Means and methods to suppress weed growth

Abstract

The present invenon relates to the field of sustainable agriculture. More parcularly, the present disclosure provides composions and methods for natural pest management, more parcularly for inhibing or suppressing growth of unwanted plant species by making use of bioherbicides. The bioherbicide composions of current applicaon comprise one or more natural compounds produced by bacterial strains from the Streptomyces chrestomycecus species.

Description

[0001] MEANS AND METHODS TO SUPPRESS WEED GROWTH

[0002] FIELD OF THE INVENTION

[0003] The present invention relates to the field of sustainable agriculture. More particularly, the present disclosure provides compositions and methods for natural pest management, more particularly for inhibiting or suppressing growth of unwanted plant species by making use of bioherbicides.

[0004] BACKGROUND

[0005] Weeds are persistent nuisances in agricultural and horticultural settings, competing with desired crops for resources such as water, nutrients, and sunlight. Weeds are also of a prime concern of home gardeners for aesthetic reasons and in growing home vegetables. In response to these concerns, a plethora of weed control strategies have been developed such as coverings, manual removal, tillage, thermal methods and chemical weed control. The latter remains the main component of traditional weed management on large areas, mainly for practical ease and cost efficiency. However, the use of synthetic herbicides often poses risks to human health, for example by direct contact through spray drift, accidental spills, or by indirect contact through consumption of food or water contaminated by herbicides. Additionally, the environment can be affected for long periods of time due to the persistence of some chemical compounds, potentially causing soil and water contamination and adverse effects to non-target organisms. Moreover, the overreliance on chemical herbicides has led to the emergence of herbicide-resistant weeds, exacerbating weed management challenges. There is thus a need for alternative weed control strategies that most importantly are environmentally friendly, sustainable and effective.

[0006] Bioherbicides, derived from natural sources such as plants, microbes, or their metabolic products, represent a promising avenue for addressing weed infestations while minimizing adverse ecological impacts. W02011106491 discloses a Burkholderia species with pesticidal activity against weeds, insects and fungi, while WO1996003882A1 discloses microorganisms from the Exserohilum and Curvularia genera with the ability to control weeds. In this application, the Applicant reports on a novel bioherbicidal composition comprising a bioactive agent comprising or derived from a culture of a Streptomyces chrestomyceticus species. Streptomyces is the most common soil actinomycete (69.4%), followed by Micromonospora, Nocardia, and Streptosporangium (Lechevalier and Lechevalier 1970). Actinomycetes are known to produce phytotoxic active substances among other biologically active compounds with antibacterial, anti-inflammatory or anticancer activity. For example, the secondary metabolites thaxtomin A produced by Streptomyces scabies (King and Calhoun 2009 Phytochemistry 70) and albucidin from Streptomyces albus (Hahn et al. 2009 J Antibiot 62) reduce plant cell growth, reduce cell wall lignification and inhibit cellulose synthesis. Igarashi et al (1997, J Antbiot 50) reported on a Streptomyces platensis strain producing resormycin that inhibits growth of both monocotyledonous and dicotyledonous weeds. In addition, phytotoxic compounds herbicidins A and B are produced by Streptomyces saganonensis (Arai et al. 1976 J Antibiot 29) and S. scopuliridis (Won et al 2016 doi.org / 10.5109 / 1564081), cycloheximide by Streptomyces strain KR0005 (Umurzokov et al 2022 doi.org / 10.1080 / 09583157.2023.2167936), Cl and C3 by S. anulatus strains (Bo et al 2019 doi.org / 10.1371 / journal. pone.0222933), 249-Yl by S. gardneri strain KRA18-249 (Umurzokov et al 2022 doi.org / 10.1016 / j. pestbp.2022.105213), cinnoline-4-carboxamide and cinnoline-4-carboxylic acid by S. olivochromogenes strain KRA17-580 (Kim et al 2020 doi.org / 10.1021 / acs.jafc.0c01974), and also the well-known herbicide phosphinothricin used worldwide as bialaphos is produced by Streptomyces viridochromogenes and Streptomyces hygroscopicus (Bayer et al. 1972 doi.org / 10.1002 / hlca.19720550126).

[0007] Counterintuitively given the disclosures of Streptomyces strains producing bioactive compounds including herbicidal compounds, the Streptomyces genus is still underexplored, largely because the genus is exceptionally large. Additionally, in contrast to what could be perceived based on the above cited reports, not every Streptomyces species or strain shows potential for industrial applications. Only a very small selection of unpredictable Streptomyces strains demonstrates fungicidal, insecticidal or herbicidal activity. Kim et al (2020) for example screened 1200 Streptomyces isolates of which only 10 isolates exhibited phytotoxic activity.

[0008] To the best of Applicant's knowledge, this application is the first report on herbicidal activity of the S. chrestomyceticus species. The strains disclosed herein, i.e. strain MED-B-M1H1 and MED-B-M23A7, are closely related to S. chrestomyceticus strain S20 with which they share 99.46% sequence identity on 16S rDNA level. Strain S20 was shown to biodegrade textile dyes, more particularly malachite green (Vignesh et al 2019 doi.org / 10.1007 / s00449-020-02339-z). Other studies have reported the application of S. chrestomyceticus strain STR-2 for antifungal use (Rahila et al 2023 Curr Microbiol 80), of S. chrestomyceticus strain ADP4 for anti-biofilm activity against Candida albicans (Vartika et al 2016 doi.org / 10.1016 / j.jbiosc.2016.03.013), but so far not a single disclosure reported on the herbicidal activity of S. chrestomyceticus.

[0009] SUMMARY

[0010] In a first aspect the application provides an herbicidal composition comprising a bioactive agent, wherein the bioactive agent is a Streptomyces bacterium or a spore thereof or a fermentation product derived from a cell culture of said Streptomyces bacterium. In one embodiment, said fermentation product is selected from the list consisting of an extract, an extract fraction, a supernatant, a supernatant fraction, a filtrate, a whole cell broth and an herbicidal substance endogenously produced by the Streptomyces bacterium. In another embodiment, said Streptomyces bacterium comprises a 16S rDNA sequence having at least 99.00%, at least 99.50% or at least 99.80% sequence identity to SEQ ID No. 1. In a more particular embodiment, the Streptomyces bacterium comprises a 16S rDNA sequence as depicted in SEQ ID No. 1 or SEQ ID No. 2. In an even more particular embodiment said Streptomyces species is a Streptomyces chrestomyceticus species. In a most particular embodiment, said Streptomyces species is the bacterial strain deposited under the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM) / Laboratory Microbiology Gent (LMG) Bacteria collection on 7thJune 2024 under Accession No. LMG-P-33652 or at the Polish Collection of Microorganisms (PCM) on 7thFebruary 2024 under Accession No. B / 00525, or a functional homologue thereof. In a further embodiment, said functional homologue is a Streptomyces strain having at least 94.00% sequence identity on whole genome level compared to strain M1H1 deposited as LMG-P- 33652 or to strain M23A7 deposited as B / 00525, wherein said functional homologue has herbicidal or phytotoxic activity or produces a fermentation product having herbicidal or phytotoxic activity. In yet another embodiment, the herbicidal composition further comprises an agricultural compatible carrier. In a particular embodiment, said carrier is a surfactant. In another particular embodiment, the herbicidal composition is a sprayable composition.

[0011] In a second aspect, an isolated bacterial strain as deposited under the Budapest Treaty at the BCCM / LMG on 7thJune 2024 under Accession No. LMG-P-33652 or at the PCM on 7thFebruary 2024 under Accession No. B / 00525 is provided, or a lyophilized, freeze-dried form thereof or said bacterial strain in a form selected from dried cells, dehydrated cells, devitalized cells, inactivated cells, frozen cells or cells in artificial suspension or in a dry powder. Also provided is a cell culture, an enriched cell culture or a biologically pure culture of said isolated bacterial strain. In one embodiment, a product derived from said cell culture is provided, wherein the product is selected from the group consisting of a spore, an extract, an extract fraction, a whole cell broth, a supernatant, a supernatant fraction, a filtrate and an herbicidal substance endogenously produced by said bacterial strain.

[0012] In a third aspect, the use is provided of said bacterial strain or a spore, or an extract, extract fraction, a whole cell broth, a supernatant, a filtrate or an herbicidal substance derived from or produced by a cell culture of said bacterial strain, for controlling growth of one or more target plant species or for protecting a crop against a plant pest population or plant pest infestation.

[0013] In a fourth aspect, a method is provided of controlling the growth of one or more target plant species, comprising the step of applying to (or treating) said one or more target plant species or plant part thereof (with) the herbicidal composition disclosed herein. In one embodiment, the step of applying or treating can comprise spraying, dusting, infiltration, immersion, dipping, incubation or any combination thereof. In a further embodiment, the method further comprises a step of determining the phytotoxic effect of the application or treatment with said composition on the one or more target plant species. In one embodiment, the target plant species is an annual weed, a perennial weed, a dicotyledonous plant or a monocotyledonous plant, more particularly a target plant species selected from the list consisting of Digitaria sanguinalis or other Digitaria species, Arabidopsis thaliana, Agrostis capillaris or other Agrostis species, Amaranthus retroflexus or other Amaranthus species, Chenopodium album or other Chenopodium species, Papaver rhoeas or other Papaver species, Poa annua or other Poa species, Alopecurus myosuroides or other Alopecurus species, Matricaria chamomilla or other Matricaria species, Polygonum aviculare or other Polygonum species, Veronica persicae or other Veronica species, Solanum nigrum or other Solanum species, Setaria viridis or other Setaria species, Zea mays and Triticum aestivum.

[0014] DEPOSIT OF BIOLOGICAL MATERIAL

[0015] The purified bacterial strains (proposed taxonomic designation Streptomyces chrestomyceticus) as taught herein have been deposited under the terms of the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM) / LMG Bacteria collection (BCCM / LMG) (address: Universiteit Gent, Laboratorium voor Microbiologie (LMG), K.L. Ledeganckstraat 35, 9000 Gent, Belgium), on 7thJune 2024 under Accession No. LMG-P-33652 (with the following identification reference given to the deposited material by the depositor: MED-B-M1H1) or at the Polish Collection of Microorganisms (PCM) (address: Institute of Immunology and Experimental Therapy, Polish Academy of Sciences, Ul. Weigle 12, 53-114 Wroclaw, Poland) on 7thFebruary 2024 under Accession No. B / 00525 (with the following identification reference given to the deposited material by the depositor: MED-B-M23A7). For reasons of brevity, the MED-B-M1H1 strain is also referred to as strain "M1H1" throughout this specification, and MED-B-M23A7 as strain "M23A7".

[0016] Table 1. Overview of deposited strains and details of the depository institutes

[0017] BRIEF DESCRIPTION OF THE FIGURES

[0018] Figure 1 shows the phytotoxic effect of the extract of M1H1 (right column) on A thaliana (upper row), A. capillaris (second row from the top), C. album (third row from the top) and A. myosuroides (lower row) seedlings scored 9 days after administering the extract. The extract was compared to two negative controls, i.e. a formulation control (left column) and an untreated control (middle column).

[0019] Figure 2 shows the phytotoxic effect of the extract of M1H1 (right column) on A. retroflexus (upper row), D. sanguinalis (middle row) and P. rhoeas (lower row) seedlings scored 9 days after administering the extract. The extract was compared to two negative controls, i.e. a formulation control (left column) and an untreated control (middle column).

[0020] Figure 3 shows the phytotoxic effect of the extract of M1H1 on Poa annua seedlings scored 10 days after administering the extract. Figure 3A is a top view of untreated P. annua seedlings (left box), P. annua seedlings treated with the M1H1 extract (middle box) and P. annua seedlings treated with the formulation control (right box). Figure 3B is a close-up of the formulation control, while Figure 3C is a close-up of the M1H1 treatment.

[0021] Figure 4 shows the phytotoxic effect of the extract of M1H1 (right) on maize seedlings scored 16 days after administering the extract. The extract was compared to two negative controls, i.e. a formulation control (left) and an untreated control (middle). Figure 5 shows the phytotoxic effect of the extract of M1H1 (right) on wheat seedlings scored 16 days after administering the extract. The extract was compared to two negative controls, i.e. a formulation control (left) and an untreated control (middle).

[0022] Figure 6 shows that fraction 29 from the M1H1 extract has an identical phytotoxic activity on Amaranthus compared to the full M1H1 extract.

[0023] Figure 7 shows that fraction 23 from the M23A7 extract has an identical phytotoxic activity on Arabidopsis compared to the full M1H1 extract.

[0024] Figure 8 shows the phytotoxic effect of the supernatant of the M1H1 bacterial culture in a 1:4 dilution on different plant species. The pictures show a representative situation of the plants when treated with a mock solution (left column) and with the 1:4 dilution of the supernatant of the M1H1 culture (right column). A. thaliana (upper row), A. capillaris (second row), A. retroflexus (third row) and D. sa ng u in alis (lower row).

[0025] Figure 9 is a phylogenetic tree showing the phylogenetic distance and relationship between M1H1 and its close relatives. The subcluster comprising M1H1, NBRC15454, DSM40545 and M23A7 (highlighted in transparent grey box) has herbicidal activity, while the other subclusters comprising more distinct strains was demonstrated to not have phytotoxic effects.

[0026] Figure 10 shows Matricaria chamomilla plants 20 days after treatment (DAT) with pelargonic acid (A, top left), M1H1 (C, bottom left) and a formulation control (D, bottom right). The untreated control is shown in B (top right).

[0027] Figure 11 shows Chenopodium album plants 20 DAT with M1H1 (A, top left), a formulation control (B, top right) and pelargonic acid (D, bottom right). The untreated control is shown in C (bottom left).

[0028] Figure 12 shows Polygonum aviculare plants 20 DAT with a formulation control (B, top right), pelargonic acid (C, bottom left) and M1H1 (D, bottom right). The untreated control is shown in A (top left).

[0029] Figure 13 shows Veronica persicae plants 20 DAT with pelargonic acid (A, top left), a formulation control (B, top right) and M1H1 (D, bottom right). The untreated control is shown in C (bottom left).

[0030] Figure 14 shows Solanum nigrum plants 9 DAT with pelargonic acid (B, top right), a formulation control (C, bottom left) and M1H1 (D, bottom right). The untreated control is shown in A. (top left)

[0031] Figure 15 shows Setaria viridis plants DAT with a formulation control (B, top right), M1H1 (C, bottom left) and pelargonic acid (D, bottom right). The untreated control is shown in A (top left).

[0032] DETAILED DESCRIPTION

[0033] Weeds, referred herein as the unwanted plants that sprout up amongst our crops, pose a significant threat to agricultural productivity. First of all, they aggressively compete with crops for vital resources like water, sunlight, and nutrients, which results in yearly yield losses ranging from 5% to 30% depending on the severity of the infestation. Second, weeds can act as havens for harmful insects and pathogens thereby increasing the disease pressure within the field and thus further increasing yield losses. Additionally, some weeds produce pollen or other substances that can trigger allergic reactions in humans and animals, or produce seeds that can be harmful if ingested by livestock. To provide eco- friendly alternatives to synthetic herbicides, the inventors of current application set out to develop means and methods to control weed growth by making use of natural compounds. The present application reports on a novel bioherbicidal composition comprising or derived from a culture of a Streptomyces species, more particularly of Streptomyces chrestomyceticus.

[0034] In order that the present description can be more readily understood, certain terms are first defined. Additional definitions are set forth throughout the detailed description.

[0035] DEFINITIONS

[0036] As used herein, the singular forms "a", "an", and "the" include both singular and plural referents unless the context clearly dictates otherwise.

[0037] The terms "comprise", "comprising", "comprises" and "comprised of" as used herein are synonymous with "include", "including", "includes" or "contain", "containing", "contains", and are inclusive or open- ended and do not exclude additional, non-recited members, elements or method steps. The terms also encompass "consisting of" and "consisting essentially of".

[0038] The recitation of numerical ranges by endpoints includes all numbers and fractions subsumed within the respective ranges, as well as the recited endpoints. This applies to numerical ranges irrespective of whether they are introduced by the expression "from... to..." or the expression "between... and..." or another expression.

[0039] The terms "about" or "approximately" as used herein when referring to a measurable value such as a parameter, an amount, a temporal duration, and the like, are meant to encompass variations of and from the specified value, such as variations of + / -10% or less, preferably + / -5% or less, more preferably + / -1% or less, and still more preferably + / -0.1% or less of and from the specified value, insofar such variations are appropriate to perform in the disclosed invention. It is to be understood that the value to which the modifier "about" or "approximately" refers is itself also specifically, and preferably, disclosed.

[0040] Furthermore, the terms first, second, third and the like in the description and in the claims, are used for distinguishing between similar elements and not necessarily for describing a sequential or chronological order, unless specified. It is to be understood that the terms so used are interchangeable under appropriate circumstances and that the embodiments of the invention described herein are capable of operation in other sequences than described or illustrated herein.

[0041] Whereas the term "one or more" or "at least one", such as one or more or at least one member(s) of a group of members, is clear per se, by means of further exemplification, the term encompasses inter alia a reference to any one of said members, or to any two or more of said members, such as, e.g., any >3, >4, >5, >6 or >7 etc. of said members, and up to all said members. In another example, "one or more" or "at least one" may refer to 1, 2, 3, 4, 5, 6, 7 or more.

[0042] The discussion of the background to the invention herein is included to explain the context of the invention. This is not to be taken as an admission that any of the material referred to was published, known, or part of the common general knowledge in any country as of the priority date of any of the claims. Throughout this disclosure, various publications, patents and published patent specifications may be referenced by an identifying citation. All documents cited in the present specification are hereby incorporated by reference in their entirety. In particular, the teachings or sections of such documents herein specifically referred to are incorporated by reference.

[0043] Unless otherwise defined, all terms used in disclosing the invention, including technical and scientific terms, have the meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. By means of further guidance, term definitions are included to better appreciate the teaching of the invention. When specific terms are defined in connection with a particular aspect of the invention or a particular embodiment of the invention, such connotation or meaning is meant to apply throughout this specification, i.e., also in the context of other aspects or embodiments of the invention, unless otherwise defined.

[0044] In the following passages, different aspects or embodiments of the invention are defined in more detail. Each aspect or embodiment so defined may be combined with any other aspect(s) or embodiment(s) unless clearly indicated to the contrary. In particular, any feature indicated as being preferred or advantageous may be combined with any other feature or features indicated as being preferred or advantageous.

