Aptamer biosensors for detecting aspergillus niger

Species-specific DNA aptamers for Aspergillus niger conidia address the limitations of current diagnostic methods by providing rapid and accurate detection, enhancing treatment efficacy and environmental monitoring.

WO2026008866A2PCT designated stage Publication Date: 2026-01-08VIENNA UNIVERSITY OF TECHNOLOGY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/EP2025/069203
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-07-04
Filing Date
2025-07-04
Publication Date
2026-01-08

AI Technical Summary

Technical Problem

Current diagnostic methods for aspergillosis lack sensitivity and specificity, particularly in differentiating between Aspergillus species, leading to delayed and inadequate treatment, especially in immunocompromised patients.

Method used

Development of species-specific DNA aptamers, such as AN03-R9-N-AN070, AN03-R8-AN435, AN01-R9-115, AN02-R9-099, and AN02-R9-185, which are capable of binding specifically to Aspergillus niger conidia, and their integration into biosensors for rapid and accurate detection.

Benefits of technology

The aptamers provide rapid, sensitive, and specific detection of Aspergillus niger, potentially reducing diagnostic delays and improving patient outcomes by enabling timely antifungal therapy and environmental monitoring.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure EP2025069203_08012026_PF_FP_ABST
    Figure EP2025069203_08012026_PF_FP_ABST
Patent Text Reader

Abstract

Disclosed is an aptamer for binding Aspergillus niger conidia having a sequence selected from the group consisting of tcccagcgcccggagaacacgaggaacgcacctatcacac (SEQ ID NO: 1), caccaccacgacacacaaccttcccgtgcggacccagcga (SEQ ID NO: 2), ccgacatctttgtactagtacgcctccacgaaaacacact (SEQ ID NO: 3), cctgagtaactgctcgtactagttcgcctcctcgaattac (SEQ ID NO: 4), acttcgcagtctgactagtacgcctccacgaagggtttct (SEQ ID NO: 5), and ccggatgctctaccgtactagtacgactccacgaaattat (SEQ ID NO: 6). Also disclosed is the use of this aptamer for detecting Aspergillus niger.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Aptamer biosensors for detecting Aspergillus niger

[0002] The field of the present invention relates to aptamers as biosensors for the detection of Aspergillus.

[0003] It is often necessary to detect the presence of fungi in environmental samples. Accordingly, molecular biology techniques, such as the polymerase chain reaction (PCR) and sequencing, are employed for the identification of these organisms.

[0004] In recent years, the incidence of infectious diseases, including fungal infections, has been observed to increase steadily. A particular threat is posed by aspergillosis, which is caused by fungi of the genus Aspergillus. It is estimated that this chronic pulmonary disease affects 3 million people annually, and a further 300,000 people are affected by the invasive form of the disease. The high mortality rate associated with aspergillosis is frequently attributable to a delayed diagnosis.

[0005] The diagnosis of pulmonary aspergillosis is currently established using a combination of different instruments and methods, including microscopic analyses, conventional cultures, serological tests, and molecular analyses. Although these techniques have enabled an improvement in the therapeutic success rate, the rapid and correct diagnosis of aspergillosis remains a challenge. None of the diagnostic instruments that are currently employed exhibit both high sensitivity and high specificity when used in isolation. The various diagnostic tests show differing sensitivity depending on the type of aspergillosis (allergic, chronic, or invasive) and the source of the sample under investigation (e.g., blood, sputum, bronchoalveolar lavage fluid). In recent years, it has become apparent that invasive aspergillosis is occurring with increasing frequency not only in immunodeficient and neutropenic patients, but also in non-neutropenic patients. Depending on the status of the patient, different diagnostic approaches are required.

[0006] Culturing techniques are time-consuming and can cause further delays in diagnosis. PCR analyses are generally more sensitive, but are strongly influenced by the DNA extraction and amplification methods employed, and it typically takes 24 to 48 hours to obtain a result. Furthermore, the correct identification of the pathogen is of the utmost importance in order to respond with a suitable treatment.

[0007] The early diagnosis of aspergillosis is hampered by several factors, including the immune status of the patient, the cooccurrence of other infections, and the often non-specific clinical presentation. Consequently, existing diagnostic tools are often deficient in terms of high specificity and sensitivity. To address these shortcomings, novel diagnostic instruments based on DNA aptamers that recognise Aspergillus cells would be an attractive option. In general, the use of DNA aptamers provides a diagnostic method that is cost- effective, sensitive, and specific.

[0008] Seo et al., 2021, discloses Aspergillus spore-specific DNA aptamers using systematic evolution of ligands by exponential enrichment (SELEX).

[0009] However, those aptameres do not differentiate between Aspergillus species, which, however, would be highly beneficial in diagnostics and environmental detection. Accordingly, it is an object of the invention to provide aptamers that are able to distinguish between different Aspergillus species and, in particular, specifically recognize Aspergillus niger.

[0010] The present invention addresses this by providing an aptamer (typically for binding Aspergillus niger conidia) having a sequence (i.e., having an N40 sequence corresponding to the variable region within the general aptamer sequence) selected from the group consisting of:

[0011] AN03-R9-N-AN070 : tcccagcgcccggagaacacgaggaacgcacctatcacac [SEQ ID NO: 1],

[0012] AN03-R8-AN435 : caccaccacgacacacaaccttcccgtgcggacccagcga [SEQ

[0013] ID NO: 2],

[0014] AN01-R9-115: ccgacatctttgtactagtacgcctccacgaaaacacact [SEQ

[0015] ID NO: 3],

[0016] AN02-R9-099: cctgagtaactgctcgtactagttcgcctcctcgaattac [SEQ

[0017] ID NO: 4],

[0018] AN02-R9-185: acttcgcagtctgactagtacgcctccacgaagggtttct [SEQ

[0019] ID NO: 5], and

[0020] AN01-R9-006: ccggatgctctaccgtactagtacgactccacgaaattat [SEQ

[0021] ID NO: 6].

[0022] This aptamer is preferably a DNA aptamer, specifically a single-stranded DNA (ssDNA) aptamer.

[0023] In a preferred embodiment, this aptamer is coupled to a detection system. It is particularly preferred when this is a fluorescent dye, preferably carboxyfluorescein (FAM).

[0024] The present invention also provides the (in vitro) use of the aptamer as a biosensor. This biosensor may be used for detecting Aspergillus, in particular Aspergillus niger and, more specifically, Aspergillus niger conidia.

[0025] In further preferred embodiments, the aptamer is used in a lateral flow assay, or in a flow cytometer or cell sorter (in particular when conjugated to a fluorescent dye or label).

[0026] The present invention addresses the technical problem of providing a rapid, sensitive, and species-specific means for detecting Aspergillus niger. The invention provides novel DNA aptamers capable of specifically binding to Aspergillus niger conidia, methods for their production, and their use in diagnostic applications. These aptamers were identified by optimising a whole-cell SELEX pipeline for fungal conidia. Specifically, in the course of the present invention, three independent whole-cell SELEX experiments were performed, which led to the identification and selection of species-specific DNA aptamers against Aspergillus niger conidia by means of next-generation sequencing and subsequent bioinformatic analysis.

[0027] In the course of the present invention, eighteen of the resulting nucleic acid sequences were characterised in detail and were all confirmed to be capable of binding to Aspergillus niger conidia. The sequences of these aptamers are provided in Supplementary Table 1 in the examples section. Notably, the aptamers designated AN01-R9-006, AN02-R9-099, and AN02-R9-185 were found to bind to Aspergillus conidia with particularly high specificity and affinity.

[0028] The aptamers developed in the experiments described in more detail below are synthetic, non-naturally occurring DNA molecules that bind specifically to Aspergillus niger conidia. The ability of the aptamers to distinguish between closely related Aspergillus species is a particularly advantageous and surprising feature.

[0029] The use of specific DNA aptamers as provided by the invention can accelerate the diagnosis of aspergillosis, which currently relies on methods that are often either insufficiently sensitive or excessively time-consuming. This approach has the potential to improve patient survival rates while simultaneously reducing the costs associated with expensive treatments. From an industrial perspective, the DNA aptamers of the invention can be synthesised on a large scale and offer significant advantages over traditional antibodies in terms of cost, batch-to-batch reproducibility, and the stability of the final product. The use of these aptamers provides clinicians with a specific and rapid method that may obviate the need for more complex and costly techniques, such as molecular analyses followed by sequencing.

[0030] In embodiments, for use in practical applications, the singlestranded DNA aptamer sequences can be coupled to a detection system. For instance, they can be directly fused to a fluorescent dye, such as fluorescein. Alternatively, they can be conjugated to other detector molecules by incorporating a 5', 3', or internal azide functionality, which can subsequently be linked to other sensor molecules using click chemistry. While the aptamers bind with high specificity and affinity to the surface of the target conidia, the identification of the exact molecular structures they recognise is not a prerequisite for their use in the methods and products disclosed herein. The invention in particular resides in the provision of the functional binding molecules themselves .

