Novel pres1 derivative compound inhibiting host entry of hepatitis b virus
Second-generation MyrB derivatives with enhanced stability and HBV entry inhibitory activity address the limitations of rapid degradation in existing HBV treatments, providing effective HBV inhibition and suppression.
Patent Information
- Application Number
- PCT/KR2025/009408
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-07-05
- Filing Date
- 2025-07-02
- Publication Date
- 2026-01-08
AI Technical Summary
Current hepatitis B virus (HBV) treatments, such as immunomodulators and nucleotide analogs, have limited efficacy in eradicating cccDNA and HBsAg and cause significant side effects, while existing entry inhibitors like Myrcludex B suffer from rapid degradation by in vivo hydrolytic enzymes, necessitating improved stability for effective HBV inhibition.
Development of second-generation MyrB derivatives with enhanced stability and HBV entry inhibitory activity through macrocyclization, forming cyclic amides to resist enzymatic degradation.
The novel peptides effectively inhibit HBV entry and improve stability in the bloodstream, offering a potential for sustained viral suppression without side effects.
Smart Images

Figure KR2025009408_08012026_PF_FP_ABST
Abstract
Description
A novel PRES1 derivative compound that inhibits host penetration of hepatitis B virus
[0001] The present invention relates to a novel PreS1 derivative compound that inhibits the penetration of hepatitis B virus.
[0002] Hepatitis B virus (HBV) infection is known to be closely associated with an increased risk of liver dysfunction such as hepatocellular cirrhosis and liver cancer. Approximately 250 million people suffer from chronic HBV infection, and approximately 1 million people die from hepatocellular carcinoma caused by chronic HBV infection each year. Immunomodulators (e.g., interferon-α (IFN-α) or pegylated IFN-α) and nucleotide analogs (e.g., tenofovir or entecavir) are commonly prescribed to infected patients, but these treatments cause serious side effects, and even with treatment, their efficacy in eradicating cccDNA (covalently closed circular DNA) and hepatitis B virus surface antigen (HBsAg) is limited. In order to achieve sustained viral suppression without side effects in long-term treatment, the development of alternative treatments is urgent. Recently, through analysis of the life cycle of the hepatitis B virus, entry inhibitors, polymerase inhibitors, capsid assembly inhibitors, and virus secretion inhibitors have been developed, and multifaceted drug combination treatment is being attempted.
[0003] The first step in inhibiting HBV infection is blocking the viral entry step. Targeting this step can block viral infection and transmission at an early stage. The entry inhibitor was designed with inspiration from the L protein and optimized through structure-activity relationship studies. Shorter peptides, truncated to 48 amino acids at the C-terminus, exhibited enhanced inhibitory activity compared to the full-length peptide. When the myristoyl group was removed, the peptide not only exhibited inhibitory activity but also blocked liver accumulation.
[0004] Myrcludex B (MyrB), a 47-amino acid residue derived from the N-terminal PreS1 (surface protein) domain of HBV, is a well-known early entry inhibitor for hepatitis B virus (HBV) and hepatitis delta virus (HDV). MyrB competitively blocks HBV attachment to the same site and exhibits in vitro HBV entry inhibition activity at low concentrations, i.e., picomolar concentrations. In various animal models, including monkeys, dogs, and humanized mice, a reduction in HBV DNA and its accumulation in the liver were observed, demonstrating its in vivo pharmacokinetic and biological profiles.
[0005] A phase 3 clinical trial of MyrB in patients with HBV / HDV co-infection is ongoing. However, the main drawback of MyrB is its linear peptide nature, which makes it rapidly degraded by in vivo hydrolytic enzymes and has poor metabolic stability. Clinical results have shown that MyrB preferentially accumulates in the liver, yet has a half-life of only two hours in patients. Therefore, improving MyrB's proteolytic stability in the bloodstream is essential to extending the dosing interval.
[0006] Accordingly, the inventors of the present invention have studied a drug design strategy capable of improving stability while maintaining HBV entry inhibitory activity, and as a result, have synthesized a second-generation MyrB derivative with significantly improved HBV entry inhibitory activity and whole blood stability compared to linear peptide MyrB, thereby leading to the present invention.
[0007] One object of the present invention is to provide a linear or cyclic peptide represented by the following chemical formula 1 or chemical formula 2.
[0008] Another object of the present invention is to provide a pharmaceutical composition and a food composition for preventing or treating hepatitis virus infection disease, which contain a peptide represented by the following or chemical formula 2 or a pharmaceutically acceptable salt thereof as an active ingredient.
[0009] [Chemical Formula 1]
[0010]
[0011] [Chemical Formula 2]
[0012]
[0013] In the above chemical formulas 1 and 2,
[0014] m is an integer from 10 to 14,
[0015] n is an integer from 1 to 6,
[0016] o is an integer from 1 to 3,
[0017] A is O or NH,
[0018] R1 is a peptide having an amino acid sequence of either SEQ ID NO: 1 or SEQ ID NO: 2,
[0019] R2 is a peptide having an amino acid sequence of any one of sequence numbers 3 to 8,
[0020] R3 is a direct bond or a peptide having an amino acid sequence of any one of SEQ ID NOs. 9 to 15,
[0021] R4 is hydroxy, -NR5R6 or morpholinyl,
[0022] The above R5 and R6 are each independently hydrogen or C1 to C3 alkyl.
[0023] However, the technical problems to be solved by the present invention are not limited to the problems mentioned above, and other problems not mentioned can be clearly understood by those skilled in the art from the description below.
[0024] In one embodiment of the present invention, a peptide represented by the following chemical formula 1, chemical formula 2 or chemical formula 3 is provided:
[0025] [Chemical Formula 1]
[0026]
[0027] [Chemical Formula 2]
[0028]
[0029] In the above chemical formulas 1 and 2,
[0030] m is an integer from 10 to 14,
[0031] n is an integer from 1 to 6,
[0032] o is an integer from 1 to 3,
[0033] A is O or NH,
[0034] R1 is a peptide having an amino acid sequence of either SEQ ID NO: 1 or SEQ ID NO: 2,
[0035] R2 is a peptide having an amino acid sequence of any one of sequence numbers 3 to 8,
[0036] R3 is a direct bond or a peptide having an amino acid sequence of any one of SEQ ID NOs. 9 to 15,
[0037] R4 is hydroxy, -NR5R6 or morpholinyl,
[0038] The above R5 and R6 are each independently hydrogen or C1 to C3 alkyl.
[0039]
[0040] The peptide represented by the chemical formula 1 of the present invention may be any one of peptides 1 to 4 and 6 in the manufacturing examples of Table 1 in the present specification, and the peptide represented by the chemical formula 2 of the present invention may be any one of peptides 5, 7, 8 to 18 in the manufacturing examples of Table 1 in the present specification.
[0041]
[0042] In the peptide represented by the above chemical formula 1 of the present invention, m is an integer of 12, R1 is a peptide having an amino acid sequence of SEQ ID NO: 1, R2 is a peptide having an amino acid sequence of SEQ ID NO: 3 or 4, R3 is a peptide having an amino acid sequence of any one of SEQ ID NOs: 9 to 12, and R4 may be a hydroxy peptide, but is not limited thereto.