[0045] Reference throughout this specification to "one embodiment", "an embodiment" means that a particular feature, structure or characteristic described in connection with the embodiment is included in at least one embodiment of the present invention. Thus, appearances of the phrases "in one embodiment" or "in an embodiment" in various places throughout this specification are not necessarily all referring to the same embodiment, but may. Furthermore, the particular features, structures or characteristics may be combined in any suitable manner, as would be apparent to a person skilled in the art from this disclosure, in one or more embodiments. Furthermore, while some embodiments described herein include some but not other features included in other embodiments, combinations of features of different embodiments are meant to be within the scope of the invention, and form different embodiments, as would be understood by those in the art. For example, in the appended claims, any of the claimed embodiments can be used in any combination. By extensive experimental testing, the present inventors have found that extracts of Streptomyces bacteria belonging to a subcluster within the Streptomyces species exhibit phytotoxic effects in several plant species and hence that such extracts can advantageously be used as weed control products.

[0046] In all herein described aspects and embodiments - unless specified differently- "inhibit" or "decrease" or "suppress" or "reduce" refers to a statistically significant reduction and / or an at least 1%, 2%, 3%, 4% or 5% reduction or at least 6% reduction or at least 7% reduction or at least 8% reduction or at least 9% reduction or at least 10% reduction or at least 15% reduction or at least 20% reduction or at least 25% reduction or at least 30% reduction or at least 50% reduction or at least 75% reduction or at least a 100% reduction in growth, development, emergence, germination or survival of the one or more (target) plant species treated with the phytotoxic agent herein disclosed or any of the compositions or the bacterial strains of the application compared to a control situation. Said control situation is a mock situation wherein the plant, plant seed or other plant part was not treated with the phytotoxic agent, any of the compositions or bacterial strains herein disclosed. The skilled person is aware of how a scientifically sound mock situation should be set up. "Treated" as used herein can be direct treatment (e.g. spraying plants) and / or indirect treatment (e.g. providing the substrate wherein the plant is growing with the phytotoxic agent or the bacterial strains of the application).

[0047] In all herein described aspects and embodiments - unless specified differently - "enhance" or "increase" or "improvement" refers to a statistically significant increase and / or an at least 1%, 2%, 3%, 4% or 5% increase or at least 6% increase or at least 7% increase or at least 8% increase or at least 9% increase or at least 10% increase or at least 15% increase or at least 20% increase or at least 25% increase or at least 30% increase or at least 50% increase or at least 75% increase or at least a 100% increase in the property being measured and compared to a control situation. Said control situation is a mock situation wherein the phytotoxic agent, any of the herein described compositions or of the bacterial strains of the application was not administered. In one embodiment, said property is plant growth, plant development, yield or any economically important crop related feature.

[0048] The term "statistically significant" or "statistically significantly" different is well known by the person skilled in the art. Statistical significance plays a pivotal role in statistical hypothesis testing. It is used to determine whether the null hypothesis should be rejected or retained. It states that the results are obtained because of chance and are not supporting a real change or difference between two data sets. The null hypothesis is the default assumption that what one is trying to prove did not happen. In contrast the alternative hypotheses states that the obtained results support the theory being investigated. For the null hypothesis to be rejected (and thus the alternative hypothesis to be accepted), an observed result has to be statistically significant, i.e. the observed p-value is less than the pre-specified significance level a. The p stands for probability and measures how likely it is that the null hypothesis is incorrectly rejected and thus that any observed difference between data sets is purely due to chance. In most cases the significance level a is set at 0.05.

[0049] "Microbial" as used herein refers to microorganisms, wherein said microorganisms can include bacteria, archaebacteria, fungi, yeasts, mycorrhiza, microscopic eukaryotes (e.g. protozoa and algae), viruses, viroids or a combination thereof. A "microbial population" as used herein can thus refer to a synthetic or artificial collection of different microorganisms with distinct geographical origins. In various more particular embodiments of this application, "microbial" refers to "bacterial".

[0050] The terms "bacterium", "bacteria" or "bacterial" broadly refer in general to any prokaryotic organism, and may refer to an organism from either Kingdom Eubacteria (Bacteria), Kingdom Archaebacteria (Archaea), or both. In some cases, bacterial genera have been reassigned due to various reasons (such as, but not limited to, the evolving field of whole genome sequencing), and it is understood that such nomenclature reassignments are within the scope of any claimed genus. As used herein, "bacterial strain" (which may be abridged to "strain" where the context makes clear that a bacterial strain is meant) refers to any of the prokaryotic microorganism belonging to the same class of species, including the species. The term "strain" as a basic operational unit of microbial taxonomy, such as bacterial taxonomy, is frequently used to denote a population made up of the descendants of a single isolation in pure culture, usually made up of a succession of cultures ultimately derived from an initial single colony. Where a species encompasses two or more distinct isolates, the term "strain" may be used to refer to an isolate or group of isolates that can be distinguished from other isolates of the same genus and species by phenotypic characteristics or genotypic characteristics or both.

[0051] As used herein, "derived from" means directly isolated or obtained from a particular source or alternatively having identifying characteristics of a substance or organism isolated or obtained from a particular source. In the event that the "source" is an organism, "derived from" means that it may be isolated or obtained from the organism itself or culture broth, suspension, or medium used to culture or grow said organism. A compound or composition "derived from" or "obtainable from" means that the compound or composition may be isolated from or produced by a cell culture or a whole cell broth, or suspension, filtrate, supernatant, fraction, or extract derived from a cell culture or a whole cell broth.

[0052] Any of the bacterial strains of current application can be cultivated or fermented by shake flask cultivation or by small scale or large-scale fermentation (including but not limited to continuous, batch, fed-batch, or solid state fermentation) in laboratory or industrial fermenters performed in a suitable medium and under conditions allowing for bacterial cell growth. The fermentation or cultivation can take place in suitable nutrient medium comprising carbon and nitrogen sources and inorganic salts, using procedures known in the art. Suitable media are available from commercial sources or are prepared according to publications well-known in the art.

[0053] As used herein, the term "preparation" or "bacterial preparation" refers to an isolate of bacteria in which the prevalence (i.e. concentration and / or ratio) of the bacterial strain or functional homolog is enriched over that (or exceeds that) found in nature. In nature, the bacterial strain is typically part of a microbiome (e.g. plant or soil microbiome), consisting of more than thousands of microbial species. According to certain embodiments, the preparation is in a form selected from the group consisting of a liquid culture, a still (plate or non-shaking liquid) culture, whole culture stored stock of cells (particularly glycerol stocks), agar strip, stored agar plug in glycerol / water, freeze dried stock, and dried stocks such as lyophilizate dried onto filter paper or grain seed.

[0054] As used herein, the term "culture", "cell culture" or "whole cell culture" refers to a population of microorganisms that are propagated on or in media of various kinds and thus refers to a fluid, pellet, scraping, dried sample, lyophilizate or a support, container, or medium such as a plate, paper, filter, matrix, straw, pipette or pipette tip, fibre, needle, gel, swab, tube, vial, particle, etc. that contains any of the bacterial strains herein disclosed or a functional homolog thereof, preferably in an amount that exceeds that found in nature. In the present invention, an "isolated culture" of a microbial strain is a culture fluid or a scraping, pellet, dried preparation, lyophilizate, or a support, container, or medium that contains the bacterial strain of the application or the functional homolog thereof, in the absence of other microorganisms.

[0055] A "spore" or "spores" refers to microbial structures that are generally viable, more resistant to environmental influences such as heat and bactericidal agents than other forms of the same microbial species, and typically capable of germination and out-growth. Bacteria that are "capable of forming spores" are those bacteria comprising the genes and other necessary abilities to produce spores under suitable environmental conditions.

[0056] "CFU" or "cfu" as used herein refers to colony-forming unit. This unit is well-known by the person skilled in the art of microbiology (as well as the methodology how to determine the number of colonyforming units) and is used to estimate the number of viable bacteria or fungal cells in a sample. "Viable" or "live" is defined as the ability to multiply via binary fission under controlled conditions. Counting with colony-forming units requires culturing the microbes and counting only viable cells, in contrast with microscopic examination which counts all cells, alive or dead.

[0057] In order to reconstruct the evolutionary relationships and sequence identity of one bacterial isolate to another, phylogenetic approaches are used standardly exploiting the 16S sequence. The term "16S sequence" or synonymous terms such as "16S nucleotide sequence" "16S", "16S rDNA" or "16S rRNA" refer to the nucleic acid sequence, such as in particular the DNA sequence, of the 16S ribosomal RNA (rRNA) of a bacterium. 16S rRNA gene sequencing is a well-established method for studying phylogeny and taxonomy of bacteria. A full length 16S nucleic acid sequence is approximatelyl500 nucleotides in length. In certain embodiments, the bacterial strain may comprise a single copy of the 16S rRNA gene. In certain embodiments, the bacterial strain may comprise more than one copy of the 16S rRNA gene, such as two, three or more (multicopy) copies of the 16S rRNA gene. In such embodiments where two or more 16S rRNA gene copies are found in the bacterial strain, at least one of these 16S rRNA gene copies complies with the sequence identity requirements specified in the present application, preferably two or more and preferably all of the 16S rRNA gene copies (each independently) comply with the stated sequence identity requirements. By means of an example and without limitation, where a bacterial strain comprises three 16S rRNA gene copies, at least one, preferably at least two, and more preferably all three 16S rRNA gene copies will, each independently, display at least 99.75% sequence identity to SEQ ID NO: 1, and may in certain preferred embodiments be identical. Conveniently, the 16S rRNA sequence can be determined by sequencing (e.g. Sanger sequencing) the 16S gene sequence(s) in the chromosomal DNA, which may be amplified (e.g. PCR amplified) using suitable amplification primers, such as in particular the Forward primer 27F: AGAGTTTGATCCTGGCTCAG (SEQ ID NO: 4) and Reverse primerl492R: GGTTACCTTGTTACGACTT (SEQ ID NO: 5). Alternative methods to identify groups of derived and functionally identical or nearly identical strains include Multi-locus sequence typing (MLST), concatenated shared genes trees, Whole Genome Alignment (WGA), Average Nucleotide Identity (ANI) method, and MinHash (Mash) distance metric.

[0058] The term "defined by SEQ ID No. X" or "as depicted in SEQ ID No. X" as used herein refers to a biological sequence consisting of the sequence of amino acids or nucleotides given in the SEQ ID No. X. For instance, a nucleotide defined in / by SEQ ID No. X consists of the nucleotide sequence given in SEQ ID No. X. A further example is a nucleotide sequence comprising SEQ ID No. X, which refers to a nucleotide sequence longer than the nucleotide sequence given in SEQ ID No. X but entirely comprising the nucleotide sequence given in SEQ ID No. X, or to a nucleotide sequence consisting of the nucleotide sequence given in SEQ ID No. X.

[0059] In this application "sequence similarity", "sequence identity" and "sequence homology" are interchangeably used. The term "sequence identity" as used herein refers to the extent that sequences are identical on a nucleotide-by-nucleotide basis over a window of comparison. Thus, a "percentage of sequence identity" is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g., A, T, C, G, I) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity. A gap, i.e., a position in an alignment where a residue is present in one sequence but not in the other is regarded as a position with non-identical residues. Determining the percentage of sequence identity can be done manually, or by making use of computer programs that are available in the art. Examples of useful algorithms are PILEUP (Higgins & Sharp, CABIOS 5:151 (1989), BLAST and BLAST 2.0 (Altschul et al. J. Mol. Biol. 215: 403 (1990). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (http: / / www.ncbi.nlm.nih.gov / ).

[0060] According to some embodiments of the invention, the identity is a global identity, i.e., an identity over the entire nucleic acid sequences herein disclosed and not over portions thereof. According to some embodiments, the identity is a partial identity, i.e., an identity over certain percentages of the length of the nucleic acid sequences as described herein. According to certain exemplary embodiments, the identity between 16S rRNA sequences is calculated over at least 97%, at least 98%, at least 98.5%, at least 99% or at least 99.5% of the full length of SEQ ID No. 1 or SEQ ID No. 2, which resembles a query coverage of at least 97%, 98%, 98.5%, 99%, or 99.5%. As used herein, the term "query coverage" refers to a percentage that describes how much of the query sequence is included in the region aligned to the target sequence. According to a specific embodiment, the identity between 16S rRNA sequences is calculated over the full length of SEQ ID No. 1 or SEQ ID No. 2, resembling a 100% query coverage.

[0061] As used herein, the term "plant" refers to all plants, plant parts, seed, and plant populations, such as desirable and undesirable wild plants, weeds, cultivars, transgenic plants, and plant varieties. Cultivars and plant varieties can be plants obtained by conventional propagation and breeding methods that can be assisted or supplemented by one or more biotechnological methods such as by use of double haploids, protoplast fusion, random and directed mutagenesis, molecular or genetic markers or by bioengineering and genetic engineering methods. The embodiments disclosed herein may generally be used for any plant species, including, but not limited to, monocots and dicots. In specific embodiments, plants of the present invention are weeds (e.g., Digitaria, Amaranthus or Chenopodium species) or volunteer crops (for example corn, alfalfa, sunflower, Brassica, soybean, cotton, safflower, peanut, sorghum, wheat, millet, tobacco, etc.). As used herein, the term "plant parts" refers to all above ground and below ground parts and organs of plants such as shoot, leaf, blossom and root, whereby for example leaves, needles, stems, branches, blossoms, fruiting bodies, fruits and seeds, as well as roots, tubers, corms and rhizomes are included. Vegetative and generative propagating material, for example, cuttings, corms, rhizomes, tubers, runners and seeds are also plant parts. The term "herbicide" or "herbicidal composition" is used herein to mean a composition comprising an herbicidal active ingredient. The term "herbicidal active ingredient" refers to an active ingredient that - at an effective amount - kills, controls or otherwise adversely modifies the growth, development, metabolism and / or germination of one or more plant species, more particularly of a target plant species. The terms plants and vegetation include germinant seeds, emerging seedlings, plants emerging from vegetative propagules, and established vegetation. An "effective amount" refers to an amount sufficient to effect one or more desired results. An effective amount of an herbicide (equivalent to an herbicidal ly effective amount or a plant vegetation controlling amount) then refers to an amount that leads to a statistically significant adverse effect on plant growth and development of the one or more target plant species treated with the herbicide as compared to that of said plant species in a control situation. The adverse effect on plant growth and development includes but is not limited to a decrease of growth, development, activity and / or biomass, to chlorosis and / or necrosis, to plant growth delay, to wilting, to desiccation, to retardation, to plant death or to any negative deviation from natural development, and the like. A control situation for assessing an herbicidal effect provides a reference point for measuring growth, development, activity and / or biomass or any of the above features of the one or more target plant species in the absence of the herbicidal composition of the application. An effective amount can be administered in one or more administrations.

[0062] The term "phytotoxic" as used herein refers to any negative effect of a biological or chemical compound or of microorganism on the growth, development and / or germination of a plant. In one embodiment, phytotoxic means a reduction or inhibition of plant growth, plant development or seed germination. In another embodiment, phytotoxic means killing the plant or seed that has been treated. Without wishing to be bound by theory, the herbicidal or phytotoxic agent suppresses the growth of a target plant or weed (i.e. exhibits weed suppressive activity), by interfering with the normal growth and development of the target plant or weed. For example, but not wishing to be limiting, the herbicidal or phytotoxic agent may inhibit root growth, shoot growth, reduce biomass, inhibit seed production, reduce competitiveness of the target plant or weed for a crop's water and nutrients, or a combination thereof.

[0063] "Chlorosis" as used herein refers to the yellowing of plant tissues due to the disruption of chlorophyll production. This condition is a visible symptom of stress or damage for example caused by herbicides, leading to a loss of green colour in leaves as chlorophyll levels decrease. Chlorosis can be an indication of impaired photosynthesis and can progress to necrosis, ultimately affecting plant growth and health. "Necrosis" refers to the premature death of plant cells or tissues for example due to herbicide exposure. This condition is characterized by the localized or widespread death of plant cells, leading to visible symptoms such as tissue discoloration, wilting, and tissue degradation. Necrosis in plants can result from the disruption of essential cellular processes, ultimately causing irreversible damage and cell death.

[0064] A "weed" as used herein is a plant that is considered undesirable in a particular situation, growing where it conflicts with human preferences, needs, or goals. It is a plant that is not intentionally grown and competes with cultivated plants for resources. Weeds are not defined by their taxonomic classification, but rather by their context. A plant that is a weed in one context may not be a weed in another. For example, some plants that are widely regarded as weeds are intentionally grown in gardens and other cultivated settings. Similarly, volunteer plants from a previous crop are regarded as weeds when growing in a subsequent crop. "Volunteer" or "volunteer crop" as used herein refers to a plant or crop that grows on its own, rather than being deliberately planted by a farmer or gardener. Volunteers often grow from seeds that float in on the wind, are dropped by birds, or are left on the field after the harvest. Volunteers that grow from the seeds of specific cultivars are not reliably identical or similar to their parent and often differ significantly from it.

[0065] The term "plant growth promoting" as used herein, refers to a promoting effect on a wide range of growth and development properties of cultured plants or crops, including but not limited to increased root development, increased leaf area, increased plant yield, increased fresh or dry weight, increased seed yield, increased seed germination, increased photosynthesis, increase in accumulated biomass of the plant, increased nitrogen fixation or increased efficiency of nutrients such as nitrogen, phosphorus or potassium.

[0066] The terms or definitions provided herein are solely to aid in the understanding of the invention. Unless specifically defined herein, all terms used herein have the same meaning as they would to one skilled in the art of the present invention. Practitioners are particularly directed to "Fermentation Microbiology and Biotechnology", 4thed., Edited by El-Mansi, Nielsen, Mousdale and Carlson, to "Practical Handbook of Microbiology", 4thed., Edited by Green and Goldman (2021) CRC Press, and to Ausubel et al., Current Protocols in Molecular Biology (Supplement 47), John Wiley & Sons, New York (1999), for definitions and terms of the art. The definitions provided herein should not be construed to have a scope less than understood by a person of ordinary skill in the art.

[0067] PHYTOTOXIC AGENT

[0068] By extensive experimental testing, the present inventors have isolated Streptomyces strains of which both the extract and the supernatant of the fermentation broth individually significantly reduces the growth of a plethora of plant species, among which economically relevant weeds such as Digitaria and Chenopodium sp. Hence such bacterial strains and / or fermentation products thereof can advantageously be used as herbicidal or weed control agents. Interestingly, the phytotoxic Streptomyces strains all belong to a phylogenetically related subcluster within the Streptomyces species.

