (e.g., smoldering multiple myeloma, non-secretory myeloma, osteosclerotic myeloma, plasma cell leukemia, solitary plasmacytoma and extramedullary plasmacytoma), Waldenstrom's macroglobulinemia, monoclonal gammopathy of undetermined significance, benign monoclonal gammopathy and heavy chain disease. Solid tumors include, by way of example, bone and connective tissue sarcomas (e.g., bone sarcoma, osteosarcoma, chondrosarcoma, Ewing's sarcoma, malignant giant cell tumor, fibrosarcoma of bone, chordoma, periosteal sarcoma, soft- tissue sarcomas, angiosarcoma (hemangiosarcoma), fibrosarcoma, Kaposi's sarcoma, leiomyosarcoma, liposarcoma, lymphangiosarcoma, neurilemmoma, rhabdomyosarcoma, synovial sarcoma), brain tumors (e.g., glioma, glioblastoma, astrocytoma, brain stem glioma, ependymoma, oligodendroglioma, nonglial tumor, acoustic neurinoma, craniopharyngioma, medulloblastoma, meningioma, pineocytoma, pineoblastoma, primary brain lymphoma), breast cancer (e.g., adenocarcinoma, lobular (small cell) carcinoma, intraductal carcinoma, medullary breast cancer, mucinous breast cancer, tubular breast cancer, papillary breast cancer, Paget's disease, and inflammatory breast cancer), adrenal cancer (e.g., pheochromocytoma and adrenocortical carcinoma), thyroid cancer (e.g., papillary or follicular thyroid cancer, medullary thyroid cancer and anaplastic thyroid cancer), pancreatic cancer (e.g., insulinoma, gastrinoma, glucagonoma, vipoma, somatostatin-secreting tumor, and carcinoid or islet cell tumor), pituitary cancers (e.g., Cushing's disease, prolactin-secreting tumor, acromegaly, and diabetes insipidus), eye cancers (e.g., ocular melanoma such as iris melanoma, choroidal melanoma, and ciliary body melanoma, and retinoblastoma), vaginal cancers (e.g., squamous cell carcinoma, adenocarcinoma, and melanoma), vulvar cancer (e.g., squamous cell carcinoma, melanoma, adenocarcinoma, basal cell carcinoma, sarcoma, and Paget's disease), cervical cancers (e.g., squamous cell carcinoma and adenocarcinoma), uterine cancers (e.g., endometrial carcinoma and uterine sarcoma), ovarian cancers (e.g., ovarian epithelial carcinoma, borderline tumor, germ cell tumor, and stromal tumor), esophageal cancers (e.g., squamous cancer, adenocarcinoma, adenoidcystic carcinoma, mucoepidermoid carcinoma, adenosquamous carcinoma, sarcoma, melanoma, plasmacytoma, verrucous carcinoma, and oat cell (small cell) carcinoma), stomach cancers (e.g., adenocarcinoma, fungating (polypoid), ulcerating, superficial spreading, diffusely spreading, malignant lymphoma, liposarcoma, fibrosarcoma, and carcinosarcoma), colon cancers, rectal cancers, liver cancers (e.g., hepatocellular carcinoma and hepatoblastoma), gallbladder cancers (e.g., adenocarcinoma), cholangiocarcinomas (papillary, nodular, and diffuse), lung cancers (e.g., non-small cell lung cancer, squamous cell carcinoma (epidermoid carcinoma), adenocarcinoma, large-cell carcinoma and small-cell lung cancer), testicular cancers (e.g., germinal tumor, seminoma, anaplastic, classic (typical), spermatocytic, nonseminoma, embryonal carcinoma, teratoma carcinoma, choriocarcinoma (yolk-sac tumor)), prostate cancers (e.g., adenocarcinoma, leiomyosarcoma, and rhabdomyosarcoma), penile cancers, oral cancers (e.g., squamous cell carcinoma), basal cancers, salivary gland cancers (e.g., adenocarcinoma, mucoepidermoid carcinoma, and adenoidcystic carcinoma), esopharyngeal cancers (e.g., squamous cell cancer and verrucous cancer), skin cancers (e.g., basal cell carcinoma, squamous cell carcinoma and melanoma, superficial spreading melanoma, nodular melanoma, lentigo malignant melanoma, acral lentiginous melanoma), kidney cancers (e.g., renal cell cancer, adenocarcinoma, hypernephroma, fibrosarcoma, transitional cell cancer (renal pelvis and / or ureter), Wilms' tumor), bladder cancers (e.g., transitional cell carcinoma, squamous cell cancer, adenocarcinoma, and carcinosarcoma). In addition, cancers include myxosarcoma, osteogenic sarcoma, endotheliosarcoma, lymphangio endothelio sarcoma, mesothelioma, synovioma, hemangioblastoma, epithelial carcinoma, cystadenocarcinoma, bronchogenic carcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma and papillary adenocarcinomas.

[0058] As used throughout, the term “cell proliferative disorder” also includes rheumatoid arthritis and other auto-immune disorders that are often characterized by inappropriate proliferation of cells of the immune system.

[0059] As used throughout, a subject can be a vertebrate, more specifically a mammal (e.g., a human, horse, cat, dog, cow, pig, sheep, goat, mouse, rabbit, rat, and guinea pig). The term does not denote a particular age or sex. Thus, adult, newborn and pediatric subjects, whether male or female, are intended to be covered. As used herein, patient or subject may be usedinterchangeably and can refer to a subject with or at risk of developing a disorder. The term patient or subject includes human and veterinary subjects. In any of the methods provided herein, the subject can be a subject diagnosed with cancer, an infection or an autoimmune disease.

[0060] Any of the methods provided herein can further comprise administering a second therapeutic agent to the subject. The second therapeutic agent can be selected from the group consisting of a chemotherapeutic agent, an adjuvant, an immunomodulatory agent, a vaccine, a tumor antigen, or a combination thereof. In some instances, the second therapeutic agent is a prodrug that can be converted into a toxic drug by a prodrug activator encoded by the retroviral system. In cases, where the second therapeutic is a nucleic acid sequence encoding a therapeutic polypeptide, the second therapeutic agent can be delivered by viral or non-viral means.

[0061] Representative chemotherapeutic agents include, but are not limited to amsacrine, bleomycin, busulfan, capecitabine, carboplatin, carmustine, chlorambucil, cisplatin, cladribine, clofarabine, crisantaspase, cyclophosphamide, cytarabine, dacarbazine, dactinomycin, daunorubicin, docetaxel, doxorubicin, epirubicin, etoposide, fludarabine, fluorouracil, gemcitabine, hydroxycarbamide, idarubicin, ifosfamide, irinotecan, leucovorin, liposomal doxorubicin, liposomal daunorubicin, lomustine, melphalan, mercaptopurine, mesna, methotrexate, mitomycin, mitoxantrone, oxaliplatin, paclitaxel, pemetrexed, pentostatin, procarbazine, raltitrexed, satraplatin, streptozocin, tegafur-uracil, temozolomide, teniposide, thiotepa, tioguanine, topotecan, treosulfan, vinblastine, vincristine, vindesine, vinorelbine, or a combination thereof. Representative pro-apoptotic agents include, but are not limited to fludarabinetaurosporine, cycloheximide, actinomycin D, lactosylceramide, 15d-PGJ(2) and combinations thereof.

[0062] It is understood that combinations, for example, a composition comprising one or more of the viral vectors described herein and a second therapeutic agent can be administered either concomitantly (e.g., as an admixture), separately but simultaneously (e.g., via separate intravenous lines into the same subject), or sequentially (e.g., one of the compositions or agents is given first followed by the second). Any of the methods provided herein can further comprise radiation therapy or surgery.

[0063] As used herein, the term “therapeutically effective amount” or “effective amount” refers to an amount of a composition that, when administered to a subject, is effective, alone orin combination with additional agents, to treat a disease or disorder either by one dose or over the course of multiple doses. A suitable dose can depend on a variety of factors including the particular composition or system used and whether it is used concomitantly with other therapeutic agents. Other factors affecting the dose administered to the subject include, e.g., the type or severity of the disease. For example, a subject having pancreatic cancer may require administration of a different dosage than a subject with brain cancer.

[0064] The effective amount of a compound (for example, a chemotherapeutic agent or an immunomodulator) described herein or pharmaceutically acceptable salts or prodrugs thereof can be determined by one of ordinary skill in the art and includes exemplary dosage amounts for a mammal of from about 0.5 to about 200 mg / kg of body weight of active compound per day, which can be administered in a single dose or in the form of individual divided doses, such as from 1 to 4 times per day. Alternatively, the dosage amount can be from about 0.5 to about 150 mg / kg of body weight of active compound per day, about 0.5 to 100 mg / kg of body weight of active compound per day, about 0.5 to about 75 mg / kg of body weight of active compound per day, about 0.5 to about 50 mg / kg of body weight of active compound per day, about 0.5 to about 25 mg / kg of body weight of active compound per day, about 1 to about 20 mg / kg of body weight of active compound per day, about 1 to about 10 mg / kg of body weight of active compound per day, about 20 mg / kg of body weight of active compound per day, about 10 mg / kg of body weight of active compound per day, or about mg / kg of body weight of active compound per day. Other factors that influence dosage can include, e.g., other medical disorders concurrently or previously affecting the subject, the general health of the subject, the genetic disposition of the subject, diet, time of administration, rate of excretion, drug combination, and any other additional therapeutics that are administered to the subject. It should also be understood that a specific dosage and treatment regimen for any particular subject also depends upon the judgment of the treating medical practitioner.

[0065] When administering viral vectors (i.e., recombinant vector plasmids, recombinant vector virions, infectious viral particles, or recombinant vector particles), an effective amount of any of the viral vectors described herein will vary and can be determined by one of skill in the art through experimentation and / or clinical trials. For example, for in vivo injection, an effective dose can be from about 106to about 1015recombinant vectors or recombinant vector virions. Forexample, about 106, 107, 108, 109, IO10, IO11, 1012, 1013, I O14, 1 O1?recombinant vectors or recombinant vector virions (e.g., virus particles) or any amount in between these amounts can be administered. In another example, about 106to about 107, about 106to about 108, about 106to about 109, about 106to about 1010, about 106to about 1011, about 106to about 1012, about 106to about 1013, or about 106to about 1014recombinant vectors or recombinant vector virions are administered. Effective doses for any of the administration methods described herein can be extrapolated from dose-response curves derived from in vitro or animal model test systems.

[0066] As used herein, administer or administration refers to the act of introducing, injecting or otherwise physically delivering a substance as it exists outside the body (e.g. a retroviral system described herein) into a subject, such as by mucosal, intradermal, intravenous, intratumoral, intramuscular, intrarectal, oral, subcutaneous delivery and / or any other method of physical delivery described herein or known in the art. When a disease, or a symptom thereof, is being treated, administration of the substance typically occurs after the onset of the disease or symptoms thereof. When a disease, or symptoms thereof, are being prevented, administration of the substance typically occurs before the onset of the disease or symptoms thereof.

[0067] The recombinant viral systems, e.g., retroviral systems, are administered via any of several routes of administration, including orally, parenterally, intramucosally, intravenously, intratumorally, intraperitoneally, intraventricularly, intramuscularly, subcutaneously, intracranially, intracavity or transdermally. Administration can be achieved by, e.g., topical administration, local infusion, injection, or by means of an implant.

[0068] Disclosed are materials, compositions, and components that can be used for, can be used in conjunction with, can be used in preparation for, or are products of the disclosed methods and compositions. These and other materials are disclosed herein, and it is understood that when combinations, subsets, interactions, groups, etc. of these materials are disclosed that while specific reference of each various individual and collective combinations and permutations of these compounds may not be explicitly disclosed, each is specifically contemplated and described herein. For example, if a method is disclosed and discussed and a number of modifications that can be made to a number of molecules including in the method are discussed, each and every combination and permutation of the method, and the modifications that are possible are specifically contemplated unless specifically indicated to the contrary. Likewise, anysubset or combination of these is also specifically contemplated and disclosed. This concept applies to all aspects of this disclosure including, but not limited to, steps in methods using the disclosed compositions. Thus, if there are a variety of additional steps that can be performed, it is understood that each of these additional steps can be performed with any specific method steps or combination of method steps of the disclosed methods, and that each such combination or subset of combinations is specifically contemplated and should be considered disclosed.

[0069] Publications cited herein and the material for which they are cited are hereby specifically incorporated by reference in their entireties.EXAMPLEExample 1

[0070] A retroviral replication vector (SEQ ID NO:3) was constructed by insertion of a coding sequence for RLI. The coding sequence for RLI was generated to minimize direct or inverted repeats and 5’ or 3’ splice sites while retaining optimized codons. In addition, the RNA instability motif ATTA was removed where possible. The resulting RLI coding sequence is shown in SEQ ID NO: 1. Changes in the RLI coding sequence are indicated in FIG. 4.