[0043] In one specific example of the present invention, among the peptides represented by the chemical formula 1, peptide 1 is a linear peptide, in the chemical formula 1, m is an integer of 12, R1 is a peptide having an amino acid sequence of SEQ ID NO: 1, R2 is a peptide having an amino acid sequence of SEQ ID NO: 3, R3 is a peptide having an amino acid sequence of SEQ ID NO: 12, and R4 may be a hydroxyl peptide, but is not limited thereto.
[0044] In another specific example of the present invention, among the peptides represented by the chemical formula 1, peptide 2 is a linear peptide, in which m in the chemical formula 1 is an integer of 12, R1 is a peptide having an amino acid sequence of SEQ ID NO: 1, R2 is a peptide having an amino acid sequence of SEQ ID NO: 4, R3 is a peptide having an amino acid sequence of SEQ ID NO: 12, and R4 may be a hydroxyl peptide, but is not limited thereto.
[0045] In another specific example of the present invention, among the peptides represented by the chemical formula 1, peptide 3 is a linear peptide, wherein in the chemical formula 1, m is an integer of 12, R1 is a peptide having an amino acid sequence of SEQ ID NO: 1, R2 is a peptide having an amino acid sequence of SEQ ID NO: 3, R3 is a peptide having an amino acid sequence of SEQ ID NO: 10, and R4 may be a hydroxyl peptide, but is not limited thereto.
[0046] In another specific example of the present invention, among the peptides represented by the chemical formula 1, peptide 4 is a linear peptide, wherein in the chemical formula 1, m is an integer of 12, R1 is a peptide having an amino acid sequence of SEQ ID NO: 1, R2 is a peptide having an amino acid sequence of SEQ ID NO: 3, R3 is a peptide having an amino acid sequence of SEQ ID NO: 9, and R4 may be a hydroxyl peptide, but is not limited thereto.
[0047] In another specific example of the present invention, among the peptides represented by the chemical formula 1, peptide 6 is a linear peptide, wherein in the chemical formula 1, m is an integer of 12, R1 is a peptide having an amino acid sequence of SEQ ID NO: 1, R2 is a peptide having an amino acid sequence of SEQ ID NO: 3, R3 is a peptide having an amino acid sequence of SEQ ID NO: 11, and R4 may be a hydroxyl peptide, but is not limited thereto.
[0048]
[0049] In the peptide represented by the above chemical formula 2 of the present invention, m is an integer of 10 to 14, n is an integer of 1 to 6, o is an integer of 1 to 3, A is O or NH, R1 is a peptide having an amino acid sequence of SEQ ID NO: 1 or 2, R2 is a peptide having an amino acid sequence of any one of SEQ ID NOs: 3 to 8, R3 is a direct bond or a peptide having an amino acid sequence of any one of SEQ ID NOs: 9 to 15, R4 is hydroxy, -NR5R6 or morpholinyl, and R5 and R6 may each independently be hydrogen or a C1 to C3 alkyl peptide, but are not limited thereto.
[0050] In the peptide represented by the chemical formula 2 of the present invention, the sum of n and o may be 2 to 9, and may be specifically characterized as being 2 to 8, but is not limited thereto.
[0051] In one specific example of the present invention, among the peptides represented by the chemical formula 2, peptide 5 is a cyclic peptide, and in the chemical formula 1, m is an integer of 12, n is 4, o is 1, A is O, R1 is a peptide having an amino acid sequence of SEQ ID NO: 1, R2 is a peptide having an amino acid sequence of SEQ ID NO: 5, R3 is a direct bond, and R4 is a hydroxyl peptide, but is not limited thereto.
[0052] In another specific example of the present invention, among the peptides represented by the above chemical formula 2, peptide 7 is a cyclic peptide, and in the above chemical formula 1, m is an integer of 12, n is 1, o is 1, A is O, R1 is a peptide having an amino acid sequence of SEQ ID NO: 1, R2 is a peptide having an amino acid sequence of SEQ ID NO: 3, R3 is a peptide having an amino acid sequence of SEQ ID NO: 11, and R4 may be a hydroxyl peptide, but is not limited thereto.
[0053] In another specific example of the present invention, among the peptides represented by the above chemical formula 2, peptide 8 is a cyclic peptide, wherein in the above chemical formula 2, m is an integer of 12, n is 4, o is 1, A is NH, R1 is a peptide having an amino acid sequence of SEQ ID NO: 1, R2 is a peptide having an amino acid sequence of SEQ ID NO: 7, R3 is a peptide having an amino acid sequence of SEQ ID NO: 11, and R4 may be a hydroxyl peptide, but is not limited thereto.
[0054] In another specific example of the present invention, among the peptides represented by the above chemical formula 2, peptide 9 is a cyclic peptide, wherein in the above chemical formula 2, m is an integer of 12, n is 1, o is 1, A is NH, R1 is a peptide having an amino acid sequence of SEQ ID NO: 1, R2 is a peptide having an amino acid sequence of SEQ ID NO: 8, R3 is a peptide having an amino acid sequence of SEQ ID NO: 11, and R4 may be a hydroxyl peptide, but is not limited thereto.
[0055] In another specific example of the present invention, among the peptides represented by the above chemical formula 2, peptide 10 is a cyclic peptide, wherein in the above chemical formula 2, m is an integer of 12, n is 4, o is 1, A is NH, R1 is a peptide having an amino acid sequence of SEQ ID NO: 2, R2 is a peptide having an amino acid sequence of SEQ ID NO: 6, R3 is a peptide having an amino acid sequence of SEQ ID NO: 11, and R4 may be a hydroxyl peptide, but is not limited thereto.
[0056] In another specific example of the present invention, among the peptides represented by the above chemical formula 2, peptide 11 is a cyclic peptide, in which in the above chemical formula 2, m is an integer of 12, n is 4, o is 1, A is NH, R1 is a peptide having an amino acid sequence of SEQ ID NO: 2, R2 is a peptide having an amino acid sequence of SEQ ID NO: 6, R3 is a peptide having an amino acid sequence of SEQ ID NO: 11, and R4 is -NH2, but is not limited thereto.
[0057] In another specific example of the present invention, among the peptides represented by the above chemical formula 2, peptide 12 is a cyclic peptide, wherein in the above chemical formula 2, m is an integer of 12, n is 4, o is 1, A is NH, R1 is a peptide having an amino acid sequence of SEQ ID NO: 2, R2 is a peptide having an amino acid sequence of SEQ ID NO: 6, R3 is a peptide having an amino acid sequence of SEQ ID NO: 13, and R4 may be a hydroxyl peptide, but is not limited thereto.
[0058] In another specific example of the present invention, among the peptides represented by the above chemical formula 2, peptide 13 is a cyclic peptide, in which in the above chemical formula 2, m is an integer of 12, n is 4, o is 1, A is NH, R1 is a peptide having an amino acid sequence of SEQ ID NO: 2, R2 is a peptide having an amino acid sequence of SEQ ID NO: 6, R3 is a peptide having an amino acid sequence of SEQ ID NO: 13, and R4 is -NH2, but is not limited thereto.