[0069] In a first aspect, the application provides an herbicidal composition or a weed (growth) control composition or a composition for controlling growth of one or more plant species, more particularly of one or more target plant species or weeds. Said composition comprises an effective amount of a bioactive agent, wherein said bioactive agent is a Streptomyces bacterium or a spore thereof, more particularly a Streptomyces species comprising a 16S rDNA sequence having at least 98.00%, at least 98.50%, at least 99.00%, at least 99.50%, at least 99.55%, at least 99.60%, at least 99.65%, at least 99.70%, at least 99.75%, at least 99.80%, at least 99.85%, at least 99.90% identity to the sequence as depicted in SEQ ID No. 1 or SEQ ID No. 2, or a fermentation product derived from a culture of said Streptomyces species. In a particular embodiment, said % sequence identity is calculated over at least 98.0%, at least 98.5%, at least 99.0%, at least 99.5% of the full length of SEQ ID No. 1 or 2 or is calculated over the full length of SEQ ID No. 1 or 2. In one embodiment, said bioactive agent is a Streptomyces bacterium comprising a 16S rDNA sequence having at least 98.50% identity to SEQ ID No. 1 and has an average nucleotide identity of at least 94.0% to the Streptomyces strain deposited under the Budapest Treaty at the BCCM / LMG on 7thJune 2024 under Accession No. LMG-P-33652, or a fermentation product derived from a culture of said Streptomyces bacterium. In a further or alternative embodiment, said bioactive agent is a Streptomyces bacterium of which a representative culture has been deposited under the Budapest Treaty at the BCCM / LMG on 7thJune 2024 under Accession No. LMG-P-33652 or at the Polish Collection of Microorganisms (PCM) on 7thFebruary 2024 under Accession No. B / 00525, or a fermentation product derived from a culture of any of said Streptomyces bacterium. In a further or alternative embodiment, said Streptomyces bacterium is a S. chrestomyceticus species. In one embodiment, said herbicidal composition is a bioherbicidal composition. Also provided is an herbicidal composition comprising a fermentation product from a cell culture of a Streptomyces species as described herein, more particularly of a S. chrestomyceticus species, and a surfactant to improve the uptake of said fermentation product into a plant or plant part. Said fermentation product can be an extract or fraction thereof, a supernatant or fraction thereof, a filtrate, whole cell culture of said Streptomyces or S. chrestomyceticus species or a phytotoxic substance endogenously produced by said Streptomyces species. In another or further embodiment, said fermentation product derived from a cell culture of one of the bacterial strains herein disclosed has herbicidal activity.

[0070] STRAIN

[0071] In another aspect of the invention, a bacterium, more particularly a Streptomyces species is provided comprising a 16S rDNA sequence having at least 99.0%, at least 99.1%, at least 99.2%, at least 99.3%, or at least 99.5% identity to the sequence as depicted in SEQ ID No. 1. In one embodiment, said species is a Streptomyces chrestomyceticus species, more particularly the Streptomyces strain M1H1 with Accession No. LMG-P-33652 or the Streptomyces strain M23A7 with Accession No. B / 00525. In another or further embodiment, said bacterial species comprises a 16S rDNA sequence having at least 99.50%, at least 99.60%, at least 99.70%, at least 99.75%, at least 99.80%, at least 99.85%, at least 99.90% or at least 99.95% identity to SEQ ID No. 1. In a particular embodiment, the sequence identity is calculated over at least 98.0%, at least 98.5%, at least 99.0% or at least 99.5% of the full length of SEQ ID No. 1. In a most particular embodiment, the sequence identity is calculated over the full length of SEQ ID No. 1.

[0072] In another or further embodiment, a Streptomyces species is provided comprising a 16S rDNA sequence having at least 99.50%, at least 99.60%, at least 99.70%, at least 99.75%, at least 99.80%, at least 99.85%, at least 99.90% or at least 99.95% identity to SEQ ID No. 2. In a particular embodiment, the sequence identity is calculated over at least 98.0%, at least 98.5%, at least 99.0% or at least 99.5% of the full length of SEQ ID No. 2. In a most particular embodiment, the sequence identity is calculated over the full length of SEQ ID No. 2.

[0073] In another more particular embodiment, said bacterial species comprises a 16S rDNA sequence as depicted in SEQ ID No. 1 or in SEQ ID No. 2 or comprises a 16S rDNA sequence with maximally 7, 6, 5, 4, 3 or two nucleotides different from SEQ ID No. 1 or SEQ ID No. 2 or comprises a 16S rDNA sequence with maximally one nucleotide different from SEQ ID No. 1. or SEQ ID No. 2. In a more particular embodiment, any of the bacteria described herein is provided, wherein any of said bacteria produces or is capable of producing an effective amount of a phytotoxic fermentation product (including but not limited to an extract or supernatant of the fermentation broth) or wherein any of said bacteria has an herbicidal activity. "Capable of producing" a phytotoxic fermentation product as used herein refers to the endogenous production of said phytotoxic fermentation product and excludes the possibility that the species is genetically modified to become capable of producing said phytotoxic fermentation product. Hence, in a further or particular embodiment, the bacteria of current application are not genetically engineered or genetically modified with the purpose of producing a phytotoxic fermentation product.

[0074] In yet another embodiment, the bacteria according to the application are isolated species. The term "isolated" means that the bacteria have been removed from their natural environment. "Isolated" thus implies a purification step. However, "isolated" does not necessarily reflect the extent to which the microorganisms, more particularly the bacteria have been purified. In one embodiment, the bacteria of current application are purified at least 2x, at least 5x, at least lOx, at least 50x or at least lOOx from the raw material from which it is isolated. As a non-limiting example, if a microorganism is isolated from soil as raw material, the microorganism can be isolated to an extent that its concentration in a given quantity of purified or partially purified material (e.g. soil) is at least 2x, at least 5x, at least lOx, at least 50x or at least lOOx higher that in the original raw material.

[0075] In another aspect of current application, a bacterium is provided of which a representative culture has been deposited under the Budapest Treaty at the BCCM / LMG on 7thJune 2024 under Accession No. LMG P-33652 or at the Polish Collection of Microorganisms (PCM) on 7thFebruary 2024 under Accession No. B / 00525. A "representative culture" of LMG P-33652 or B / 00525 as used herein refers to a culture obtained from bacterial strain M1H1 or M23A7 respectively and that consists of the descendants of the original isolated bacterium. Although said descendants are genetically identical, because of spontaneous mutations in non-essential genomic regions that occur during the steps of culturing, and because of inevitable sequencing errors of state-of-the art sequencing technologies, sequencing results from the duplicates of strain M1H1 or M23A7 will likely not be 100% identical to each other or to the original isolated bacteria on 16S level and / or on whole genome level. In one embodiment, the average technical error is 0.15% or less. This means that two bacterial cultures having 99.85% or more sequence identity will still be considered genetically identical. In another embodiment, the average technical error is 0.12% or less, or 0.10% or less, or 0.08% or less, or 0.06% or less, or 0.04% or less or 0.02% or less. This means that two bacterial cultures have at least 99.88% sequence identity, or at least 99.90%, or at least 99.92%, or at least 99.94%, or at least 99.96% or at least 99.98% will still be considered genetically identical.

[0076] Also provided is a bacterial strain with deposit accession number LMG-P-33652 as deposited under the Budapest Treaty at the BCCM / LMG on 7thJune 2024 or with deposit accession number B / 00525 as deposited under the Budapest Treaty at the PCM on 7thFebruary 2024. Also provided is a bacterial species having at least 90.0%, at least 91.0%, at least 92.0%, at least 93.0% or at least 94.0%, most particularly at least 95.0%, 96.0%, 97.0%, 98.0%, or at least 99.0% genomic sequence identity with the bacterial strain deposited as LMG-P-33652 and wherein the bacterial species, a spore thereof or a fermentation product derived from a cell culture of said bacterial species exhibits phytotoxic activity when applied to a plant, more particularly when sprayed on the leaves of a plant. In a further embodiment of the current invention, said fermentation product thereof is selected from the list consisting of an extract, an extract fraction, a supernatant, a supernatant fraction, a filtrate, a whole cell broth derived from a cell culture of said bacterial species or a phytotoxic substance endogenously produced by said bacterial species. In another embodiment, a Streptomyces strain is provided, wherein said Streptomyces strain is a functional mutant or functional homologue of the Streptomyces strain deposited as LMG-P-33652 and wherein said functional homologue or a fermentation product obtained from a cell culture of said functional homologue is still capable of exhibiting phytotoxic activity when applied to a plant. Indeed, it is herein demonstrated that the Streptomyces strain deposited as LMG-P-33652 exhibits phytotoxic activity and thus can be used to control weed growth in the field. However, not every single nucleotide in said strain's genome is essential for the technical effect herein disclosed. Moreover, due to the degenerate or redundant genetic code (i.e. multiple codons can code for the same amino acid) a strain can comprise multiple nucleotide differences compared to the Streptomyces strain herein disclosed and still be capable of exhibiting a phytotoxic activity and thus be as effective as weed control agent. Hence, it is obvious that current disclosure is broader than just the deposited strains M1H1 and M23A7. The current application provides also Streptomyces bacteria that have a minimal number of differences on the level of the nucleotide sequence compared to the deposited M1H1 strain, but importantly still exhibit a significant phytotoxic activity when applied to a plant. In one embodiment, said difference(s) on the level of the nucleotide sequence are silent mutations that do not alter the properties or activities of the gene product for which they encode. This is exemplified by the two deposited Streptomyces strains LMG-P-33652 and B / 00525 as disclosed herein and the two publicly available strains NBRC15454 and DSM40545. The 16S rDNA sequences of LMG-P-33652 and B / 00525 share 99.869% identical nucleotides. On whole genome level both genomes are 95.95% identical (ANI = 95.95%). Although the 16S rDNA sequence and the whole genome sequence of LMG P-33652 and B / 00525 are not identical to each other, LMG P-33652 and B / 00525 have both an herbicidal activity and produce the same phytotoxic compounds. The same holds true for DSM40545 and NBRC15454. The sequence identity between LMG P-33652 and DSM40545 on 16S rDNA level is 99.93% and on whole genome level 97.83%. The 16S rDNA sequence of LMG P-33652 and NBRC15454 are identical but on whole genome level there is 94.62% sequence identity. The sequence identity between B / 00525 and DSM40545 on 16S rDNA level is 99.87% and on whole genome level 96.21%. The 16S rDNA sequence of B / 00525 and NBRC15454 is 99.87% identical and on whole genome level there is 94.84% sequence identity. Although the strains are not identical on nucleic acid level, LMG P-33652, NBRC15454, DSM40545 and B / 00525 have a similar phytotoxic activity and produce the same phytotoxic compound.

[0077] The terms "functional mutant" or "functional homologue", "functionally homologous", "functional variant" are grammatical equivalents that are used herein interchangeably and refer to a modification on nucleotide level (e.g., nucleotide substitution or mutation) of the bacterial strains of the invention resulting in a bacterial strain that is endowed with substantially the same ensemble of biological activities - particularly the capability to control or inhibit the growth, development and / or activity of one or more target plants (e.g., at least 5%, 10%, 20%, 40%, 50%, 60%, 75% or 100% when tested under the same conditions) - as that of the bacterial strain of the invention and can be classified to the same species or strain based on known methods of species / strain classifications as described herein. The modification can be man-made or evolutionary, e.g., during propagation with or without selection.

[0078] Therefore, in a particular embodiment, said functional mutant of the Streptomyces strain deposited as LMG-P-33652 is a Streptomyces bacterium having at least 90.0%, at least 90.5%, at least 91.0%, at least 92.0%, at least 92.5%, at least 93.0%, at least 93.5%, at least 94.0%, at least 94.5%, at least 95.0%, at least 95.5%, at least 96.0%, at least 96.5%, at least 97.0%, at least 97.5%, at least 98.0%, at least 98.5%, at least 99.0%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.75%, at least 99.8%, at least 99.85%, at least 99.9% or at least 99.95% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and wherein the strain, a spore thereof or a fermentation product obtained from a cell culture of said strain is capable of exhibiting a phytotoxic effect when applied to a plant.

[0079] In a further particular embodiment, said functional mutant has at least 90.00% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and comprises a 16S rDNA sequence with at least 99.50% identity to that of LMG-P-33652 and wherein the functional mutant, a spore thereof or a fermentation product obtained from a cell culture of said functional mutant is capable of exhibiting a phytotoxic effect when applied to a plant. In another more particular embodiment, said functional mutant has at least 90.00% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and comprises a 16S rDNA sequence with at least 99.60% identity to that of LMG-P-33652 and wherein the functional mutant, a spore thereof or a fermentation product obtained from a cell culture of said functional mutant is capable of exhibiting a phytotoxic effect when applied to a plant. In another more particular embodiment, said functional mutant has at least 90.00% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and comprises a 16S rDNA sequence with at least 99.70% identity to that of LMG-P- 33652 and wherein the functional mutant, a spore thereof or a fermentation product obtained from a cell culture of said functional mutant is capable of exhibiting a phytotoxic effect when applied to a plant. In another more particular embodiment, said functional mutant has at least 90.00% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and comprises a 16S rDNA sequence with at least 99.75% identity to that of LMG-P-33652 and wherein the functional mutant a spore thereof or a fermentation product obtained from a cell culture of said functional mutant is capable of exhibiting a phytotoxic effect when applied to a plant. In another more particular embodiment, said functional mutant has at least 90.00% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and comprises a 16S rDNA sequence with at least 99.80% identity to that of LMG-P-33652 and wherein the functional mutant, a spore thereof or a fermentation product obtained from a cell culture of said functional mutant is capable of exhibiting a phytotoxic effect when applied to a plant. In another more particular embodiment, said functional mutant has at least 90.00% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and comprises a 16S rDNA sequence with at least 99.85% identity to that of LMG-P- 33652 and wherein the functional mutant, a spore thereof or a fermentation product obtained from a cell culture of said functional mutant is capable of exhibiting a phytotoxic effect when applied to a plant. In another more particular embodiment, said functional mutant has at least 90.00% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and comprises a 16S rDNA sequence with at least 99.9% identity to that of LMG-P-33652 and wherein the functional mutant, a spore thereof or a fermentation product obtained from a cell culture of said functional mutant is capable of exhibiting a phytotoxic effect when applied to a plant. In yet another more particular embodiment, said functional mutant has at least 90.00% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and comprises a 16S rDNA sequence as depicted in SEQ. ID No. 1 and wherein the functional mutant, a spore thereof or a fermentation product obtained from a cell culture of said functional mutant is capable of exhibiting a phytotoxic effect when applied to a plant.

[0080] In a further particular embodiment, said functional mutant has at least 92.00% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and comprises a 16S rDNA sequence with at least 99.50% identity to that of LMG-P-33652 and wherein the functional mutant, a spore thereof or a fermentation product obtained from a cell culture of said functional mutant is capable of exhibiting a phytotoxic effect when applied to a plant. In another more particular embodiment, said functional mutant has at least 92.00% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and comprises a 16S rDNA sequence with at least 99.60% identity to that of LMG-P-33652 and wherein the functional mutant, a spore thereof or a fermentation product obtained from a cell culture of said functional mutant is capable of exhibiting a phytotoxic effect when applied to a plant. In another more particular embodiment, said functional mutant has at least 92.00% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and comprises a 16S rDNA sequence with at least 99.70% identity to that of LMG-P- 33652 and wherein the functional mutant, a spore thereof or a fermentation product obtained from a cell culture of said functional mutant is capable of exhibiting a phytotoxic effect when applied to a plant. In another more particular embodiment, said functional mutant has at least 92.00% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and comprises a 16S rDNA sequence with at least 99.75% identity to that of LMG-P-33652 and wherein the functional mutant, a spore thereof or a fermentation product obtained from a cell culture of said functional mutant is capable of exhibiting a phytotoxic effect when applied to a plant. In another more particular embodiment, said functional mutant has at least 92.00% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and comprises a 16S rDNA sequence with at least 99.80% identity to that of LMG-P-33652 and wherein the functional mutant, a spore thereof or a fermentation product obtained from a cell culture of said functional mutant is capable of exhibiting a phytotoxic effect when applied to a plant. In another more particular embodiment, said functional mutant has at least 92.00% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and comprises a 16S rDNA sequence with at least 99.85% identity to that of LMG-P- 33652 and wherein the functional mutant, a spore thereof or a fermentation product obtained from a cell culture of said functional mutant is capable of exhibiting a phytotoxic effect when applied to a plant. In another more particular embodiment, said functional mutant has at least 92.00% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and comprises a 16S rDNA sequence with at least 99.90% identity to that of LMG-P-33652 and wherein the functional mutant, a spore thereof or a fermentation product obtained from a cell culture of said functional mutant is capable of exhibiting a phytotoxic effect when applied to a plant. In yet another more particular embodiment, said functional mutant has at least 92.00% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and comprises a 16S rDNA sequence as depicted in SEQ. ID No. 1 and wherein the functional mutant, a spore thereof or a fermentation product obtained from a cell culture of said functional mutant is capable of exhibiting a phytotoxic effect when applied to a plant.

[0081] In a further particular embodiment, said functional mutant has at least 94.00% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and comprises a 16S rDNA sequence with at least 99.50% identity to that of LMG-P-33652 and wherein the functional mutant, a spore thereof or a fermentation product obtained from a cell culture of said functional mutant is capable of exhibiting a phytotoxic effect when applied to a plant. In another more particular embodiment, said functional mutant has at least 94.00% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and comprises a 16S rDNA sequence with at least 99.60% identity to that of LMG-P-33652 and wherein the functional mutant, a spore thereof or a fermentation product obtained from a cell culture of said functional mutant is capable of exhibiting a phytotoxic effect when applied to a plant. In another more particular embodiment, said functional mutant has at least 94.00% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and comprises a 16S rDNA sequence with at least 99.70% identity to that of LMG-P- 33652 and wherein the functional mutant, a spore thereof or a fermentation product obtained from a cell culture of said functional mutant is capable of exhibiting a phytotoxic effect when applied to a plant. In another more particular embodiment, said functional mutant has at least 94.00% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and comprises a 16S rDNA sequence with at least 99.75% identity to that of LMG-P-33652 and wherein the functional mutant, a spore thereof or a fermentation product obtained from a cell culture of said functional mutant is capable of exhibiting a phytotoxic effect when applied to a plant. In another more particular embodiment, said functional mutant has at least 94.00% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and comprises a 16S rDNA sequence with at least 99.80% identity to that of LMG-P-33652 and wherein the functional mutant, a spore thereof or a fermentation product obtained from a cell culture of said functional mutant is capable of exhibiting a phytotoxic effect when applied to a plant. In another more particular embodiment, said functional mutant has at least 94.00% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and comprises a 16S rDNA sequence with at least 99.85% identity to that of LMG-P- 33652 and wherein the functional mutant, a spore thereof or a fermentation product obtained from a cell culture of said functional mutant is capable of exhibiting a phytotoxic effect when applied to a plant. In another more particular embodiment, said functional mutant has at least 94.00% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and comprises a 16S rDNA sequence with at least 99.90% identity to that of LMG-P-33652 and wherein the functional mutant, a spore thereof or a fermentation product obtained from a cell culture of said functional mutant is capable of exhibiting a phytotoxic effect when applied to a plant. In yet another more particular embodiment, said functional mutant has at least 94.00% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and comprises a 16S rDNA sequence as depicted in SEQ. ID No. 1 and wherein the functional mutant, a spore thereof or a fermentation product obtained from a cell culture of said functional mutant is capable of exhibiting a phytotoxic effect when applied to a plant.