[0071] SEQ ID NO: 3 is depicted directly below and includes the optimized RLI coding sequence (SEQ ID NO: 1):RLI RRV sequence:5’tagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggc tgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtg gagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggccc gcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggtttt ggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcacc aaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataag cagagctggtttagtgaaccggcgccagtcctccgattgactgagtcgcccgggtacccgtgtatccaataaaccctcttgcagttgcatccg acttgtggtctcgctgttccttgggagggtctcctctgagtgattgactacccgtcagcgggggtctttcatttgggggctcgtccgggatcgg gagacccctgcccagggaccaccgacccaccaccgggaggtaagctggccagcaacttatctgtgtctgtccgattgtctagtgtctatga ctgattttatgcgcctgcgtcggtactagttagctaactagctctgtatctggcggacccgtggtggaactgacgagttcggaacacccggcc gcaaccctgggagacgtcccagggacttcgggggccgtttttgtggcccgacctgagtccaaaaatcccgatcgttttggactctttggtgc accccccttagaggagggatatgtggttctggtaggagacgagaacctaaaacagttcccgcctccgtctgaatttttgctttcggtttgggac cgaagccgcgccgcgcgtcttgtctgctgcagcatcgttctgtgttgtctctgtctgactgtgtttctgtatttgtctgagaatatgggccagact gttaccactcccttaagtttgaccttaggtcactggaaagatgtcgagcggatcgctcacaaccagtcggtagatgtcaagaagagacgttg ggttaccttctgctctgcagaatggccaacctttaacgtcggatggccgcgagacggcacctttaaccgagacctcatcacccaggttaaga tcaaggtcttttcacctggcccgcatggacacccagaccaggtcccctacatcgtgacctgggaagccttggcttttgacccccctccctgg gtcaagccctttgtacaccctaagcctccgcctcctcttcctccatccgccccgtctctcccccttgaacctcctcgttcgaccccgcctcgatcctccctttatccagccctcactccttctctaggcgccaaacctaaacctcaagttctttctgacagtggggggccgctcatcgacctacttacag aagaccccccgccttatagggacccaagaccacccccttccgacagggacggaaatggtggagaagcgacccctgcgggagaggcac cggacccctccccaatggcatctcgcctacgtgggagacgggagccccctgtggccgactccactacctcgcaggcattccccctccgcg caggaggaaacggacagcttcaatactggccgttctcctcttctgacctttacaactggaaaaataataacccttctttttctgaagatccaggt aaactgacagctctgatcgagtctgttctcatcacccatcagcccacctgggacgactgtcagcagctgttggggactctgctgaccggaga agaaaaacaacgggtgctcttagaggctagaaaggcggtgcggggcgatgatgggcgccccactcaactgcccaatgaagtcgatgcc gcttttcccctcgagcgcccagactgggattacaccacccaggcaggtaggaaccacctagtccactatcgccagttgctcctagcgggtct ccaaaacgcgggcagaagccccaccaatttggccaaggtaaaaggaataacacaagggcccaatgagtctccctcggccttcctagaga gacttaaggaagcctatcgcaggtacactccttatgaccctgaggacccagggcaagaaactaatgtgtctatgtctttcatttggcagtctgc cccagacattgggagaaagttagagaggttagaagatttaaaaaacaagacgcttggagatttggttagagaggcagaaaagatctttaata aacgagaaaccccggaagaaagagaggaacgtatcaggagagaaacagaggaaaaagaagaacgccgtaggacagaggatgagca gaaagagaaagaaagagatcgtaggagacatagagagatgagcaagctattggccactgtcgttagtggacagaaacaggatagacagg gaggagaacgaaggaggtcccaactcgatcgcgaccagtgtgcctactgcaaagaaaaggggcactgggctaaagattgtcccaagaa accacgaggacctcggggaccaagaccccagacctccctcctgaccctagatgactagggaggtcagggtcaggagcccccccctgaa cccaggataaccctcaaagtcggggggcaacccgtcaccttcctggtagatactggggcccaacactccgtgctgacccaaaatcctgga cccctaagtgataagtctgcctgggtccaaggggctactggaggaaagcggtatcgctggaccacggatcgcaaagtacatctagctacc ggtaaggtcacccactctttcctccatgtaccagactgtccctatcctctgttaggaagagatttgctgactaaactaaaagcccaaatccacttt gagggatcaggagcccaggttatgggaccaatggggcagcccctgcaagtgttgaccctaaatatagaagatgagcatcggctacatgag acctcaaaagagccagatgtttctctagggtccacatggctgtctgattttcctcaggcctgggcggaaaccgggggcatgggactggcagt tcgccaagctcctctgatcatacctctgaaagcaacctctacccccgtgtccataaaacaataccccatgtcacaagaagccagactgggga tcaagccccacatacagagactgttggaccagggaatactggtaccctgccagtccccctggaacacgcccctgctacccgtaagaaacc agggactaatgattataggcctgtccaggatctgagagaagtcaacaagcgggtggaagacatccaccccaccgtgcccaacccttacaa cctcttgagcgggctcccaccgtcccaccagtggtacactgtgcttgatttaaaggatgcctttttctgcctgagactccaccccaccagtcag cctctcttcgcctttgagtggagagatccagagatgggaatctcaggacaattgacctggaccagactcccacagggtttcaaaaacagtcc caccctgtttgatgaggcactgcacagagacctagcagacttccggatccagcacccagacttgatcctgctacagtacgtggatgacttact gctggccgccacttctgagctagactgccaacaaggtactcgggccctgttacaaaccctagggaacctcgggtatcgggcctcggccaa gaaagcccaaatttgccagaaacaggtcaagtatctggggtatcttctaaaagagggtcagagatggctgactgaggccagaaaagagac tgtgatggggcagcctactccgaagacccctcgacaactaagggagttcctagggacggcaggcttctgtcgcctctggatccctgggtttg cagaaatggcagcccccttgtaccctctcaccaaaacggggactctgtttaattggggcccagaccaacaaaaggcctatcaagaaatcaa gcaagctcttctaactgccccagccctggggttgccagatttgactaagccctttgaactctttgtcgacgagaagcagggctacgccaaag gtgtcctaacgcaaaaactgggaccttggcgtcggccggtggcctacctgtccaaaaagctagacccagtagcagctgggtggccccctt gcctacggatggtagcagccattgccgtactgacaaaggatgcaggcaagctaaccatgggacagccactagtcattctggccccccatg cagtagaggcactagtcaaacaaccccccgaccgctggctttccaacgcccggatgactcactatcaggccttgcttttggacacggaccg ggtccagttcggaccggtggtagccctgaacccggctacgctgctcccactgcctgaggaagggctgcaacacaactgccttgatatcctg gccgaagcccacggaacccgacccgacctaacggaccagccgctcccagacgccgaccacacctggtacacggatggaagcagtctct tacaagagggacagcgtaaggcgggagctgcggtgaccaccgagaccgaggtaatctgggctaaagccctgccagccgggacatccg ctcagcgggctgaactgatagcactcacccaggccctaaagatggcagaaggtaagaagctaaatgtttatactgatagccgttatgcttttg ctactgcccatatccatggagaaatatacagaaggcgtgggttgctcacatcagaaggcaaagagatcaaaaataaagacgagatcttggc cctactaaaagccctctttctgcccaaaagacttagcataatccatgtccaggacatcaaaagggacacagcgccgaggctagaggcaac cggatggctgaccaagcggcccgaaaggcagccatcacagagactccagacacctctaccctcctcatagaaaattcatcaccctacacct cagaacattttcattacacagtgactgatataaaggacctaaccaagttgggggccatttatgataaaacaaagaagtattgggtctaccaag gaaaacctgtgatgcctgaccagtttactttgaattattagactttcttcatcagctgactcacctcagcttctcaaaaatgaaggctctcctaga gagaagccacagtccctactacatgctgaaccgggatcgaacactcaaaaatatcactgagacctgcaaagcttgtgcacaagtcaacgcc agcaagtctgccgttaaacagggaactagggtccgcgggcatcggcccggcactcattgggagatcgatttcaccgagataaagcccgg attgtatggctataaatatcttctagtttttatagataccttttctggctggatagaagccttcccaaccaagaaagaaaccgccaaggtcgtaac caagaagctactagaggagatcttccccaggttcggcatgcctcaggtattgggaactgacaatgggcctgccttcgtctccaaggtgagtcagacagtggccgatctgttggggattgattggaaattacattgtgcatacagaccccaaagctcaggccaggtagaaagaatgaatagaac catcaaggagactttaactaaattaacgcttgcaactggctctagagactgggtgctcctactccccttagccctgtaccgagcccgcaacac gccgggcccccatggcctcaccccatatgagatcttatatggggcacccccgccccttgtaaacttccctgaccctgacatgacaagagtta ctaacagcccctctctccaagctcacttacaggctctctacttagtccagcacgaagtctggagacctctggcggcagcctaccaagaacaa ctggaccgaccggtggtacctcacccttaccgagtcggcgacacagtgtgggtccgccgacaccagactaagaacctagaacctcgctg gaaaggaccttacacagtcctgctgaccacccccaccgccctcaaagtagacggcatcgcagcttggatacacgccgcccacgtgaagg ctgccgaccccgggggtggaccatcctctagactgacatggcgcgttcaacgctctcaaaaccccctcaagataagattaacccgtggaag cccttaatagtcatgggagtcctgttaggagtagggatggcagagagcccccatcaggtctttaatgtaacctggagagtcaccaacctgat gactgggcgtaccgccaatgccacctccctcctgggaactgtacaagatgccttcccaaaattatattttgatctatgtgatctggtcggagag gagtgggacccttcagaccaggaaccgtatgtcgggtatggctgcaagtaccccgcagggagacagcggacccggacttttgacttttac gtgtgccctgggcataccgtaaagtcggggtgtgggggaccaggagagggctactgtggtaaatgggggtgtgaaaccaccggacagg cttactggaagcccacatcatcgtgggacctaatctcccttaagcgcggtaacaccccctgggacacgggatgctctaaagttgcctgtggc ccctgctacgacctctccaaagtatccaattccttccaaggggctactcgagggggcagatgcaaccctctagtcctagaattcactgatgca ggaaaaaaggctaactgggacgggcccaaatcgtggggactgagactgtaccggacaggaacagatcctattaccatgttctccctgacc cggcaggtccttaatgtgggaccccgagtccccatagggcccaacccagtattacccgaccaaagactcccttcctcaccaatagagattgt accggctccacagccacctagccccctcaataccagttaccccccttccactaccagtacaccctcaacctcccctacaagtccaagtgtcc cacagccacccccaggaactggagatagactactagctctagtcaaaggagcctatcaggcgcttaacctcaccaatcccgacaagaccc aagaatgttggctgtgcttagtgtcgggacctccttattacgaaggagtagcggtcgtgggcacttataccaatcattccaccgctccggcca actgtacggccacttcccaacataagcttaccctatctgaagtgacaggacagggcctatgcatgggggcagtacctaaaactcaccaggc cttatgtaacaccacccaaagcgccggctcaggatcctactaccttgcagcacccgccggaacaatgtgggcttgcagcactggattgact ccctgcttgtccaccacggtgctcaatctaaccacagatattgtgtattagtgaactctggcccagagtaattaccactcccccgattatatgt atggtcagcttgaacagcgtaccaaatataaaagagagccagtatcattgaccctggcccttctactaggaggattaaccatgggagggatt gcagctggaatagggacggggaccactgccttaattaaaacccagcagtttgagcagcttcatgccgctatccagacagacctcaacgaa gtcgaaaagtcaattaccaacctagaaaagtcactgacctcgttgtctgaagtagtcctacagaaccgcagaggcctagatttgctattcctaa aggagggaggtctctgcgcagccctaaaagaagaatgttgtttttatgcagaccacacggggctagtgagagacagcatggccaaattaag agaaaggcttaatcagagacaaaaactatttgagacaggccaaggatggttcgaagggctgtttaatagatccccctggtttaccaccttaat ctccaccatcatgggacctctaatagtactcttactgatcttactctttggaccttgcattctcaatcgattggtccaatttgttaaagacaggatct cagtggtccaggctctggttttgactcagcaatatcaccagctaaaacccatagagtacgagccaGgaagcgga gagggcagaggaagtcttctaacatgcggtgacgtggaggagaatcccggccctATGGCTCCTCGGAGAGCCAGAGGCTGTAGAACACTTGGACTGCCTGCCTTGCT TCTCCTGCTGCTGCTCCGGCCACCTGCCACAAGAGGCATCACCTGTCCTCCTCC TATGAGCGTGGAACACGCTGATATCTGGGTGAAGTCCTACTCCCTGTACAGCA GAGAAAGATACATCTGCAACAGCGGCTTCAAGCGGAAGGCCGGAACAAGCAGC CTGACAGAGTGTGTGCTGAACAAGGCTACCAACGTGGCCCACTGGACCACACC TAGCCTGAAGTGTATCAGAGACCCCGCTCTGGTGCATCAGCGACCTGCACCAC CTTCTGGTGGATCCGGTGGCGGCGGTTCTGGCGGGGGCTCCGGAGGCGGAGG ATCTCTGCAAAATTGGGTCAACGTCATCTCCGACCTGAAGAAGATCGAGGACC TGATTCAGAGCATGCATATCGACGCCACACTGTACACCGAGAGCGACGTGCAC CCTAGCTGTAAAGTGACCGCCATGAAGTGCTTTCTGCTGGAACTGCAAGTGATT AGCCTGGAATCCGGCGATGCCAGCATCCACGACACCGTGGAAAACCTGATCAT CCTGGCCAACAACTCACTGTCTAGCAACGGCAACGTGACCGAGTCCGGCTGCA AGGAGTGCGAAGAGCTCGAGGAAAAGAATATCAAAGAGTTCCTGCAGAGCTTC GTGCACATCGTTCAAATGTTCATCAACACCAGCTGAgcggccgcagataaaataaaagattttatttagtctccagaaaaaggggggaatgaaagaccccacctgtaggtttggcaagctagcttaag taacgccattttgcaaggcatggaaaaatacataactgagaatagagaagttcagatcaaggtcaggaacagatggaacagctgaatatgg gccaaacaggatatctgtggtaagcagttcctgccccggctcagggccaagaacagatggaacagctgaatatgggccaaacaggatatc tgtggtaagcagttcctgccccggctcagggccaagaacagatggtccccagatgcggtccagccctcagcagtttctagagaaccatcag atgtttccagggtgccccaaggacctgaaatgaccctgtgccttatttgaactaaccaatcagttcgcttctcgcttctgttcgcgcgcttctgct ccccgagctcaataaaagagcccacaacccctcactcggggcgccagtcctccgattgactgagtcgcccgggtacccgtgtatccaata aaccctcttgcagttgcatccgacttgtggtctcgctgttccttgggagggtctcctctgagtgattgactacccgtcagcgggggtctttcatta catgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagc atcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgc gctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcaatgctcacgctgtaggtat ctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgt cttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgct acagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaa agagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaagg atctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaa ggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatc agtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttacc atctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccg agcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttg cgcaacgttgttgccattgctgcaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgag ttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatg gttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagt gtatgcggcgaccgagttgctcttgcccggcgtcaacacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaa cgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttt tactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatact catactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaatagg ggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaataggcgtatcacgag gccctttcgtcttcaagaattcat3’

[0072] Bold sequence is the RLI coding sequence (SEQ ID NO: 1). Underlined codons in theRLI coding sequence represent silent changes made to increase viral stability and optimize expression. Tenets that were utilized to inform these changes include:-minimizing direct or inverted repeats and the likelihood of cryptic 5’ or 3’ splice sites, while retaining maximal usage of favorable codons; and-also avoiding the RNA instability motif ATTTA.