[0059] In another specific example of the present invention, among the peptides represented by the above chemical formula 2, peptide 14 is a cyclic peptide, and in the above chemical formula 2, m is an integer of 12, n is 4, o is 1, A is NH, R1 is a peptide having an amino acid sequence of SEQ ID NO: 2, R2 is a peptide having an amino acid sequence of SEQ ID NO: 6, R3 is a direct bond, and R4 is -NH2, but is not limited thereto.
[0060] In another specific example of the present invention, among the peptides represented by the above chemical formula 2, peptide 15 is a cyclic peptide, in which in the above chemical formula 2, m is an integer of 12, n is 4, o is 1, A is NH, R1 is a peptide having an amino acid sequence of SEQ ID NO: 2, R2 is a peptide having an amino acid sequence of SEQ ID NO: 6, R3 is a peptide having an amino acid sequence of SEQ ID NO: 14, and R4 is -NH2, but is not limited thereto.
[0061] In another specific example of the present invention, among the peptides represented by the above chemical formula 2, peptide 16 is a cyclic peptide, in which in the above chemical formula 2, m is an integer of 12, n is 4, o is 1, A is NH, R1 is a peptide having an amino acid sequence of SEQ ID NO: 2, R2 is a peptide having an amino acid sequence of SEQ ID NO: 6, R3 is a peptide having an amino acid sequence of SEQ ID NO: 15, and R4 is -NH2, but is not limited thereto.
[0062] In another specific example of the present invention, among the peptides represented by the above chemical formula 2, peptide 17 is a cyclic peptide, wherein in the above chemical formula 2, m is an integer of 12, n is 4, o is 1, A is NH, R1 is a peptide having an amino acid sequence of SEQ ID NO: 2, R2 is a peptide having an amino acid sequence of SEQ ID NO: 6, R3 is a peptide having an amino acid sequence of SEQ ID NO: 14, R4 is - NR5R6, and R5 and R6 may each independently be a C2 alkyl peptide, but are not limited thereto.
[0063] In another specific example of the present invention, among the peptides represented by the above chemical formula 2, peptide 18 is a cyclic peptide, wherein in the above chemical formula 2, m is an integer of 12, n is 4, o is 1, A is NH, R1 is a peptide having an amino acid sequence of SEQ ID NO: 2, R2 is a peptide having an amino acid sequence of SEQ ID NO: 6, R3 is a peptide having an amino acid sequence of SEQ ID NO: 14, and R4 may be a peptide that is morpholinyl, but is not limited thereto.
[0064] The amino acid sequence numbers 1 to 18 constituting the peptide of the present invention are shown in Table 1 below.
[0065] Sequence Amino Acid Sequence Sequence No. 1 GQNL Sequence No. 2 GTNL Sequence No. 3 STSNPLGFFPD Sequence No. 4 STSNPLGFFPE Sequence No. 5 STSNPLGFFPDHQLD Sequence No. 6 KVPNPLGFFPD Sequence No. 7 KTSNPLGFFPD Sequence No. 8 DprTSNPLGFFPD Sequence No. 9 HQLD Sequence No. 10 HQLDPA Sequence No. 11 H*QLDPA Sequence No. 12 HQLDPAFRANS Sequence No. 13 R*QLDPA Sequence No. 14 R*QLDP Sequence No. 15 R*QLDp Wherein, H* is N-methyl-histidine, Dpr is diaminopropionic acid, and R* is N-methyl-arginine. Lowercase p stands for D-proline.
[0066]
[0067] In another embodiment of the present invention, a pharmaceutical composition for preventing or treating hepatitis virus infection disease is provided, comprising a peptide represented by the following chemical formula 1 or chemical formula 2 or a pharmaceutically acceptable salt thereof as an active ingredient:
[0068] [Chemical Formula 1]
[0069]
[0070] [Chemical Formula 2]
[0071]
[0072] In the chemical formula of the present invention, the contents and sequence numbers for each of m, n, o, R1, R2, R3, and R4 are the same as those described above, and are omitted to avoid excessive complexity of the present specification.
[0073] In the present invention, the pharmaceutically acceptable salt may include an acid or base addition salt. For example, the compound may be in the form of an organic or inorganic acid addition salt. The salt may include, but is not limited to, any salt that has a desired effect on the patient when administered to the patient and maintains the activity of the parent compound. These salts include inorganic and organic salts, such as acetic acid, nitric acid, aspartic acid, sulfonic acid, sulfuric acid, maleic acid, glutamic acid, formic acid, succinic acid, phosphoric acid, phthalic acid, tannic acid, tartaric acid, hydrobromic acid, propionic acid, benzenesulfonic acid, benzoic acid, stearic acid, lactic acid, bicarboxylic acid, bisulfuric acid, bitartaric acid, oxalic acid, butyric acid, calcium idet, carbonic acid, chlorobenzoic acid, citric acid, idetic acid, toluenesulfonic acid, fumaric acid, gluceptic acid, esilic acid, pamoic acid, gluconic acid, methyl nitrate, malonic acid, hydrochloric acid, hydroiodoic acid, hydroxynaphtholic acid, isethionic acid, lactobionic acid, mandelic acid, mucic acid, napsylic acid, muconic acid, p-Nitromethanesulfonic acid, hexamic acid, pantothenic acid, monohydrogenphosphoric acid, dihydrogenphosphoric acid, salicylic acid, sulfamic acid, sulfanilinic acid, methanesulfonic acid, etc. The addition salts of bases may include salts of alkali metals or alkaline earth metals, such as salts of ammonium, lithium, sodium, potassium, magnesium, calcium, etc.; salts with organic bases, such as salts of benzathine, N-methyl-D-glucamine, hydrabamine, etc.; and salts with amino acids, such as arginine, lysine, etc. In addition, these salts can be converted into free forms by treatment with an appropriate base or acid.
[0074] The compound represented by Chemical Formula 1 or Chemical Formula 2 of the present invention can very effectively prevent, improve, or treat hepatitis virus infection diseases. The composition of the present invention can be very effectively used for the prevention, improvement, or treatment of hepatitis virus infection diseases because it can inhibit the entry of the virus in the early stage of hepatitis virus infection by inhibiting degradation by in vivo hydrolytic enzymes.
[0075] The "hepatitis virus" of the present invention is a virus that causes hepatitis, and has been reported to include hepatitis A virus (HAV), hepatitis B virus (HBV), hepatitis C virus (HCV), hepatitis D virus (HDV), hepatitis E virus (HEV), hepatitis G virus (HGV), etc.