[0082] In another further particular embodiment, said functional mutant has at least 95.00% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and comprises a 16S rDNA sequence with at least 99.50% identity to that of LMG-P-33652 and wherein the functional mutant, a spore thereof or a fermentation product obtained from a cell culture of said functional mutant is capable of exhibiting a phytotoxic effect when applied to a plant. In another more particular embodiment, said functional mutant has at least 95.00% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and comprises a 16S rDNA sequence with at least 99.60% identity to that of LMG-P-33652 and wherein the functional mutant, a spore thereof or a fermentation product obtained from a cell culture of said functional mutant is capable of exhibiting a phytotoxic effect when applied to a plant. In another more particular embodiment, said functional mutant has at least 95.00% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and comprises a 16S rDNA sequence with at least 99.70% identity to that of LMG-P- 33652 and wherein the functional mutant, a spore thereof or a fermentation product obtained from a cell culture of said functional mutant is capable of exhibiting a phytotoxic effect when applied to a plant. In another more particular embodiment, said functional mutant has at least 95.00% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and comprises a 16S rDNA sequence with at least 99.75% identity to that of LMG-P-33652 and wherein the functional mutant, a spore thereof or a fermentation product obtained from a cell culture of said functional mutant is capable of exhibiting a phytotoxic effect when applied to a plant. In another more particular embodiment, said functional mutant has at least 95.00% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and comprises a 16S rDNA sequence with at least 99.80% identity to that of LMG-P-33652 and wherein the functional mutant, a spore thereof or a fermentation product obtained from a cell culture of said functional mutant is capable of exhibiting a phytotoxic effect when applied to a plant. In another more particular embodiment, said functional mutant has at least 95.00% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and comprises a 16S rDNA sequence with at least 99.85% identity to that of LMG-P- 33652 and wherein the functional mutant, a spore thereof or a fermentation product obtained from a cell culture of said functional mutant is capable of exhibiting a phytotoxic effect when applied to a plant. In another more particular embodiment, said functional mutant has at least 95.00% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and comprises a 16S rDNA sequence with at least 99.90% identity to that of LMG-P-33652 and wherein the functional mutant, a spore thereof or a fermentation product obtained from a cell culture of said functional mutant is capable of exhibiting a phytotoxic effect when applied to a plant. In yet another more particular embodiment, said functional mutant has at least 95.00% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and comprises a 16S rDNA sequence as depicted in SEQ. ID No. 1 and wherein the functional mutant, a spore thereof or a fermentation product obtained from a cell culture of said functional mutant is capable of exhibiting a phytotoxic effect when applied to a plant.

[0083] In a more particular embodiment, said functional mutant has at least 97.00% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and comprises a 16S rDNA sequence with at least 99.50% identity to that of LMG-P-33652 and wherein the functional mutant, a spore thereof or a fermentation product obtained from a cell culture of said functional mutant is capable of exhibiting a phytotoxic effect when applied to a plant. In another more particular embodiment, said functional mutant has at least 97.00% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and comprises a 16S rDNA sequence with at least 99.60% identity to that of LMG-P-33652 and wherein the functional mutant, a spore thereof or a fermentation product obtained from a cell culture of said functional mutant is capable of exhibiting a phytotoxic effect when applied to a plant. In another more particular embodiment, said functional mutant has at least 97.00% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and comprises a 16S rDNA sequence with at least 99.70% identity to that of LMG-P- 33652 and wherein the functional mutant, a spore thereof or a fermentation product obtained from a cell culture of said functional mutant is capable of exhibiting a phytotoxic effect when applied to a plant. In another more particular embodiment, said functional mutant has at least 97.00% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and comprises a 16S rDNA sequence with at least 99.75% identity to that of LMG-P-33652 and wherein the functional mutant, a spore thereof or a fermentation product obtained from a cell culture of said functional mutant is capable of exhibiting a phytotoxic effect when applied to a plant. In another more particular embodiment, said functional mutant has at least 97.00% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and comprises a 16S rDNA sequence with at least 99.80% identity to that of LMG-P-33652 and wherein the functional mutant, a spore thereof or a fermentation product obtained from a cell culture of said functional mutant is capable of exhibiting a phytotoxic effect when applied to a plant. In another more particular embodiment, said functional mutant has at least 97.00% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and comprises a 16S rDNA sequence with at least 99.85% identity to that of LMG-P- 33652 and wherein the functional mutant, a spore thereof or a fermentation product obtained from a cell culture of said functional mutant is capable of exhibiting a phytotoxic effect when applied to a plant. In another more particular embodiment, said functional mutant has at least 97.00% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and comprises a 16S rDNA sequence with at least 99.90% identity to that of LMG-P-33652 and wherein the functional mutant, a spore thereof or a fermentation product obtained from a cell culture of said functional mutant is capable of exhibiting a phytotoxic effect when applied to a plant. In yet another more particular embodiment, said functional mutant has at least 97.00% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and comprises a 16S rDNA sequence as depicted in SEQ. ID No. 1 and wherein the functional mutant, a spore thereof or a fermentation product obtained from a cell culture of said functional mutant is capable of exhibiting a phytotoxic effect when applied to a plant.

[0084] In another more particular embodiment, said functional mutant has at least 98.00% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and comprises a 16S rDNA sequence with at least 99.60% identity to that of LMG-P-33652 and wherein the functional mutant, a spore thereof or a fermentation product obtained from a cell culture of said functional mutant is capable of exhibiting a phytotoxic effect when applied to a plant. In another more particular embodiment, said functional mutant has at least 98.00% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and comprises a 16S rDNA sequence with at least 99.70% identity to that of LMG-P-33652 and wherein the functional mutant, a spore thereof or a fermentation product obtained from a cell culture of said functional mutant is capable of exhibiting a phytotoxic effect when applied to a plant. In another more particular embodiment, said functional mutant has at least 98.00% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and comprises a 16S rDNA sequence with at least 99.80% identity to that of LMG-P- 33652 and wherein the functional mutant, a spore thereof or a fermentation product obtained from a cell culture of said functional mutant is capable of exhibiting a phytotoxic effect when applied to a plant. In yet another more particular embodiment, said functional mutant has at least 98.00% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and comprises a 16S rDNA sequence as depicted in SEQ. ID No. 1 and wherein the functional mutant, a spore thereof or a fermentation product obtained from a cell culture of said functional mutant is capable of exhibiting a phytotoxic effect when applied to a plant.

[0085] In a further particular embodiment, said functional mutant has at least 99.00% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and comprises a 16S rDNA sequence with at least 99.50% identity to that of LMG-P-33652 and wherein the functional mutant, a spore thereof or a fermentation product obtained from a cell culture of said functional mutant is capable of exhibiting a phytotoxic effect when applied to a plant. In another more particular embodiment, said functional mutant has at least 99.00% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and comprises a 16S rDNA sequence with at least 99.60% identity to that of LMG-P-33652 and wherein the functional mutant, a spore thereof or a fermentation product obtained from a cell culture of said functional mutant is capable of exhibiting a phytotoxic effect when applied to a plant. In another more particular embodiment, said functional mutant has at least 99.00% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and comprises a 16S rDNA sequence with at least 99.70% identity to that of LMG-P- 33652 and wherein the functional mutant, a spore thereof or a fermentation product obtained from a cell culture of said functional mutant is capable of exhibiting a phytotoxic effect when applied to a plant. In another more particular embodiment, said functional mutant has at least 99.00% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and comprises a 16S rDNA sequence with at least 99.75% identity to that of LMG-P-33652 and wherein the functional mutant, a spore thereof or a fermentation product obtained from a cell culture of said functional 1 mutant is capable of exhibiting a phytotoxic effect when applied to a plant. In another more particular embodiment, said functional mutant has at least 99.00% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and comprises a 16S rDNA sequence with at least 99.80% identity to that of LMG-P-33652 and wherein the functional mutant, a spore thereof or a fermentation product obtained from a cell culture of said functional mutant is capable of exhibiting a phytotoxic effect when applied to a plant. In another more particular embodiment, said functional mutant has at least 99.00% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and comprises a 16S rDNA sequence with at least 99.85% identity to that of LMG-P- 33652 and wherein the functional mutant, a spore thereof or a fermentation product obtained from a cell culture of said functional mutant is capable of exhibiting a phytotoxic effect when applied to a plant. In another more particular embodiment, said functional mutant has at least 99.00% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and comprises a 16S rDNA sequence with at least 99.90% identity to that of LMG-P-33652 and wherein the functional mutant, a spore thereof or a fermentation product obtained from a cell culture of said functional mutant is capable of exhibiting a phytotoxic effect when applied to a plant. In yet another more particular embodiment, said functional mutant has at least 99.00% genomic sequence identity with the Streptomyces strain as deposited as LMG-P-33652 and comprises a 16S rDNA sequence as depicted in SEQ. ID No. 1 and wherein the functional mutant, a spore thereof or a fermentation product obtained from a cell culture of said functional mutant is capable of exhibiting a phytotoxic effect when applied to a plant.

[0086] In one embodiment, said being capable of exhibiting a phytotoxic effect when applied to a plant refers to comprising a phytotoxic activity, more particularly to comprising a similar phytotoxic activity compared to LMG-P-33652 or B / 00525 or to a fermentation product derived from a cell culture of LMG-P-33652 or B / 00525. In a particular embodiment, said "similar phytotoxic activity" or a "similar phytotoxic effect" as that of LMG-P-33652 or B / 00525 or of a fermentation product derived from a cell culture of LMG-P-33652 or B / 00525 is having at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90% of the phytotoxic activity of LMG-P-33652 or B / 00525 or of a fermentation product derived from a cell culture of LMG-P-33652 or B / 00525. In a most particular embodiment, said similar phytotoxic activity compared to LMG-P-33652 or B / 00525 or to a fermentation product derived from a cell culture of LMG-P-33652 or B / 00525 is a phytotoxic activity that is not statistically significantly different from that of LMG-P-33652 or B / 00525 or of a fermentation product derived from a cell culture of LMG-P-33652 or B / 00525.

[0087] In a most particular embodiment, the differences in genetic sequence on whole genome level or onl6S rDNA level between the functional homologue and LMG-P-33652 or B / 00525 are because of silent mutations. "x% genomic sequence identity" as used herein is equivalent to saying "x% sequence identity on whole genome level".

[0088] In one embodiment, "x% genomic sequence identity" is the same as an Average Nucleotide Identity (ANI) of x%. "Average Nucleotide Identity" also referred herein as ANI is a descriptor of genetic relatedness. This descriptor is based on a large number of genes (typically> 1000 genes in total), thereby increasing the robustness and resolution of extracted phylogenetic signals. The genomic sequence identity or %ANI can be determined by several methods well-known by the person skilled in the art. A non-limiting example is to first perform a whole-genome alignment between two genome sequences. To do so, the genomic DNA has to be extracted and quantified. To extract sufficient high- quality DNA for whole genome sequencing, many different methods including conventional procedures and the use of commercial kits, can be carried out. After that, whole genome sequencing can be performed with high-throughput DNA sequencing technology using benchtop instruments such as, but not limited to, 454 GS FLX Titanium / GS Junior (Roche), Genome Analyzer / HiSeq 2000 / MiSeq (Illumina), SOLiD / lon Torrent PGM (Life Technologies), or RS (Pacific Biosciences). The whole-genome alignment can then be done using bioinformatics tools like MUMmer, Mauve, or BLAST (Qi et al 2024 Front Microbiol 15). Next, the percent identity between the aligned genomic regions is calculated. This represents the overall genomic sequence identity between the two strains. Tools like MUMmer or BLAST can provide the percent identity statistic directly (Qi et al 2024 Front Microbiol 15). Alternatively, the number of identical nucleotides across the entire aligned genomes can be calculated and divided by the total number of aligned nucleotides to calculate the % genomic sequence identity. For example, a whole-genome alignment between the deposited Streptomyces strains LMG-P-33652 and B / 00525 revealed that 96% of the nucleotides are identical between the two bacterial strains. Hence, the percent genomic sequence identity or ANI is 96%. The BLAST calculation of ANI values, using the Blast algorithm, is called ANIb. ANI values can be calculated by using the NUCmer program in the MUMmer software package and are called ANIm.

[0089] From hereon, any of the above-described Streptomyces bacteria will be referred to as any of the Streptomyces species of current application. The proposed taxonomic designation of the Streptomyces species of current application is Streptomyces chrestomyceticus.

[0090] In a most particular embodiment, the Streptomyces species of current application is resistant to or compatible with a biocide. A "biocide" as used herein is a chemical substance that can exert a controlling effect on an organism by chemical or biological means. Biocides include pesticides, such as fungicides, bactericides, insecticides, herbicides or other crop protection chemicals, and the like. Such compounds are discussed in detail elsewhere herein. A bacterial species is compatible with a biocide when the bacterial species is able to survive and / or reproduce in the presence of an effective amount of a biocide of interest. Also provided is the bacterial species of current application wherein the growth of the species is compatible with one or more agricultural chemicals used to improve performance of biocides. Such agricultural chemicals include safeners, surfactants, stickers, spreaders, UV protectants, and suspension and dispersal aids. Safeners are chemicals that improve or modify the performance of insecticides. Surfactants, spreaders, and stickers are chemicals included in agricultural spray preparations that change the mechanical properties of the spray (for example, by altering surface tension or improving penetration or uptake). UV protectants improve the performance of agricultural biocides by reducing degradation by ultraviolet light. Suspension and dispersal aids improve the performance of biocides by altering their behaviour in a spray tank. A bacterial species is compatible with a product when the bacterial species is able to survive and / or reproduce in the presence of an effective amount of said product. In another or further most particular embodiment, the Streptomyces species of current application or any product derived thereof is not harmful to bees.

[0091] In a particular embodiment, the Streptomyces bacterium or species of current application is an isolated species. The term "isolated" means that the species has been removed from its natural environment. "Isolated" thus implies a purification step. However, "isolated" does not necessarily reflect the extent to which the microorganism, more particularly the bacterium has been purified. In one embodiment, the Streptomyces species of current application is purified at least 2x, at least 5x, at least lOx, at least 50x or at least lOOx from the raw material from which it is isolated. As a non-limiting example, if a microorganism is isolated from soil as raw material, the microorganism can be isolated to an extent that its concentration in a given quantity of purified or partially purified material (e.g. soil) is at least 2x, at least 5x, at least lOx, at least 50x or at least lOOx higher than in the original raw material.

[0092] Also provided is a microbial cell population comprising the Streptomyces species of current application, as well as an agricultural composition or an agricultural active composition, denoted herein as an herbicidal composition, and which owing to its effect can alternatively be denoted as a phytotoxic composition, a weed control composition or a composition for controlling weed growth or growth of unwanted plants, wherein said composition comprises the Streptomyces species of current application or comprises a microbial cell population comprising the Streptomyces species of current application. In another aspect of the application a culture of the Streptomyces species of current application is provided. The term "culture" as used herein refers to a population of microorganisms that are propagated on or in media of various kinds. In one embodiment, said culture is an enriched culture of the Streptomyces species of current application. This is equivalent as saying that a culture of microorganisms, more particularly a bacterial culture, is provided, wherein said culture is enriched with the Streptomyces species of current application (e.g. Streptomyces strain M1H1) and wherein "enriched" means that the total microbial (or more particularly the total bacterial) population of said culture contains more than 50%, more than 60%, more than 70%, more than 80%, more than 90%, or more than 95% of the isolated Streptomyces species of current application, more particularly of the Streptomyces strain M1H1 with deposit accession number LMG-P-33652 or of the Streptomyces strain M23A7 with deposit accession number B / 00525. In one embodiment, said percentage is determined by the number or CFUs of the isolated bacterial species in view of all microorganisms or bacterial cells present in the culture. In another embodiment, said percentage is determined by the biomass of the isolated bacterial species in view of all microorganisms or bacterial cells present in the culture.

[0093] In another embodiment, a biologically pure culture of the Streptomyces species of current application is provided. As used herein, "biologically pure" refers to a culture which contains substantially no other microorganisms than the desired species and thus a culture wherein virtually all of the cells present are of the selected species. In practice, a culture is defined biologically pure if the culture contains at least more than 96%, at least more than 97%, at least more than 98% or at least more than 99% of the Streptomyces species of current application, more particularly of Streptomyces strain M1H1 with deposit accession number LMG-P-33652 or of the Streptomyces strain M23A7 with deposit accession number B / 00525. When a biologically pure culture contains 100% of the desired microorganism a monoculture is reached. A monoculture thus only contains cells of the selected species and is the most extreme form of a biologically pure culture. In one embodiment, said percentage is determined by the number or CFUs of the isolated bacterial species.

[0094] In yet another embodiment, the culture of the Streptomyces species of the application comprises at least 1%, at least 5%, at least 10%, at least 25%, at least 50%, at least 75%, at least 80%, at least 85%, at least 90% or at least 95% living Streptomyces species of the application, most particularly living Streptomyces strain LMG-P-33652 or B / 00525.

[0095] In a particular embodiment, the Streptomyces species of current application may be lyophilized, freeze-dried or in a form selected from dried cells, dehydrated cells, devitalized cells, inactivated cells, frozen cells or cells in artificial suspension or in a dry powder. In another particular embodiment, an aqueous slurry of the Streptomyces species of the current application or of any culture herein described comprising the Streptomyces species of the application is provided. In a further embodiment, the slurry is dried to a powder at a temperature which does not adversely affect the viability of the Streptomyces species.