[0073] Ggaagcgga encodes a GlySerGly linker.

[0074] Gagggcagaggaagtcttctaacatgcggtgacgtggaggagaatcccggccct (SEQ ID NO: 5) encodes a T2A peptide.

[0075] To measure viral stability, an MOT of 0.01 was added to tumor cells and allowed to spread to 100% transduced cells at 14 days. The resulting supernatant was then placed on tumor cells at an MOI of 0.01 and the protocol was repeated for a total of 8 weeks. Genomic DNA was then isolated using the Monarch® Genomic DNA Purification Kit (NEB Biolabs). Polymerase chain reaction with primers crossing the RLI insert (SEQ ID NO: 1) were used to determine stability of the construct. Primer sequences were as follows: FWD: ggaccttgcattctcaatcgattgg (SEQ ID NO:6); REV: cccctttttctggagactaaataa (SEQ ID NO:7). A single band that corresponds to the size of the RLI insert was observed at 2, 4, 6, and 8 weeks without additional bands, indicating viral stability and lack of insert drop out. See, FIG. 5

[0076] Spread of the vector was tested in SB28 and Tu2449 models. Specific multiplicities of infection (MOI) of the RLI vector (SEQ ID NO:3) were added to tumor cells in vivo and allowed to replicate over time, with transduction levels measured at regular intervals via staining for the gag viral protein and flow cytometry. Azidothymidine (AZT), which inhibits viral spread, was utilized for control groups. As shown in FIG. 2, RLI RRV spreads well in the Tu2449 and SB28 murine glioblastoma cell lines.

[0077] Production of RLI was measured using an ELISA assay directed to the RLI protein in uninfected cells, cells infected with empty vector and cells infected with the RLLcoding vector. RLI production levels were determined using supernatant from 100% RLI RRV infected SB28 tumor cells. RLI levels in the supernatant was measured via Human IL-15 Quantikine enzyme- linked immunosorbent assay (R&D Systems). RLI function was determined using the CTLL-2 proliferation assay similarly to previous studies. As shown in FIG. 3, RLI RRV infected SB28 cells produce on average 16.3 pg of RLI per 100,000 infected cells.Example 2

[0078] Glioblastoma (GBM) is a lethal brain tumor that is resistant to conventional therapies. We engineered a non-lytic replicating retrovirus (RRV) that delivers a superagonist interleukin- 15 receptor-linked fusion protein (RLI) directly into GBM cells, creating localized immunotherapy biofactories. In orthotopic mouse models, RRV-RLI dramatically suppressed tumor growth, prolonged survival, and induced lasting remission with immunologic memory. Mechanistically, we observed increased CD8+T-cell and natural killer cell infiltration and activation, alongside elevated antigen presentation pathways. Combining RRV-RLI withtemozolomide - GBM’s standard-of-care chemotherapy - synergistically enhanced anti-tumor immunity and survival. T-cell receptor sequencing revealed a polyclonal repertoire of T-cells enhanced by combining RRV-RLI with temozolomide. Analysis of the T-cell repertoire suggested it to be directed against tumor rather than viral antigens, supporting the specificity and re-applicability of our approach. These findings illustrate that RRV-RLI reprograms GBM into an immunostimulatory hub, offering a powerful viral immunotherapy against GBM and other therapy-resistant solid tumors.Introduction

[0079] Glioblastoma (GBM) is a devastating brain cancer and carries a poor prognosis despite standard-of-care treatment, including surgical resection, radiation, and chemotherapy.7The median survival for newly diagnosed GBM is 15 months, with only modest improvements over the past decade and a need for novel therapeutics.2 2Despite success in other cancer types, systemically delivered single-agent immunotherapy has thus far seen limited success in treating GBM due to the tumor’s uniquely immunosuppressive microenvironment.2'7'6 9Several characteristics contribute to the immunodeficient and immunosuppressive tumor microenvironment (TME) of GBM, including the downregulation of MHC Y,7 9low tumor mutational burden (TMB),70tumor intrinsic signaling pathways,77and infiltration of immunosuppressive myeloid cells.72A key contributor to the immunosuppression seen in GBM is the low number of tumor-infiltrating T cells, which are often exhausted and dysfunctional.6'77,77GBM patients also have low systemic T cells due to their sequestration in the bone marrow, compounding the low anti -turn or T cell activity seen.75

[0080] Systemic immunotherapy for GBM faces additional challenges. The doses needed to overcome the severe immunosuppression and cross the blood-brain barrier may be high enough to cause systemic toxicities such as autoimmune side effects or cytokine storm.'6 / 6Consequently, there is a growing interest in local immunotherapies that deliver immunostimulatory proteins like cytokines directly to tumor cells.79’20While local immunotherapies investigated to date have taken many forms, such as nanoparticles, scaffolds, and hydrogels, one of the most promising is the use of viral vectors to deliver therapeutic transgenes, such as a suicide gene or local immunotherapy directly to the tumor mi croenvironment .7920

[0081] Replicating retrovirus (RRV) is a promising viral vector for cancer gene therapy that selectively infects, stably integrates, and replicates in tumor cells27Unlike other viral vectors, RRV is relatively immunologically silent, allowing widespread tumor dissemination with minimal immune clearance.22RRV delivering the suicide gene yeast cytosine deaminase (CD), has been used to treat recurrent GBM in clinical trials, revealing an excellent safety profile.22 24Molecular profiling of treated patients confirmed the tumor selectivity and safety of RRV,23with virus only transiently detected in patient blood with quantitative signal in 6% of plasma samples and 3% of whole blood samples. While integration sites were identified in blood and tumor samples, there was no evidence to suggest clonal expansion associated with integration and no patient in an RRV trial has developed lymphoma.22Unfortunately, in a randomized phase III trial, RRV carrying CD failed to improve survival compared to standard of care, suggesting a need to consider a genetic payload employing a more potent paradigm of tumor killing.

[0082] Immunostimulatory cytokines, such as interleukin-2 (IL2) and interleukin- 15 (IL-15), represent promising candidates for transgene therapy due to their capacity to enhance the proliferation of Natural Killer (NK) and T-cells.25Of particular interest is IL-15, which exhibits a favorable profile by stimulating the expansion of NK- and T-cells while also promoting their cytotoxic function and release of additional inflammatory cytokines.25Unlike IL-2, IL- 15 does not stimulate T regulatory (Treg) cells which can suppress anti-tumor immunity, thereby offering a therapeutic advantage.25The clinical utility of IL- 15 alone is in part limited by its complex signaling pathway, involving trans-presentation, a novel mechanism of delivery unique to IL- 15 as IL-15 primarily exists bound to the high-affinity IL-15Ra leading to IL-15 / IL-15Ra complexes that are shuttled to the cell surface of NK- and T-cells, where they can stimulate opposing cells such as myeloid cells through the p / yC receptor complex. In oncology patients, the expression of IL-15Ra is frequently downregulated, and IL-15 has a relatively short halflife, further complicating its application as a therapeutic agent.

[0083] These limitations have inspired the development of superagonists which can directly bind to effector cells and have increased stability.22 23One such superagonist is receptor-linked- IL-15 (RLI), which is bound to the sushi domain of the IL- 15 receptor alpha, allowing it to bind directly to IL-15 receptors on NK and T cells and improving stability. Systemically administeredRLI has been shown to slow tumor growth and promote anti-tumor immune activity in multiple preclinical cancer models.2 22

[0084] Given the promising preclinical results associated with systemic RLI treatment, we hypothesized that local RLI therapy delivered via RRV would stimulate an even greater antitumor immune response without systemic side effects. In the present study, we successfully engineered an RRV expressing RLI and demonstrated its ability to increase survival in poorly immunogenic mouse models of GBM in a T cell-dependent manner. RRV-RLI also synergized with GBM standard-of-care chemotherapy with leukocyte single-cell sequencing revealing clonal T-cell expansion, enhanced antigen-driven immune response, and favorable shifts in myeloid populations when the two treatments were combined. T-cell receptor sequencing revealed a selective expansion of tumor antigen-specific receptors, with no detectable evidence of an anti-viral immune response. This approach provides a novel viral cancer immunotherapy for GBM with a high potential for clinical translation.ResultsIL15 expression is associated with immune signaling and T-cell Infiltration in glioblastoma, with implications for gene therapy

[0085] To better understand the applicability of IL-15 as a cancer immunotherapy, we examined baseline IL15 expression across various cancer types and investigated differences between IL15 high and low glioblastoma (GBM) tumors. Analysis of bulk RNA sequencing data revealed that gliomas of all grades, including GBM, exhibited among the lowest levels of IL15 expression across cancer types, whereas thyroid cancer showed the highest expression. In GBM tumors with high IL15 expression, we observed significantly increased expression of immune and inflammatory genes such as IL2RA, CD70, IL6, and CCL11, as well as immunoglobulin genes IGKV1D-17 and IGHV3-72. Subsequent gene ontology analysis indicated upregulation of pathways associated with immunoglobulin production, phagocytosis, antigen binding, receptorligand activity, and molecular mediators of immune response.

[0086] CIBERSORT analysis of 22 different immune cell populations revealed a significant increase in infiltrating CD8+T cells and monocytes in the IL15 high tumors, along with a decrease in infiltrating M0 macrophages. Analysis of available single-cell RNA sequencing data from four resected GBM tumors supported these findings, demonstrating increased infiltration of T-cells and antigen-presenting cells29Together, this data identified GBM as an / / . / 5-deficienttumor with a more favorable anti-tumoral immune microenvironment in those GBMs that happened to have highZ / 5 expression, implicating IL- 15 as an intriguing gene therapy strategy in GBM.

[0087] We therefore generated RRV-RLI, an RRV expressing an codon- and virus-optimized RLI insert following a T2A cleavage site on the RRV backbone as previously described.27RRVs replicate well in tumors due to their reliance on two hallmarks of cancer, sustained proliferative signaling and immunosuppression in the tumor microenvironment.20As such, we aimed to utilize RRV-RLI to convert tumor cells into biofactories for secreted RLI in order to enhance the activation and proliferation of CD8+T cells, NK cells, and antigen-presenting cells and generate an anti-tumor immune response.RRV-RLI efficiently infects and spreads in murine GBM, driving the secretion of functional RLI

[0088] We first sought to understand viral infectivity kinetics in mouse orthotopic GBM tumors in vivo through direct intratumoral injection. We confirmed that SB28 murine GBMs can support the replication of an RRV expressing the emerald (EMD) protein in vivo, with on average 85.5% of intracranial SB28 GBM cells expressing the EMD protein at tumor endpoint after direct intracranial injection, similar to what was seen after implanting a 4% ex vivo- transduced tumor. This also confirmed the efficacy of intracranial injection for viral delivery. We then sought to assess replication and stability of the RRV-RLI viral construct in cultured murine GBM tumor cell lines. The data demonstrated the ability of RRV-RLI to efficiently spread through cultured SB28 cells beginning with multiplicities of infection (MOIs) of 0.1 and 1. Transduced cells exposed to azidothymidine (AZT), which inhibits viral spread, showed no increase in RRV-RLI over time, providing further assurance about the safety of this approach. Similar kinetics of RRV-RLI spread were noted in cultured Tu-2449 murine GBM cells. Given the potential for insert dropout and loss, the stability of RRV-RLI was confirmed using polymerase chain reaction (PCR) across the RLI insert site every two weeks for eight weeks of total culture, with no evidence of RLI insert loss.