[0031] In other embodiments, the DNA aptamers of the invention, which are capable of detecting Aspergillus conidia, can be developed into novel diagnostic instruments for detecting aspergillosis. In one exemplary embodiment, the aptamers may be incorporated into a simple-to-use lateral flow assay (strip test) for the rapid detection of A. niger in a clinical or environmental sample. In another embodiment, the DNA aptamers, when coupled to a fluorescent dye, can be employed as specific detection reagents for Aspergillus conidia in applications such as flow cytometry and fluorescence-activated cell sorting.

[0032] The development of specific biosensors utilising aptamer-based technology for the detection of, for example, Aspergillus niger conidia, is suitable for application across multiple sectors. Such sensors may provide detection capabilities, for instance rapid, sensitive, and / or highly specific detection capabilities, which may improve the monitoring and management of fungal spores in clinical, environmental, industrial, and research settings.

[0033] In the medical field, the early and / or accurate diagnosis of invasive fungal infections (IFIs) is of importance, particularly in immunocompromised patients such as those undergoing chemotherapy, organ transplantation, or long-term immunosuppressive therapy. Certain conventional diagnostic methods, for example culture-based techniques or histopathological analysis, may exhibit long turnaround times and / or limited sensitivity, particularly in the early stages of infection.

[0034] Aptamer-based biosensors designed to bind to Aspergillus niger conidia provide a suitable alternative. These sensors can be integrated into point-of-care diagnostic platforms for the rapid and / or non-invasive detection of fungal spores in clinical samples such as bronchoalveolar lavage fluid, sputum, or blood. By enabling real-time detection and / or quantification, aptamer-based systems may reduce diagnostic delays, allow for timely initiation of antifungal therapy, and / or improve patient outcomes.

[0035] The use of aptamers of the present invention enables recognition of specific fungal species, allowing for discrimination between closely related organisms. This feature may be particularly useful in clinical contexts wherein differentiating between, for example, Aspergillus niger, A. fumigatus, or A. flavus can influence therapeutic choices, for instance due to species-specific antifungal resistance profiles . Aptamer-based sensors may also provide a suitable approach for monitoring airborne Aspergillus conidia in indoor and / or outdoor environments. Airborne Aspergillus spores may be present in such environments, and elevated concentrations in indoor spaces, for example of toxigenic species like A. niger, may be associated with certain health risks. In embodiments, the sensors may be integrated into HVAC systems, placed at key monitoring points, and may be configured to trigger an alert or an alarm when spore concentrations exceed a predefined threshold .

[0036] Such proactive detection capability may be beneficial in scenarios where water damage has occurred, as moisture-rich environments can provide conditions for mould proliferation. Early detection may enable remediation efforts. During and after mould remediation activities, these sensors can be used to validate the effectiveness of interventions. Continuous data logging can also reveal temporal trends, thereby supporting long-term environmental management.

[0037] In research and epidemiological studies, aptamer-based biosensors may also be useful. The ability to conduct high- frequency and / or spatially resolved spore measurements may provide researchers with data suitable for analysing the distribution, prevalence, and / or dynamics of Aspergillus niger in various ecosystems. These sensors may be deployed across multiple geographic locations to map fungal loads under different environmental conditions. Such data can be useful for understanding the ecology of Aspergillus species, identifying factors that may drive their propagation, and / or developing strategies to mitigate exposure. Furthermore, the specificity of aptamers may enable researchers to study the surface structures and / or morphologies of fungal conidia, which can be useful for exploring interspecies differences or investigating spore resilience mechanisms. In the food and agricultural industries, contamination with Aspergillus species is a concern, for instance due to their potential to produce mycotoxins such as ochratoxins and aflatoxins. Aptamer-based sensors may provide an effective means to monitor and / or control fungal contamination throughout food and feed supply chains. These sensors can be incorporated into test kits for on-site testing of raw materials, processed goods, or storage environments. Their high specificity may allow for the differentiation between toxigenic and non-toxigenic species, thereby enabling targeted risk assessment. For example, in grain silos or food processing facilities, aptamer-based assays may provide early warnings of fungal presence. Their potential portability and / or user-friendliness may render them suitable for use in low-resource settings or in-field testing scenarios. Moreover, aptamer-based diagnostics can be adapted for multiplexing, allowing for the simultaneous detection of multiple fungal pathogens or allergens in a single assay.

[0038] In biotechnological settings where Aspergillus niger is used as a production organism, for example in the manufacture of citric acid or enzymes, aptamer-based sensors may be employed for applications such as strain monitoring and / or contamination control. These sensors can help to distinguish production strains from environmental contaminants. Additionally, aptamer platforms may be engineered to function under harsh industrial conditions, offering robust solutions for online process monitoring in bioreactors or fermentation systems .

[0039] For the implementation of, for example, ssDNA aptamers, immobilisation of the ssDNA aptamers onto a sensor surface may be carried out. Several strategies may be suitable for this purpose. One suitable method may comprise direct thiolation, wherein a thiol (-SH) group is introduced at the 5' or 3' end of the aptamer. This can facilitate chemisorption onto gold surfaces through the formation of gold-thiol (Au-S) bonds. Thiolated aptamers may be attached to gold electrodes or nanoparticles, for instance for use in electrochemical or colorimetric detection systems. Alternatively, cross-linker chemistry can be used to tether aptamers to a variety of surfaces, such as glass, polymers, or silicon. In another strategy, dendrimer anchoring may be used, wherein dendritic molecules act as multivalent scaffolds for aptamer attachment. This approach can enhance the surface density and / or orientation control of aptamers. Furthermore, target-assisted immobilisation methods may be used, which can exploit the aptamer-target interaction itself to stabilise and / or orient the aptamer on the surface upon target binding. Once immobilised, ssDNA aptamers may enable specific and / or sensitive detection via various transduction mechanisms. In electrochemical sensors, target binding may induce a conformational change in the aptamer, which in turn may alter interfacial properties such as charge distribution, surface impedance, or electron transfer resistance. These changes may be monitored through variations in Faradaic current, electrochemical impedance spectroscopy (EIS), or differential pulse voltammetry (DPV).

[0040] To expand the utility and versatility of the aptamers, a range of chemical modifications may be introduced, for example at the 5'-end. Such modifications may provide functional handles for immobilisation, detection, and / or further chemical conjugation. Non-limiting examples of said modifications may include 5'-phosphorylation for ligation or enzymatic reactions; a 5'-amino modification (-NH2) for conjugation, for example via NHS esters or carbodiimide crosslinking; a 5'- thiol modification (-SH) for immobilisation, for instance onto a gold surface or for disulfide-based coupling; and / or biotinylation, which may facilitate binding to streptavidin or avidin-coated surfaces, beads, or nanoparticles. Further examples may include the addition of fluorophores, such as FAM, Cy3, or Cy5, for optical detection in fluorescence-based assays or imaging applications; click chemistry handles, such as dibenzocyclooctyne (DBCO) or azide groups, which may enable copper-free bioorthogonal reactions; and / or NHS esters or other active esters for efficient amide bond formation with amines. The aptamers may also be conjugated to various other ligands, peptides, or therapeutic agents. The modular nature of such modifications may allow for the tailored design of multifunctional aptamers suitable for various applications.

[0041] In certain embodiments, the aptamers may be labelled with fluorescent tags, such as FAM, and may be configured to change their emission upon target binding, thereby allowing for sensitive and / or real-time detection. Changes in colour or light emission upon target binding may be measured for detection, which may be rapid and / or multiplexed, for instance using coupled enzymatic assays.

[0042] Herein, all sequences given are nucleotide sequences, unless stated otherwise.

[0043] The present invention further relates to the following embodiments :

[0044] Embodiment 1. Use of an aptamer suitable for distinguishing conidia of a first Aspergillus species from conidia of other Aspergillus species, for detecting conidia of the first Aspergillus species in a sample.

[0045] Embodiment 2. Use of embodiment 1, wherein the aptamer is a DNA aptamer, preferably an ssDNA aptamer.