[0096] Throughout the application, a fermentation product derived from any of the Streptomyces species of current application can be an extract, an extract fraction, a supernatant, a supernatant fraction, a filtrate, a whole cell broth or an herbicidal substance endogenously produced by said bacterial species. Hence, in another particular embodiment, the application provides an extract or an extract fraction thereof of the bacterial species of current application. Non-limiting examples of said extract are a solvent extract, a supercritical fluid extract, a pressurized liquid extract, a microwave-assisted extract, an ultrasound assisted extract, an enzyme-assisted extract and other extracts well known by the skilled person. The term "extract" or synonyms "cell extract" or "lysate" refers to the liquid substance removed from cells. Microbial extracts are obtained by removing the cell walls and / or cell membranes of the microbial cells, a process known as lysis, thereby obtaining one or more endogenous products of the cultured microbial cells. Removing the cell walls and / or cell membranes of microbial cells (such as the bacterial species of the application) can be performed by several procedures which are well- known by the person skilled in the art. Non-limiting examples are the addition of chemicals to the culture (solvent, detergent, buffer, and / or organic solvent, for example), heating the culture, or induce cell lysis in a mechanical way. The extract and the cell debris can be separated from each other by centrifugation, filtration, or other methods known in the art. An extract can also be obtained by autolysis of the bacterial species. The extract may comprise a concentrated amount of an effective fermentation product (such as a compound or metabolite) compared to the concentration of the fermentation product in the cells prior to extraction. An "extract fraction" as used herein refers to a part, portion, fragment, segment, piece, or fraction of a whole, complete, or full extract of a microbial culture. An extract fraction can be obtained by fractionation for example by chromatography. The extract can be further purified using methods well-known in the art. In some embodiments, the extract is a cell-free or inactivated preparation of any of the bacterial species as disclosed herein.

[0097] Surprisingly, the inventors of current application could also demonstrate that the supernatant of a cell culture of the Streptomyces strain M1H1 is as effective in phytotoxicity as the extract thereof. In another particular embodiment, the application also provides a supernatant or supernatant fraction of the culture or cell culture of the bacterial species of the application or the functional homologs thereof. The term "supernatant" refers to the liquid broth remaining when cells grown in said broth are removed by centrifugation, filtration, sedimentation or other means well known in the art. In analogy with the term "extract fraction", "supernatant fraction" as used herein refers to a part, portion, fragment, segment, piece, or fraction of a whole, complete, or full supernatant of a microbial culture. In another particular embodiment, the application provides a filtrate of a cell culture of the bacterial species of current application or of the functional homologs thereof. As used herein, "filtrate" refers to the liquid from a whole cell broth culture that has passed through a membrane. Hence, filtrate is a particular form of the supernatant of said whole cell broth.

[0098] In yet another particular embodiment, the application also provides a whole cell broth collected from the fermentation of any of the bacterial species of the application. "Whole-cell broth" as used herein refers to the contents of a microbial bioreactor wherein the bacterial species of current application is grown and thus to the liquid culture comprising both the bacterial cells and the liquid fermentation medium including nutrients, waste, and other components present or produced during the fermentation or cell culture process.

[0099] In yet another particular embodiment, the application provides an herbicidal substance endogenously produced by any of the bacterial species of current application, more particular of the bacterial strain as deposited under accession number LMG-P-33652 or B / 00525 or any functional homologue thereof. As used herein, "herbicidal substance" refers to a compound or product with a negative biological effect in or onto an unwanted plant, for example a plant weed such as Amaranthus and Digitaria or a volunteer crop such as maize, and thus that suppresses, inhibits, limits, or controls growth, germination, reproduction, survival and / or development of or kills one or more plant species or target plant species such as undesirable plant pests. In one embodiment, said herbicidal substance induces chlorosis, necrosis and / or growth delay in a plant to which it was administered. In one embodiment said herbicidal substance is a compound or product produced by any of the bacterial species of the application that has not been genetically modified to be able to produce said herbicidal substance. More particularly, the herbicidal substance can be present in the above-described extract, extract fraction, supernatant, supernatant fraction, filtrate, or whole cell broth.

[0100] "Endogenously produced" as used herein refers to the herbicidal substance that is produced by the bacterial species of current application, more particularly of the bacterial strain M1H1 or M23A7, or functional homologues thereof. Non-limiting examples of endogenously produced herbicidal substances of the bacterial species of current application are a metabolite, a lipid, a fatty acid, a steroid, a carbohydrate, a protein, a peptide, an enzyme, an antibody, a nucleic acid, a chemical compound, a vitamin and a mineral.

[0101] In yet another embodiment, any of the herein disclosed bacterial species, more particularly the bacterial strain deposited under accession number LMG-P-33652 or B / 00525, or any functional homologue thereof are provided for use as an herbicide.

[0102] In particular embodiments, the fermentation product derived from a cell culture of any of the bacterial species of current application, more particularly the extract, extraction fraction, supernatant, supernatant fraction, filtrate, whole cell broth or herbicidal substance endogenously produced by said bacterial species, may be diluted with another composition, such as water, buffer, fresh media and / or a formulation before using them for example to spray on unwanted plants. In other particular embodiments, said fermentation product may be concentrated. Such diluted or concentrated extracts, extraction fractions, supernatants, supernatant fractions, filtrates, whole cell broths or herbicidal substances endogenously produced by any of the bacterial species of current application are still considered fermentation products derived from a cell culture of any of the Streptomyces species of current application. AGRICULTURAL COMPOSITIONS

[0103] To the best of Applicant's knowledge, the art is completely silent on the fact that Streptomyces chrestomyceticus species have herbicidal activity or have the ability to produce herbicidal substances. In one aspect, Streptomyces chrestomyceticus species, more particularly the Streptomyces species as disclosed herein, or any fermentation product (such as extract, filtrates, supernatants and alike) derived or obtained from a culture of the Streptomyces chrestomyceticus species or of the Streptomyces species as disclosed herein, is applied to plants as a formulation or a composition, more particularly as an agricultural composition. An "agricultural composition" as used herein refers to a composition for agricultural purposes. Given that the composition is of use to control weeds, also an herbicidal composition is provided. More particularly, the application provides a composition, an agricultural composition or an herbicidal composition for controlling, reducing, suppressing or inhibiting the growth of one or more plant species, comprising any of the Streptomyces species or the Streptomyces chrestomyceticus species of the application, a spore thereof or a fermentation product obtained from a cell culture of the Streptomyces species or of the Streptomyces chrestomyceticus species of the application. In a particular embodiment, said one or more plant species refer to one or more target plants.

[0104] Also provided is a composition comprising an inoculum of the Streptomyces species of the application. As used herein, the term "inoculum" is intended to mean any form of Streptomyces cells, or spores, which is capable of propagating on or in a substrate when the conditions of temperature, moisture, etc., are favourable for bacterial growth. A "spore" generally refers to a microorganism in its dormant, protected state.

[0105] In another embodiment, a composition is provided comprising the Streptomyces species of the application further comprising a cryoprotectant and / or growth medium appropriate for Streptomyces species, more particularly Streptomyces chrestomyceticus species. A "cryoprotectant" as used herein protects microorganisms by preventing the damaging effects of water crystals when cells are frozen, more particularly at -60°C, or -70°C, or -80°C or in liquid nitrogen. Non-limiting examples of a cryoprotectant is glycerol and trehalose. In another embodiment, a composition is provided comprising the Streptomyces species herein disclosed wherein the Streptomyces species is lyophilized, freeze dried or in the form of a dry powder. In one embodiment, the composition can further comprise a preservative.

[0106] In a particular embodiment, any of the compositions herein disclosed may be in the form of a liquid, a semisolid, a solid or a gas and / or in a form of a tablet, capsule, powder, dry powder, wettable powder, dust, spray dried formulation, granulate, aerosol, paste, syrup, slurry, suspension, emulsion or solution. The skilled person knows that there are various formulation types available such as solid or liquid formulations. Agricultural composition can be formulated as powders for application in dry state (DS) or as powders that first need to be dispersed at high concentration in water before application as a slurry (i.e. water dispersible powder for slurry treatment (WS) or wettable powder (WP)). Another solid formulation type is the water dispersible granules (WG or WDG). The latter formulation consists of granules that are to be applied after disintegration and dispersion in water, thereby overcoming the dustiness of WS formulations.

[0107] Emulsifiable concentrate (EC) formulations are one of the most common liquid formulation types worldwide. EC formulations combine an active ingredient dissolved in a solvent with emulsifiers. When EC formulations are diluted with water they form a spontaneous emulsion, with emulsion droplets in the size range of 0.1 to 1.0 pm. The spontaneous emulsion can be achieved by selecting one or more surfactants based upon their ability to emulsify the solvent system, including the active ingredient, into water. It is by means of balancing the water soluble and oil soluble surfactant components at the water / solvent interface that a physically stable emulsion is formed. When sprayed, the dilute emulsion gives a uniform and accurate application of active ingredient on the plant or plant parts.

[0108] Concentrated aqueous emulsion (EW) formulations can be considered as a safer and more environmentally friendly alternative to emulsifiable concentrates (EC). In an EW the continuous phase is water (as opposed to an organic solvent for ECs) which offers the benefit of lower phytotoxicity, no flashpoint concern, ease of handling, and a lower environmental impact. EW formulations are physically stabilized by specifically identified polymeric surfactants incorporated at an appropriate level. The emulsion has already been established in the formulation and is only diluted further before use.

[0109] Suspension concentrates (SC) formulations, also known as "flowables" (F), consist of a solid active ingredient dispersed in water. SCs have grown in popularity due to benefits such as the absence of dust, ease of use, and effectiveness when compared to other formulation types such as ECs and wettable powder (WP). To formulate a stable SC, the solid particles of the active ingredient must remain insoluble and suspended under all temperature conditions.

[0110] Flowable concentrates for seed treatment (FS) formulations are a modification of suspension concentrates (SC) with supplemental additives for adhesion to the seed surface and colourants as safety markers to indicate that a seed has been treated with a product. The active ingredients are typically mixed with a polymer or copolymer and fillers such as talc, graphite, aluminium or calcium salts. FS formulations are now the most popular type of seed treatment because they are concentrated formulations that can be directly applied on the seed or after dilution and are safer to apply as they are water based. Microemulsion (ME) formulations are water-based formulations with a very small emulsified droplet size; this makes the formulation transparent. They are thermodynamically stable over a wide temperature range due to this very fine droplet size, usually between 0.01 and 0.05 pm. Therefore in contrast to other emulsion systems, where the oil droplets can slowly coalesce causing phase separation, in ME formulations this does not occur.

[0111] Suspoemulsion (SE) formulations are used to combine two active ingredients with very different physical properties into one formulation. They are a combination of suspension concentrate (SC) and concentrated aqueous emulsion (EW) technologies. The advantages are that it is possible to formulate multiple active ingredients together, broadening the spectrum of activity and eliminating the disadvantage of (tank-mix) incompatibility.

[0112] An oil dispersion (OD) formulation is a solid active ingredient dispersed in oil. The oil can vary from paraffinic to aromatic solvent types and vegetable oil or methylated seed oils. Ideally the active ingredient is uniformly suspended in the oil phase. ODs are an excellent delivery system for water sensitive active ingredients such as sulfonylureas. However, ODs have extended to other active ingredients due to their better spray retention, spreading and foliar uptake as the carrier oil often acts as an adjuvant.

[0113] A (micro)capsule suspension (CS) formulation is a combination of an active ingredient encapsulated in polymer shell suspended in water with a dispersant and wetting agent. CS formulations remain one of the most advanced formulation types for agricultural active compositions worldwide. These are typically next generation formulations. When CS formulations are diluted with water they form a spontaneous suspension, with particles in the size range of 0.1 to 20 pm. When sprayed, the dilute emulsion gives a uniform and accurate application of active ingredient on to the crop or seeds. It is possible to use CS formulations to give controlled or delayed release of active ingredients as well as provide better protection against toxic active ingredients or prevent degradation of material. For special seed treatment applications gel formulations (GF) are also used.

[0114] In a particular embodiment, a formulation is provided comprising any of the bacterial strains of the application or spore thereof and / or any fermentation product of any of the bacterial strains of the application, wherein said formulation is a dry state formulation, a wettable powder formulation, a water dispersible granule formulation, an emulsifiable concentrate formulation, a concentrated aqueous emulsion formulation, a suspension concentrate formulation, a flowable concentrate formulation, a microemulsion formulation, a suspoemulsion formulation, an oil dispersion formulation, or a (micro)capsule suspension formulation. In a most particular embodiment, said formulation is a suspension concentrate, an emulsifiable concentrate or a suspoemulsion. In a particular embodiment, the Streptomyces chrestomyceticus species or the Streptomyces species of the application may be lyophilized, freeze-dried or in the form selected from dried cells, dehydrated cells, devitalized cells, inactivated cells, frozen cells or cells in artificial suspension or in a dry powder before it is used in the processing of the composition. In another particular embodiment, an aqueous slurry of the Streptomyces chrestomyceticus species or of the Streptomyces species of the application is provided, which is optionally dried to a powder at a temperature which does not adversely affect viability of the Streptomyces chrestomyceticus species or of the Streptomyces species. The powder may then be mixed with an agriculturally compatible carrier. In other embodiments, a liquid suspension or slurry of the Streptomyces species of the application may be applied to an absorbent material, e.g. a granular mass. In embodiments wherein the composition is a powder (e.g. a wettable powder), a liquid, such as water, may need to be added to the powder before application, e.g. to the soil. Also provided is an inert material or an organic material or an inorganic material comprising an inoculum of the Streptomyces species of the application.

[0115] Also provided is a composition, an agricultural composition or an herbicidal composition comprising a bioactive agent, wherein said bioactive agent is a Streptomyces species, particularly a Streptomyces chrestomyceticus species, more particularly a Streptomyces species comprising an 16S rDNA sequence as depicted in SEQ ID No. 1 or SEQ ID No. 2. Also provided is a composition, an agricultural composition or a herbicidal composition comprising a bioactive agent, wherein said bioactive agent is a Streptomyces species comprising an 16S rDNA sequence with maximum 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotide differences to SEQ ID No. 1 or as depicted in SEQ ID No. 1 except for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 nucleobase substitutions. Also provided is a composition, an agricultural composition or a herbicidal composition comprising a bioactive agent, wherein said bioactive agent is a Streptomyces species comprising an 16S rDNA sequence with maximum 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotide differences to SEQ ID No. 2 or as depicted in SEQ ID No. 2 except for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 nucleobase substitutions. In a particular embodiment, said bioactive agent is the Streptomyces species of the application.

[0116] The term "bioactive agent" is interchangeably used with "biologically active agent" and refers to an agent such as a composition or compound with a biological effect, and thus that modifies, causes, promotes, enhances, blocks, reduces, limits the production or activity of a biological process, or reacts with or binds to an endogenous molecule that has a biological effect. In line with current application, a "biological effect" may be - but is not limited to - one that impacts a biological process in / onto a plant. Non-limiting examples of a biological effect include, for example, suppressing, inhibiting, limiting, or controlling growth, development, germination, reproduction of or killing one or more plant species or target plant species such as undesirable weeds but also inducing chlorosis, necrosis and / or growth delay.

[0117] In yet another more particular embodiment, said bioactive agent is a Streptomyces species having at least 90.00% on whole genome level compared to the strain deposited under the Budapest Treaty at the BCCM / LMG on 7thJune 2024 under Accession No. LMG-P-33652, and comprising an 16SrDNA sequence as depicted in SEQ ID No. 1 or as depicted in SEQ ID No. 1 with at most 1, 2, 3, 4, 5, 6 or 7 nucleotide differences, more particularly 1 to 7 silent mutations. In yet another more particular embodiment, said bioactive agent is a Streptomyces species having at least 94.00% on whole genome level compared to the strain deposited under the Budapest Treaty at the BCCM / LMG on 7thJune 2024 under Accession No. LMG-P-33652, and comprising an 16SrDNA sequence as depicted in SEQ ID No. 1 or as depicted in SEQ ID No. 1 with at most 1, 2, 3, 4, 5, 6 or 7 nucleotide differences, more particularly 1 to 7 silent mutations. In a most particular embodiment, the bioactive agent is the Streptomyces strain of which a representative culture has been deposited under the Budapest Treaty at the BCCM / LMG on 7thJune 2024 under Accession No. LMG-P-33652 or any of the Streptomyces species herein disclosed. In another embodiment, said bioactive agent is an extract or an extract fraction from the Streptomyces species of the application or from a culture comprising any of the Streptomyces species herein disclosed. In another embodiment, said bioactive agent is a supernatant (or fraction thereof) of a culture or fermentation broth from any of the Streptomyces species herein disclosed.

[0118] In another embodiment, said bioactive agent is an herbicidal substance, a filtrate or a whole cell broth derived from a cell culture of the Streptomyces species of the application.

[0119] In one embodiment, any of the compositions described herein further comprises an agriculturally compatible carrier. Said carrier can be inert (e.g. a detectable agent or label or liquid carrier) or active (e.g. a fertilizer), but should allow the Streptomyces species of the application or any phytotoxic product derived thereof to remain viable or efficacious. An "agriculturally compatible carrier" may be a natural or synthetic, organic or inorganic material with which the active ingredient (e.g. the Streptomyces species of the application or an extract thereof or a supernatant of the culture of the Streptomyces species of the application) are combined to facilitate its application on one or more plants, a plant parts, plant seeds or to the plant growth medium. Said "agriculturally compatible carrier" which can be regarded as a vehicle, is generally inert and it must be acceptable in agriculture. Thus, the phrase "agriculturally compatible" denotes a substance that can be used routinely under field conditions without interfering with growers' planting equipment, and without adversely influencing crop development or the desired ecological balance in a cultivated area.

[0120] The agriculturally compatible carrier can be solid. Solid carriers can include but are not limited to clays, natural or synthetic silicates, silica, resins, waxes, solid fertilizers, a polymer, a granular mass, perlite, a perlite granule, peat, a peat pellet, soil, vermiculite, charcoal, sugar factory carbonation press mud, rice husk, carboxymethyl cellulose, fine sand, calcium carbonate, flour, alum, a starch, talc, polyvinyl pyrrolidone, or a combination thereof. The carrier can be a mineral carrier. The carrier can be derived from organic waste material such as biomass residues, compost or manure.