[0089] Having confirmed viral kinetics and stability, we then aimed to investigate the production and function of RLI produced by infected tumor biofactories. Using an IL- 15 ELISA, we found that SB28 cells infected with RRV-RLI secreted RLI at an average rate of 16.7 pg / cell / 24 hours. To assess whether the IL- 15 secreted by RRV-RLLtransduced murine GBMcells retained its canonical functions, we performed a series of functional assays. First, conditioned media (CM) from RRV-RLI-infected SB28 cells was applied to CTLL-2 cells, a cytokine-dependent cytotoxic T-cell line derived from C57BL / 6 mice57The RLI secreted from infected tumor cells was able to simulate CTLL-2 growth to a level comparable to a recombinant IL-15 control given at the same concentration (0.33 OD vs. 0.47 OD, p=0.01). Additionally, in a co-culture system with SB28 tumor cells and naive isolated mouse CD8+T cells, RRV-RLI infection of the SB28 cells significantly promoted the expression of the canonical T-cell activation marker CD69 at a higher level than T-cells cocultured with SB28 cells infected with RRV alone or uninfected SB28 tumor cells (p<0.005); confirming the functional ability of RLI to activate T-cells. We also observed increased CD3+CD8+T-cell proliferation as indicated by Ki67 staining at 72 hours of incubation (p<0.05) and improved CD8+T-cell persistence in culture (p<0.005). Subsequent co-culture assays with RRV-RLLtransduced SB28 cells and murine NK cells revealed the ability of RLI to significantly drive NK-cell proliferation (p<0.005). These coculture assays also revealed the ability of RLI secreted by RRV-RLI-transduced SB28 cells to promote NK-cell activation, as evidenced by increased frequencies of double-positive CD69+GZMB+NK-cells (p<0.005) as well as CD69+and GZMB+single-positive NK-cells.RRV-RLI treatment decreases intracranial tumor growth and prolongs survival in two poorly immunogenic murine models of glioblastoma

[0090] Having validated the stability and immunostimulatory effects of RRV-RLI in culture, we next evaluated its therapeutic potential in vivo using SB28 and Tu2449 murine GBM lines implanted intracranially in syngeneic C57BL / 6 and B6C3F1 mice. In the SB28 model, RRV-RLI treatment significantly reduced tumor growth and extended median survival compared to control (PBS or RRV alone, 19 vs. 55 days, p=0.0016), with long-term survival in 12% of treated mice. These findings were recapitulated and improved in the Tu2449 murine GBM model. In Tu2449 tumors, RRV-RLI treatment led to pronounced tumor growth reduction on bioluminescent imaging (BLI). Survival of RRV-RLI-treated mice with Tu2449 GBMs was similarly significantly increased relative to control mice, with the majority of RRV-RLI treated mice experiencing complete tumor regression and long-term survival (p=0.005). Rechallenge of mice cured from Tu2449 GBMs with contralateral intracranial injections of Tu2449 tumor cells demonstrated immunologic memory and rejection of injected cells with sustained survival. Blood samples from RRV-RLI-treated SB28 mice showed no detectable RLI, confirming the localizedeffect of the treatment within the tumor immune microenvironment and the absence of systemic spread.RRV-RLI induces significant anti-tumor modulation of the GBM immune microenvironment

[0091] To better understand the mechanisms behind RRV-RLI’ s therapeutic benefit, we transcriptomically analyzed the effect of RRV-RLI treatment on immune cells in the SB28 microenvironment using the NanoString nCounter platform and a multiplex panel of 770 genes encoding markers of different immune cell types, common checkpoint inhibitors, and mediators of both the adaptive and innate immune responses. Differential gene expression analysis comparing RRV-RLI-treated tumors to control tumors revealed that 10 days after RRV-RLI treatment, tumors exhibited elevated transcription of the T-cell modulating and co-stimulatory protein Thyl (fold change=5.2, padj=0.001); chemokine Ccl8 (fold change=29, padj<0.001); cytotoxic T-lymphocyte granule granzymes Gzma (fold change=81, padj<0.05) and Gzmb (fold change=51, padj<0.05); and T-cell activation marker Pdcdl (fold change=42, padj<0.05), as well as reduced expression of Cd276 (fold change=-4.3, padj<0.01), which encodes the immune checkpoint protein B7-H3 (associated with inhibiting cytotoxic T cell function and suppressing anti-tumor immune responses)5 55. Gene set enrichment analysis (GSEA) comparing RRV-RLI to PBS treatment revealed that RRV-RLI promoted the upregulation of T-cell and NK-cell functionality, antigen processing, and MHC pathways. Further interrogation of genes related to IL-15 mediated functions, including T-cell and NK-cell functionality, antigen processing, and cytokine signaling revealed a diffuse upregulation in RRV-RLI-treated mice, including genes involved in the IL-15 signaling pathway. Significantly upregulated genes of specific relevance to IL- 15 functions included those involved in MHC class I function and pathways (H2-m3, H2-dl, Tap2, H2-t23, H2-kl, Psmb8) and lymphocyte trafficking (Ccr2, Ccr7, Ccr9, Cxr3). Gene network analysis uncovered a highly interconnected immune response with extensive interactions among genes involved in leukocyte cell-cell adhesion, mononuclear cell differentiation, and T-cell differentiation, supporting the notion of a coordinated immune response elicited by RRV-RLI treatment. Overall, RRV-RLI-treated SB28 GBMs demonstrated a transcriptomic profile reflecting increased tumor-infiltrating T-cells, NK-cells, and dendritic cells relative to SB28 GBMs treated PBS. These findings suggest that RRV-RLI treatment promotes a robust and coordinated antitumor immune response.

[0092] When comparing RRV-RLI to RRV to isolate the effect of RLI, we similarly observed increases in pathways related to NK-cell function, interferon, adhesion, T-cell function, dendritic cell function, antigen processing, and MHC proteins. Differential gene expression between RRV- RLI and RRV-treated GBMs revealed increases in Klra6 (modulator of NK cell function, promotes killing in the setting of downregulated MHC I, fold change=48, padj<0.001) and Tnfrsf9 (4-1BB, powerful co- stimulatory molecule critical for enhancing T cell immune responses, fold change=160,Upregulation of genes involved in mediating T- and NK-cell function or lymphocyte trafficking was also seen (e.g. Ccr2, Cxcr3, Cxcll2). When comparing RRV-RLI-treated GBMs harvested at day 14 post-implantation versus at endpoint, we observed a significant decline in most infiltrating immune cell populations, including T-cells and NK-cells. This suggests that the initial robust antitumor immune response induced by RRV-RLI treatment lacks durability in those mice that eventually failed to respond. Additionally, mice treated with RRV alone showed a paucity of immune infiltration at the day 14 timepoint, implicating RLI as the primary driver of the therapeutic effect observed.CD8+and CD4+T cells drive the antitumor al effects of RRV-RLI in murine GBM

[0093] We then investigated the role of T-cells and their subtypes in the antitumoral effects of RRV-RLI in SB28 GBM treatment through antibody -mediated depletion studies. As expected, with isotype control depletion alone, we continued to see a therapeutic benefit from RRV-RLI treatment (p<0.005). However, when systemically depleting CD4+and CD8+T cells prior to tumor implantation and throughout the experiment after treatment, we observed complete abrogation of the RRV-RLI therapeutic benefit (p=0.44). The efficacy of depletion was confirmed using the blood of tumor-bearing mice at 1 and 15 days after tumor implantation with reductions in CD3+, CD8+, and CD4+populations to near undetectable levels (p<0.05 for all populations). To better understand immune cell populations contributing to the RRV-RLI therapeutic benefit we then investigated systemic CD8+T-cell depletion alone. While CD8+T cell depletion resulted in 37.5% survivorship, there was no significant difference between RRV- RLI and PBS control in tumor-bearing CD8+-depleted mice (p>0.1), implicating CD8+cytotoxic T cells as being necessary for the therapeutic benefit seen with intratumoral RRV-RLI treatment.Anti-PDl therapy fails to overcome tumor escape from RRV-RLI treatment

[0094] Given the dependence of RRV-RLI on T-cell-mediated antitumor immune responses, the observed upregulation of Pdcdl seen in our transcriptomic analysis, and the efficacy of anti-PD1 therapies in treating many types of cancer,35we explored the therapeutic potential of combining RRV-RLI with anti-PDl blockade. Consistent with the known low immunogenicity of SB28 and its known resistance to checkpoint blockade,56systemic anti-PDl treatment alongside PBS intracranial injection did not elicit a statistically significant improvement in bioluminescent imaging or survival in tumor-bearing mice compared to isotype control (median survival 20 days vs. 23 days, p=0.132).

[0095] We then assessed whether inhibiting PD-1 signaling on circulating and intratumoral T cells via systemic anti-PDl therapy could enhance the therapeutic efficacy of intratumoral RRV- RLI in the SB28 murine GBM model. While there was a trend towards decreased bioluminescent tumor signal (p=0.23) and a higher percentage of long-term survivorship (20% vs. 10%,) this combination failed to yield a significant improvement in median survival or tumor regression when compared to RRV-RLI plus isotype control (median survival 43 days vs. 51.5 days, p=0.699), suggesting that, while RRV-RLI enhanced intratumoral immune cell infiltration and prolonged survival of GBM-bearing mice, PD-1 signaling alone was not a primary driver of treatment failure.Antitumoral efficacy of RRV-RLI against murine GBM is potentiated by systemic chemotherapy

[0096] Given the importance of antigen quality and dominance in orchestrating an effective anti-tumor immune response,57hypothesized that temozolomide (TMZ) - a cytotoxic, DNA- damaging alkylating chemotherapy and the standard of care for newly diagnosed GBM - could enhance antigen availability in the tumor microenvironment (TME) by inducing tumor cell death. By combining RRV-RLI with systemically administered TMZ, we aimed to potentiate the T- and NK-cell infiltration and activation induced by RRV-RLI treatment (Fig. 6A). Indeed, the combination of systemic TMZ with intratumoral RRV-RLI resulted in tumor remission in a significant proportion of treated mice with orthotopic SB28 GBMs, with improvement over RRV-RLI (median survival undefined vs. 48 days, p=0.0334) or PBS injection with systemic TMZ monotherapy (median survival undefined vs. 32 days, p=0.0004).

[0097] This therapeutic synergy was further reflected in sustained reductions of bioluminescent signal in RRV-RLI+TMZ combination cohort relative to RRV-RLI+ Vehicle and control groups. Flow cytometric analysis of intratumor immune cells (CD45+) revealed significantly enhanced infiltration of anti-tumoral T cell populations including CD3+,CD3+CD8+, and CD3+CD4+T-cells in the RRV-RLI treatment groups (RRV-RLI + Vehicle or RRV-RLI + TMZ) relative to controls (PBS+ Vehicle or PBS +TMZ). T-regulatory cells (CD3+CD4+FoxP3+CD25+) were not a significant population in any treatment group.

[0098] In line with the mechanism of RLI, further flow cytometric analysis demonstrated increased populations of NKT and NK cells in the RRV-RLI treatment groups. Notably, there was no difference in T-cell or NK-cell populations between RRV-RLI and RRV-RLI+TMZ treatment arms. The T-cells and NK-cells within the TME of RRV-RLI-treated mice exhibited high levels of Ki67 expression across CD3+, CD3+CD8+, and CD3+CD4+cells with no difference between RRV-RLI+ Vehicle and RRV-RLI+TMZ.

[0099] We next focused on the behavior of myeloid populations in the TME. RRV-RLI treated groups had significantly reduced infiltration of cells expressing the pan-myeloid marker CD1 lb with no difference between RRV-RLI+Vehicle and RRV-RLI+TMZ. Analysis of myeloid subpopulations revealed a decrease in macrophage (CD1 lb+ F4 / 80+) infiltration in RRV- RLI+TMZ treated mice relative to mice receiving TMZ alone (p=0.01) though no significant differences were observed between RRV-RLI treatment groups. Conventional dendritic cell (CD1 lb+CD1 lc+MHCII+) infiltration did not significantly differ between treatment groups.

[0100] Flow cytometric analysis of peripheral blood from treated mice demonstrated a significant reduction in live CD45+cells per 100 uL of blood in the TMZ-treated cohort compared to vehicle-treated animals, consistent with the lymphodepletion commonly observed in patients undergoing TMZ therapy. This reduction extended to CD3+and CD3+CD8+populations when comparing RRV- RLI + Vehicle and RRV-RLI + TMZ. These findings overall suggested that adding systemic TMZ to intratumoral RRV-RLI allowed the same levels of immune cell populations to infiltrate tumors and augmented the proliferation of these cells to the same degree despite the systemic myelosuppressive effects associated with TMZ treatment.Single-cell sequencing of intratumoral leukocytes after treatment with RRV-RLI and temozolomide reveals potent anti-tumor immune modulation

[0101] To understand how TMZ was potentiating the effects of RRV-RLI without altering levels of the immune cell populations we interrogated by flow cytometry, we performed 5’ single-cell sequencing of CD45+leukocytes, isolated by fluorescence-activated cell sorting from SB28 GBMs treated with intratumoral RRV-RLI and / or systemic temozolomide. Afterprocessing, a total of 28, 125 cells were annotated into 17 different clusters. T and NK cells were then relabeled into 12 phenotypic clusters based on predetermined markers. RRV-RLI treatment groups exhibited higher levels of T and NK cell infiltration as compared to PBS control groups, with marked expansions in specific clusters including NKT cells, NK cells, and CD8+T cell populations.