[0076] The "hepatitis B virus (HBV)" of the present invention is a small enveloped DNA virus belonging to the Hepadnaviridae family. The 3.2-kb double-stranded DNA and viral DNA polymerase are surrounded by a nucleocapsid protein (HBcAg), and this particle is surrounded by a surface protein (HBsAg). Entry by enveloped viruses is generally mediated through specific interactions between the viral surface and cell receptors on the cell surface, which induce membrane fusion or endocytosis. HBV is known to invade hepatocytes through two steps, each involving rough binding and tight binding. The virus attaches to the hepatocyte surface through rough attachment mediated by heparan sulfate proteoglycans (HSPGs), followed by tight binding to sodium taurocholate cotransporting polypeptide (NTCP), inducing endocytosis-mediated internalization. NTCP, a bile acid transporter specifically expressed on the hepatocyte surface, has been identified as a receptor to which HBV tightly binds. The HBV surface protein is composed of three units called small (S), middle (M), and large (L) surface proteins. The S protein contains the S domain, which is involved in rough interaction with HSPGs, and the M protein contains PreS2 and S domains. The L protein is composed of PreS1, PreS2, and S domains, and the N-terminus of the PreS1 domain of the L protein mediates tight binding of HBV to NTCP.
[0077] The hepatitis virus of the present invention may be at least one selected from the group consisting of hepatitis A virus (HAV), hepatitis B virus (HBV), hepatitis C virus (HCV), hepatitis D virus (HDV), hepatitis E virus (HEV), hepatitis G virus (HGV), Epstein-Barr virus, and cytomegalovirus (CMV), but is not limited thereto.
[0078] The hepatitis virus infection disease of the present invention may include all diseases and complications that are directly or indirectly caused by infection with a hepatitis virus, and may specifically be hepatitis, liver cirrhosis, or hepatocellular carcinoma, but is not limited thereto as long as it corresponds to a disease that is directly or indirectly caused by infection with a hepatitis virus.
[0079] The above "prevention" of the present invention may include, without limitation, an act of blocking, suppressing or delaying symptoms caused by infection with a hepatitis virus using the composition of the present invention.
[0080] The above “improvement” of the present invention may include, without limitation, any act that improves or benefits symptoms caused by infection with a hepatitis virus by using the composition of the present invention.
[0081] The above "treatment" of the present invention may include, without limitation, any act in which symptoms caused by infection with a hepatitis virus are improved or beneficial by using the composition of the present invention.
[0082] The compositions of the present invention can be implemented as pharmaceutical compositions or food compositions.
[0083] The pharmaceutical composition of the present invention may be characterized as being in the form of a capsule, tablet, granule, injection, ointment, powder or beverage, and the pharmaceutical composition may be characterized as being intended for humans.
[0084] In the present invention, the pharmaceutical composition is not limited to these, but may be formulated and used in the form of oral dosage forms such as powders, granules, capsules, tablets, aqueous suspensions, etc., external preparations, suppositories, and sterile injection solutions, respectively, according to conventional methods. The pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier may include a binder, a lubricant, a disintegrant, an excipient, a solubilizer, a dispersant, a stabilizer, a suspending agent, a pigment, a fragrance, etc. for oral administration, and may include a mixture of buffers, preservatives, analgesics, solubilizers, isotonic agents, stabilizers, and stabilizers for injections, and may include a base, excipients, lubricants, and preservatives for topical administration.
[0085] The pharmaceutical composition of the present invention can be prepared in various forms by mixing it with a pharmaceutically acceptable carrier as described above. For example, for oral administration, it can be prepared in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc., and for injections, it can be prepared in the form of unit dose ampoules or multiple doses. In addition, it can be formulated as a solution, suspension, tablet, capsule, sustained-release preparation, etc.
[0086] Examples of carriers, excipients, and diluents suitable for the formulation of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, or mineral oil. In addition, fillers, anticoagulants, lubricants, wetting agents, fragrances, emulsifiers, preservatives, and the like may be additionally included.
[0087] The routes of administration of the pharmaceutical composition of the present invention include, but are not limited to, oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual, or rectal. Oral or parenteral administration is preferred. In the present invention, the term "parenteral" includes subcutaneous, intradermal, intravenous, intramuscular, intraarticular, intrasynovial, intrasternal, intrathecal, intralesional, and intracranial injection or infusion techniques.
[0088] The pharmaceutical composition of the present invention may vary depending on various factors including the activity of the specific compound used, age, body weight, general health, sex, dosage form, administration time, administration route, excretion rate, drug combination, and severity of the specific disease to be prevented or treated, and the dosage of the pharmaceutical composition may vary depending on the patient's condition, body weight, degree of disease, form of medicine, administration route, and period, but may be appropriately selected by those skilled in the art, and may be administered at 0.0001 to 50 mg / kg or 0.001 to 50 mg / kg per day. The administration may be administered once a day or divided into several times. The dosage does not limit the scope of the present invention in any way. The pharmaceutical composition according to the present invention may be formulated as a pill, a dragee, a capsule, a liquid, a gel, a syrup, a slurry, or a suspension.
[0089] The food composition of the present invention can be manufactured in the form of various foods, such as beverages, gum, tea, vitamin complexes, powders, granules, tablets, capsules, confectionery, rice cakes, bread, etc.
[0090] When the compound of the present invention is included in a food composition as an active ingredient, the amount may be added in a ratio of 0.1 to 50% of the total weight, but is not limited thereto.
[0091] When the food composition of the present invention is manufactured in the form of a beverage, there are no special limitations other than including the food composition in the indicated ratio, and various flavoring agents or natural carbohydrates, etc. may be contained as additional ingredients like in a typical beverage. Specifically, the natural carbohydrates may include monosaccharides such as glucose, disaccharides such as fructose, sucrose, and other polysaccharides, dextrin, cyclodextrin, and other typical sugars, and sugar alcohols such as xylitol, sorbitol, and erythritol. The flavoring agents may include natural flavoring agents (thaumatin, stevia extracts (e.g., rebaudioside A, glycyrrhizin, etc.)) and synthetic flavoring agents (saccharin, aspartame, etc.).
[0092] The food composition of the present invention may further include various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavoring agents and natural flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, pH regulators, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc.
[0093] The ingredients included in the food composition of the present invention may be used independently or in combination. The proportion of the additives is not a key element of the present invention, but may be selected within the range of 0.1 to about 50 parts by weight per 100 parts by weight of the food composition of the present invention, but is not limited thereto.
[0094]
[0095] According to another embodiment of the present invention, a method for preventing, improving or treating a hepatitis virus infection disease is provided, comprising administering to a subject in need of administration an effective amount of a composition comprising a peptide represented by the following chemical formula 1 or chemical formula 2 or a pharmaceutically acceptable salt thereof as an active ingredient:
[0096] [Chemical Formula 1]
[0097]
[0098] [Chemical Formula 2]
[0099]
[0100] In the chemical formula of the present invention, the contents of each of m, n, o, R1, R2, R3, and R4, the sequence number, the viral infection disease, etc. are the same as those described above, and are omitted to avoid excessive complexity of the present specification.
[0101] In the present invention, the term “administration” means providing a predetermined composition of the present invention to a subject by any appropriate method.
[0102] In the present invention, the "subject" requiring the administration may include both mammals and non-mammals. Here, examples of mammals include, but are not limited to, humans, non-human primates such as chimpanzees, other apes, or monkey species; livestock animals such as cows, horses, sheep, goats, and pigs; farmed animals such as rabbits, dogs, or cats; and laboratory animals such as rodents such as rats, mice, or guinea pigs. In addition, examples of non-mammals in the present invention may include, but are not limited to, birds or fish.