[0121] The agriculturally compatible carrier can be a liquid. In one embodiment, the liquid carrier is water, sugar water, diluted or non-diluted growth medium to culture the Streptomyces species of the application. Non-limiting examples of suitable growth media for said Streptomyces species include Yeast Malt medium (comprising yeast extract, malt extract, dextrose, peptone and agar), Tryptic Soy Broth (TSB), Nutrient Agar (containing beef extract and peptone), Starch Casein Agar, Glycerol Asparagine Agar.

[0122] Other non-limited examples of liquid carriers can include but are not limited to alcohols, ketones, petroleum fractions, oils, aromatic or paraffinic hydrocarbons, chlorinated hydrocarbons, liquefied gases or a combination thereof. More particularly, the agriculturally compatible carrier can include a dispersant, a surfactant, an additive, a thickener, an anti-caking agent, residue breakdown, a composting formulation, a granular application, diatomaceous earth, a colouring agent, a stabilizer, a preservative, a polymer, a coating or a combination thereof.

[0123] The additive can comprise an oil, a gum, a resin, a clay, a polyoxyethylene glycol, a terpene, a viscid organic, a fatty acid ester, a sulfated alcohol, an alkyl sulfonate, a petroleum sulfonate, an alcohol sulfate, a sodium alkyl butane diamate, a polyester of sodium thiobutant dioate, a benzene acetonitrile derivative, a proteinaceous material, or a combination thereof. The proteinaceous material can include a milk product, wheat flour, soybean meal, blood, albumin, gelatin, or a combination thereof. The thickener can comprise a long chain alkylsulfonate of polyethylene glycol, polyoxyethylene oleate or a combination thereof. The surfactant can contain a heavy petroleum oil, a heavy petroleum distillate, a polyol fatty acid ester, a polyethoxylated fatty acid ester, an aryl alkyl polyoxyethylene glycol, an alkyl amine acetate, an alkyl aryl sulfonate, a polyhydric alcolhol, an alkyl phosphate, or a combination thereof. The anti-caking agent can include a sodium salt such as a sodium sulfite, a sodium sulfate, a sodium salt of monomethyl naphthalene sulfonate, or a combination thereof, or a calcium salt such as calcium carbonate, diatomaceous earth, or a combination thereof.

[0124] The carrier can also be a slurry, optionally comprising a sticking agent capable of sticking the inoculum to the substrate of interest, for example an inert substrate. Non-limiting examples of sticking agents include alginate, mineral oil, syrup, gum arabic, honey, methyl cellulose, milk, wallpaper paste, and combinations thereof. One of the ordinary skills in the art can readily determine the appropriate carrier to be used taking into consideration factors such as a particular Streptomyces species, plant to which the inoculum is to be applied, type of soil, climate conditions, whether the inoculum is in liquid, solid or powder form, and the like.

[0125] The agriculturally compatible carrier can also include a fertilizer, a micronutrient fertilizer material, an insecticide, an herbicide, a plant growth amendment, a fungicide, a molluscicide, an algicide, a bacterial inoculant, a fungal inoculant, or a combination thereof. Non-limiting examples are provided below. As way of example the Streptomyces species of the application may be mixed with an agriculturally compatible carrier.

[0126] In a particular embodiment, any of the compositions herein disclosed may be in the form of a liquid, a solid, a semi-solid, a gel, a slurry, a cell paste, tablets, capsules, granules, pellets, a powder such as dry powder or wettable powder, wettable granules, a fluid, a dry fluid, an emulsion, a suspension, a solution or a dispersion. Each possibility represents a separate embodiment of the present invention. A "cell paste" comprises a population of cells that has been centrifuged and / or filtered or otherwise concentrated. Non-limiting examples of the above provided compositions in practice are soluble powders, dry flowables, aqueous flowables, wettable dispersible granules, emulsifiable concentrates, dispersion concentrates, aqueous suspensions, a fertilizer granule, a sprayable formulation, an agrochemical formulation.

[0127] In particular embodiments, a composition according to the present invention can be in the form of an aerosol; a bait for pollinators dispersion; a dust; a dry flowable; an emulsifiable; an emulsifiable concentrate; a flowable; a granule; a microencapsulated; a pellet; a soluble powder; a wettable powder; a water-dispersible granule. More specifically, the composition can be in the form of a grain bait; a bait concentrate; a capsule suspension for seed treatment; an encapsulated granule; a capsule suspension; a dispersible concentrate; a dispersible powder; a powder for dry seed treatment; an emulsifiable concentrate; an emulsion or an water-in-oil emulsion for seed treatment; an emulsion; an oil in water; a fine granule; a flowable concentrate for seed treatment; a granular bait; a microgranule; a flo-dust; a granule; a solution for seed treatment; a micro-emulsion; a microgranule; an oil dispersion; an oil miscible flowable concentrate; an oil miscible liquid; an oil dispersible powder; a paste; a seed coated with pesticide; a suspension concentrate; a suspo-emulsion; a water soluble granules; a soluble concentrate; a water soluble powder; a water soluble powder for seed treatment; an ultra-low volume suspension; a tablet; a technical material; a technical concentrate; a water- dispersible granular; a wettable powder; a wettable dispersible powder for slurry seed treatment.

[0128] The agricultural composition can be formulated in any form suitable for applying the composition to a target plant or a plant part thereof or to the plant habitat as is known in the art. According to certain embodiments, the agricultural composition is formulated in a form selected from the group consisting of an emulsion, a colloid, a dust, a granule, a pellet, a powder, a spray, pressurized form, a pressurizable form, and a solution. Each possibility represents a separate embodiment of the present invention. According to certain embodiments, the formulation further comprises at least one of a stabilizer, a tackifier, a preservative, a carrier, a dispersing agent, a wetting agent, a surfactant, and a combination thereof. Each possibility represents a separate embodiment of the present invention.

[0129] According to certain embodiments, the concentration of the Streptomyces species of the application in the composition (e.g., preparation, formulation, coated seeds) is between 102CFU and 109CFU / gram powder of the composition or between 102CFU and 109CFU per ml of the composition.

[0130] According to some embodiments, the Streptomyces species of the application is applied to plants or plant substrates in a liquid formulation at a concentration range of from about 102CFU / ml to about 109CFU / ml, particularly from about 103CFU / ml to about 108CFU / ml or from about 104CFU / ml to about 10sCFU / ml, more particularly from about 105CFU / ml to 107CFU / ml of the composition.

[0131] In dry formulations such as cell pastes, wettable powders, or spray dried formulations, the Streptomyces species of the application is applied at a concentration range of from about 102CFU / g to about 109CFU / g, particularly from about 103CFU / g to about 108CFU / g or from about 104CFU / g to about 10sCFU / g, more particularly from about 105CFU / g to 107CFU / g of the composition.

[0132] In another particular embodiment, any composition disclosed in current application comprising any of the Streptomyces species of the application or comprising a fermentation product of the culture of said Streptomyces species - is provided as an agricultural composition, more particularly a herbicidal composition or a composition for controlling weed, even more particularly a sprayable agricultural or herbicidal composition. Controlling weeds refers to inhibiting, preventing, suppressing, reducing the growth, reproduction, germination and / or development of one or more unwanted plant species. The composition or "herbicidal composition" herein provided can include a further herbicide, if said herbicide is used to remove unwanted plants or prevent germination of seeds of unwanted plants.

[0133] In a particular embodiment, said further herbicide is an inhibitor of acetyl CoA carboxylase (ACCase) such as an aryloxyphenoxy-propionate, a cyclohexanedione or a phenylpyrazolin. In another particular embodiment, said further herbicide is an inhibitor of acetolactate synthase (ALS) / actohydroxyacid synthase (AHAS) such as an imidazolinone, a sulfonylurea, sulfonanilides, a triazolpyramidine, a pyrimidinylbenzoic acid or a triazolinone. In another particular embodiment, said further herbicide is a microtubule assembly inhibitor such as a dinitroaniline, a pyridine, a phosphoroamidate, a benzoic acid or a benzamide. In another particular embodiment, said further herbicide is a synthetic auxin such as a benzoic acid, a pyrimidine carboxylate, a pyridine carboxylate, a pyridyloxy carboxylate, a phenoxy carboxylate, a quinoline carboxylates or benazolin-ethyl. In another particular embodiment, said further herbicide is photosynthetic inhibitor at photosystem II, more particularly a DI Serine 264 binder such as an amide, a phenyl-carbamate, a pyridazinone, a triazine, a triazinone, an urea, a benzothiadiazinone, a phenyl-pyridazine or an uracil. In another particular embodiment, said further herbicide is a photosynthetic inhibitor at Photosystem II, more particularly a DI Histadine 215 binder such as a benzothiadiazole, a phenyl-pyridazine or a nitrile. In another particular embodiment, said further herbicide is photosynthetic inhibitor at Photosystem II, Site B such as a urea or an amide. In another particular embodiment, said further herbicide is a lipid synthesis inhibitor such as a thiocarbamate. In another particular embodiment, said further herbicide is an inhibitor of EPSP (5- enolpyruvyl-shikimate-3-phosphate) synthesis such as a glycine. In another particular embodiment, said further herbicide is an inhibitor of glutamine synthetase such as z phosphinic acid. In another particular embodiment, said further herbicide is an inhibitor of carotenoid biosynthesis such as a triazole. In another particular embodiment, said further herbicide is a phytoene desaturase (PDS) inhibitor such as a N-phenyl heterocycle, a phenyl-ether or a diphenyl heterocycle. In another particular embodiment, said further herbicide is a DOXP (1-deoxy-d-xyulose 5-phosphase) synthase inhibitor such as an isoxazolidinone. In another particular embodiment, said further herbicide is an inhibitor of protoporphyrinogen oxidase (PPO) such as an aryl triazone or a N-phenyl-triazolinone, a diphenyl ether, a N-phenyl-phthalimide, a N-phenyl-oxadiazolone, a pyrimidindione, a phenylpyrazole, or a N-phenyl-imide. In another particular embodiment, said further herbicide is a very long-chain fatty acid inhibitor of cell growth and division such as an acetamide, a chloroacetamide, a chloro-carbonic acid, an azolyl-carboxamide, a benzofuran, a pyrazole or an isoxazoline, a thiocarbamate, a thioacetamide, an oxirane, an oxyacetamide or bensulide. In another particular embodiment, said further herbicide is a benzofuranyl alkylsulfonate. In another particular embodiment, said further herbicide is a nucleic acid inhibitor such as an arsenical. In another particular embodiment, said further herbicide is a dihydropteroate inhibitor such as a carbamate. In another particular embodiment, said further herbicide is auxin transport inhibitor such as an aryl-carboxylate and semicarbazones. In another particular embodiment, said further herbicide is a nitrile. In another particular embodiment, said further herbicide is a cell membrane disruptor such as a bipyridylium. In another particular embodiment, said further herbicide is a photosynthesis and plant pigment biosynthesis inhibitor such as a benzopyrazole or a pyridinium. In another particular embodiment, said further herbicide is an inhibitor of microtubule organization such as a carbamate. In another particular embodiment, said further herbicide is an uncoupler such as a dinitrophenol. In another particular embodiment, said further herbicide is a 4-hydroxyphenylpyruvate dioxygenase (HPPD) inhibitor such as an isoxazole, a pyrazole, or a triketone. In another particular embodiment, said further herbicide is a dihydroorotate dehydrogenase inhibitor such as an aryl pyrrolidinone anilide. In another particular embodiment, said further herbicide is an inhibitor of cellulose biosynthesis such as an alkylazine, a benzamide, a nitrile, a triazolocarboxamide or quinclorac. In another particular embodiment, said further herbicide is a fatty acid thioesterase inhibitor such as a benzyl ether. In another particular embodiment, said further herbicide is a serine-threonine protein phosphatase (STPP) inhibitor such as endothall. In another particular embodiment, said further herbicide is a solanesyl diphosphate synthase inhibitor such as a diphenyl ether. In another particular embodiment, said further herbicide is a homogentisate solanesyltransferase inhibitor such as a phenoxypyridazine. In another particular embodiment, said further herbicide is a lycopene cyclase inhibitor such as a triazole or a diphenylether. In another particular embodiment, said further herbicide is an arylaminopropionic acid, an acetamide, a benzamide, a benzoylpyrazole, an organoarsenical, a fatty acid, a chlorocarbonic acid, a picolinic acid, a phosphorodithioate, a quinoline-carboxylate, an isoxazoline carboxamide, or a trifluoromethanesulfonanilide.

[0134] In yet another particular embodiment, said further herbicide is resormycin or a Streptomyces species producing it (e.g. Streptomyces platensis), or phosalicin or a Kitasatospora species producing it (e.g. Kitasatospora phosalacinea), or rotihibin or a Streptomyces species producing it (e.g. Streptomyces graminofaciens), or hydantocidin or a Streptomyces species producing it (e.g. Streptomyces hygroscopicus), or pironetin or a Streptomyces species producing it.

[0135] The composition, agricultural composition or herbicidal composition can also comprise a fertilizer, a micronutrient fertilizer material, an insecticide, a plant growth amendment, a fungicide, a molluscicide, an algicide, a bacterial inoculant, a fungal inoculant, or a combination thereof. The fungal inoculant can comprise a fungal inoculant of the family Glomeraceae, a fungal inoculant of the family Claroidoglomeraceae, a fungal inoculant of the family Acaulosporaceae, a fungal inoculant of the family Sacculospraceae, a fungal inoculant of the family Entrophosporaceae, a fungal inoculant of the family Pacidsproraceae, a fungal inoculant of the family Diversisporaceae, a fungal inoculant of the family Paraglomeraceae, a fungal inoculant of the family Archaeosporaceae, a fungal inoculant of the family Geosiphonaceae, a fungal inoculant of the family Ambisporacea, a fungal inoculant of the family Scutellosproaceae, a fungal inoculant of the family Dentiscultataceae, a fungal inoculant of the family Racocetraceae, a fungal inoculant of the phylum Basidiomycota, a fungal inoculant of the phylum Ascomycota, a fungal inoculant of the phylum Zygomycota, a fungal inoculant of the genus Glomus or a combination thereof. The bacterial inoculant can include a bacterial inoculant of the genus Rhizobium, another bacterial inoculant of the genus Bradyrhizobium, bacterial inoculant of the genus Mesorhizobium, bacterial inoculant of the genus Azorhizobium, bacterial inoculant of the genus Allorhizobium, bacterial inoculant of the genus Burkholderia, bacterial inoculant of the genus Sinorhizobium, bacterial inoculant of the genus Kluyvera, bacterial inoculant of the genus Azotobacter, bacterial inoculant of the genus Pseudomonas, bacterial inoculant of the genus Azosprillium, bacterial inoculant of the genus Bacillus, bacterial inoculant of the genus Streptomyces, bacterial inoculant of the genus Paenibacillus, bacterial inoculant of the genus Paracoccus, bacterial inoculant of the genus Enterobacter, bacterial inoculant of the genus Alcaligenes, bacterial inoculant of the genus Mycobacterium, bacterial inoculant of the genus Trichoderma, bacterial inoculant of the genus Gliocladium, bacterial inoculant of the genus Klebsiella, or a combination thereof.

[0136] In a most particular embodiment, the composition or agricultural composition or herbicidal composition as provided herein is not harmful to bees.

[0137] The composition according to the present invention can be prepared according to various processes known to a person skilled in the art, for example by a method chosen among spray dry, extrusion, fluidized-bed granulation with dehydration, freeze-drying, emulsion process, suspension in mixture with one or more chemical compounds and / or biological agents and / or with one or more co- formulants, described before.

[0138] In another embodiment, the present invention provides a kit comprising (i) any of the agricultural compositions described above and herein, comprising any of the Streptomyces species of the application or spores, lysates, extracts, supernatants or fermentation products thereof as described herein; and (ii) a delivery system for applying said agricultural composition to a plant or to a part thereof or to the plant growth medium and (iii) optionally instructions for using the agricultural composition. According to certain embodiments, the instructions for using the agricultural composition comprise instructions for the amounts and frequency of applying the agricultural composition as to reduce the presence of weeds in the field or to prevent yield or growth reduction of the crop due to the presence of weeds.

[0139] APPLICATIONS

[0140] The Streptomyces species of current application, spores thereof and / or fermentation products derived from a culture of said Streptomyces species or any of the compositions herein disclosed can be used to control weeds in the field, gardens, greenhouses or plant growth cabinets. Therefore, in another aspect of the invention, the use is provided of any of the Streptomyces chrestomyceticus species herein disclosed, more particularly of the Streptomyces species of current application, of the spores thereof and / or of one or more fermentation products derived from a culture of said Streptomyces species or of any composition herein described, for controlling growth of one or more plant species or target plants.

[0141] Also provided is a method of controlling the growth of one or more plant species or target plants, wherein the method comprises the step of administering a Streptomyces chrestomyceticus species or the Streptomyces species of current application, or spores thereof and / or one or more fermentation products derived from a culture of said Streptomyces species or any of the compositions herein disclosed to said one or more plant species or target plants or to the substrate wherein said one or more plant species or target plants grow.

[0142] In one embodiment, said "controlling" the growth of target plants refers to inhibiting, reducing, suppressing, preventing the growth, development, reproduction and / or germination of unwanted plants or of unwanted plant seeds compared to a mock or control situation. A control situation refers to an identical experimental set-up but in the absence of the active ingredient, such as the Streptomyces species of current application, the extracts, whole cell broths or supernatants or any of the compositions disclosed in current application.

[0143] Also provided is a method of controlling growth of one or more target plant species, the method comprises the step of applying any of the compositions, agricultural compositions or herbicidal compositions disclosed in current application to said one or more target plant species. In one embodiment, said compositions are applied to the one or more target plant species or to a plant population present in a field, garden, greenhouse or plant growth cabinet. In another embodiment, said compositions are sprayed to the one or more target plant species or plant parts thereof or the habitat or growth medium of said one or more target plant species. In a further particular embodiment, the method of controlling growth of one or more target species comprises a further step of determining or analyzing or measuring the plant fitness of the treated target plant species or determining the effect, more particularly the phytotoxic effect, of the application on the treated target plant species. Non-limiting examples of said phytotoxic effect are chlorosis, necrosis and plant growth delay.

[0144] Also provided is a method of reducing emergence and / or growth of one or more target plant species comprising applying to seeds of one or more target plant species or applying to a substrate hosting said one or more target plant species any of the compositions herein disclosed, in an amount effective to reduce said emergence and / or growth of the one or more plant species, wherein said composition is applied prior and / or after emergence of said one or more target plant species.