[0102] Differential gene expression analysis of tumor-infiltrating CD8+T cells between RRV- RLI + TMZ and RRV-RLI + Vehicle demonstrated upregulation of genes indicative of cytotoxic immune activity and antitumor immunity including Gzmb (log2FC=0.67, padj=2.13e-12) , Gzmc (log2FC=2.23, padj =1.5e-14), Gzmd (log2FC=5.72, padj =1.32e-10), Gzmc(log2FC=6.27, padj=2.53e-7), Gzmf (log2FC=6.81, padj=4.72e-17), and Gz / w (log2FC=8.50, padj=4.14e-7). Additionally, there was notable downregulation of Tox (log2FC=-1.0, padj=4.45e-5), indicative of reduced T-cell exhaustion.38Further gene set enrichment analysis (GSEA) revealed enrichment of biological processes related to chemotaxis, cell killing, and response to chemokines in RRV-RLI + TMZ as compared to RRV-RLI + Vehicle. Similar trends in gene expression and GSEA were seen when comparing NKT cells between these groups.38Together, these findings highlight the synergistic effects of temozolomide and RRV-RLI in enhancing cytotoxic immune activity, reducing T-cell exhaustion, and promoting antitumor immune processes within the GBM TME.

[0103] Attention was then turned to myeloid populations across the different treatment groups, identifying 20 different myeloid sub-clusters using scType39and expression of canonical marker genes.40 42As observed in flow cytometric analyses, myeloid populations were a lower fraction of total CD45+cells in RRV-RLI treatment groups, with a disproportionate decrease in the macrophage population when compared to PBS groups. However, MHC class I gene expression was increased in RRV-RLI treatment groups, with even higher expression overall in the RRV- RLI+TMZ combination. This increase was particularly evident in genes including H2-q6, H2-q7, H2-q4, H2-ql0, H2-kl, H2-dl.

[0104] Specific myeloid cell populations with increased MHC class I gene expression varied but included myeloid DC 1 and 2 cells, neutrophils, and precursor myeloid DC cells. These findings supported the hypothesis that TMZ-induced cell death and antigen release led to enhanced antigen-presentation by myeloid cells in the GBM TME.

[0105] To assess potential interactions between these gene expression changes we conducted a ligand-receptor analysis using CellChat. Comparing CD8+T cells between RRV-RLI + Vehicle and PBS + Vehicle identified increased receptor-ligand signaling dominated by antigen presentation signaling primarily through MHC class I proteins from multiple myeloid cell populations (including neutrophils, myeloid DC 1, myeloid DC2, and macrophages / microglia) to the CD8+T cell population suggestive of cross-presentation of antigens. This antigen presentation signaling was further amplified when comparing CD8+T cells between RRV-RLI + TMZ vs. RRV-RLI + Vehicle. Similarly, enhanced signaling pathways related to migration and immune cell infiltration (e.g., Sppl signaling) were observed in both comparisons. These results demonstrate that the combination of temozolomide with RRV-RLI enhances myeloid cell- mediated antigen presentation, likely amplifies cross-presentation to CD8+ T cells, and drives robust immune activity in the TME.T-cell receptor sequencing suggests tumor antigen-specific T-cell responses induced by RRV-RLI treatment and potentiated by the addition of TMZ to RRV-RLI

[0106] To further elucidate the impact of each treatment on the T-cell receptor (TCR) repertoire on tumor-infiltrating T-cells, TCR sequencing was performed on tumor-infiltrating T- cells. Comparison of TCR repertoire between treatment groups revealed over double the percent recurrent TCRs sequenced in the RRV-RLI+TMZ treatment group vs. the RRV-RLI+ Vehicle group (15.3% vs. 7.2% ), suggestive of clonal expansion and an antigen-driven immune response / 5This was further supported by a higher percentage of the TCR repertoire space being occupied by recurrent clonotypes in tumors treated with RRV-RLI+TMZ vs. RRV-RLI+Vehicle, indicating that combining RRV-RLI and TMZ enhanced the antigen-specific immune response relative to RRV-RLI alone.

[0107] T-cell receptor (TCR) clustering was performed using CDR3 beta-chain sequences from all samples. We found that 1,810 out of 1,813 TCRs were within 80 distance units of each other. The top 10 clusters accounted for 91.7% of the sequenced TCRs (1,659 out of 1,813 TCRs), and each of these clusters included TCRs from a PBS-treated control group (non-virus exposed), suggesting that the majority of TCRs after treatment were directed against tumoral antigens rather than viral antigens.

[0108] To further assess how much of the response to RRV-RLI was directed against tumoral versus viral antigens, we then assessed the similarity between our TCR sequences and those specific to pathogens and murine leukemia virus (MLV) as reported in the McPAS-TCR database / 4In total, 42 out of 1,813 beta chain TCRs (2.3%) were within 18 distance units of a pathogen-specific TCRs from McPAS-TCR. Notably, none of the TCRs reactive to the envelope protein of MLV were within 100 distance units for paired chains or 18 distance units for beta chains in our samples.

[0109] Subsequently, we performed exact matching on the beta chain TCR data. There were 45 exact matches across all TCR sequences. Importantly, no exact matches were found in our data for beta chains of TCRs reactive to MLV envelope proteins. We identified a total of 24 exact matches corresponding to pathogen-specific TCRs, which mapped to herpes simplex virus type 1 (HSV-1), influenza virus, and murine cytomegalovirus (mCMV). Together, these findings suggested that the TCRs we had identified were part of a tumor-specific response enhanced by RRV-RLI and RRV-RLI+TMZ rather than an antiviral response triggered by RRV-RLI.Discussion

[0110] The IL-15 superagonist RLI is a potent immunostimulatory agent with the ability to enhance an anti-tumor immune response through T- and NK-cell modulation. Our study evaluates RRV-RLI as a viral immunotherapy for the treatment of GBM. We demonstrate that tumor cells infected with RRV-RLI produce functional RLI with canonical functions such as supporting T- and NK-cell proliferation. Single-agent intratumoral RRV-RLI treatment resulted in significantly improved survival in the immunosuppressive SB28 model and long-term survival with immunologic memory to contralateral orthotopic rechallenge in the Tu2449 GBM model. RRV-RLI also synergizes with GBM standard of care in the form of TMZ chemotherapy to provide a long-term survival benefit in the SB28 model. RRV is a highly translatable vector platform with a strong safety profile in patients even when delivered intravenously.50This work establishes RRV-RLI as a novel and translatable viral cancer immunotherapy underscoring its potential for clinical application in humans.

[0111] IL- 15 is regarded as a promising immunocytokine for cancer immunotherapy.45While other cytokines, such as IL -2, promote T cell growth, they also act as a 'double-edged sword' by concurrently upregulating T-regulatory cells and triggering activation-induced cell death (AICD)or capillary leak syndrome. In comparison, IL-15 supports the proliferation and activation of CD8+T-cells (including memory phenotype), NKT cells, and NK cells.76 77Moreover, IL-15 induces pro-inflammatory changes within the tumor microenvironment and has demonstrated synergy when combined with other immune and chemotherapeutic agents.50,57

[0112] Local delivery of immunotherapies directly to the TME mitigates the dose-limiting toxicities associated with systemic administration. In the brain, this approach also circumvents the blood-brain barrier (or blood-tumor barrier), a major obstacle for many systemically administered treatments. In this study, we aimed to transform GBM tumor cells into biofactories for RLI through delivery via RRV, a virus that selectively spreads in dividing cells without inherently killing host cells. Our rationale was that this strategy would create a portion of tumor cells secreting RRV-RLI and a field effect across the tumor with the goal of in situ tumor vaccination.

[0113] We observed that local delivery and tumor-mediated secretion of RLI in intracranial tumors produced outcomes in line with or superior to those observed with systemic administration of RLI in other cancer types or ALT-803, an alternative IL-15 superagonist, in GBM.52 57An advantage of our study is that our findings were in two syngeneic GBM models with best-in-class translatability with regard to the investigation of immunotherapies.56Directed tumor delivery of RRV-RLI led to a significant survival benefit in both the SB28 and Tu2449 GBM models. Notably, treated Tu2449 mice exhibited over 90% long-term survivorship and developed immunologic memory upon intracranial rechallenge, effectively demonstrating successful vaccination against tumor cells. We attribute the differential response to single-agent RRV-RLI treatment between the two models to variations in their underlying tumor immunogenicity. While Tu2449 is also poorly immunogenic relative to most murine GBM models, it does exhibit higher T-cell infiltration and a higher (but still low) baseline rejection rate compared to the SB28 model, indicating increased immunogenicity. SB28 being one of the least immunogenic models makes it more representative of human GBM, characterized by low T cell infiltration and a low tumor mutational burden.5655Impressively, RRV-RLI treatment alone significantly increased CD8 T-cell, NKT cell, and NK-cell infiltration in treated SB28 mice from near undetectable levels. We believe these findings are promising for the treatment of human GBM, where CD8+T-cell infiltration is estimated to be under 5% of tumor-infiltrating immunecells, similar to the SB28 model.56RRV-RLI treatment also induced broad transcriptomic inflammatory changes within the TME and upregulated antigen-presenting pathways. These findings align with existing literature highlighting the role of IL- 15 in the maturation and function of antigen-presenting cells.57Collectively, this manipulation of the local TME enhanced the immunogenicity of an otherwise immunologically silent tumor.

[0114] Given the increased infiltration of both T-cell and NK-cell populations in the TME, we sought to examine the critical mediators of the RRV-RLI treatment response. Simultaneous depletion of both CD4+and CD8+T cells as well as CD8+T cells alone abrogated the survival benefit imbued by RRV-RLI treatment, indicating a reliance on those T cell populations for treatment efficacy, despite increased NK-cell infiltration in treated tumors. This is in line with previous work using ALT-803 in GBM which saw a reduction in treatment efficacy with CD4+or CD8+T-cell depletion, but not with NK-cell depletion.58The role of NK-cells in mediating anti-tumor efficacy in response to systemic IL- 15 immunotherapy has varied, with some cancer models demonstrating a dependence on NK-cells59and others proving reliant only on tissueresident CD8+T-cells.5460Interestingly, CD8 depletion did not significantly affect overall survival but did result in a subset of long-term survivors among RRV-RLI-treated mice, indicating a heterogeneous response to RRV-RLI in this context, with the lack of long-term survivors in mice with simultaneous CD4 and CD8 depletion potentially suggesting a dynamic compensatory role for CD4+T cells and NK cells in the RRV-RLI response in the absence of CD8+T cells.

[0115] An inherent challenge to the translation of immunotherapies to GBM is understanding interactions with standard of care, especially temozolomide which causes myelosuppression as a known dose-limiting toxicity.67,62Interestingly, the combination of RRV-RLI and temozolomide worked synergistically to provide a significant survival benefit compared to either treatment alone. Flow cytometric analysis of the TME revealed no gross differences in immune cell infiltration between the RRV-RLI monotherapy and the combination therapy with temozolomide, highlighting the sustained presence of tumor-infiltrating T-cells despite systemic myelosuppression as indicated on flow cytometry of peripheral blood samples. This has important implications for clinical translation given the widespread use of TMZ in patients. 5’ single cell RNA sequencing of the treatment groups also revealed similar immune cellinfiltration, in congruence with the flow cytometry- with no difference between RRV-RLI alone and with TMZ. Interestingly, RRV-RLI treatment elicited enhanced activation of T-cells and NKT-cells, evidenced by the upregulation of cytotoxicity-associated genes such as Gzmb and the downregulation of Tox, a marker of T-cell exhaustion.55Additionally, single-cell T-cell receptor (TCR) sequencing revealed more than double the percentage of recurrent TCR clonotypes in the RRV-RLI + temozolomide (TMZ) group, indicative of a robust antigen-specific response. The presence of non-virus exposed samples (PBS and PBS + TMZ) in the majority of dominant TCR clusters in combination with the paucity of MLV and pathogen-specific TCR matches or similarities support a tumor-specific reaction rather than one against the viral therapy. These findings, coupled with the increased expression of MHC class I genes in myeloid populations within both the RRV-RLI+ Vehicle and RRV-RLI+TMZ groups, support the hypothesis that TMZ-induced cell death and tumor antigen release in the TME provides additional antigenic material for antigen-presenting myeloid cells. These cells, likely further activated by local RLI expression, facilitate cross-presentation to CD81T-cells. This is further corroborated by CellChat analysis, which demonstrated increased MHC class I-CD8 T cell receptor-ligand interactions in the RRV-RLI+ Vehicle group compared to control, with even greater enhancement observed in the RRV-RLI+TMZ group compared to RRV-RLI+Vehicle.

[0116] Others have employed various oncolytic platforms, such as herpesviruses (HSV), vesicular stomatitis virus (VSV), and poxviruses, to deliver local immunotherapies to tumors.6365Although these vectors can replicate in neoplastic tissue, their lytic nature leads to early tumor cell destruction and can trigger robust antiviral host responses - such as NK-cell activity and Type I interferon signaling - that limit the duration and breadth of intratumoral transgene delivery.66’67Recent work in VSV has demonstrated the generation of anti-viral T-cell responses that can, in fact, detract from concurrent immune checkpoint inhibition.65Previous work has also demonstrated improved delivery of an HSV oncolytic platform with pre-delivery immunosuppression via TGF-0 administration.69In contrast, our non-lytic replicating retrovirus can suppress type I interferon signaling and spreads throughout the tumor mass without inducing immediate cell death or a robust anti-viral response, enabling sustained and uniform intratumoral delivery of the therapeutic transgene.70We achieved over 85% tumor cell infection in orthotopic GBM models by 18 days post-injection and do not see evidence of an anti-viral immune response in our TCR sequencing. Furthermore, non-replicating viral vectors such as adeno-associated viruses (AAVs) and lentiviruses, while safe and stable, lack the capacity for on-site amplification in rapidly dividing tumor cells. As a result, these non-replicating vectors cannot effectively scale with tumor growth and have difficulty reaching a significant number of tumor cells, limiting their ability to achieve extensive and persistent therapeutic gene expression. Our use of a non-lytic, replicating retroviral platform thus addresses key limitations of both lytic oncolytic viruses and non-replicating vectors for IL- 15 delivery in the challenging context of solid tumors.