[0103] The peptides included as active ingredients in the composition of the present invention can be combined with a carrier to enhance the efficacy of treating hepatitis virus infection. Any carrier that is biocompatible and capable of achieving the desired effects of the present invention may be used without limitation. Examples include, but are not limited to, serum albumin, peptides, immunoglobulins, hemocyanins, and polysaccharides.
[0104] In the present invention, the formulation of the composition administered as described above is not particularly limited, and may be administered as a solid formulation, a liquid formulation, or an aerosol formulation for inhalation, and may be administered as a solid formulation intended to be converted into a liquid formulation for oral or parenteral administration immediately before use, and may be administered by being formulated in the form of, for example, oral formulations such as powders, granules, capsules, tablets, and aqueous suspensions, external preparations, suppositories, and sterile injectable solutions, but is not limited thereto.
[0105] In addition, in the present invention, an adjuvant may be further added together with the composition of the present invention during the administration, and any adjuvant known in the art as a pharmaceutical or immunological substance may be used without limitation. For example, sugars or amino acids may be used as stabilizers, and mineral oil, vegetable oil, alum, aluminum phosphate, bentonite, silica, muramyl dipeptide derivatives, thymosin, interleukin, etc. may be used as adjuvants.
[0106] In addition, in the present invention, a pharmaceutically acceptable carrier may be additionally administered together with the composition of the present invention during the administration. Here, the pharmaceutically acceptable carrier may include a binder, a lubricant, a disintegrant, an excipient, a solubilizer, a dispersant, a stabilizer, a suspending agent, a pigment, a fragrance, etc. for oral administration, and may include a mixture of a buffer, a preservative, an analgesic, a solubilizer, an isotonic agent, a stabilizer, etc. for injections, and may include a base, an excipient, a lubricant, a preservative, etc. for topical administration. The formulation of the composition of the present invention may be prepared in various ways by mixing it with the pharmaceutically acceptable carrier described above. For example, the composition may be prepared in the form of a tablet, troche, capsule, elixir, suspension, syrup, wafer, etc. for oral administration, and may be prepared in the form of a unit dosage ampoule or a multiple dosage form for injections. It can be formulated as a solution, suspension, tablet, capsule, sustained-release preparation, etc.
[0107] Meanwhile, examples of carriers, excipients, and diluents suitable for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, malditol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, or mineral oil. In addition, fillers, anticoagulants, lubricants, wetting agents, fragrances, emulsifiers, preservatives, and the like may be additionally included.
[0108] Routes of administration of the composition according to the present invention include, but are not limited to, oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual, or rectal. Oral or parenteral administration is preferred.
[0109] In the present invention, "parenteral" includes subcutaneous, intradermal, intravenous, intramuscular, intraarticular, intrasynovial, intrasternal, intrathecal, intralesional, and intracranial injection or infusion techniques. The composition of the present invention may also be administered in the form of a suppository for rectal administration.
[0110] As used herein, a "pharmaceutically effective amount" refers to a sufficient amount of an agent to produce a desired biological result. This result may be a reduction and / or alleviation of the signs, symptoms, or causes of a disease, or any other desired alteration in a biological system. For example, an "effective amount" for preventive or therapeutic use is the amount of a composition disclosed herein required to produce a clinically significant reduction in a disease. An appropriate "effective" amount in any individual case can be determined by one skilled in the art using routine experimentation. Accordingly, the expression "effective amount" generally refers to an amount of an active agent that has a therapeutic effect. In the present invention, the active agent is a peptide represented by Chemical Formula 1 or Chemical Formula 2, or a pharmaceutically acceptable salt thereof, and is an agent for the prevention, improvement, or treatment of a hepatitis virus infection disease.
[0111] The composition of the present invention may vary depending on various factors including the activity of the active ingredient used, age, body weight, general health, sex, diet, administration time, administration route, excretion rate, drug combination, and severity of the specific disease to be prevented or treated, and the dosage of the composition may vary depending on the patient's condition, body weight, degree of disease, drug form, administration route, and period, but may be appropriately selected by those skilled in the art, and may be administered at 0.0001 to 100 mg / kg or 0.001 to 100 mg / kg per day. Administration may be administered once a day or divided into several times. The dosage does not limit the scope of the present invention in any way. The composition according to the present invention may be formulated as a pill, a dragee, a capsule, a liquid, a gel, a syrup, a slurry, or a suspension.
[0112] The composition of the present invention may be used alone or in combination with methods using surgery, hormone therapy, chemotherapy, and biological response modifiers.
[0113]
[0114] Another embodiment of the present invention provides a method for improving the stability of a drug.
[0115] In the present invention, the method may include a step of obtaining a drug for stabilization; and a step of forming a macrocycle by forming a cyclic amide on at least two amino acids among the amino acid sequences included in the drug.
[0116] In the present invention, the cyclic amide may be a cyclic amide cyclized through lactamization or lactonization, and specifically, may be a cyclic amide cyclized through lactamization, but is not limited thereto.
[0117] In the present invention, the cyclic amide is characterized by including N-methylation, C-term modification, or a combination thereof at an amino acid residue adjacent to an amino acid participating in cyclization.
[0118] In the present invention, the lactamization or lactonization ring in the cyclic amide may be composed of 5 to 9 ring atoms, specifically 6 to 8 ring atoms, and most specifically 7 ring atoms, but is not limited thereto.
[0119] In the present invention, the ring atom of lactamization or lactonization means a carbon or hetero atom participating in lactam or lactone cyclization for a linear peptide (e.g., R2 of the above chemical formula 2), and the atoms constituting the peptide that is the target of cyclization (e.g., R2 of the above chemical formula 2) are excluded from the number of lactamization or lactonization ring atoms.
[0120] In the present invention, the drug targeted for stabilization may be at least one selected from the group consisting of a virus entry inhibitor, a cccDNA-targeting drug, a nucleocapsid inhibitor, a polymerase inhibitor, an HBsAg inhibitor, and an immunosuppressant, and may be specifically a virus entry inhibitor, but is not limited thereto.
[0121] In the present invention, the viral entry inhibitor may be at least one selected from the group consisting of Myrcludex B (MyrB), Cyclosporin A, and Ezetimibe, and specifically may be the drug Myrcludex-B (MyrB), but is not limited thereto.
[0122] In the present invention, the above-mentioned "Myrcludex B (MyrB)" drug is a drug that irreversibly inhibits the NTCP receptor and blocks the hepatitis B virus from invading liver cells. Myrcludex B, composed of 47 amino acids derived from the N-terminus of the PreS1 (surface protein) domain, which is a surface protein of HBV, is well known as an early entry inhibitor for hepatitis B virus (HBV) and hepatitis delta virus (HDV), but has the problem of being rapidly decomposed by in vivo hydrolytic enzymes because it is a linear peptide.