[0145] In another embodiment, a method of controlling or suppressing weed growth is provided comprising contacting said weed or a part thereof with any of the compositions herein disclosed.

[0146] Also provided is a method for administering a bacterial strain to a plant, the method comprising: administering the bacterial strain or a functional homologue thereof to the plant or a part thereof, or a location comprising the plant; wherein the bacterial strain comprises a 16S polynucleotide having at least 99.60% sequence identity to SEQ ID No. 1; wherein the functional homologue of the bacterial strain comprises a 16S polynucleotide having at least 99.60% sequence identity to SEQ ID NO: 1 and a genome having at least 94.00% identity over the entirety of the genome to the genome of the strain as deposited under the Budapest Treaty with the BCCM / LMG Bacteria collection under Accession No. LMG-P-33652. In a particular embodiment, said bacterial strain is any of the Streptomyces species disclosed herein.

[0147] Methods of qualifying and quantifying herbicidal activity of an agent are known in the art (e.g. Eberle and Gerber 1976 Archives of Environmental Contamination and Toxicology 4; Streibig 1988 Weed Research 28; Jeong et al 2024 Sensors 24). Non-limiting examples are techniques like sap flow, gas exchange, bioassays, extract screening, in-vivo assays, and visual indexing. IC50 values can be determined to qualify effective concentration of the agent resulting in inhibiting growth and development of at least 50% of the target plant population. For example, herbicidal activity can be measured by a decrease in target plant biomass.

[0148] Any method as is known in the art can be used to contact the target plant or part thereof with any of the compositions or bioactive agents disclosed herein. According to certain embodiments, said method is selected from the group consisting of - but not limited to - immersing, dipping, spraying, coating, dusting, infiltrating, incubating and any combination thereof. According to some embodiments, wherein the application is to the aerial part of a plant, the application is mediated by moving vehicles (cars or agricultural vehicles), flying devices (e.g., planes or drones), and the like.

[0149] The term, "target plant species" refers to a plant species for which growth is not desired (e.g., a weed) and which is susceptible to the effects of a natural herbicide or a bioherbicide, exhibiting, for example, reduced growth, abnormal development or death when exposed to the natural herbicide or the bioherbicide. Target plants species or alternatively called weeds, are typically annual and perennial weed species. These include both monocot weeds (e.g., grass weeds or gramineous weeds) and dicot weeds (e.g., broadleaf weeds).

[0150] Non-limiting examples of gramineous weeds include the genus Aegilops such as Aegilops cylindrical (jointed goatgrass), genus Agrostis such as Agrostis capillaris (common bent), genus Agropyron such as Agropyron repens (common couchgrass), genus Alopecurus such as Alopecurus myosuroides (blackgrass) or Alopecurus aegualis (foxtail), genus Apera such as Apera spica-venti (silky wind grass), genus Avena such as Avena fatua (wild oat) or Avena sterilis subsp. Sterilis (sterile oat), genus Brachiaria such as Brachiaria plantaginea (Alexander grass) or Brachiaria decumbens (Surinam grass), genus Bromus such as Bromus inermis (awnless brome), Bromus sterilis (barren bromegrass), Bromus tectorum (cheatgrass), Bromus arvensis (field bromegrass), Bromus secalinus (rye bromegrass) or Bromus hordeacus (lopgrass), genus Cenchrus such as Cenchrus echinatus (Mossman River grass), genus of Commelina, genus Cynodon such as Cynodon dactylon (bermudagrass), genus Cyperus, genus Dactyloctenium, genus Digitaria such as Digitaria ciliaris (southern crabgrass), Digitaria sanguinalis (hairy crabgrass), Digitaria insularis (sourgrass) or Digitaria ischaemum (smooth crabgrass), genus Echinochloa such as Echinochloa coIonum (awnless barnyardgrass), Echinochloa crus-galli (common barnyard grass), Echinochloa crus-pavonis (Gulf cockspurgrass), Echinochloa oryzoides (early barnyardgrass) or Echinochloa phyllogogon (late barnyardgrass), genus Eleocharis, genus Eleusine such as Eleusine indica (Indian goosegrass), genus Eragrostis, genus Eriochloa, genus Festuca, genus Fimbristylis, genus Heteranthera, genus Imperata, genus Ischaemum such as Ischaemum rugusom (muraina grass), genus Leptochloa such as Leptochloa chinensis (Chinese sprangletop), Leptochloa fascicularis (salt-meadow grass), Leptochloa filiformis (thread sprangletop), Leptochloa mucronata (red sprangletop), Leptochloa panicoides (tighthead sprangletop), Leptochloa scabra or Leptochloa virgata (tropical sprangletop), genus Lolium such as Lolium multiflorum (Italian ryegrass), Lolium perenne (English ryegrass) or Lolium rigidum (annual rye-grass), genus Monochoria, genus Panicum such as Panicum capillare (tumble panicgrass), Panicum dichotomiflorum (smooth witchgrass), Panicum laevifolium (sweet panicgrass) or Panicum miliaceum (common millet), genus Phalaris such as Phalaris minor (lesser canary grass), Phalaris paradoxa (paradoxagrass), Phalaris canariensis (canarygrass) or Phalaris brachystachys (short-spiked canarygrass), genus Paspalum, genus Phleum, genus Poa such as Poa annua (annual bluegrass), Poa pratensis (Kentucky bluegrass) or Poa trivialis (rough meadowgrass), genus Rottboellia such as Rottboellia exaltata (guinea-fowl grass), genus Sagittaria, genus Scirpus, genus Setaria such as Setaria faberi (giant foxtail), Setaria glauca (pearl millet), Setaria italic (Italian millet), Setaria pumila (yellow foxtail), Setaria verticillata (bristly foxtail) or Setaria viridis (green foxtail), genus Sorghum such as Sorghum halepense (Johnson grass). Also volunteer monocotyledonous crops are considered weeds, such as Zea mays and Triticum aestivum.

[0151] Non-limiting examples of dicotyledonous weeds, in particular broadleaf weeds include, but are not limited to Polygonum species such as Polygonum convolvolus (wild buckwheat), Amaranthus species such as Amaranthus albus (tumble pigweed), Amaranthus blitoides (mat amaranth), Amaranthus hybridus (green pigweed), Amaranthus palmer! (Palmer amaranth), Amaranthus powellii (Powell amaranth), Amaranthus retroflexus (redroot pigweed), Amaranthus tuberculatus (rough-fruit amaranth), Amaranthus rudis (tall amaranth) or Amaranthus viridis (slender amaranth), Arabidopsis species such as Arabidopsis thaliana (thale crest), Bellis species, Chenopodium species such as Chenopodium album (common lambsquarters), Chenopodium ficifolium (fig-leaved goosefoot), Chenopodium polyspermum (many-seeded goosefoot) or Chenopodium hybridum (maple-leaf goosefoot), Sida species such as Sida spinosa L. (prickly sida), Ambrosia species such as Ambrosia artemisiifolia (common ragweed), Acanthospermum species, Anthemis species such as Anthemis arvensis (field chamomile), Aphanes species, Artemisia species, Atriplex species, Carduus species, Cirsium species, Convolvulus species, Conyza species such as Conyza bonariensis (hairy horseweed) or Conyza canadensis (Canada horseweed), Cassia species, Commelina species, Emex species, Erysimum species, Datura species, Euphorbia species, Geranium species such as Geranium dissectum (cut-leaf geranium), Geranium pusillium (small-flower geranium) or Geranium rotundifolium (round-leaved cranesbill), Galinsoga species, Hibiscus species, Ipomoea species such as Ipomoea hederacea (morningglory), Lamium species, Lindemia species, Malva species, Matricaria species such as Matricaria chamomilla (wild chamomile), Matricaria discoidea (pineapple weed) or Matricaria inodora (false chamomille), Mentha species, Mullugo species, Portulaca species, Sysimbrium species, Solanum species, Ranunculus species, Rorippa species, Rotala species, Rumex species, Xanthium species, Veronica species, Viola species, Stellaria species such as Stellaria media (common chickweed), Abutilon species such as Abutilon theophrasti (velvet leaf), Sphenoclea species, Sesbania species such as Sesbania exaltata (Hemp sesbania), Anoda species such as Anoda cristata (cottonweed), Bidens species such as Bidens pilosa (common blackjack), Centaurea species such as Centaurea cyanus (cornflower), Galeopsis species such as Galeopsis tetrahit (common hemp nettle), Galium species such as Galium aparine (cleavers or goosegrass), Galium spurium (false cleavers) or Galium tricornutum (corn cleavers), Desmodium species such as Desmodium tortuosum (giant beggar weed), Kochia species such as Kochia scoparia (mock cypress), Lepidium species, Mercurialis species such as Mercurialis annua (annual mercury), Myosotis species such as Myosotis arvensis (field forget-me-not), Papaver species such as Papaver rhoeas (common poppy), Pharbitis species, Plantago species, Salsola species such as Salsola kali (prickly glasswort), Senecio species, Sonchus species such as Sonchus arvensis (corn sowthistle), Tagetes species such as Tagetes minuta (Mexican marigold), Taraxacum species, Trifolium species, Urtica species, Richardia species such as Richardia brasiliensis (Brazil pusley), cruciferous weeds such as Raphanus raphanistrum (wild radish), Sinapis alba (white mustard), Sinapis arvensis (wild mustard), Thlaspi arvense (fanweed), Descurainia sophia (flixweed), Capsella bursa-pastoris (shepherd's purse), Sisymbrium species such as Sisymbrium officinale (hedge mustard) or Sisymbrium orientate (oriental mustard), Brassica species such as Brassica kaber (wild mustard). Also volunteer dicotyledonous crops are considered weeds, such as Glycine max (soy) and Helianthus annuus (common sunflower).

[0152] In one embodiment, the target plant is a weed selected from the list consisting of crabgrass (Digitaria spp., e.g. Digitaria sanguinalis), thale crest (Arabidopsis thaliana), common bent (Agrostis capillaris), redroot pigweed (Amaranthus retroflexus), baconweed (Chenopodium album), common poppy (Papaver rhoeas), foxtail grass (Alopecurus spp.), mustard (Brassica junced), wild mustard (Sinapis arvensis), dandelion (Taraxacum officinale), white clover (Trifolium repens), black medic (Medicago lupulina), bellflower (Campanula rapunculoides), English daisy (Bellis perennis), plantain (Plantago spp.), Bermuda grass (Cynodon dactylori), annual blue grass (Poa annua), oxeye daisy (Chrysanthemum leucanthemum), lettuce (Lactuca sativa), birdsfoot trefoil (Lotus corniculatus), common chickweed (Stellaria media), common purslane (Portulaca oleraceae), curly cress (Lepidium sativum), and Canadian thistle (Circium arvense).

[0153] In another embodiment, the target plant is a weed of the genus selected from the list consisting of Arabidopsis, Digitaria, Agrostis, Amaranthus, Chenopodium, Papaver, Poa, Alopecurus, Matricaria, Polygonum, Veronica, Setaria, Solanum, Zea and Triticum. In a more particular embodiment, the target plant is selected from the list consisting of Digitaria sanguinalis, Arabidopsis thaliana, Agrostis capillaris, Amaranthus retroflexus, Chenopodium album, Papaver rhoeas, Poa annua, Alopecurus myosuroides, Matricaria chamomilla, Polygonum aviculare, Veronica persicae, Setaria viridis, Solanum nigrum, volunteer Zea mays and volunteer Triticum aestivum.

[0154] Since weeds compete with cultivated crops for nutrients, water and light, weeds negatively influence the yield and general fitness of said cultivated crops. Therefore, the use of the Streptomyces species of current application, the extracts, supernatants, whole cell broths or any of the compositions herein disclosed is also provided for increasing or improving crop yield or for reducing and / or preventing growth reduction of a crop or for protecting a crop against a plant pest population. A "plant pest" or "plant pest population" refers to a weed that negatively affects the growth of a crop.

[0155] In another aspect of the application also a method of producing an herbicidal composition is provided, comprising the steps of growing any of the bacterial species described herein under standard bacterial growth conditions to establish a liquid bacterial cell culture; and collecting or harvesting the bacterial culture and / or any fermentation product derived from said bacterial cell culture, wherein said fermentation product comprises an effective amount of at least one herbicidal substance; and optionally adding at least one surfactant to said harvested bacterial culture and / or fermentation product to obtain an herbicidal composition. In a particular embodiment, said fermentation product can be an extract, an extract fraction, a supernatant, a supernatant fraction, a filtrate, a whole cell broth or an herbicidal substance endogenously produced by said bacterial species.

[0156] It is to be understood that although particular embodiments, specific configurations as well as materials and / or molecules, have been discussed herein for cells and methods according to the present invention, various changes or modifications in form and detail may be made without departing from the scope and spirit of this invention. The Examples described below are provided to better illustrate particular embodiments, and they should not be considered limiting the application. The application is limited only by the claims. EXAMPLES

[0157] Example 1. Microbial extracts

[0158] A microbial collection comprising nearly 8000 bacterial and fungal strains was used as starting point to screen for microbial active compounds with herbicidal activity. The fermentation broths of all used microbial strains were extracted by adding an equal volume of acetone. After incubation while shaking followed by centrifugation, DMSO was added to the supernatant and the extract was concentrated to 2xWBE (whole broth equivalent) under heated nitrogen.

[0159] Example 2. Screening for phytotoxic effects of microbial extracts

[0160] For the first screen, the dicot weeds Arabidopsis thaliana and Chenopodium album, and the monocot weeds Agrostis capillaris and Alopecurus myosuroides were used. For the foliar application, plant seeds were sown in soil, whereafter the pots were placed in a greenhouse at 18-24°C. Between 9 and 13 days after germination depending on the species, the seedlings were treated with the microbial extracts as obtained in Example 1. The extracts initially containing 20% DMSO, were formulated in a 1:3 ratio with a diluted emulsifiable concentrate, containing 90 w% vegetable oil and 2 surfactants (i.e. an emulsifier and dispersant). 200 pl of the formulated extract was applied with an airbrush (type Fengda, 0.2 mm nozzle at 0.5 bar) to the plant canopy. As a negative control, the plants were sprayed with the blank formulation at 5% DMSO. Untreated plants were used as an additional negative control. The plants were visually scored at 6, 9 and 15 days after application and classified into three classes depending on the severity of growth inhibition and / or phytotoxic effects. Extracts that induced more than 50% damage (chlorosis, necrosis, growth reduction) of the treated area were labelled "strong", while extracts that induced a growth inhibition of between 25% and 50% were labelled "moderate". In case the treatment did not lead to a clear visual difference compared to the negative controls, the extract was considered "not active".

[0161] The extracts obtained from the bacterial strains MED-B-M1H1 and MED-B-M23A7 (referred herein as M1H1 and M23A7 respectively) showed a moderate to strong phytotoxic effect in all four tested weeds (Figure 1 and Table 2).

[0162] Besides the foliar application, the M1H1 extract was also tested on seeds from Arabidopsis thaliana. Vernalised seeds were treated with the same extract preparations as were used for the foliar application, i.e. formulated in a 1:3 ratio with a diluted emulsifiable concentrate. An extract was classified as having an activity on seeds from the moment a significant amount of the seeds showed a delayed germination, a partial germination, or no germination at all. The M1H1 extract was found to be active on Arabidopsis seeds (data not shown). To investigate whether the extracts of strains M1H1 and M23A7 have a broad phytotoxic effect, five additional plant species were tested. More particular, the dicot weeds Amaranthus retroflexus and Popover rhoeas, the monocot weeds Digitaria sanguinalis and Poa annua, and maize and wheat as monocot crops were tested. Plants were sown and at 14 days of germination treated with the same extract of strain M1H1 or M23A7, except for the P. annua treatments. The P. annua seedlings were treated at 26 days after sowing.

[0163] Again, the extracts obtained from the bacterial strain M1H1 or M23A7 showed a significant phytotoxic effect on all tested weeds (Figure 2 and Table 2), with the M1H1 extract mostly showing a more pronounced effect. On maize, the M1H1 extract had a strong negative effect on the growth of the treated plants, while on wheat and Poa annua a moderate effect could be observed (Figure 3-5).

[0164] Table 2. Visual scoring of the effect of the extract of M1H1 or M23A7 on several plant species. Regarding the extract, final scoring was done at 15-16 days after administration. Regarding the supernatant, scoring was done at 5 days after administration. Classes are defined as strong, > 50% damage (necrosis, chlorosis, growth reduction) of the treated area (i.e. the plant canopy for weeds, 1 leaf for crops); moderate, 25-50% damage of the treated area; mild, < 25% damage of the treated area; not active, no visual difference compared to the blank formulation control; NT, not tested.

[0165] Example 3. Microbial species identification

[0166] The bacterial strains MED-B-M1H1 and MED-B-M23A7 were both morphologically classified as Streptomyces strains. To phylogenetically characterize both strains, genomic DNA was prepared for whole genome sequencing. The strains were grown on solid nutrient broth medium (5 g / l peptone, 3 g / l yeast extract, 5 g / l sodium chloride, 15 g / l agar, adjusted to pH 7.2) and after a 7-day incubation at 28°C harvested for genomic DNA extraction using the DNeasy PowerSoil Pro Kit (QIAGEN) according to the manufacturer's standard operating procedure (DNeasy PowerSoil Pro Kit Handbook). The DNA yield was evaluated by fluorometric means using Qubit dsDNA HS (ThermoFisher Scientific) and the integrity of the DNA assessed in a 1% (w / v) agarose-TAE (Tris-acetate-EDTA) electrophoresis gel with SYBR-safe (ThermoFisher Scientific). The extracted DNA was submitted for Whole Genome Sequencing (WGS) at a commercial provider for both long read (Oxford Nanopore Technologies) and short read (Illumina) sequencing. The genomic sequences were assembled using a hybrid approach which combines long read sequencing (assembled using Flye by Kolmogorov et al 2019 Nature Biotech 37) and short read sequencing (using Pilon by Walker et al 2014 PLoS One 9(11): ell2963). On whole genome level, strains M1H1 and M23A7 are 95.95% identical.