[0046] Embodiment 3. Use of embodiment 1 or 2, wherein the first Aspergillus species is Aspergillus niger. Embodiment 4. Use of embodiment 3, wherein the aptamer has a sequence selected from the group consisting of:

[0047] AN03-R9-N-AN070 : tcccagcgcccggagaacacgaggaacgcacctatcacac (SEQ ID NO: 1),

[0048] AN03-R8-AN435 : caccaccacgacacacaaccttcccgtgcggacccagcga (SEQ

[0049] ID NO: 2),

[0050] AN01-R9-115: ccgacatctttgtactagtacgcctccacgaaaacacact (SEQ

[0051] ID NO: 3),

[0052] AN02-R9-099: cctgagtaactgctcgtactagttcgcctcctcgaattac (SEQ

[0053] ID NO: 4),

[0054] AN02-R9-185: acttcgcagtctgactagtacgcctccacgaagggtttct (SEQ

[0055] ID NO: 5), and

[0056] AN01-R9-006: ccggatgctctaccgtactagtacgactccacgaaattat (SEQ

[0057] ID NO: 6).

[0058] Embodiment 5. Use of any one of embodiments 1 to 4, wherein the sample is a clinical sample, preferably bronchoalveolar lavage fluid, sputum, or blood, a food sample, or an environmental sample.

[0059] Embodiment 6. Use of any one of embodiments 1 to 5, wherein the aptamer is coupled to a detection system or label.

[0060] Embodiment 7. Use of any one of embodiments 1 to 6, wherein the aptamer is coupled to a fluorescent dye.

[0061] Embodiment 8. A detection device comprising an aptamer suitable for distinguishing conidia of a first Aspergillus species from conidia of other Aspergillus species, for detecting conidia of the first Aspergillus species in a samp1e.

[0062] Embodiment 9. The detection device of embodiment 8, wherein the aptamer is a DNA aptamer, preferably an ssDNA aptamer. Embodiment 10. The detection device of embodiment 8 or 9, wherein the first Aspergillus species is Aspergillus niger.

[0063] Embodiment 11. The detection device of embodiment 10, wherein the aptamer has a sequence selected from the group consisting of:

[0064] AN03-R9-N-AN070 tcccagcgcccggagaacacgaggaacgcacctatcacac (SEQ

[0065] ID NO: 1),

[0066] AN03-R8-AN435 : caccaccacgacacacaaccttcccgtgcggacccagcga (SEQ

[0067] ID NO: 2),

[0068] AN01-R9-115 : ccgacatctttgtactagtacgcctccacgaaaacacact (SEQ

[0069] ID NO: 3),

[0070] AN02-R9-099 : cctgagtaactgctcgtactagttcgcctcctcgaattac (SEQ

[0071] ID NO: 4),

[0072] AN02-R9-185 : acttcgcagtctgactagtacgcctccacgaagggtttct (SEQ

[0073] ID NO: 5), and

[0074] AN01-R9-006 : ccggatgctctaccgtactagtacgactccacgaaattat (SEQ

[0075] ID NO: 6).

[0076] Embodiment 12. The detection device of any one of embodiments 8 to 11, wherein the sample is a clinical sample, preferably bronchoalveolar lavage fluid, sputum, or blood, a food sample or an environmental sample.

[0077] Embodiment 13. The detection device of any one of embodiments 8 to 12, wherein the aptamer is coupled to a detection system or label.

[0078] Embodiment 14. The detection device of any one of embodiments 8 to 13, wherein the aptamer is coupled to a fluorescent dye.

[0079] Embodiment 15. The detection device of any one of embodiments 8 to 14, wherein the aptamer is immobilized on a surface of the detection device. Embodiment 16. The detection device of any one of embodiments 8 to 15, wherein the detection device is a lateral flow device.

[0080] Embodiment 17. The detection device of any one of embodiments 8 to 15, wherein the detection device is integrated into an HVAC system, bioreactor or fermentation system.

[0081] Figures and example

[0082] The present invention is further illustrated by the following figures and example, without being restricted thereto.

[0083] Figure 1. Schematic illustration of the whole-cell SELEX process applied to select aptamers specific to A. niger conidia. Nine consecutive rounds and three SELEX experiments were performed. Counter-selection with A. tubingensis was introduced after round 4. This figure was partly created with BioRender.com.

[0084] Figure 2. Exemplary results from test-PCRs dncl (A) and dnc2 (B) performed on recovered ssDNA to determine the optimal number of cycles for subsequent amplification. In dncl the fluorescence signal was normalized to 0. In Figure B, L: ladder, 15,16 and 17: PCR product after 15,16 and 17 cycles.

[0085] Figure 3. Quantification by qPCR of the ssDNA recovered after each round in the three SELEX experiments (A: SELEX-1, B: SELEX-2 and C: SELEX-3).

[0086] Figure 4. Melting curves of the ssDNA recovered after each round in the three SELEX experiments (A: SELEX-1, B: SELEX-2 and C: SELEX-3).

[0087] Figure 5. Total count of individual sequences over the rounds shown in percentage. Sequencing was performed on ssDNA pools recovered after rounds 2, 6, 7, 8, 9-N and 9-Tof SELEX-1 and SELEX-2 and after all rounds of SELEX-3. Additionally, the initial ssDNA library was sequenced to check for biases.

[0088] Figure 6. First screening of FAM-labelled candidate aptamers. Recovered ssDNA after binding assays with A. niger conidia was quantified by qPCR and is shown in molecules / pL. Samples were measured in duplicates. The mean value between biological and technical replicates is displayed after subtracting the mean value of the blank samples (only aptamers, no conidia). Error bars represent max. and min. values.

[0089] Figure 7. Second screening of FAM-labelled and unlabeled candidate aptamers. Recovered ssDNA after binding assays with A. niger conidia was quantified by qPCR and is shown in molecules / pL . Samples were measured in technical duplicates. The mean value between biological and technical replicates is displayed after subtracting the mean value of the blank samples (only aptamers, no conidia). Error bars represent max. and min. values.

[0090] Figure 8. Specificity evaluation of selected aptamers by means of qPCR (A) or fluorescence (B) measurements. A: Recovered ssDNA after binding assays with A. niger, A. tubingensis and A. nidulans conidia was quantified by qPCR and is shown in molecules / pL . Samples were measured in technical duplicates. The mean value between biological and technical replicates is displayed after subtracting the mean value of the blank samples (only aptamers, no conidia). The number of biological and technical replicates performed is indicated in white in each bar. Error bars represent max. and min. values. The predicted secondary structure of each aptamer was obtained with RNAFold and is shown on top of the figure. B: Confirmation of the species-specificity of three selected aptamers by fluorescent measurements upon elution. Fluorescence of the recovered and eluted ssDNA after binding assays with A. niger, A. tubingensis and A. nidulans conidia was measured at a Tecan Spark reader. Samples were measured in duplicates. The mean value between biological and technical replicates is displayed after subtracting the mean value of the blank samples (only conidia, no aptamer). Error bars represent max. and min. values. Figure 9. Binding affinity of aptamers AN01-R9-006 and AN02- R9-185 to A. niger conidia. The red line corresponds to the KDvalue.

[0091] Synopsis

[0092] Background

[0093] Spores produced by the filamentous fungus Aspergillus niger are abundant in a variety of environments. The proliferation of this fungus in indoor environments has been associated to health risks and its conidia can cause allergic reaction and severe invasive disease in animals and humans. Therefore, the detection and monitoring of Aspergillus conidia is of utmost importance to prevent serious fungal infections and contaminations. Among others, aptamers could serve as biosensors for the specific detection of fungal spores.

[0094] Results

[0095] In this study, a whole-cell SELEX approach was optimized for conidia of A. niger. Three wholecells SELEX experiments were performed in parallel with similar conditions. Quantification of recovered ssDNA and melting curve analyses were applied to monitor the ongoing SELEX process. Next-generation sequencing was performed on selected recovered ssDNA pools, allowing the identification of DNA aptamers which bind with high affinity to the target cells. The developed aptamers were shown to be species-specific, being able to bind to A. niger but not to A. tubingensis or to A. nidulans. The binding affinity of two aptamers (AN01-R9-006 and AN02-R9-185) was measured to be 58.97 nM and 138.71 nM, respectively, which is in the range of previously developed aptamers.

[0096] Conclusions This study demonstrates that species-specific aptamers can be successfully developed via whole-cell SELEX to distinguish different Aspergillus species and opens up new opportunities in the field of diagnostics of fungal infections.

[0097] Introduction

[0098] Aspergillus niger is a biotechnologically relevant filamentous fungus widely utilized in industry for its outstanding capability of producing organic acids and enzymes (Currie, 1917; Cairns et al., 2021). Bulk chemicals and proteins produced by this fungus are regarded as safe by the regulatory authorities and find applications in a variety of commodity products. Generally, A. niger is regarded as non-toxic and non-pathogenic for healthy individuals but it has the potential to cause allergic reactions and infectious diseases in patients with a compromised immune system (Schuster et al., 2002; Paulussen et al., 2017; Frisvad et al., 2018).