[0123] The method of the present invention has discovered a macrocyclization method as a drug design strategy for improving the stability of the drug, and the macrocyclization can be performed through lactamization or lactonization, and the cyclic amide includes N-methylation, C-term modification, or a combination thereof of amino acids adjacent to amino acids participating in the cyclization, thereby significantly reducing the decomposition of the drug by body hydrolytic enzymes and maximizing the effect of inhibiting the invasion of hepatitis viruses.
[0124] The novel peptide according to the present invention can be very effectively used for the prevention, improvement or treatment of hepatitis B virus infection diseases by very effectively inhibiting the host penetration of hepatitis B virus.
[0125] FIG. 1 is a diagram showing the results of confirming the in vitro HBV entry inhibition activity of PreS1 derivatives (MyrB-old and peptides 6 to 9) according to one embodiment of the present invention.
[0126] Figure 2 is a diagram showing the results of monitoring for up to 24 hours for peptides 6 to peptide 9 to confirm whole blood stability according to one embodiment of the present invention.
[0127] Figure 3 shows the sequences of (a) PreS / 2-48Myr (MyrB-old) and Myrcludex B (MyrB) according to one embodiment of the present invention and (b) the second library (2) of PreS1 derivatives (peptides 10 to 13). nd The basic sequence is designed as a library, and the result is modified according to the sequence of MyrB.
[0128] FIG. 4 is a diagram showing the results of confirming in vitro HBV entry inhibition activity for (a) a control group (MyrB-old, peptide 8, and MyrB) and PreS1 derivatives (peptides 10 to peptide 13) according to one embodiment of the invention, and (b) the results of confirming HBV entry inhibition activity in a lower range (0-2.5 nM) of peptides 12 and 13.
[0129] Figure 5 is a diagram showing the results of confirming the stability of rat whole blood for MyrB and peptide 13 according to one embodiment of the present invention.
[0130] FIG. 6 is a diagram showing the results of administering peptide 13 via subcutaneous injection at 1 mg / kg using a humanized mouse model to evaluate the in vivo HBV entry inhibition efficacy of peptide 13 according to one embodiment of the present invention, and confirming (a) serum HBV DNA, (b) intracellular cccDNA, (c) HBsAg, and (d) HBeAg.
[0131] FIG. 7 is a diagram showing the results of an in vivo pharmacokinetic study (PK study) performed on a mouse intravenously injected with peptide 13 according to one embodiment of the present invention.
[0132] FIG. 8 is a diagram illustrating (a) an analysis of an immune response induced by MyrB or peptide 13 without an adjuvant for the evaluation of immunotoxicity of peptide 13 (DL-5-99) when no adjuvant is used according to one embodiment of the present invention, (b) measuring the body weight of mice every three days according to a subcutaneous injection schedule, and (c) analyzing the immune response through flow cytometry, and comparing the results between groups using Kruskal-Wallis statistics.
[0133] FIG. 9 is a diagram illustrating an analysis of an immune response induced by (a) MyrB or peptide 13 and an adjuvant for evaluating the immunotoxicity of peptide 13 (DL-5-99) when administered in combination with an adjuvant according to one embodiment of the present invention, (b) measuring the body weight of mice every three days according to a subcutaneous injection schedule, and (c) analyzing the immune response using flow cytometry. The results are compared between groups using Kruskal-Wallis statistics.
[0134] FIG. 10 is a diagram showing the results of analysis of antibodies induced by MyrB or peptide 13 for antigenicity evaluation of peptide 13 (DL-5-99) according to one embodiment of the present invention.
[0135] Figure 11 is a third library (3) of peptide 13 derivatives (peptide 14 to peptide 18) according to one embodiment of the present invention. rd This is a diagram showing the results of designing a library.
[0136] FIG. 12 is a diagram comparing the in vitro entry inhibitory activity of MyrB, peptide 13 (DL-5-99) or various derivative compounds according to one embodiment of the present invention.
[0137] [Revised 30.07.2025 under Rule 91] Figure 13 is a diagram comparing the in vitro entry inhibitory activity of MyrB, peptide 13 (DL-5-99), or derivative compound peptide 18 (DL-7143) according to one embodiment of the present invention. Figures 14 and 15 are diagrams showing HPLC chromatogram results according to one embodiment of the present invention.
[0138] Hereinafter, the present invention will be described in more detail through examples. These examples are intended solely to illustrate the present invention more specifically, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples, in accordance with the gist of the present invention.
[0139]
[0140] Example
[0141] [Preparation Example] Preparation of materials and equipment
[0142] Preparation of materials
[0143] Reagents and solvents were used without further purification. Rink amide MBHA resin, 2-chlorotrityl resin, Fmoc-D-Pro-OH, Fmoc-Lys(Alloc)-OH, and PyBOP were purchased from Novabiochem (Darmstadt, Germany). HOAt and Fmoc-Asp(OAll) were purchased from Advanced ChemTech (Louisville, KY, USA). HATU and amino acids were purchased from Chem-Impex International, Inc. (Wood Dale, IL, USA). TFA and DMF (> 99.9%, peptide synthesis grade) were purchased from Acros Organics (Fair Lawn, NJ, USA). 2,4,6-Collidine, phenylsilane, and 2-nitrobenzenesulfonyl chloride were purchased from Alfa Aesar (Ward Hill, MA, USA). Acetonitrile (HPLC grade) was purchased from Fisher Scientific (Waltham, MA, USA). DIEA and morpholine were purchased from Tokyo Chemical Industry (Tokyo, Japan). All other reagents and solvents were purchased from Sigma-Aldrich (St. Louis, MO, USA). Empty cartridges, frits, and cap plugs were purchased from Applied Separations (Allentown, PA, USA). Micrococcal nuclease (M0247) was purchased from New England BioLabs (Ipswich, MA, USA). The G-spinTM total kit (14067) was purchased from iNtRON (Seongnam, Korea). Cysteine-containing MyrB and cysteine-containing peptide 13 were purchased from Anygen (Gwangju, Korea).
[0144] Preparing the device
[0145] Analytical HPLC was performed on a Waters HPLC system (Waters 2489 UV-Vis detector, Waters 1525 binary HPLC pump, Waters 2707 autosampler, and Water 5CH column oven) equipped with a C18 column (SunFire, C18, 4.6 Y 250 mm, 5 μm). The column oven temperature was set at 40 °C, and the binary mobile phases used were as follows: (A, water with 0.1% CF3COOH; B, CH3CN with 0.1% CF3COOH; flow rate, 1 mL / min), with a linear gradient of 10% B over 0–5 min, 5–25 min to 100% B, and 100% B over 25–30 min. Compounds were monitored at 220 nm and 254 nm.
[0146] Preparative HPLC was performed on a Waters HPLC system (Waters prepLC system, Waters 2545 quaternary HPLC pump, Waters 2489 UV-Vis detector, Waters fraction collector III) using a C18 column (SunFire, C18, 19 × 150 mm, 5 μm). The flow rate was 14 mL / min. Preparative HPLC was performed under the same mobile phase conditions as the analytical HPLC, and sample elution was monitored by absorbance at 220 and 254 nm. The purity of each fraction was confirmed by the UV-Vis detector of the analytical HPLC. Fractions with a purity exceeding 97% were collected, lyophilized, and stored at -80°C.