[0117] This study positions RRV-RLI as a potent and clinically translatable viral immunotherapy for GBM, showcasing its ability to drive robust activation of T-cells, NK-cells, and enhanced antigen presentation in the TME. Treatment with RRV-RLI significantly extends survival in two distinct syngeneic murine GBM models and synergizes effectively with the current standard of care chemotherapy. Furthermore, our TCR-sequencing demonstrating the lack of immunogenicity of the RRV backbone supports RRV as a delivery vehicle for the potent RLI transgene and supports the tolerability of repeat treatments in future studies. Overall, our findings provide compelling preclinical evidence to support a Phase I clinical trial to evaluate the safety and efficacy of RRV-RLI in human patients. Moreover, the versatility of this therapeutic approach holds promise for broader application across other cancer types, offering a novel paradigm in the treatment of solid tumors.MethodsStudy design

[0118] The objective of this study was to assess the therapeutic potential of RRV-RLI and to elucidate the underlying biological mechanisms driving its efficacy. For in vivo experiments, 8- 12 week-old mice were utilized, with 6 to 10 mice per group, ensuring adequate statistical power based on preliminary data. Mice were randomized into treatment arms following tumor implantation, with randomization based on bioluminescent imaging to equalize the average starting tumor sizes across groups. All experiments adhered to Institutional Animal Care and Use Committee (IACUC) guidelines, with predetermined survival endpoints applied. Mice reaching non-tumor endpoints were censored from survival analyses.Construction of RRV-RLI

[0119] Gibson assembly cloning was used to place a codon- and stability- optimized genetic sequence for RLI77into pAC3-P2A-yCD. A T2A cleavage peptide sequence was positioned at the C-terminus of the viral envelope protein followed by the RLI sequence.Cell lines and culture

[0120] Human embryonic kidney 293T (Lenti-X cells, purchased from Takara, Inc.), murine glioblastoma Tu2449 (generously provided by Dr. Noriyuki Kasahara, University of California, San Francisco), and human glioblastoma U87 (generously provided by Dr. Noriyuki Kasahara, University of California, San Francisco) were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and IX Gibco GlutaMAX (Gibco, Inc.). Murine glioblastoma SB28 (generously provided by Dr. Hideho Okada, University of California, San Francisco) were cultured in RPMI 1640 medium supplemented with 10% FBS, 2% Gibco GlutaMAX, 1% non-essential amino acids (Gibco, Inc.), 1% HEPES (Gibco, Inc.), 1% Penicillin-Streptomycin (Gibco, Inc.), and 0.1% beta-mercaptoethanol. Cells were screened bimonthly for mycoplasma and validated every six months by Short Tandem Repeat (STR) analysis at the University of California Cell Culture Facility.Viral production and concentration

[0121] Virus was produced via transient transfection and the use of stable producer cell lines. For transient transfection protocols, reverse transfection utilizing Fugene HD (Promega) and 10 micrograms of viral plasmid DNA was implemented. Stable U87 producer cell lines were also utilized for viral production. Virus containing supernatant was collected at approximately 36-48 hours after initial transfection. For in vivo studies virus was concentrated using column-based retrovirus purification with buffer exchange to phosphate buffer solution (PBS) (Bioland Scientific LLC.). Functional viral titers in transducing units per mL (TU / mL) were determined via staining for the viral gag-protein and flow-cytometry.In vitro viral replication and stability

[0122] Viral replication and stability were performed in a similar manner to previous studies.72In brief, specific multiplicities of infection (MOI) were added to tumor cells in vitro and allowed to replicate over time, with transduction levels measured at regular intervals via staining for the gag viral protein and flow cytometry. Azidothymidine, which inhibits viral spread, was utilized for control groups. For viral stability, an MOI of 0.01 was added to tumor cells and allowed to spread to 100% transduced cells at 14 days. The resulting supernatant was then placed on tumorcells at an MOI of 0.01 and the protocol was repeated for a total of 8 weeks. Genomic DNA was then isolated using the Monarch® Genomic DNA Purification Kit (NEB Biolabs). Polymerase chain reaction with primers crossing the RLI insert were used to determine stability of the construct. Primer sequences were as follows: FWD: ggaccttgcattctcaatcgattgg REV: cccctttttctggagactaaataa.RLI production and function

[0123] RLI production levels were determined using supernatant from 100% infected SB28 tumor cells. RLI levels in the supernatant was measured via Human IL-15 Quantikine enzyme- linked immunosorbent assay (R&D Systems). RLI function was determined using the CTLL-2 proliferation assay similarly to previous studies.75In brief, RLI from transduced cells was added to cytokine-starved CTLL-2 cells with proliferation of these cells subsequently measured via Colorimetric MTS Assay (Promega). Co-culture assays were conducted by incubating SB28 tumor cells with freshly isolated NK cells (BioLegend MojoSort™ NK Cell Isolation Kit) or CD8+ T cells (BioLegend MojoSort™ CD8 T Cell Isolation Kit) from C57BL / 6 spleens. Tumor and effector cells were co-cultured at varying tumor-to-effector cell ratios and conditions. Activation markers were measured via flow cytometric analysis. Cytotoxic activity was measured using the xCelligence real-time cell analysis system.Animal studies

[0124] Animal experiments were approved by UCSF IACUC (approval #AN105170-02). C57BL / 6 and B6C3F 1 mice (8-12 weeks old) were obtained from Jackson Laboratories and housed at the University of California, San Francisco. Experiments utilizing Tu2449 and SB28 murine glioblastoma cell lines were conducted under comparable conditions. All cell lines expressed luciferase to facilitate bioluminescent imaging. On day 0, 10,000 tumor cells were implanted intracranially using a stereotactic frame at the following coordinates relative to the bregma: anteroposterior (AP), 0 mm; mediolateral (ML), 1.2 mm; and dorsoventral (DV), 3.5 mm. Mice were imaged on day 3 or day 4 post-tumor injection to establish pretreatment bioluminescent baselines, after which they were randomized into treatment groups. On day 4 post-tumor implantation, mice were injected with 2.5 x 10 5 TU of either RRV-RLI or control RRV, depending on the assigned treatment group.

[0125] For the anti-PDl combination experiments, mice were administered either anti-PDl antibody (RMP1-14, BioXcell) or isotype control (BioXcell) at a dose of 200 pg, delivered via intraperitoneal injection on day 7 and day 24 post-tumor implantation, with subsequent dosing every other day for a total of four doses. In the TMZ combination experiments, mice were treated with temozolomide (TMZ) at a total dose of 400 mg / kg, administered over three days (diluted in 10% DMSO, T2577 Sigma Aldrich) starting on day 15 post- virus injection, or with vehicle control (10% DMSO).

[0126] For T cell depletion studies, depletion antibodies were administered two days prior to tumor implantation and subsequently continued biweekly post-implantation. A total of 400 pg of anti-CD8 antibody (200 pg YTS 169.4, BioXcell; 200 pg 53-6.7, BioXcell) and 200 pg of anti- CD4 antibody (GK1.5, BioXcell) were administered. Control mice received 600 pg of isotype antibody (LTF-2, BioXcell). Depletion was confirmed on days 1 and 15 after tumor implantation. Survival data were plotted using the Kaplan-Meier method, with statistical comparisons between groups performed using the Log-rank test (GraphPad Prism 9).Analysis of immune alterations

[0127] Mice were sacrificed at endpoint, day 14 post-tumor injection timepoint (non-TMZ studies), or day 18 timepoints (TMZ studies). The following tissues were harvested: spleen, bone marrow, blood, and brain tumor. Brain tumors were minced and digested in collagenase type IV (Thermo Fisher Scientific, #17104019) and Deoxyribonuclease I (Worthington Biochemical Corporation) solutions while agitated at 37°C. Tumor suspensions were subsequently filtered through 70 pm filters, and red blood cells were lysed using Ammonium-Chloride-Potassium (ACK) lysing buffer (Lonza). Spleens were dissociated through 40 pm filters and similarly subjected to ACK lysis, as was the bone marrow.

[0128] Flow cytometric analysis was then performed on processed tissues. A detailed list of antibodies can be found in Supplemental Table 1. Briefly, cells were first blocked with mouse Fc block in PBS containing 2% bovine serum albumin (BSA). After Fc blocking, cells were washed and stained with Zombie Aqua fixable viability dye (BioLegend, #423101) in PBS. Following viability staining, cells were washed again and stained for surface markers in PBS with 2% BSA. Intracellular marker staining was performed using the eBioscience™ Foxp3 / Transcription Factor Staining Buffer Set (Thermo Fisher Scientific, #00-5523-00). Data acquisition was conductedusing an Attune NxT Flow Cytometer (Thermo Fisher Scientific), and flow cytometry data were analyzed using FlowJo software.Nanostring multiplex transcriptomic analysis

[0129] RNA was extracted from murine tumor single-cell suspensions using the RNeasy Mini kit (Qiagen) and stored at -80°C until further use. RNA quality and quantity were assessed using a bioanalyzer. For each sample, 100 ng of RNA was hybridized with the Nanostring Mouse PanCancer Immune Profiling codeset for 18 hours. A 30 pL aliquot of the reaction was loaded into the nCounter cartridge and processed on the nCounter SPRINT Profiler. Quality control and raw data alignment were conducted using nSolver (Nanostring).

[0130] Differential gene expression analysis was performed using the DESeq2 package in R, followed by pathway expression analysis as defined by the KEGG 2019 Human database, utilizing the Enrichr pipeline. Simultaneously, raw files were analyzed on the Rosalind online platform (OnRamp Bio) to calculate normalized gene expression counts, determine significance of differentially expressed genes, and derive cell type scores. Visualizations, including heatmaps and volcano plots, were generated using GraphPad Prism 10.Mouse scRNA sequencing and immune cell profiling analysis

[0131] Brain tumors were processed as previously described on day 18 after tumor implantation. CD45+cells were isolated via fluorescence activated cell sorting. 5’ scRNA-seq with TCR sequencing was carried out using the 10X Genomics platform and per manufacturer instructions. Sequencing was performed on the Illumina Novaseq 6000.

[0132] Single-cell FASTQ files, along with paired TCR V(D)J immune profiling FASTQ files, were aligned using CellRanger (version 7.2, 10X Genomics). The resulting expression matrices were imported into RStudio (version 4.3.2) for downstream analysis. Standard pre-processing was conducted using Seurat (version 5.0.3). The dataset included 2,928 cells in the PBS condition, 8,716 cells in the TMZ condition, 6,225 cells in the RRV-RLI + Vehicle condition, and 10,872 cells in the RRV-RLI + TMZ condition. Cells expressing more than 200 genes with less than 10% mitochondrial gene expression were retained for further analysis.

[0133] Samples were integrated using the standard Seurat v5 workflow. In total, 28, 125 cells were assigned across 25 clusters. Cell types were identified using a combination of suggestedlabels from scType and marker gene expression based on literature review. Alluvial bar graphs showing sample composition by cell type were created using ggalluvial (version 0.12.5).

[0134] The integrated samples were divided into lymphocyte and myeloid subsets based on cluster identity. The lymphocyte subset included cells labeled as NK Cells, CD4+ T Cells, CD8+ T Cells, CD8+ NKT-like Cells, and CD4+ NKT-like Cells, while the myeloid subset contained Macrophages, Microglia, Proliferating Microglia, Macrophages / Microglia, Myeloid DCs, Neutrophils, and DC Precursor Cells. Cells in the lymphocyte subset were relabeled according to phenotypes determined by ProjecTILs (version 3.3.0). Cells assigned an "NA" label were presumed to be NK cells, and cells expressing both Cd3e and Klrblc above the 20th percentile were classified as NKT cells.

[0135] Volcano plots were generated using EnhancedVolcano (version 1.2.0). Gene Set Enrichment Analysis (GSEA) was performed using ClusterProfiler (version 4.10.1). Ligandreceptor interaction analysis was conducted with CellChat (version 2.1.2).