[0099] Aspergillosis, in particular, poses a serious threat as it can lead to a fatal outcome if not diagnosed promptly. Besides, some strains of A. niger are able to produce mycotoxins, such as fumonisins, ochratoxin A and oxalic acid (Frisvad et al., 2018), which can contaminate food products and cause multiple diseases in animals and humans (Frisvad et al., 2018; Taniwaki et al., 2018). A. niger is ubiquitous, being able to grow at a wide range of temperatures and pHs, and its conidia can be found in various natural as well as in indoor environments (Schuster et al., 2002). Monitoring and diagnostics of A. niger conidia is crucial to prevent and manage spread of fungal infections and contamination of food products and air.

[0100] A rapid and species-specific biosensor for A. niger conidia would facilitate the detection of fungal spores in critical environments and even support the early diagnosis of a fungal infection in a hospital setting (Guo et al., 2023). Species-specific detection of fungal conidia could be achieved using specific aptamers. Aptamers are short (typically less than 100 k-mer) single-stranded oligonucleotide (DNA or RNA) molecules that, upon folding into a tridimensional structure, can bind with high affinity to any target of interest against which they were selected. They can potentially be developed starting from a random oligonucleotide library against various target of interest, from small molecules to proteins, with an iterative process called SELEX (Ellington and Szostak, 1990; Tuerk and Gold, 1990). Even more complex targets can be used (Morris et al., 1998; Homann and Goringer, 1999), such as entire cells, in which case the process is termed whole-cell SELEX (Sefah et al., 2010). Once identified, aptamers can be readily modified with fluorophores or chemical groups for multiple applications (Yuce and Kurt, 2017). From an industrial standpoint, DNA aptamers can be synthesized at large-scale, outperforming antibodies in terms of costs, batch-to-batch reproducibility and stability of the final product (Yuce and Kurt, 2017). Next to the potential diagnostic applications of Aspergillus-specffic aptamers, these molecules could help understand the composition of the fungal conidial surface. The outer layer of conidia, the cell wall, mainly consists of proteins and polysaccharides and plays an important role in the interaction of the conidia with the external environment (Garcia-Rubio et al., 2020). The particular composition of the conidial wall is not only crucial for the establishment of an infection but can also have significance for industrial applications (Blango et al., 2019). For example, pellet morphology, an important prerequisite for production of citric acid with A. niger is strongly affected by the cell wall composition (Zhang and Zhang, 2016). Therefore, investigating the presence or the absence of specific surface constituents can be beneficial for multiple applications. Successful implementation of whole-cell SELEX was already shown against various microorganisms, including bacteria (Trunzo and Hong, 2020) and yeast (Bachtiar et al., 2019).

[0101] More recently, whole-cell SELEX was applied against spores produced by fungi. Krivitsky and colleagues developed an electrochemical aptamer-based method to collect and detect spores produced by the basidiomycete plant pathogen Phakopsora pachyrhizi (Krivitsky et al., 2021). Aptamers recognizing three different species of Aspergillus (A.fumigatusrA.flavus and A. niger) were developed. These aptamers were obtained by subsequent incubation of the recovered ssDNA with the three fungal species, so that the enriched sequences were not selected for species-specificity (Seo et al., 2021).

[0102] In this study, whole-cell SELEX was optimized for fungal conidia of Aspergillus. Three independent wholecell SELEX experiments were performed which led to the identification and selection of speciesspecific aptamers against A. niger conidia .

[0103] Materials and Methods

[0104] Buffers and chemicals lOx PBST (1.37 M NaCI, 27 mM KCI, 100 mM Na2HPO4x 2H2O, 18 mM KH2PO4and 0.5% Tween20, pH 7.4) was prepared as stock solution, filtered and stored at room temperature. lx PBST was prepared by diluting lOx PBST with sterile ultrapure lab water prepared with MilliQ system (Merck) and stored at 4°C. lOx MgCI2(14 mM) was prepared in lx PBST and stored at -20°C.

[0105] Binding buffer was prepared fresh by diluting MgCI2in lx PBST (1.4 mM final MgCl2concentration). BSA or recombinant albumin (NEB) and salmon sperm DNA (Thermo Fisher Scientific) were used as competitors at a final concentration of 0.5 and 0.25 pg / pL, respectively.

[0106] Strains and culture conditions

[0107] Conidia of A. niger strains ATCC 1015 and CBS 544.65 were used as target for the whole-cell SELEX process. Conidia of A. tubingensis MA 3973 (ACBR Fungal Database: https: / / acbr- database .boku.ac.at)(Ellena, 2020) were used for counterselection .

[0108] Conidia of A. tubingensis MA 3973 and of A. nidulans FGSC A4 were used for species-specificity characterizations.

[0109] Strains were inoculated from glycerol stocks on minimal medium plates (Barratt et al., 1965) and incubated for 5 days at 30°C. Conidia were harvested from the plates with 0.1% Tween20, washed twice with lx PBST (5,000 rpm and 10 minutes) and resuspended in lx PBST. Conidia concentration was determined using a Thoma counting chamber. ssDNA library and primers

[0110] The random ssDNA library consisted of a randomized region of 40 nucleotides flanked by 23 constant primer binding sites (5'-tagggaagagaaggacatatgat-N40-ttgactagtacatgaccacttga-3'). It was ordered from IDT (Coralville, USA) with unique handmix ratio of the random bases and HPLC purification.

[0111] Modified primers 5'- / 56-FAM / tagggaagagaaggacatatgat-3 ' and 5'- / 5Phosph / tcaagtggtcatgtactagtcaa-3 ' were used for the amplification of the recovered ssDNA pool after each SELEX round.

[0112] Unmodified primers (5'-tagggaagagaaggacatatgat-3 ' and 5'-tcaagtggtcatgtactagtcaa-3 ') were used for DNA quantification, melting curve analyses and characterization studies . A random but specific 40 bp sequence flanked by the common primer binding sites (BA-NC-1: 5'- tagggaagagaaggacatatgatgctagatggacttgccgttggaagacacagcatgacccc gttgactagtacatgaccacttga [SEQ ID NO: 7] - 3') was used as negative control for the binding assays. Two additional random and specific 40 bp sequences flanked by the common primer binding sites (BA-NC-2: 5'- tagggaagagaaggacatatgattacctatcgcctgaaagccagttggtgttaaggagtgct cttgactagtacatgaccacttga [SEQ ID NO: 8] - 3' and BA-NC-3: 5'- tagggaagagaaggacatatgatagcgctcccagcacaacggccaaggaagtctccaatttc tttgactagtacatgaccacttga [SEQ ID NO: 9] - 3') were used for specificity tests based on fluorescent measurements. Primers, selected candidate aptamers and the negative control sequence were ordered from IDT (Coralville, USA) purified by standard desalting. Library, primers and aptamers were resuspended and diluted in ultrapure nuclease-free water to a final concentration of 100 pM.

[0113] Whole-cell SELEX

[0114] Three independent whole-cell SELEX experiments (SELEX-1, -2 and -3) consisting of 9 consecutive rounds were performed according to a previously published protocol (Kolm et al., 2020) with modifications. Conidia suspensions were prepared in PBST as described above. 5x10sconidia of each A. niger strain (ATCC 1015 and CBS 554.65) were pipetted in the same tube, centrifuged at 5,000 g for 5 minutes and resuspended in the appropriate volume of binding buffer (Tables 1, 2 and 3). The ssDNA library (in the first round) or the recovered ssDNA pool was incubated for 1 hour at room temperature in binding buffer in a total volume of 50 pL and then added to the resuspended conidia. Reaction volume and ssDNA concentration were specific for each round (Tables 1, 2 and 3). Incubation was performed in a thermoblock at 21°C for 30 minutes and 650 rpm. Additionally, samples were shaken by hand every 5 minutes to avoid settling of the conidia to the bottom of the tube. After incubation, samples were washed with 1 mL binding buffer and resuspended in 50 pL ultrapure nuclease-free water. The number of washes was gradually increased over the rounds (Tables 1, 2 and 3). To allow elution of the aptamers from the conidia, the samples were incubated for 10 minutes at 95°C, followed by 10 minutes on ice. They were then centrifuged at 5,000 g for 5 minutes and the supernatant was transferred to fresh tubes to which 0.1 volumes of 3 M sodium acetate and 3 volumes of 96% ethanol were added for overnight precipitation at-20°C.

[0115] Precipitated ssDNA was recovered by centrifugation (20 minutes, 16,000 g, 4°C) and washed twice with 70% ethanol. It was then resuspended in 50 pL ultrapure nuclease-free water.

[0116] Recovered ssDNA pools were amplified by PCR. To determine the optimal number of cycles for the enrichment PCR, two test-PCRs were performed (dncl and dnc2).