[0147] LC-MS was performed on an Agilent Technology infinity 1260 system (quaternary pump, autosampler, temperature controller, and Hewlett Packard Series 1100 detector) and a C18 column (Poroshell, 120 EC-C18, 4.6 × 50 mm, 2.7 μm). The column heating temperature was set at 50 °C. The binary mobile phases used were as follows: (A, water containing 0.1% CF3COOH; B, CH3CN containing 0.1% CF3COOH, flow rate, 0.8 mL / min), with a linear gradient of 5% B over 0–3 min, 3–8 min to 100% B, and 8–11 min to 100% B. Compounds were monitored at 220 nm and 254 nm.
[0148] [Manufacturing Example] Synthesis of candidate substances, peptides 1 to 18
[0149] 2.1. General synthesis of cyclic peptides
[0150] Rink amide resin (250 mg, 0.13 mmol, loading 0.52 mmol / g) or Fmoc-Ala-Wang resin LL (110 mg, 0.13 mmol, loading 1.14 mmol / g) was swollen in CH2Cl2 (2 mL) at room temperature for 20 min. Fmoc deprotection was performed using 20% (v / v) piperidine in DMF (2 mL) at room temperature for 5 min. The resin was washed with CH2Cl2(Y2), DMF(Y2), MeOH(Y1), DMF(Y2), and CH2Cl2(Y2). The desired amino acid (3.0 equiv), HATU (150 mg, 0.39 mmol, 3.0 equiv), and DIEA (140 mg, 0.3 mL, 1.0 mmol, 8.0 equiv) in DMF (2 mL) were added to the resin and coupled. The reaction was performed under microwave irradiation (75 °C, 400 W maximum power, 75%, ramp 2.5 min, hold 8.0 min, stirring level 3), and the resin was washed with DMF (Y1), CH2Cl2 (Y2), DMF (Y2), MeOH (Y1), DMF (Y2), and CH2Cl2 (Y2). The two steps were repeated until the desired sequence was obtained. After the linear peptide synthesis, the allyl group or acid-labile group at the cyclization site was removed. Allyl deprotection was performed by adding Pd(PPh3)4 (15 mg, 0.013 mmol, 0.1 equiv) and PhSiH3 (340 mg, 0.34 mL, 3.1 mmol, 24.0 equiv) to CH2Cl2 (2 mL) at room temperature for 3 h. The resin was washed with CH2Cl2(Y2), DMF(Y2), MeOH(Y1), DMF(Y2), and CH2Cl2(Y2). Then, the resin was treated with TFA:TIS:CH2Cl2 (v / v / v) 2.5:2.5:95 and stirred at room temperature for 2 min to remove residual palladium. The resin was washed with CH2Cl2(Y2), DMF(Y2), MeOH(Y1), DMF(Y2), and CH2Cl2(Y2).This washing step was repeated three times. For acid-labile protecting groups, the resin was treated with TFA:TIS:CH2Cl2 (v / v / v) 2:2:96 and stirred at room temperature for 2 min. The resin was washed with CH2Cl2(Y2), DMF(Y2), MeOH(Y1), DMF(Y2), and CH2Cl2(Y2). This deprotection step was repeated twice. After removing the protecting groups, the resin was treated with 10% (v / v) DIEA in DMF and stirred at room temperature for 10 min to neutralize the free amine. The resin was washed with CH2Cl2(Y2), DMF(Y2), MeOH(Y1), DMF(Y2), and CH2Cl2(Y2). Then, macrocyclization was performed by adding PyBOP (340 mg, 0.65 mmol, 5.0 equiv), HOAt (90 mg, 0.65 mmol, 5.0 equiv), and DIEA (170 mg, 0.2 mL, 1.3 mmol, 10.0 equiv). The resin was soaked in DMF (2 mL) at room temperature for 2 h. The resin was washed with CH2Cl2(Y2), DMF(Y2), MeOH(Y1), DMF(Y2), and CH2Cl2(Y2). After macrocyclization, Fmoc deprotection was performed using 20% (v / v) piperidine in DMF (2 mL). Myristoylation was performed by adding myristic acid (90 mg, 0.39 mmol, 3.0 equiv), HATU (150 mg, 0.39 mmol, 3.0 equiv), and DIEA (130 mg, 0.18 mL, 1.0 mmol, 8.0 equiv) to DMF (2 mL). The mixture was stirred under microwave irradiation (75 °C, 400 W, 75% power, ramp 2.5 min, hold 8.0 min, stirring level 3). The resin was washed with CH2Cl2(Y2), DMF(Y2), MeOH(Y1), DMF(Y2), and CH2Cl2(Y2). The crude material was obtained by digestion with TFA:TIS:CH2Cl2(v / v / v) 95:2.5:2.5 at room temperature for 2 h.The TFA solution was removed by a stream of N2 gas, and the residue was dissolved in 1:1 (v / v) water / acetonitrile and filtered through a 0.45 μm PTFE syringe filter. The crude material was purified by preparative HPLC to obtain the desired product. Fractions with a purity of 97% or more were collected, lyophilized, and stored at -80°C. For peptides 17 and 18, the peptide (1.0 equiv.) was dissolved in DMF with DIEA (20.0 equiv.) to remove residual TFA. The desired amine (3.0 equiv.) and HATU (3.0 equiv.) were added to the solution, and the mixture was stirred at room temperature for 3 h to promote the C-terminal modification. The crude material was then purified by preparative HPLC.
[0151]
[0152] (a) Mechanism of aspartimide formation during peptide synthesis
[0153]
[0154] (b) Aspartic acid with modified side chain protection to inhibit aspartimide formation.
[0155]
[0156] Peptides 1 to 18 were prepared in the manufacturing examples in Table 2 below.
[0157] Manufacturing Example Compound Peptide 1 Peptide 2 Peptide 3 Peptide 4 Peptide 5 Peptide 6 Peptide 7 Peptide 8 Peptide 9 Peptide 10 Peptide 11 Peptide 12 Peptide 13 Peptide 14 Peptide 15 Peptide 16 Peptide 17 Peptide 18 PreS1(MyrB-old) MyrB
[0158]
[0159] [Manufacturing Method 1] Synthesis of Peptide 5
[0160]
[0161]
[0162] [Manufacturing Method 2] Synthesis of Biotinylated MyrB
[0163] Biotinylated MyrB was synthesized for immunogenicity experiments. Cysteine-containing MyrB was obtained according to the general peptide synthesis protocol described above. Cysteine-containing MyrB (2.8 mg, 0.5 μmol, 1.0 equiv) was dissolved in 5% DMSO / PBS buffer (1 mL). Biotin-maleimide (2.3 mg, 5 μmol, 10.0 equiv) was dissolved in 5% DMSO / PBS buffer (1 mL), and this solution was poured into the cysteine-containing MyrB solution. The mixture was stirred at room temperature for 3 h, and the desired product was identified by LC-MS. The crude product was then diluted with a 1:1 (v / v) water / acetonitrile solution and purified by preparative HPLC to obtain the desired product.