[0136] T cell V(D)J sequencing data was analyzed using immunarch (version 1.0.0), and unique clonotypes were identified based on paired TRA and TRB gene sequences. By sample, 66 T cells were sequenced in the PBS condition, 15 in the TMZ condition, 755 in the RLI condition, and 1,052 in the RLI + TMZ condition. Immunarch was also used to find matching TCR CDR3 beta sequences in the McPAS databass. TCR distance analysis was performed using the tcrdist3 package (vO.2.2) in Jupyter notebook (python 3.12.7). All single cell sequencing data analyzed in this study can be accessed from the Gene Expression Omnibus repository, accession code GSE278988.Human bulk RNA-sequencing analysis

[0137] To evaluate the gene expression of IL15 across different cancer types, the TCGA PanCancer Atlas from Hoadley et al. was accessed via cBioPortal (cbioportal.org) for IL15 RSEM scaled estimates in available solid tumor samples.77To investigate differences according to magnitude of IL15 expression in glioblastoma, the TCGA cohort of primary glioblastoma samples was stratified into high and low IL15 expression at the 80th percentile after extracting HTSeq counts via TCGAbiolinks and converting into counts per million (CPM) via edgeR.5Differentially expressed genes were evaluated between high and low IL15 glioblastoma patients via DESeq2 and defined as genes with a Benj mini-Hochberg adjusted p-value < 0.05 and alog2Fold Change > 2. Gene ontology enrichment analysis was performed on overexpressed genes in high IL15 glioblastoma patients to identify the overrepresented biological processes, cellular components, and molecular functions in those tumors. To quantify and compare the immune cell infiltration between high and low IL15 glioblastoma patients, RSEM scaled estimates were converted into transcripts per million (TPM) and processed through the CIBERSORT web application (https: / / cibersortx.stanford.edu / ), a deconvolution algorithm that infers the proportion of 22 types of tumor-infiltrating immune cells from bulk RNA-sequencing data.76Degree of immune cell infiltration was compared using the Mann-Whitney U test. A two- tailed p-value < 0.05 was used as the threshold for statistical significance.Human scRNA and immune cell profiling analysis

[0138] Differences in transcriptomic expression were investigated by analyzing single cell RNA sequencing data from four previously published GBM resection specimens.29Clusters and cell identities largely mirrored those identified in the original study; however, immune cells were further subdivided to refine cell-type classification. This sub classification of immune cells was achieved using labels suggested by SingleR and marker gene expression identified through literature review. Samples were classified s IL15 High or IL15 Low based on standard analysis of IL15 gene expression levels. Differential gene expression was visualized using volcano plots generated with EnhancedVolcano. Gene ontology analysis was conducted using ToppGene, and cellular communication via ligand-receptor interactions was assessed using CellChat.Statistical analysis

[0139] Statistical analyses were performed using Prism 10 (GraphPad). Specific study parameters and statistical methods are detailed within the figure legends. Comparisons between two groups were conducted using a two-tailed Student’s t-test. For comparisons among multiple groups, a one-way ANOVA was employed, followed by Fisher’s LSD post-hoc test for pairwise comparisons, assuming a Gaussian distribution and equal standard deviations. For nonparametric comparisons, the Mann-Whitney U test or Kruskal -Wallis test with Dunn’s post-hoc test was applied. Kaplan-Meier analysis was used for in vivo survival studies, with differences assessed via the log-rank (Mantel-Cox) test. Outliers were removed based on Grubbs’ test.References1 . Stupp, R. et al. Radiotherapy plus Concomitant and Adjuvant Temozolomide for Glioblastoma. New England Journal of Medicine 352, 987-996 (2005).2. Ostrom, Q. T. et al. CBTRUS Statistical Report: Primary Brain and Other Central Nervous System Tumors Diagnosed in the United States in 2012-2016. Neuro Oncol 21, vl- vlOO (2019).3. Young, J. S., Dayani, F., Morshed, R. A., Okada, H. & Aghi, M. K. Immunotherapy for High-Grade Gliomas: A Clinical Update and Practical Considerations for Neurosurgeons. World Neurosurgery vol. 124 397-409 Preprint at https: / / doi.Org / 10.1016 / j.wneu.2018.12.222 (2019).4. Reardon, D. A. et al. Effect of Nivolumab vs Bevacizumab in Patients with Recurrent Glioblastoma: The CheckMate 143 Phase 3 Randomized Clinical Trial. JAMA Oncol (2020) doi: 10.1001 / jamaoncol.2020.1024.5. Montoya, M. L., Kasahara, N. & Okada, H. Introduction to immunotherapy for brain tumor patients: challenges and future perspectives. Neurooncol Pract doi: 10.1093 / NOP / NPAA007.6. Woroniecka, K. I., Rhodin, K. E., Chongsathidkiet, P., Keith, K. A. & Fecci, P. E. T- Cell dysfunction in glioblastoma: Applying a new framework. Clinical Cancer Research vol. 24 3792-3802 Preprint at https: / / doi.Org / 10.l 158 / 1078-0432.CCR-18-0047 (2018).7. Aidape, K., Zadeh, G., Mansouri, S., Reifenberger, G. & von Deimling, A. Glioblastoma: pathology, molecular mechanisms and markers. Acta Neuropathologica vol. 129 829-848 Preprint at https: / / doi.org / 10.1007 / s00401-015-1432-l (2015).8. D’Alessio, A., Proietti, G., Sica, G. & Scicchitano, B. M. Pathological and molecular features of glioblastoma and its peritumoral tissue. Cancers vol. 11 Preprint at https: / / doi.org / 10.3390 / cancersl 1040469 (2019).9. Facoetti, A. et al. Human leukocyte antigen and antigen processing machinery component defects in astrocytic tumors. Clinical Cancer Research 11, 8304-8311 (2005).10. Cristescu, R. et al. Pan-tumor genomic biomarkers for PD-1 checkpoint blockade-based immunotherapy. Science (1979) 362, (2018).11 . Lim, M., Xia, Y., Bettegowda, C. & Weller, M. Current state of immunotherapy for glioblastoma. Nat Rev Clin Oncol 15, 422-442 (2018).12. Alban, T. J. et al. Global immune fingerprinting in glioblastoma patient peripheral blood reveals immune-suppression signatures associated with prognosis. JCI Insight 3, (2018).13. Woroniecka, K. et al. T-cell exhaustion signatures vary with tumor type and are severe in glioblastoma. Clinical Cancer Research 24, 4175-4186 (2018).14. Haddad, A. F. et al. Higher cytolytic score correlates with an immunosuppressive tumor microenvironment and reduced survival in glioblastoma. Sci Rep 10, (2020).15. Chongsathidkiet, P. et al. Sequestration of T cells in bone marrow in the setting of glioblastoma and other intracranial tumors. Nat Med 24, 1459-1468 (2018).16. Filley, A. C., Henriquez, M. & Dey, M. Recurrent glioma clinical trial, CheckMate- 143: the game is not over yet. Oncotarget 8, 91779-91794 (2017).17. Kennedy, L. B. & Salama, A. K. S. A review of cancer immunotherapy toxicity. CA Cancer J Clin 70, 86-104 (2020).18. Chongsathidkiet, P. et al. Sequestration of T cells in bone marrow in the setting of glioblastoma and other intracranial tumors. Nat Med 24, 1459-1468 (2018).19. Haddad, A. F., Young, J. S. & Aghi, M. K. Using viral vectors to deliver local immunotherapy to glioblastoma. Neurosurg Focus 50, 1-7 (2021).20. Haddad, A. F., Young, J. S., Mummaneni, N. V, Kasahara, N. & Aghi, M. K. Immunologic aspects of viral therapy for glioblastoma and implications for interactions with immunotherapies. J Neurooncol (2021) doi: 10.1007 / s 11060-020-03684-5.21. Logg, C. R., Robbins, J. M., Jolly, D. J., Gruber, H. E. & Kasahara, N. Retroviral Replicating Vectors in Cancer. Methods Enzymol 507, 199-228 (2012).22. Lin, A. H. et al. Blockade of Type I Interferon (IFN) Production by Retroviral Replicating Vectors and Reduced Tumor Cell Responses to IFN Likely Contribute To Tumor Selectivity. J Virol 88, 10066-10077 (2014).23. Hogan, D. J. et al. Molecular analyses support the safety and activity of retroviral replicating vector toca 511 in patients. Clinical Cancer Research 24, 4680-4693 (2018).24. Cloughesy, T. F. et al. Effect of Vocimagene Amiretrorepvec in Combination with Flucytosine vs Standard of Care on Survival following Tumor Resection in Patients with Recurrent High-Grade Glioma: A Randomized Clinical Trial. JAMA Oncol 6, (2020).25. Berraondo, P. et al. Cytokines in clinical cancer immunotherapy. British Journal of Cancer vol. 120 6-15 Preprint at https: / / doi.org / 10.1038 / s41416-018-0328-y (2019).26. Desbois, M. et al. IL-15 superagonist RLI has potent immunostimulatory properties on NK cells: Implications for antimetastatic treatment. J Immunother Cancer 8, 632 (2020).27. Desbois, M. et al. IL-15 Trans -Signaling with the Superagonist RLI Promotes Effector / Memory CD8 + T Cell Responses and Enhances Antitumor Activity of PD-1 Antagonists . The Journal of Immunology 197, 168-178 (2016).28. Bessard, A., Sole, V., Bouchaud, G., Quemener, A. & Jacques, Y. High antitumor activity of RLI, an interleukin- 15 (IL-15)-IL-15 receptor fusion protein, in metastatic melanoma and colorectal cancer. Mol Cancer Ther 8, 2736-2745 (2009).29. Darmanis, S. et al. Single-Cell RNA-Seq Analysis of Infiltrating Neoplastic Cells at the Migrating Front of Human Glioblastoma. Cell Rep 21, 1399-1410 (2017).30. Collins, S. A., Shah, A. H., Ostertag, D., Kasahara, N. & Jolly, D. J. Clinical development of retroviral replicating vector Toca 511 for gene therapy of cancer. Expert Opin Biol Ther 21, 1199-1214 (2021).31. Paxton, R. J. Measurement of interleukin 15. Curr Protoc Immunol Chapter 6, (2001).32. Getu, A. A. et al. New frontiers in immune checkpoint B7-H3 (CD276) research and drug development. Molecular Cancer 2023 22: 1 22, 1-15 (2023).33. Picarda, E., Ohaegbulam, K. C. & Zang, X. Molecular Pathways: Targeting B7-H3 (CD276) for Human Cancer Immunotherapy. Clin Cancer Res 22, 3425 (2016).34. Vinay, D. S. & Kwon, B. S. Immunotherapy of cancer with 4-1BB. Mol Cancer Ther 11, 1062-1070 (2012).35. Haddad, A. F., Young, J. S., Gill, S. & Aghi, M. K. Resistance to immune checkpoint blockade: Mechanisms, counter-acting approaches, and future directions. Semin Cancer Biol (2022) doi : 10.1016 / J. SEMCANCER.2022.02.019.36. Haddad, A. F. et al. Mouse models of glioblastoma for the evaluation of novel therapeutic strategies. Neurooncol Adv 3, 1-16 (2021).37. Haen, S. P., Loffler, M. W., Rammensee, H. G. & Brossart, P. Towards new horizons: characterization, classification and implications of the tumour antigenic repertoire. Nat Rev Clin Oncol 17, 595-610 (2020).38. Khan, O. et al. TOX transcriptionally and epigenetically programs CD8+ T cell exhaustion. Nature 571, 211 (2019).39. lanevski, A., Giri, A. K. & Aittokallio, T. Fully-automated and ultra-fast cell-type identification using specific marker combinations from single-cell transcriptomic data. Nature Communications 2022 13:1 13, 1-10 (2022).40. Jurga, A. M., Paleczna, M. & Kuter, K. Z. Overview of General and Discriminating Markers of Differential Microglia Phenotypes. Front Cell Neurosci 14, (2020).41. Wang, L. xun, Zhang, S. xi, Wu, H. juan, Rong, X. lu & Guo, J. M2b macrophage polarization and its roles in diseases. J Leukoc Biol 106, 345-358 (2019).42. Ochocka, N. et al. Single-cell RNA sequencing reveals functional heterogeneity of glioma-associated brain macrophages. Nature Communications 2021 12: 1 12, 1-14 (2021).43. Frank, M. L. et al. T-Cell Receptor Repertoire Sequencing in the Era of Cancer Immunotherapy. Clinical Cancer Research 29, 994 (2023).44. Tickotsky, N., Sagiv, T., Prilusky, J., Shifrut, E. & Friedman, N. McPAS-TCR: a manually curated catalogue of pathology-associated T cell receptor sequences. Bioinformatics 33, 2924-2929 (2017).45. ‘Mac’ Cheever, M. A. Twelve immunotherapy drugs that could cure cancers. Immunol Rev 222, 357-368 (2008).46. C. Ochoa, M. et al. Interleukin- 15 in gene therapy of cancer. Curr Gene Ther 13, 15-30 (2013).47. Pilipow, K. et al. IL 15 and T-cell Sternness in T-cell-Based Cancer Immunotherapy. Cancer Res 75, 5187-5193 (2015).48. Jakobisiak, M., Golab, J. & Lasek, W. Interleukin 15 as a promising candidate for tumor immunotherapy. Cytokine Growth Factor Rev 22, 99-108 (2011).49. Waldmann, T. A. The shared and contrasting roles of interleukin-2 (IL-2) and IL-15 in the life and death of normal and neoplastic lymphocytes: implications for cancer therapy. Cancer Immunol Res 3, 219 (2015).50. Waldmann, T. A., Dubois, S., Miljkovic, M. D. & Conlon, K. C. IL-15 in the Combination Immunotherapy of Cancer. Front Immunol 11, 868 (2020).51. Bergamaschi, C. et al. Heterodimeric IL-15 delays tumor growth and promotes intratumoral CTL and dendritic cell accumulation by a cytokine network involving XCL1, IFN- y, CXCL9 and CXCL10. J Immunother Cancer 8, (2020).52. Bessard, A., Sole, V., Bouchaud, G., Quemener, A. & Jacques, Y. High antitumor activity of RLI, an interleukin- 15 (IL-15)-IL-15 receptor a fusion protein, in metastatic melanoma and colorectal cancer. Mol Cancer Ther 8, 2736-2745 (2009).53. Desbois, M. et al. IL-15 superagonist RLI has potent immunostimulatory properties on NK cells: Implications for antimetastatic treatment. J Immunother Cancer 8, 632 (2020).54. Desbois, M. et al. IL-15 Trans -Signaling with the Superagonist RLI Promotes Effector / Memory CD8 + T Cell Responses and Enhances Antitumor Activity of PD-1 Antagonists . The Journal of Immunology 197, 168-178 (2016).55. Genoud, V. et al. Responsiveness to anti -PD-1 and anti-CTLA-4 immune checkpoint blockade in SB28 and GL261 mouse glioma models. Oncoimmunology 7, el501137 (2018).56. Gonzalez-Tablas Pimenta, M. et al. Tumor cell and immune cell profiles in primary human glioblastoma: Impact on patient outcome. Brain Pathol 31, 365-380 (2021).57. Ohteki, T., Suzue, K., Maki, C., Ota, T. & Koyasu, S. Critical role of IL-15-IL-15R for antigen-presenting cell functions in the innate immune response. Nature Immunology 2001 2:12 2, 1138-1143 (2001).58. Mathios, D. et al. Therapeutic administration of IL-15 superagonist complex ALT-803 leads to long-term survival and durable antitumor immune response in a murine glioblastoma model. Int J Cancer 138, 187-94 (2016).59. Yajima, T. et al. Overexpression of interleukin- 15 in vivo enhances antitumor activity against MHC class negative and -positive malignant melanoma through augmented NK activity and cytotoxic T-cell response. Int J Cancer 99, 573-578 (2002).60. Epardaud, M. et al. Interleukin- 15 / interleukin-15R alpha complexes promote destruction of established tumors by reviving tumor-resident CD8+ T cells. Cancer Res 68, 2972-2983 (2008).61. Sampson, I. H. et al. Greater chemotherapy-induced lymphopenia enhances tumorspecific immune responses that eliminate EGFRvIII-expressing tumor cells in patients with glioblastoma. Neuro Oncol 13, 324 (2011).62. Hotchkiss, K. M. & Sampson, J. H. Temozolomide treatment outcomes and immunotherapy efficacy in brain tumor. I Neurooncol 151, 55-62 (2021).63. Patel, M. R. et al. Vesicular stomatitis virus expressing interferon-P is oncolytic and promotes antitumor immune responses in a syngeneic murine model of non-small cell lung cancer. Oncotarget 6, 33165 (2015).64. Tang, B. et al. Synergistic Combination of Oncolytic Virotherapy and Immunotherapy for Glioma. Clin Cancer Res 26, 2216-2230 (2020).65. Ma, R. et al. An Oncolytic Virus Expressing IL15 / IL15Ra Combined with Off-the- Shelf EGFR-CAR NK Cells Targets Glioblastoma. Cancer Res 81, 3635-3648 (2021).66. Lemos de Matos, A., Franco, L. S. & McFadden, G. Oncolytic Viruses and the Immune System: The Dynamic Duo. Mol Ther Methods Clin Dev 17, 349 (2020).67. Alvarez-Breckenridge, C. A. et al. NK cells impede glioblastoma virotherapy via NKp30 and NKp46 natural cytotoxicity receptors. Nat Med 18, 1827 (2012).68. Webb, M. J. et al. Expression of tumor antigens within an oncolytic virus enhances the anti -tumor T cell response. Nat Commun 15, (2024).69. Han, J. et al. TGF-P treatment enhances glioblastoma virotherapy by inhibiting the innate immune response. Cancer Res 75, 5273 (2015).70. Lin, A. H. et al. Blockade of Type I Interferon (IFN) Production by Retroviral Replicating Vectors and Reduced Tumor Cell Responses to IFN Likely Contribute To Tumor Selectivity. J Virol 88, 10066-10077 (2014).71. Bessard, A., Sole, V., Bouchaud, G., Quemener, A. & Jacques, Y. High antitumor activity of RLI, an interleukin- 15 (IL-15)-IL-15 receptor a fusion protein, in metastatic melanoma and colorectal cancer. Mol Cancer Ther 8, 2736-2745 (2009).72. Perez, O. D. et al. Design and selection of toca 511 for clinical use: Modified retroviral replicating vector with improved stability and gene expression. Molecular Therapy 20, 1689- 1698 (2012).73. Paxton, R. J. Measurement of Interleukin 15. Curr Protoc Immunol 18, (1996).74. Hoadley, K. A. et al. CelLof-Origin Patterns Dominate the Molecular Classification of 10,000 Tumors from 33 Types of Cancer. Cell 173, 291-304. e6 (2018).75. Pender, A. et al. Genome and Transcriptome Biomarkers of Response to Immune Checkpoint Inhibitors in Advanced Solid Tumors. Clin Cancer Res 27, 202-212 (2021).76. Newman, A. M. et al. Robust enumeration of cell subsets from tissue expression profiles. Nat Methods 12, 453-457 (2015).