[0117] All the ssDNA recovered after the first cycle (50 pL) was first amplified with 6 cycles and subsequently purified to allow enrichment of each of the recovered sequences before proceeding with the test-PCRs. To enrich the ssDNA recovered after the first round, 10 reactions of 25 pL were set up, each containing 5 pL of the recovered ssDNA, lx Q5 buffer (NEB), 0.2 mM dNTPs, 1 pM of each modified primer and 0.5 units of Q5 High-Fidelity DNA polymerase (NEB). Dncl was performed in a reaction volume of 25 pL containing 1 pL of recovered ssDNA (purified PCR product for round 1), lx Q5 buffer (NEB), 0.2 mM dNTPs, 1 pM of each modified primer, lx EvaGreen Plus dye (Biotium) and 0.5 units of Q5 High-Fidelity DNA polymerase (NEB). The thermocycling program was the following: denaturation for 3 minutes at 95°C followed by 30 cycles of 15 seconds at 95°C, 15 seconds at 58°C and 15 seconds at 72°C, and final elongation for 2 minutes at 72°C. Fluorescence was acquired at each cycle on the green channel during the first elongation step. The amplification range was determined based on the amplification curve obtained from the fluorescence measurement and three cycles before the peak were selected for dnc2.

[0118] Dnc2 was performed with the same conditions of dncl but without EvaGreen dye. Three reactions were set up in parallel and stopped at different number of cycles. Aliquots of the PCR products were loaded on a 3% agarose gel stained with SYBR Gold (Thermo Fisher Scientific) and the optimal number of cycles was selected based on robust amplification without by- product / heteroduplex formation. ssDNA (22-25 reactions) was then amplified with the same conditions used for dnc2. Amplified DNA was purified with the Monarch PCR & DNA Cleanup Kit from NEB and digested to ssDNA with a Lambda Exonuclease (NEB).

[0119] For ssDNA generation, multiple 50 pL reactions containing 500 ng of DNA, lx Lambda exonuclease reaction buffer and 0.5 units of Lambda Exonuclease were prepared. Samples were incubated at 37°C for 30 minutes, followed by enzyme inactivation at 80°C for 10 minutes. Aliquots of the generated ssDNA were checked on a 4% agarose gel stained with SYBR Gold (Thermo Fisher Scientific) and the samples were purified with the Oligonucleotide Cleanup protocol included in the Monarch PCR & DNA Cleanup Kitfrom NEB. An aliquot of the generated ssDNA was checked on a 4% agarose gel and the concentration determined at the NanoDrop. Over the rounds, more stringent conditions (decreasing the starting DNA concentration, increasing the number of washes and addition of competitors during the incubation) were applied as reported in Tables 1, 2 and 3.

[0120] Counter-selection was performed in rounds 4 to 8 with A. tubingensis . In brief, recovered, amplified and singlestranded generated DNA was incubated with 107A. tubingensis conidia for 30 minutes at 21°C. The samples were then centrifuged and the supernatant containing unbound sequences was added to A. niger conidia before continuing with the standard protocol.

[0121] In round 9, a negative selection (R9-T) was performed in parallel with the standard protocol (R9-N). In this case, the same protocol was applied, with the difference that conidia of A. tubingensis were used as target with the aim of identifying and excluding aptamer sequences not species-specific for A. niger.

[0122] Quantification of recovered ssDNA by qPCR qPCR was performed using a RotorGene Q (Qiagen) in a total volume of 15 pL. The reaction mixture consisted of lx KAPA Sybr Fast (Sigma-Aldrich), 500 nM unmodified primer and 1 pL of recovered ssDNA. The thermocycling program consisted of denaturation for 3 minutes at 95°C followed by 35 cycles of 15 seconds at 95°C, 20 seconds at 62°C and 1 second at 72°C. Fluorescence was acquired at each cycle on the green channel during the elongation step. Determination of the DNA concentration was based on serial dilutions of the ssDNA library (103-108molecules / reaction) performed in 500 pg / L poly(dl-dC) (Merck).

[0123] Samples were measured undiluted and diluted 1:10 in 10 mM Tris-HCI, pH 8.0. All samples, standards and non-template controls were measured in technical duplicates.

[0124] Monitoring sequence diversity by melting curves

[0125] Sequence diversity and sequence enrichment were monitored during the SELEX process by means of melting curves (Vanbrabant et al., 2014; Kolm et al., 2020). To this end, 105DNA molecules were amplified in a total volume of 25 pL. The reaction mixture consisted of lx Q5 buffer (NEB), 0.2 mM dNTPs, 1 pM of each unmodified primer, lx EvaGreen Plus dye (Biotium) and 0.5 units of Q5 High-Fidelity DNA polymerase (NEB). Reactions were performed on a Mastercycler ep realplex Real-time PCR system (Eppendorf) with the following conditions: denaturation for 3 minutes at 95°C followed by 35 cycles of 15 seconds at 95°C, 15 seconds at 55°C and 15 seconds at 72°C. After amplification, a melting profile was applied which consisted of 3 minutes at 95°C, followed by 15 seconds at 95°C, 15 seconds at 70°C and gradual increase (0.03°C / second) from 70°C to 90°C. The whole-cell SELEX process was stopped when melting curves showed a distinct increase of the homoduplex peak, indicating sequence enrichment .

[0126] Identification of candidate aptamers by next-generation sequencing

[0127] DNA recovered after SELEX rounds 2, 6, 7, 8 and 9 of SELEX-1 and SELEX-2 and after all rounds of SELEX-3 was prepared for next-generation sequencing. First, the ssDNA was diluted to 105molecules / pL and 1 pL used to perform a preparative PCR with the optimal number of cycles. Amplified DNA was purified with the Monarch PCR & DNA Cleanup Kit (NEB) and preliminary quality control was performed with a fragment analyzer (Advanced Analytical). DNA concentration was determined using Qubit (Thermo Fisher Scientific). 22 pL (containing at least 20 ng of DNA) of the purified PCR products were sent for sequencing to the Next Generation Sequencing Facility of the Vienna Biocenter Core Facilities. DNA libraries were prepared by ligation and the DNA was sequenced on the Illumina MiSeq using the PE150 Micro kit (300 cycles) in paired-end mode.

[0128] Sequencing data analysis was performed using the previously developed Aptaflow script (Kolm et al., 2020). Additionally, sequences were clustered according to the Levenshtein distance (k- mer=3) using FASTAptamer 2.0 _(_https: / / fastaptamer2.missouri.edu). To speed up the analysis only the first 10 clusters were generated.

[0129] Candidate aptamers belonging to different clusters were selected based on their prevalence in the selected round, their appearance in earlier rounds, their absence in the negative selection (R9-T) and their minimum free energy. Minimum free energy was predicted using RNAFold

[0130] (http: / / rna.tbi.univie.ac.at / cgi-bin / RNAWebSuite / RNAfold.cgi) selecting DNA parameters (Matthews model, 2004) and 21°C in the energy parameters and incorporating G-Quadruplex formation into the structure prediction algorithm.

[0131] Binding assays and determination of aptamer specificity

[0132] To test the binding capabilities and the specificity of the selected aptamers, binding assays were performed and the amount of bound ssDNA determined by two independent methods: fluorescence measurements and quantification by qPCR. Conidia of either A. niger A. tubingensis or A. nidulans and aptamers used for binding assays were prepared as described above. 107total conidia were centrifuged at 5,000 g for 5 minutes and resuspended in 100 nM of each aptamer in a total of 100 pL. Competitors were added to each reaction. The same protocol followed during whole-cell SELEX was applied, with the difference that three washes were performed after the incubation. Before elution, recovered conidia-bound ssDNA was resuspended in 100 pL of ultrapure nuclease-free water for qPCR samples or 10 mM Tris-EDTA (pH 8.00) for fluorescent measurements. Blank reactions without conidia and contamination control reactions without aptamers were performed in parallel. For fluorescence measurements, 50 pL of eluted sample were transferred to a 96-well plate and fluorescence was measured at a Tecan Spark reader.

[0133] Fluorescence was measured after shaking (5 seconds) with an excitation wavelength of 485 nm, emission wavelength of 520 nm and a gain of 128. Quantification by qPCR was performed as previously described on the ethanol precipitated and recovered ssDNA.

[0134] Aptamer binding affinity determination

[0135] Binding affinity curves were obtained by performing the binding assays with 107total A. niger conidia and different starting aptamer concentrations (ranging from 0 to 600 nM) in a reaction volume of 100 pL. Determination of the bound ssDNA was performed by fluorescent measurements at a Tecan Spark reader on 50 pL of the eluted samples. Two replicates were performed for each tested concentration. Values obtained from samples containing only conidia were used as blanks and subtracted from the values obtained in the other samples.