[0167] Full length 16S rRNA sequences were extracted in silica using barrnap (Seemann), which itself relies on "nhmmer", a tool which uses hidden Markov models to search for specific gene signatures. The sequence searches revealed that the 16S rDNA sequences of strains M1H1 and M23A7 show only 2 nucleotide differences, resulting in a sequence identity of 99.869% over a length of 1527 nucleotides as in SEQ ID No. 1. Both 16S rRNA sequences were also queried against the RefSeq 16S rRNA reference database using the platform provided by NCBI, standard settings for "high similarity" searches were used. Multiple sequence alignments were performed using Muscle (Edgar 2004 Nucleic Acid Research 32). The closest related Streptomyces strain showed a sequence identity of 99.35% on 16S rDNA level. Based on the above, both M1H1 and M23A7 are proposed to be classified as Streptomyces chrestomyceticus.

[0168] Example 4. Fractionation screen

[0169] In a first attempt to identify the one or more active phytotoxic compounds produced by the M1H1 and M23A7 S. chrestomyceticus strains, an extract of each culture was fractionated upon which the several obtained extracts were tested for their activity. First, the S. chrestomyceticus strains were propagated in a commercial bacterial growth medium and an equal volume of acetone was added to the fermentation broth (125 ml). After 2 h of incubation while shaking, the acetone extract was filtered and concentrated under reduced pressure. The aqueous residue was loaded onto a resin column for a solid-phase extraction (SPE) and eluted with acetone. The extract was evaporated, the residue dissolved in 100% DMSO and subsequently filtered at 0.2 pm prior to semi-preparative fractionation to constitute a HPLC head. An aliquot of the flow-through was kept for its possible evaluation of activity if not retained by the SPE resin. Subsequently, 100 mg material per extract was subjected to semipreparative reversed phase HPLC (Zorbax SB-C8 column, 21.2 x 250 mm, 7 pm, 20 mL / min, UV detection at 210 and 280 nm) eluting with CH3CN: H?O, in a linear gradient of acetonitrile (AcN) specific for each sample, and a wash step to yield a collection of 80 fractions. Those 80 different fractions were then tested for herbicidal activity after evaporation of the organic solvent and preparation of an aliquot per fraction at a concentration of 100 mg / ml in 20% of DMSO in water. All 80 fractions of the extracts of M1H1 and M23A7 were tested in two technical repeats using a foliar spray for their phytotoxic activity. Fractions 27 , 28, 29, 30, 31, 32 and 33 of the M1H1 extract showed the same phytotoxic activity as was found with the full extract (Figure 6), indicating that these fractions comprise the active compound or compounds that is / are responsible for the phytotoxic effect of the M1H1 extract. The one or more phytotoxic compounds were not present in other fractions.

[0170] For M23A7, the one or more phytotoxic compounds were present in fractions 20, 21, 22, 23 and 24. When applied separately on Arabidopsis seedlings a similar strong phytotoxic activity of those extract fractions could be observed as with the full extract (Figure 7).

[0171] Finally, the identified active fractions of both M1H1 and M23A7 extracts were analyzed using HPLC. Briefly, a Zorbax was used for the separation. Two solvents were used as mobile phase: solvent A (water:AcN 90:10) and solvent B (water:AcN 10:90), both with 13 mM ammonium formate and 0.01% TFA. Based on the retention time of the detected components all active fractions comprised the same chemical compound. The observation that the same phytotoxic compound was produced by both S. chrestomyceticus strains is in line with the high sequence identity between M1H1 and M23A7, both on 16S rDNA and on whole genome level.

[0172] Example 5. Supernatant of the M1H1 fermentation broth

[0173] In order to investigate whether the phytotoxic compound available in the Streptomyces chrestomyceticus extracts is also secreted by the bacteria, we tested the supernatant of a M1H1 bacterial culture. The M1H1 strain was cultured in a liquid medium (125 ml growth medium), subsequently centrifuged and filtered and then tested on A. thaliana, A. capillaris, A. retroflexus and D. sanguinalis. The plants were sown and grown as described in Example 2.

[0174] At 8 days after germination, the seedlings were treated with the supernatant of the M1H1 bacterial culture. The supernatant was formulated in a 1:4 and in a 1:10 dilution using a diluted emulsifiable concentrate, containing 90 w% vegetable oil and 2 surfactants (i.e. an emulsifier and dispersant). 300 pl of the formulated supernatant was applied with an airbrush (type Fengda, 0.2 mm nozzle at 1 bar) to the plant canopy. As a negative control, the plants were sprayed with the centrifuged and formulated sterile fermentation medium. Untreated plants were used as an additional negative control. Five days after the application, the plants were visually scored and classified into three classes depending on the severity of growth inhibition and / or phytotoxic effects. Treatments that induced more than 50% damage (chlorosis, necrosis, growth reduction) of the treated area were labelled "strong", while extracts that induced a growth inhibition of between 25% and 50% were labelled "moderate". In case the treatment did not lead to a clear visual difference compared to the negative controls, the extract was considered "not active". Interestingly, the supernatant obtained from the M1H1 bacterial culture showed an identical strong phytotoxic effect in three of the four tested plant species (Figure 8 and Table 1). For Agrostis, the effect of the M1H1 supernatant was scored moderate. Surprisingly, the same phytotoxic effect could be observed in Arabidopsis, Agrostis, Amaranthus and Digitaria when the supernatant was diluted in a 1:10 ratio (data not shown). Additionally, the M1H1 supernatant also had a phytotoxic effect on Arabidopsis seeds, both in a 1 to 4 dilution (no germination, data not shown) and in a 1 to 10 dilution (partial germination, data not shown).

[0175] Example 6. Bee toxicity test

[0176] The extract sample derived from Streptomyces strain M 1H1 was tested in a bee toxicity study according to the OECD 213 and 214 GUIDELINES FOR THE TESTING OF CHEMICALS, designed to assess respectively, oral and contact toxicity of pesticides and other chemicals to adult worker honeybees.

[0177] To assess oral toxicity, adult worker honeybees were exposed to two doses of a 1 / 8 dilution of the extract dispersed in sucrose solution. After those two exposures, the bees were fed a normal diet, i.e. the same diet without the test substance.

[0178] To assess contact toxicity, adult worker honeybees were exposed to two doses of a 1 / 4 diluted extract dissolved in an appropriate carrier, by direct application to the thorax (droplets). For both the oral and contact toxicity tests, mortality was recorded at 24 and 48 hours and compared to control values. If the mortality rate for the test substance at 48h was higher than that at 24h whilst control mortality remained at an accepted level, i.e. <10%, the test was extended until 96h. In both the oral toxicity test and the contact toxicity test, no effect of the M1H1 extract could be observed on honeybees (data not shown). Given the high sequence identity between M1H1 and M23A7, and the identification of a phytotoxic compound with the same chemical characteristics in both extracts, it is anticipated that also the extract of M23A7 is not toxic to bees.

[0179] Example 7. Close relatives of M1H1 and M23A7 show a similar herbicidal activity

[0180] To investigate whether the observed herbicidal activity of strains M1H1 and M23A7 is an isolated feature of a specific strain or is shared among a subcluster of Streptomyces species, close relatives were searched for by blasting the 16S rDNA sequence of M1H1 against proprietary and public bacterial collections. We could identify 9 additional related strains and based on their 16S rDNA sequence we constructed a phylogenetic tree (Figure 9).

[0181] Next, the activity of the extracts of all close relatives (as prepared in Example 1) was tested on phytotoxic activity using both Agrostis and Digitaria. Table 2 summarizes the results. Although the 16S rDNA sequence is sometimes evaluated solely as phylogenetic tool, a clear correlation could be found between % identity to the 16S sequence from M1H1 and the herbicidal activity of the close relatives of M1H1. The strains that are most closely related to M1H1 (i.e. NBRC15454 and DSM40545) showed a similar herbicidal activity compared to M1H1. However, strains that shared less than 99.6% sequence identity to M1H1 on 16S rDNA level did not show a convincing phytotoxic activity (Table 3).

[0182] For those strains of which we had the whole genome sequence, we were also able to calculate the Average Nucleotide Identity (ANI). Based on those ANIb values, a similar correlation as observed using the 16S rDNA sequence was found: only those strains most closely related to M1H1 and thus having a high ANIb value (i.e. more than 90.00%) possess herbicidal activity, while the less related strains having a ANIb value of less than 85.00% were found to be not active in the performed bioassays (Table 3).

[0183] Table 3. Summary of key features of strain M1H1 and its close relatives, more particularly the visual scoring of the effect of the extract of MIHl and close relatives on A. capillaris and D. sanguinalis at 15- 16 days after administration, and % identity between M1H1 and its close relatives on 16S rDNA level (16S rDNA) and whole genome level (AN lb). Visual scoring classes are defined as strong, > 50% damage (necrosis, chlorosis, growth reduction) of the treated area; moderate, 25-50% damage of the treated area; mild, < 25% damage of the treated area; not active, no visual difference compared to the blank formulation control.

[0184] Extract Agrostis Digitaria 16S rDNA ANIb

[0185] Finally, all extracts were analyzed using HPLC for the presence of the phytotoxic compound found in the extracts of M1H1 and M23A7 (see Example 4). Interestingly, the extracts that showed a clear herbicidal activity (i.e. M1H1, NBRC15454, DSM40545 and M23A7) comprises said compound, while the compound could not be observed in the HPLC results of the extracts derived from the other, nonactive strains.

[0186] In summary, the observed herbicidal activity of M1H1 and M23A7 is not a stand-along finding, but is rather a characteristic of a sub-cluster of Streptomyces strains represented by M1H1 (Figure 9). This is further substantiated by the chemical analyses of the tested extracts that indicate that the strains within the identified sub-cluster induce phytotoxicity through the same mode of action.

[0187] Example 8. Benchmarking herbicidal activity of M1H1 extracts

[0188] In a next step, the herbicidal composition derived from strain M1H1 was benchmarked to a commercially available biological herbicide based on pelargonic acid (Beloukha®). In total, four different treatments were performed: 1) an untreated negative control, 2) a formulation negative control, 3) positive control (Beloukha) and 4) the formulated M1H1 product. The weeds Matricaria chamomilla, Chenopodium album, Polygonum aviculare, Veronica persicae, Solanum nigrum and Setaria viridis were sown in plant boxes in standard potting soil, grown in the greenhouse, treated at one specific stage of their development and scored at 9 and 20 days after treatment.

[0189] Matricaria chamomille was treated at BBCH14. The BBCH scale is used to identity the phenological development stages of plants (for more information see Meier, Uwe (2019) Growth stages of mono- and dicotyledonous plants; DOI: 10.5073 / 20180906-074619). The first digit of the BBCH scale refers to the principal growth stage, wherein 1 refers to the stage of leaf development. The second digit refers to the secondary growth stage corresponding to the number of true leaves, leaf pairs or whorls unfolded. Hence BBCH14 refers to Matricaria seedlings having 4 true leaves or whorls unfolded. Already at 9 days (data not shown), but even more pronounced at 20 days after treatment (DAT) a significant effect of the M1H1 extract could be observed compared to the negative controls (Figure

[0190] 10). While the pelargonic acid treatment induced clear necrosis in Matricaria at 9 DAT, the M1H1 treatment significantly outperformed the positive control.

[0191] Chenopodium album was also treated at the BBCH 14 stage. At both 9 and 20 DAT, the M1H1 treatment induced the same strong phytotoxic effect in Chenopodium compared to the positive control (Figure

[0192] 11).

[0193] Polygonum aviculare was treated at BBCH13. At 20 days after treating the weeds with the M1H1 extract all plants were dead. A similar response could be observed with the positive control, while the negative control treatments did not induce any negative effect on plant growth (Figure 12).

[0194] Veronica persicae plants were treated at BBCH22. A similar effect could be observed as with Polygonum: the M1H1 treatment showed a similar or even stronger phytotoxic effect compared to the positive control (Figure 13).

[0195] Solanum nigrum was treated at BBCH12. The pelargonic acid and the M1H1 treatments both induced clear phytotoxic effects compared to the formulation and untreated control (Figure 14).

[0196] Finally, Setaria viridis was treated at BBCH21. In contrast with the above, the M1H1 treatment did not lead to the same strong effect of the positive control. However, a clear growth delay and chlorosis effect can be observed compared to the negative controls (Figure 15). To conclude, the M1H1 extract has a strong and broad herbicidal activity comparable to the commercial benchmark pelargonic acid. In several weeds, M1H1 had a stronger effect compared to the positive control. In Setaria, the M1H1 treatment was less effective compared to pelargonic acid. SEQUENCE LISTING

[0197] Throughout the description and examples, reference is made to the following sequences

[0198] SEQ ID No. 1: nucleotide sequence of the 16S rDNA from strain M1H1 from 5' to 3'

[0199] SEQ ID No. 2: nucleotide sequence of the 16S rDNA from strain M23A7 from 5' to 3'

[0200] SEQ ID No. 3: nucleotide sequence of the 16S rDNA from strain DSM40545 from 5' to 3' SEQ ID No. 4: forward primer 27F

[0201] SEQ ID No. 5: reverse primerl492R

Claims

Claims1. A composition for controlling growth of one or more plant species, the composition comprising a bioactive agent having herbicidal or phytotoxic activity, wherein the bioactive agent is a bacterium, a spore thereof or a fermentation product derived from a cell culture of said bacterium and wherein said bacterium is a Streptomyces species comprising a 16S rDNA sequence having at least 99.80% sequence identity to SEQ ID No. 1.

2. The composition according to claim 1, wherein the Streptomyces species has an average nucleotide identity (ANI) of at least 90.0% to the Streptomyces strain deposited under the Budapest Treaty at the BCCM / LMG on 7thJune 2024 under Accession No. LMG-P-33652.

3. The composition according to any one of the previous claims, wherein the Streptomyces species comprises a 16S rDNA sequence selected from the list consisting of SEQ ID No. 1-3.

4. The composition according to any one of the previous claims, wherein the Streptomyces species: a. is the bacterial strain M1H1 of which a representative culture has been deposited under the Budapest Treaty at the BCCM / LMG on 7thJune 2024 under Accession No. LMG-P- 33652; or b. having at least 94.0 % sequence identity on whole genome level to said deposited strain with Accession No. LMG-P-33652 and being functionally homologous to LMG-P-33652.

5. The composition according to any one of claims 1-3, wherein the Streptomyces species: a. is the bacterial strain M23A7 of which a representative culture has been deposited under the BudapestTreaty at the Polish Collection of Microorganisms (PCM) on 7thFebruary 2024 under Accession No. B / 00525; or b. having at least 94.0% sequence identity on whole genome level to said deposited strain with Accession No. B / 00525 and being functionally homologous to B / 00525.

6. The composition according to any one of claims 4-5, wherein the Streptomyces species being functionally homologous to LMG-P-33652 or to B / 00525 has at least 50% of the herbicidal or phytotoxic activity of LMG-P-33652 or B / 00525, or is a Streptomyces species of which a spore thereof or a fermentation product derived from a cell culture thereof has at least 50% of the herbicidal or phytotoxic activity of a spore or fermentation product derived from a cell culture of LMG-P-33652 or B / 00525.

7. The composition according to any one of the previous claims, wherein the fermentation product is selected from the list consisting of an extract, an extract fraction, a supernatant, a supernatant fraction, a filtrate, a whole cell broth and an herbicidal substance endogenously produced by the Streptomyces species.

8. The composition according to any one of the previous claims, further comprising an agricultural compatible carrier.

9. The composition according to claim 8, wherein the agricultural compatible carrier is selected from the list consisting of a dispersant, a surfactant, an additive, a thickener, an anti-caking agent, residue breakdown, a composting formulation, a granular application, diatomaceous earth, a coloring agent, a stabilizer, a preservative, a polymer, a coating, and a combination thereof.

10. The composition according to any one of the previous claims, wherein said composition is in a liquid, semisolid, solid or gaseous form and / or wherein said composition is in a form of a tablet, capsule, powder, wettable powder, dust, spray dried formulation, granulate, aerosol, paste, syrup, suspension, emulsion or solution.

11. The composition according to any one of the previous claims, wherein the composition is a sprayable composition.

12. An isolated bacterium comprising a 16S rDNA sequence having at least 99.8% identity to SEQ ID No. 1 over the full length of SEQ ID No. 1.

13. The isolated bacterium according to claim 12, wherein the bacterium is strain M1H1 of which a representative culture has been deposited under the Budapest Treaty at the BCCM / LMG on 7thJune 2024 under Accession No. LMG P-33652 or is the strain M23A7 of which a representative culture has been deposited at the PCM on 7thFebruary 2024 under Accession No. B / 00525.

14. A composition comprising the isolated bacterium according to any one of claims 12-13, wherein the isolated bacterium is lyophilized, freeze-dried or in a form selected from dried cells, dehydrated cells, devitalized cells, inactivated cells, frozen cells or cells in artificial suspension or in a dry powder.

15. A cell culture of the isolated bacterium according to any one of claims 12-13.

16. The cell culture according to claim 15, wherein the cell culture is an enriched culture or a biologically pure culture.

17. A product derived from the cell culture according to any one of claims 15-16, wherein the product is selected from the list consisting of a spore, an extract, an extract fraction, a whole cell broth, a supernatant, a supernatant fraction, a filtrate and an herbicidal substance endogenously produced by the bacterial strain.

18. Use of the isolated bacterium according to any one of claims 12-13 or the product according to claim 17, for controlling growth of one or more target plant species or for protecting a crop against a plant pest infestation.

19. A method of controlling the growth of one or more target plant species, comprising the step of applying to said target plant species or plant part thereof the composition according to any one of claims 1-11.

20. The method according to claim 19, wherein the step of applying comprises spraying, dusting, infiltration, immersion, dipping, incubation or any combination thereof.

21. The method according to any one of claims 19-20, further comprising a step of determining the phytotoxic effect of the application to said one or more target plant species.

22. The method according to any one of claims 19-21, wherein the one or more target plant species is an annual weed, a perennial weed, a dicotyledonous plant or a monocotyledonous plant.

23. The method according to claim 22, wherein the one or more target plant species is selected from the group consisting of Digitaria sanguinalis or other Digitaria species, Arabidopsis thaliana, Agrostis capillaris, Amaranthus retroflexus, Chenopodium album, Papaver rhoeas, Poa annua, an Alopecurus species, Brassica junced, Sinapis arvensis, Taraxacum officinale, Trifolium repens, Medicago lupulina, Campanula rapunculoides, Bellis perennis, a Plantago species, Cynodon dactylori, Chrysanthemum leucanthemum, Lactuca sativa, Lotus corniculatus, Matricaria chamomilla, Polygonum aviculare, Veronica persicae, Setaria viridis, Solanum nigrum, Portulaca oleraceae, Lepidium sativum, Zea mays, Triticum aestivum and Circium arvense.

Images