[0140] The above examples are provided to illustrate the invention but not to limit its scope.EXEMPLARY SEQUENCESSEQ ID NO: 1 (improved RLI coding sequence)ATGGCTCCTCGGAGAGCCAGAGGCTGTAGAACACTTGGACTGCCTGCCTTGCT TCTCCTGCTGCTGCTCCGGCCACCTGCCACAAGAGGCATCACCTGTCCTCCTCCTATGAGCGTGGAACACGCTGATATCTGGGTGAAGTCCTACTCCCTGTACAGCA GAGAAAGATACATCTGCAACAGCGGCTTCAAGCGGAAGGCCGGAACAAGCAGC CTGACAGAGTGTGTGCTGAACAAGGCTACCAACGTGGCCCACTGGACCACACC TAGCCTGAAGTGTATCAGAGACCCCGCTCTGGTGCATCAGCGACCTGCACCAC CTTCTGGTGGATCCGGTGGCGGCGGTTCTGGCGGGGGCTCCGGAGGCGGAGG ATCTCTGCAAAATTGGGTCAACGTCATCTCCGACCTGAAGAAGATCGAGGACC TGATTCAGAGCATGCATATCGACGCCACACTGTACACCGAGAGCGACGTGCAC CCTAGCTGTAAAGTGACCGCCATGAAGTGCTTTCTGCTGGAACTGCAAGTGATTAGCCTGGAATCCGGCGATGCCAGCATCCACGACACCGTGGAAAACCTGATCAT CCTGGCCAACAACTCACTGTCTAGCAACGGCAACGTGACCGAGTCCGGCTGCA AGGAGTGCGAAGAGCTCGAGGAAAAGAATATCAAAGAGTTCCTGCAGAGCTTC GTGCACATCGTTCAAATGTTCATCAACACCAGCTGASEQ ID N0:2 (unimproved original RLI coding sequence including Kozak sequence Gccgcc, which is not in SEQ ID NO:1)Gccgccatggccccgcggcgggcgcgcggctgccggaccctcggtctcccggcgctgctactgctgctgctgctccggccgccggcg acgcggggcatcacatgccctccccccatgtccgtggaacacgcagacatctgggtcaagagctacagcttgtactccagggagcggtac atttgtaactctggtttcaagcgtaaagccggcacgtccagcctgacagagtgcgtgttgaacaaggccacgaatgtcgcccactggacaa cccccagtctcaaatgcattagagaccctgccctggttcaccaaaggccagcgccacccagcggcggctcagggggtggaggatctggt ggtggaagtggaggtggcgggtctctgcagaactgggtgaatgtaataagtgatttgaaaaaaattgaagatcttattcaatctatgcatattg atgctactttatatacggaaagtgatgttcaccccagttgcaaagtaacagcaatgaagtgctttctcttggagttacaagttatttcacttgagtc cggagatgcaagtattcatgatacagtagaaaatctgatcatcctagcaaacaacagtttgtcttctaatgggaatgtaacagaatctggatgc aaagaatgtgaggaactggaggaaaaaaatattaaagaatttttgcagagttttgtacatattgtccaaatgttcatcaacacttcttag

Claims

WHAT IS CLAIMED IS:

1. A retroviral vector comprising a polynucleotide encoding receptor-linker- IL-15 (RLI), wherein the polynucleotide is at least 90, 95, 98, 99 or 100% identical to SEQ ID NO: 1.

2. The retroviral vector of claim 1, wherein the polynucleotide lacks one or more canonical (AG) or non-canonical splice acceptor sequences compared to SEQ ID NO:2.

3. The retroviral vector of claim 1, wherein the polynucleotide comprises at least 1, 2, 3, 4, 5, 6, 7, 8 ,9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or all of the underlined sequences as shown in: ATGGCTCCTCGGAGAGCCAGAGGCTGTAGAACACTTGGACTGCCTGCCTTGCTTCTC CTGCTGCTGCTCCGGCCACCTGCCACAAGAGGCATCACCTGTCCTCCTCCTATGAGC GTGGAACACGCTGATATCTGGGTGAAGTCCTACTCCCTGTACAGCAGAGAAAGATA CATCTGCAACAGCGGCTTCAAGCGGAAGGCCGGAACAAGCAGCCTGACAGAGTGTG TGCTGAACAAGGCTACCAACGTGGCCCACTGGACCACACCTAGCCTGAAGTGTATC AGAGACCCCGCTCTGGTGCATCAGCGACCTGCACCACCTTCTGGTGGATCCGGTGGC GGCGGTTCTGGCGGGGGCTCCGGAGGCGGAGGATCTCTGCAAAATTGGGTCAACGT CATCTCCGACCTGAAGAAGATCGAGGACCTGATTCAGAGCATGCATATCGACGCCA CACTGTACACCGAGAGCGACGTGCACCCTAGCTGTAAAGTGACCGCCATGAAGTGC TTTCTGCTGGAACTGCAAGTGATTAGCCTGGAATCCGGCGATGCCAGCATCCACGAC ACCGTGGAAAACCTGATCATCCTGGCCAACAACTCACTGTCTAGCAACGGCAACGT GACCGAGTCCGGCTGCAAGGAGTGCGAAGAGCTCGAGGAAAAGAATATCAAAGAG TTCCTGCAGAGCTTCGTGCACATCGTTCAAATGTTCATCAACACCAGCTGA (SEQ ID NO:1).

4. The retroviral vector of claim 1, wherein the polynucleotide comprises SEQ ID NO: 1.

5. The retroviral vector of any one of claims 1-4, wherein the vector comprises SEQ ID NO:3 or a sequence at least 90, 95, 98, 99 or 100% identical to SEQ ID NO:3.

6. The retroviral vector of any one of claims 1-5, wherein the vector encodes a gag, pol and env gene product.

7. The retroviral vector of claim 6, wherein the vector encodes an env / RLI polypeptide, wherein the env / RLI polypeptide is separated by a self-cleaving peptide, a linker, or both.

8. The retroviral vector of claim 7, wherein a majority of amino acids in the linker are glycine and serine.

9. The retroviral vector of claim 8, wherein the linker encoding the linker comprises SEQ ID NO:4.

10. The retroviral vector of claim 7, wherein the self-cleaving peptide is selected from the group consisting of a T2A, P2A, E2A and F2A peptide.

11. The retroviral vector of any one of claims 1-4, wherein expression of the polynucleotide is under the control of a promoter.

12. The retroviral vector of claim 11, wherein the promoter is polynucleotide is expressed in cancer cells or expression of the polynucleotide is cancer-specific.

13. A method of inhibiting a cancer cell, the method comprising, introducing the retroviral vector of any of claims 1-13 into the cancer cell such that RLI is expressed in the cancer cell.

14. The method of claim 13, wherein the cancer cell is a glioblastoma (GBM) cell.

15. The method of claim 13 or 14, wherein the cancer cell is in a human and the introducing comprises administering the retroviral vector to the human.

16. The method of claim 15, wherein the introducing comprises intra-tumoral administration of the retroviral vector.

17. A pharmaceutical composition comprising a pharmaceutically-acceptable excipient and the retroviral vector of any of claims 1-13.

18. A pharmaceutical composition comprising (i) a pharmaceutically- acceptable excipient (ii) a retroviral vector encoding an RLI polypeptide and (iii) a chemotherapeutic agent.

19. The pharmaceutical composition of claim 18, wherein the chemotherapeutic agent is temozolomide.

20. A method of inhibiting a cancer cell, the method comprising, (i) introducing a retroviral vector encoding an RLI polypeptide into the cancer cell such that RLI is expressed in the cancer cell and (contacting the cancel cell with a chemotherapeutic agent.

21. The method of claim 20, wherein the chemotherapeutic agent is temozolomide.

22. The method of claim 20 or 21, wherein the cancer cell is a glioblastoma (GBM) cell.

23. The method of any one of claims 20-22, wherein the cancer cell is in a human and the introducing comprises administering the retroviral vector to the human.

24. A method of inhibiting a cancer cell, the method comprising, introducing a retroviral vector encoding receptor-linker-IL-15 (RLI) into the cancer cell such that RLI is expressed in the cancer cell and further contacting the cell with a chemotherapeutic agent.

25. The method of claim 24, wherein the chemotherapeutic agent is temozolomide.

26. The method of claim 24 or 25, wherein the cancer cell is a glioblastoma (GBM) cell.

27. The method of any one of claims 24-26, wherein the cancer cell is in a human and the introducing comprises administering the retroviral vector to the human.

28. The method of claim 27, wherein the introducing comprises intra-tumoral administration of the retroviral vector. 29 . The method of any one of claims 24-28, wherein the vector encodes a gag, pol and env gene product.

30. The method of claim 29, wherein the vector encodes an env / RLI polypeptide, wherein the env / RLI polypeptide is separated by a self-cleaving peptide, a linker, or both.

Citation Information

Patent Citations

  • Recombinant modified vaccinia virus ankara (MVA) filovirus vaccine

    US20170304427A1

  • Il-15 and il-15r\alpha sushi domain based immunocytokines

    US20240083963A1

  • Interleukin 15 fusion proteins, and compositions and therapeutic methods thereof

    WO2019213517A1