[0136] Curve fitting to the experimental binding data of the aptamers was done in R (version 4.3.2). Specifically, the nls() function was employed to fit a hyperbolic model ([AboUnd ~ [F]) [F] ~ (n * [A]) / ([A] + KD) to the experimental data, enabling the determination of dissociation constant (KD) values. 95% confidence intervals for KDwere computed using the confint() function in R.

[0137] Results and Discussion

[0138] Implementation and design of a whole-cell SELEX process for the development of aptamers specific to A. niger conidia

[0139] A whole-cell SELEX approach was applied to conidia of A. niger as illustrated in Figure 1. Three main changes were introduced to a previously published protocol used to select aptamers against bacterial cells (Kolm et al., 2020): the overnight precipitation in ethanol to recover the bound-ssDNA after each SELEX round, an additional test-PCR (dnc2) for the determination of the number of cycles and the negative selection performed with A. tubingensis before sequencing. Compared to a previous study where aptamers against three different Aspergillus species were generated with a toggle approach (Seo et al., 2021), here we aimed at the in-vitro selection of species-specific aptamers. Advanced tools (qPCR and melting curves) were applied to quantify and monitor the diversity of the recovered ssDNA, while next-generation sequencing was used to identify potential aptamer candidates binding to fungal conidia.

[0140] In the first round, conidia of the two A. niger strains ATCC 1015 and CBS 554.65 were incubated with a total of 1015molecules of the FAM-labelled ssDNA library. Upon incubation, the unbound sequences were removed by centrifugation and washing. The bound sequences were recovered by elution and subsequent precipitation in ethanol to remove the conidia from the recovered ssDNA before PCR amplification. This step was introduced due to the large amounts of PCR inhibitors present in A. niger conidia, among which melanin, that would otherwise strongly interfere with the amplification reaction (Eckhart et al., 2000; Fraczek et al., 2019; Yuan et al., 2023). After recovery, the precipitated ssDNA was subjected to two independent test- PCRs (dncl and dnc2) for the determination of the optimal number of cycles for enrichment PCR. This is crucial for the subsequent efficient ssDNA generation via lambda exonuclease. The optimal number of cycles is defined as the number of cycles at which the highest PCR product yield can be obtained without generating by-products (Wang et al., 2019). Recovered ssDNA was subsequently amplified by enrichment PCR with the selected number of cycles and ssDNA generated from it with a lambda exonuclease enzyme, before being subjected to another round of in-vitro selection. In total, 3 independent whole-cell SELEX experiments were performed, each consisting of a total of 9 rounds. The selection conditions applied in each round are reported in Tables 1, 2 and 3. In general, the conditions were rendered more stringent over the rounds by decreasing the amount of input DNA, increasing the number of washes or adding competitors to the reaction. To increase the speciesspecificity of the enriched sequences, counter-selection was performed starting from round 4 until round 8. In this case, the recovered ssDNA was incubated first with A. tubingensis and the unbound sequences were then recovered by centrifugation and incubated with A. niger. This allowed to preferentially enrich sequences that only bind to A. niger and do not recognize conidia of its close relative A. tubingensis. In all three SELEX experiments, round 9 was performed in parallel against both target (A. niger; R9-N) and non-target species {A. tubingensis; R9-T) using aliquots of the ssDNA pool recovered after round 8. This allowed to assess unspecific binding to A. tubingensis and potential PCR bias introduced during the in-vitro selection. Additionally, a positive selection against A. niger with counter-selection against A. tubingensis was performed in SELEX-3 (R9 in Table 3).

[0141] Table 1. Selection conditions applied m SELEX-1.

[0142] Table 2. Selection conditions applied in SELEX-2 Table 3. Selection conditions applied in SELEX-3. *ssDNA applied to round 6 was derived from a mixture of dsDNA obtained from the amplification of the ssDNA recovered after round 5 and amplified from the already amplified ssDNA.

[0143] 6

[0144] __ i , A tubingensis2-92X ™ BSA,4sDNA 3xMA 3973

[0145] When using lambda exonuclease for the generation of ssDNA, it is important that only fulllength double-stranded products (homoduplexes) are generated during enrichment PCR, as heteroduplexes cannot be efficiently digested by the enzyme. Due to the high sequence heterogeneity characterizing the utilized random ssDNA library, there is a risk of forming byproducts (heteroduplexes) and introducing biases during the PCR (Tolle et al., 2014; Kohlberger and Gadermaier, 2022). A commonly used method to avoid formation of heteroduplexes is the determination of the optimal number of cycle prior enrichment PCR (Sefah et al., 2010). To this end, an aliquot of the recovered ssDNA was subjected to two test-PCRs: dncl (Figure 2A) and dnc2 (Figure 2B). The amplification profile of the ssDNA recovered after round 3 of SELEX-3 is illustrated in Figure 2A as an example. The fluorescence signal increases over the amplification cycles, before reaching a maximum at cycle 18. The subsequent decrease in fluorescence, previously described as "hook effect", corresponds to the formation of heteroduplexes (Warton et al., 2020). Heteroduplexes, which start to form after depletion of the primers, generally have a lower melting temperature than the full-length PCR products (homoduplexes), as they are composed of only partially complementary sequences. If their melting temperature is lower than the temperature at which the fluorescence signal is measured, they will be dissociated during the measurement. This is reflected in a lower fluorescent signal which causes the hook effect (Warton et al., 2020). In a previous study, this test-PCR only was sufficient to determine the optimal number of amplification cycles, corresponding to the number of cycles before the peak (Kolm et al., 2020). In this study, three reactions were performed in an additional test-PCR (Figure 2B) with the three subsequent number of cycles before the peak (15, 16 and 17 in the example of Figure 2A). This allowed to obtain an independent confirmation of the absence of heteroduplexes after the enrichment PCR. In the case reported in Figure 2B, the cycle right before the peak (17) corresponded to the start of heteroduplex formation, visible as a shorter product on the gel, while after 16 cycles only the specific product (86 bp, homoduplexes) was visible. This led to the decision of using 16 cycles to perform amplification of the recovered ssDNA.

[0146] Monitoring the amount and the diversity of the recovered ssDNA during the SELEX process Advanced tools were applied to monitor the in-vitro selection process allowing to precisely quantify the amount by qPCR (Figure 3) and measure changes in the diversity by melting curves of the recovered ssDNA after each round (Figure 4). Round 1 was excluded from these analyses as all of the recovered ssDNA was amplified for further processing.

[0147] Quantification of the recovered ssDNA was performed by qPCR. With this method, absolute recovered DNA quantities can be determined with high sensitivity (Avci-Adali et al., 2013). Differences in the amount of recovered ssDNA could be observed between different rounds, with concentrations ranging from 107to 109molecules / pL.

[0148] The increase in the amount of bound DNA was reported in literature as an indicator of successful sequence enrichment (Kohlberger and Gadermaier, 2022). However, the amount of recovered DNA does not only depend on the enrichment of certain sequences but also on the selection conditions applied at each round and on the specificity and accessibility of conidia surface targets to the binder sequences present in the ssDNA pool. The decrease of recovered DNA measured at round 4 of SELEX-1 and SELEX-2 might be due to the counter-selection, which was applied starting from this round. However, a similar effect is not visible in SELEX-3, indicating that it is likely a combination of factors, rather than one factor only, to contribute to the number of bound sequences. Moreover, although all the three SELEX experiments were initiated with the same ssDNA library, the sequences randomly present in each aliquot were not the same and most likely led to different enrichment patterns. Round 5 of SELEX-3 yielded a very low amount of DNA (Figure 3A) and in order to obtain enough DNA to continue with round 6 of the SELEX process, additional DNA was obtained by the dilution and further amplification of the already amplified PCR product, introducing a bias in the selection .

[0149] When the same ssDNA pool was applied to A. niger (R9-N) or to A. tubingensis (R9-T), higher concentrations of recovered ssDNA were measured for R9-N in all SELEX experiments. This suggests successful enrichment of A. niger-specific sequences.

[0150] A more effective method to monitor sequence enrichment is based on the analysis of the melting curves, performed on the recovered DNA after PCR amplification (Vanbrabant et al., 2014; Kolm et al., 2020). Melting curves of the three SELEX experiments are reported in Figure 4. Melting curves allow to monitor the formation of homoduplexes, derived from the annealing of two complementary strands of a PCR products. At the beginning of selection, homoduplexes are rare, as most of the sequences are unique. However, if sequence enrichment is successful, homoduplex formation can be observed as a distinct melting peak at around 82°C in the melting profile. Distinct melting peaks started to appear in rounds 7 of SELEX-1 and SELEX-2 and in round 5 of SELEX-3, indicating a decrease in sequence diversity and the appearance of enriched sequences. Melting peaks increased further in subsequent rounds, suggesting further enrichment. However, while this increase appeared gradual in SELEX-1 and SELEX-2, it was abrupt between rounds 5 and 6 of SELEX-3. This is most likely due to the PCR bias introduced in this experiment which led to the loss of sequences present in low abundance while those present in higher copies had a higher chance to be amplified and carried over to the next round. Different peak shapes correspond to changes in nucleotide composition of the analyzed pool (Kolm et al., 2020). Based on the evolution of the melting peaks, the selection was stopped after nine rounds. In SELEX-3, the highest melting peak was reached at round 8, suggesting a loss of potential binders at round 9. Interestingly, melting peaks of round 9-T (selection against A. tubingensis in round 9) were higher than those of round 9-N.

[0151] NGS data analysis and selection of aptamer candidates

[0152] Sequencing data were processed with the previously developed Aptaflow script (Kolm et al., 2020). Graphs showing the sequence enrichment in recovered ssDNA pools over the subsequent SELEX rounds (Figure 5) and a list of the 1,000 most enriched sequences for each round were generated. The total count of individual sequences, representing sequence enrichment, increased during the subsequent rounds in all three performed SELEX experiments, reaching a peak at round 9 in SELEX-1 and SELEX-2 and at round 8 in SELEX-3. The sequencing data confirmed the changes in diversity observed in the melting curves, highlighting the power of combining these two techniques to determine how many SELEX rounds to perform and which rounds to sequence. As already observed in the melting curves, the increased count of enriched sequences in round 9-T (negative selection, performed with A. tubingensis instead of A. niger) might indicate that the incubation of the aptamers with A. tubingensis after selection with A. niger led to a loss of diversity of specific enriched sequences. Only a few sequences were retained by A. tubingensis conidia and these had a higher chance to be amplified at higher rates. This phenomenon is reflected as an apparent increase in sequence enrichment, similar to what observed in round 6 of SELEX-3, which, however, does not correspond to an increase of binder molecules. Therefore, performing negative selection and subsequent analysis of the sequences enriched in such an unspecific round can be a valuable strategy to more easily identify potential binders enriched in the target rounds as well as to remove unspecific sequences from the potential binding candidates. The first selected aptamer candidates were identified from round 8 of SELEX-3, as melting curve analyses, as well as the sequencing data, showed the highest enrichment during this round. Additional 8 potential aptamer candidates were identified from rounds 9 of SELEX-1 and SELEX- 2. Selection was performed on sequences belonging to different clusters, by ranking them based on their prevalence at the selected round and their appearance in earlier rounds. Sequences AN03-R8- AN435, AN03-R9-N-AN070, AN01-R9-095, AN01-R9-105, AN01-R9-115, AN02-R9-099 and AN02-R9-185 were selected because present with higher reads in the positive selection round (R9-N) than in the negative selection round (R9-T). AN03-R8-AN156 was selected as negative control as it showed higher read counts in round 9-T than in any of the rounds performed with A. niger conidia as targets. The minimum free energy and the secondary structure of the selected sequences were predicted using the online tool RNAFold 2.5.1. All 18 selected aptamer candidates with their characteristics and reason for selection are listed in Supplementary Table 1.

[0153] Aptamer identification and impact of the FAM label on the aptamer binding

[0154] The selected aptamer candidates were screened for their capability to bind to A. niger conidia by performing binding assays and subsequent quantification of the recovered ssDNA by qPCR. In a first screening experiment, ten of the selected candidates were ordered with a FAM-label at the 5'end (Figure 6). The quantified DNA was compared to three negative controls: the starting ssDNA library, a labelled random negative control (BA-NC-1) and the AN03-R8-AN156 sequence.

[0155] The ssDNA recovered after most of the binding assays was similar to the amount of ssDNA recovered after incubation of A. niger conidia with either the ssDNA library, the negative control BA-NC-1 or the negative control AN03-R8-AN156. This might be due to the PCR bias introduced in round 6 of SELEX-3, which most likely led to the enrichment of sequences which are more easily amplified but might not bind to the conidia and the concomitant loss of potential binders. However, two candidates, AN03-R8-AN435 and AN03-R9-N-AN070, showed significantly higher recovery rates compared to the negative controls, indicating that they can bind to the target conidia. As a high background could be measured for the negative controls (ssDNA library, BA- NC-1 and AN03-R8-AN156), a second screening was performed with unlabeled aptamer candidates to determine if the FAM-label had an effect on the binding process. To this end, eight aptamer candidates identified in SELEX-1 and SELEX-2 were tested in their unlabeled version and compared to the unlabeled BA-NC-1 (Figure 7). Additionally, labelled and unlabeled versions of aptamer candidates AN01-R9- 006, AN01-R9-115, AN02-R9-099 and AN02-R9-185 and of the negative control BA-NC-1 were compared (Figure 7). Candidates AN01-R9-006, AN01-R9-115, AN02-R9-099 and AN02-R9-185 showed higher recovery rates than the negative control in both versions (labelled and unlabeled). Interestingly, labelled aptamers were associated with higher recovery rates than unlabeled ones. We confirmed that this was not an artifact due to the interference of the FAM fluorescence during the qPCR, but it rather derived from higher binding of the FAM-labelled sequences to conidia of A. niger than the unlabeled counterparts. This suggests that the FAM fluorophore itself interacts with the target cells to a certain extent. Based on the measured recovery rates, aptamers AN03-R8-AN435, AN03-R9- N- AN070, AN01-R9-006, AN01-R9-115, AN02-R9-099 and AN02-R9- 185 were selected for further characterization.

[0156] Aptamer specificity to other Aspergillus species

[0157] To determine whether the selected aptamers can bind to A. niger in a species-specific manner, binding assays were performed with other two Aspergillus species, A. tubingensis and A. nidulans. Based on the qPCR results, all the selected aptamers showed to be species-specific for A. niger (Figure 8A). DNA recovered after incubation with A. niger increased from 2.5 to 17-fold when compared to A. tubingensis and from 7 to 500-fold when compared to A. nidulans. Interestingly, the negative control (BA-NC-1) seems to bind preferentially to the conidia of A. niger than to those of the other two fungal species. This sequence was not present in the sequencing data but it was randomly generated and it is possible that it binds to a certain extent to the conidia of A. niger.

[0158] To confirm successful and species-specific binding, fluorescent measurements were performed on the eluted samples upon binding with three selected aptamers (AN02-R9-185, AN01- R9- 006 and AN02-R9-099) (Figure 8B). Additionally, to avoid the introduction of a bias due to the selection of the random sequence, other two negative controls differing in the unique internal 40 bp region (BA-NC-2 and BA-NC-3) were measured in parallel (Figure 8B).

[0159] Fluorescent measurements confirmed the species-specific binding of the selected aptamers to A. niger conidia. Furthermore, different fluorescent values could be measured when comparing the three different negative controls. The first selected negative control (BA-NC-1) showed the highest binding to A. niger conidia. BA-NC-2 did not bind at all to target conidia and BA-NC-3 only slightly. Therefore, randomly selected sequences have the potential to bind to a certain extent to the target cells. These results highlight the importance of choosing a suitable negative control and suggest that using multiple negative controls should be preferred.

[0160] A. niger and A. tubingensis are phylogenetically closely related, belonging both to the section Nigri of the genus Aspergillus (Visagie et al., 2024). Due to their highly similar phenotype, they can be hardly distinguished based on classical morphological criteria and the use of molecular analyses is crucial for their differentiation (Samson et al., 2007; Susca et al., 2007). The capability of the DNA aptamers developed in this study to distinguish between these closely related species is of high relevance and indicates that these fungi might substantially differ in their surface proteome. These results could open the way to new strategies in the identification and characterization of closely related Aspergillus species.

[0161] Aptamer binding affinity

[0162] The binding affinity of the aptamers AN01-R9-006, AN02-R9-099 and AN02-R9-185 was determined by incubating the A. niger conidia with different concentrations of the corresponding aptamer. The binding curves were obtained by measuring fluorescence after elution (Figure 9).

[0163] KDvalues were calculated for aptamers AN01-R9-006 and AN02-R9- 185. AN01-R9-006 showed a KDof 58.97 nM (95% confidence interval 42.89 - 81.03 nM). AN02-R9-185 showed a KDof 138.71 nM (95% confidence interval 79.65- 255.51 nM). The measured equilibrium dissociation constants are in the range of aptamers previously developed against fungal conidia (Seo et al., 2021) and indicate specific binding on the conidial surface with high affinity. The binding affinity curves indicate that the aptamers interact in a concentrationdependent manner with the A. niger conidia.

[0164] Conclusions

[0165] In this study, whole-cell SELEX was optimized for conidia of A. niger. Next-generation sequencing was performed on the obtained enriched ssDNA pools, allowing the identification of sequences binding with high affinity to A. niger conidia. By introducing counter-selection steps and a negative selection against the closely related Aspergillus species A. tubingensisrspecies-specific aptamers were be obtained. The binding affinity to A. niger conidia of two of the developed aptamers, AN01-R9-006 and AN02-R9-185, was determined to be 58.97 and 138.71 nM, respectively.

[0166] The availability of DNA molecules able to distinguish closely related fungal species and the possibility of potentially developing such aptamers against any Aspergillus species create new opportunities in the fungal research. DNA aptamers could be used to better understand the complex structures constituting the external surface of fungal conidia. Not only the developed aptamers may be implemented as biosensors for quantitative monitoring and detection of fungal conidia, but their species-specificity feature may be exploited for the rapid identification of morphologically identical Aspergillus species in various fields, from clinical to taxonomical applications.

[0167]

[0168] Non-patent references

[0169] Avci-Adali, M., et al. (2013). Absolute Quantification of Cell-Bound DNA Aptamers During SELEX. Nucleic Acid Ther. 23, 125-130.

[0170] Bachtiar, B. M., et al. (2019). RNA aptamers selected against yeast cells inhibit Candida albicans biofilm formation in vitro. Microbiologyopen 8.

[0171] Barratt, R. W., et al. (1965). Wild-Type and mutant stocks of Aspergillus nidulans. Genetics 52, 233-246.

[0172] Blango, M. G., et al. (2019). Conidial surface proteins at the interface of fungal infections. PLOS Pathog. 15, el007939.

[0173] Cairns, T. C., et al. (2021). Something old, something new: challenges and developments in Aspergillus niger biotechnology. Essays Biochem. 65, 213-224.

[0174] Currie, J. N. (1917). The citric acid fermentation of Aspergillus niger. J. Biol. Chem., 15-37.

[0175] Eckhart, L., et al. (2000). Melanin binds reversibly to thermostable DNA polymerase and inhibits its activity. Biochem. Biophys. Res. Commun. 271, 726-730.

[0176] Ellena, V. (2020). Towards a sexual cycle in Aspergillus niger. Dr. thesis.

[0177] Ellington, A. D., et al. (1990). In vitro selection of RNA molecules that bind specific ligands. Nature 346, 818-822.

[0178] Fraczek, M. G., et al. (2019). Fast and reliable PCR amplification from Aspergillus fumigatus spore suspension without traditional DNA extraction. Curr. Protoc. Microbiol. 54.

[0179] Frisvad, J. C., et al. (2018). Safety of the fungal workhorses of industrial biotechnology: update on the mycotoxin and secondary metabolite potential of Aspergillus niger, Aspergillus oryzae, and Trichoderma reesei. Appl. Microbiol. Biotechnol. 102, 9481-9515.

[0180] Garcia-Rubio, R., et al. (2020). The fungal cell wall: Candida, Cryptococcus, and Aspergillus species. Front. Microbiol. 10. Guo, X., et al. (2023). "Nanomaterials-based biosensors against Aspergillus and aspergillosis: Control and diagnostic perspectives".

[0181] Henri, J., et al. (2019). A guide to using nucleic acid aptamers in cell based assays. Aptamers 3, 4-9. Available at: http: / / www.amsbio.com .

[0182] Homann, M., et al. (1999). Combinatorial selection of high affinity RNA ligands to live African trypanosomes. Nucleic Acids Res. 27, 2006-2014.

[0183] Kohlberger, M., et al. (2022). SELEX: Critical factors and optimization strategies for successful aptamer selection. Biotechnol. Appl. Biochem. 69, 1771-1792.

[0184] Kolm, C., et al. (2020). DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing. Sci. Rep. 10, 1-16.

[0185] Krivitsky, V., et al. (2021). Rapid Collection and Aptamer-Based Sensitive Electrochemical Detection of Soybean Rust Fungi Airborne Urediniospores. ACS Sensors.

[0186] Morris, K. N., et al. (1998). High affinity ligands from in vitro selection: Complex targets. Proc. Natl. Acad. Sci. 95, 2902-2907.

[0187] Paulussen, C., et al. (2017). Ecology of aspergillosis: insights into the pathogenic potency of Aspergillus fumigatus and some other Aspergillus species. Microb. Biotechnol. 10, 296-322.

[0188] Samson, R. A., et al. (2007). Diagnostic tools to identify black aspergilli. Stud. Mycol. 59, 129-145.

[0189] Schuster, E., et al. (2002). On the safety of Aspergillus niger - a review. Appl. Microbiol. Biotechnol. 59, 426-435.

[0190] Sefah, K., et al. (2010). Development of DNA aptamers using Cell- SELEX. Nat. Protoc. 5, 1169-1185.

[0191] Seo, J.-W., et al. (2021). Selection and characterization of toxic Aspergillus spore-specific DNA aptamer using spore-SELEX. RSC Adv. 11, 2608-2615. Susca, A., et al. (2007). Polymerase chain reaction (PCR) identification of Aspergillus niger and Aspergillus tubingensis based on the calmodulin gene. Food Addit. Contam. 24, 1154-1160.

[0192] Taniwaki, M. H., et al. (2018). Aspergillus species and mycotoxins: occurrence and importance in major food commodities. Curr. Opin. Food Sci. 23, 38-43.

[0193] Tolle, F., et al. (2014). By-Product Formation in Repetitive PCR Amplification of DNA Libraries during SELEX. PLoS One 9, ell4693.

[0194] Trunzo, N. E., et al. (2020). Recent progress in the identification of aptamers against bacterial origins and their diagnostic applications. Int. J. Mol. Sci. 21, 5074.

[0195] Tuerk, C., et al. (1990). Systematic Evolution of Ligands by Exponential Enrichment: RNA Ligands to Bacteriophage T4 DNA Polymerase. Science 249, 505-510.

[0196] Vanbrabant, J., et al. (2014). Melting curve analysis as a tool for enrichment monitoring in the SELEX process. Analyst 139, 589-595.

[0197] Visagie, C. M., et al. (2024). A review of recently introduced Aspergillus, Penicillium, Talaromyces and other Eurotiales species. Stud. Mycol. 107, 1-286.

[0198] Wang, T., et al. (2019). A Detailed Protein-SELEX Protocol Allowing Visual Assessments of Individual Steps for a High Success Rate. Hum. Gene Ther. Methods 30, 1-16.

[0199] Warton, K., et al. (2020). Target sequence heterogeneity causes the 'hook effect' in fluorescent dye-based quantitative PCR. Biotechniques 69, 80-83.

[0200] Yuan, G., et al. (2023). Rapid and robust squashed spore / colony PCR of industrially important fungi. Fungal Biol. Biotechnol. 10, 15.

[0201] Yuce, M., et al. (2017). How to make nanobiosensors: surface modification and characterisation of nanomaterials for biosensing applications. RSC Adv. 7, 49386-49403.

[0202] Zhang, J., et al. (2016). The filamentous fungal pellet and forces driving its formation. Grit. Rev. Biotechnol. 36, 1066-1077.

Claims

Claims1. An aptamer for binding Aspergillus niger conidia having a sequence selected from the group consisting of:AN03-R9-N-AN070 : tcccagcgcccggagaacacgaggaacgcacctatcacac (SEQID NO: 1)AN03-R8-AN435 : caccaccacgacacacaaccttcccgtgcggacccagcga (SEQID NO: 2)AN01-R9-115 : ccgacatctttgtactagtacgcctccacgaaaacacact (SEQID NO: 3)AN02-R9-099 : cctgagtaactgctcgtactagttcgcctcctcgaattac (SEQID NO: 4)AN02-R9-185 : acttcgcagtctgactagtacgcctccacgaagggtttct (SEQID NO: 5), andAN01-R9-006 : ccggatgctctaccgtactagtacgactccacgaaattat (SEQID NO: 6).

2. The aptamer of claim 1, having the sequence:AN02-R9-185: acttcgcagtctgactagtacgcctccacgaagggtttct (SEQID NO: 5).

3. The aptamer of claim 1, having the sequence:AN01-R9-006 : ccggatgctctaccgtactagtacgactccacgaaattat (SEQID NO: 6).

4. The aptamer of claim 1, having the sequence:AN02-R9-099: cctgagtaactgctcgtactagttcgcctcctcgaattac (SEQID NO: 4).

5. The aptamer of any one of claims 1 to 4, wherein the aptamer is coupled to a detection system.

6. The aptamer of any one of claims 1 to 4, wherein the aptamer is coupled to a fluorescent dye, preferably carboxyfluorescein (FAM).

7. Use of the aptamer of any one of claims 1 to 6 as a biosensor for Aspergillus.

8. Use of claim 7, wherein the aptamer is used in a lateral flow assay.

9. Use of claim 7, wherein the aptamer is used in a flow cytometer or cell sorter.