[0164]
[0165]
[0166] [Manufacturing Method 3] Synthesis of Biotinylated Peptide 13
[0167] Cysteine-containing peptide 13 (25 μmol) was obtained according to the general peptide synthesis protocol mentioned above. The formation of oxidative disulfide bonds of cysteine, or sulfenic, sulfinic, or sulfonic groups, should be considered. The crude material was obtained through specific digestion using TFA:TIS:1,2-ethanedithiol:thioanisole:NH4I:H2O (v / v / v / v / v) 82.5:5:3.5:2.5:1.5:5 at room temperature. The TFA solution was removed by a flow of N2 gas for 2 h, and ethyl acetate was poured onto the oily residue. The resulting precipitate was collected and dissolved in 5% DMSO / PBS solution. Then, a biotin-maleimide solution (100 mM DMSO stock, 12 μmol, 120 μL, 0.5 equivalents) was added to the reaction mixture, and the solution was stirred at room temperature for 1.5 h. The crude material was diluted with a 1:1 (v / v) water / acetonitrile solution and purified by preparative HPLC to obtain the desired product. Fractions with a purity of ≥97% were collected, lyophilized, and stored at -80°C.
[0168]
[0169]
[0170] [Experimental Method]
[0171] [Experimental Method 1] In vitro HBV entry inhibition assay
[0172] HepG2-NTCP was cultured at 37°C with 5% CO2 in DMEM containing 10% FBS and 100 U penicillin containing 0.1 mg / mL streptomycin. All maintained cells tested by PCR were mycoplasma negative. HepG2-NTCP was cultured in 12-well plates containing the indicated cyclic peptides for 2 h, and then cells were incubated with HBV particles (2 x 10 per mL). 6(10 virus copies) and treated with the indicated cyclic peptides for an additional 3 h. After removal of the virus-containing medium, cells were cultured for an additional 16 h in the absence of the indicated cyclic peptides.
[0173] After treating cells with indicated cyclic peptides, intracellular HBV DNA was extracted, purified, and quantified by quantitative PCR. To isolate intracellular HBV DNA, cells were lysed on ice for 10 min in lysis buffer (50 mM Tris-HCl, pH 7.5, 1 mM EDTA, 1% NP40). Cell debris and nuclei were removed by centrifugation at 15,000 × g, and the supernatant was treated with micrococcal nuclease (0.25 U / μL) at 37°C for 1 h. Subsequently, EGTA was added to a final concentration of 10 mM to inactivate micrococcal nuclease. Subsequently, intracellular HBV DNA was extracted using the G-spinTM Total Kit. The isolated intracellular HBV DNA was subjected to PCR using HBV DNA primer and probe sets (primer: forward: 5'-TCCTCTTCATCCTGCTGCTAT G-3', reverse: 5'- CGTGCTGGTAGTTGATGTTCCT, probe: 5'- TATTGTTCTTCTGGACTA).
[0174]
[0175] [Experimental Method 2] Rat Whole Blood Stability Analysis
[0176] Cyclic peptide (1 μL, 1 mM DMSO stock) was added to each tube containing heparinized rat whole blood (49 μL) (20 μM in 2% DMSO, f / c). The solutions were incubated in a 37°C water bath for 0, 1, 3, 6, and 24 h. Water containing 2% SDS and 5 mM EDTA (50 μL) was then added to each tube, and the tubes were sonicated for 5 min. The solutions were diluted with acetonitrile containing 0.1% trifluoroacetic acid (200 μL), vortexed, and centrifuged at 5000 rpm for 10 min to precipitate cellular components. The clear supernatant was filtered through a 0.2 μm PTFE syringe filter (Whatman) and analyzed by LC-MS using selected ion mode (SIM) to quantify the intact peptide.
[0177]
[0178] [Experimental Method 3] MTS Analysis
[0179] Human hepatoma cells (HepG2) and human lung cancer cells (MRC-5) were purchased from the Korea Cell Line Bank. All were cultured in DMEM medium containing 10% FBS at 37°C, 5% CO2. MTS cell viability was measured to determine the effect of cyclic peptides on cell growth. 2 x 10 4 HepG2 and 1.3 x 10 4Aliquots (100 μL) of the medium containing MRC-5 were dispensed into each well of a 96-well plate. Cells were grown in a humidified atmosphere of 5% CO2 in air at 37°C and allowed to attach for 24 h. When the cell density reached approximately 70% confluency, the medium was replaced with serial dilutions of the cyclic peptide stock in medium and incubated for 24 h. CellTiter 96 Aqueous Nonradioactive Cell Proliferation Assay Reagent 20 containing a tetrazolium compound [MTS3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt; MTS] was added to each well, and the plates were incubated at 37°C for 4 h to allow for metabolism. MTS-formazan production from viable cells was measured at 490 nm using a microplate reader, and cell viability (%) was measured as a percentage compared to untreated cells. Percentage of cell viability = A / A control X 100, where A is the absorbance of the test well and A control is the average absorbance of wells containing cells not treated with the cyclic peptide.
[0180]
[0181] [Experimental Method 4] In vivo HBV entry inhibition assay
[0182] Human liver-chimeric uPA / SCID (PXB) mice were obtained from PhoenixBio Co., Ltd. (Higashi-Hiroshima, Japan). Three-week-old uPA / SCID mice were injected with human hepatocytes (10 per mouse) through the spleen. 5 10 inland 6 (dog cells) were transplanted, and at 9 weeks after human hepatocyte transplantation, the replacement index of all mice exceeded 90%. At 17 weeks of age, the mice were transferred to the Animal Research Center and transplanted with HepG2.2.15 cells (1.3 Y10 per mouse).6 A single intravenous injection of human HBV virions from the chimeric liver (CaPi, genotype D) was administered. After 6 weeks, persistent HBV infection of human hepatocytes was established in the chimeric liver. At 22 weeks of age, mice began daily subcutaneous treatment with the cyclic peptide (1 mg / kg, n = 3) or vehicle (n = 3), and serum samples were collected weekly from the orbital sinus for measurement of serum HBV DNA. Animal experiments were performed in accordance with the guidelines of the Institutional Animal Care and Use Committee, and infections, serum sampling, and sacrifice were performed under ether anesthesia.
[0183]
[0184] [Experimental Method 5] HPLC chromatogram
[0185] [Correction under Rule 91 30.07.2025] - HPLC chromatogram results are shown in Figure 14.
[0186] [Correction under Rule 91 30.07.2025] - HPLC chromatogram results are shown in Figure 15.
[0187]
[0188] [Experimental Method 6] ESI-MS data
[0189] Peptide sequence Calc. m / z, [M+2H] 2+ Obs.m / z, [M+2H] 2+1Myr-GQNLSTSNPLLGFFPDHQLDPAFRANS-OH1520.81521.02Myr-GQNLSTSNPLLGFFPEHQLDPAFRANS-OH1518.81519.13 Myr-GQNLSTSNPLLGFFPDHQLDPA-OH1233.21233.34Myr-GQNLSTSNPLLGFFPDHQLD-OH1149.11149.65Myr-GQNLSTSNP LGFFPDHQLD1140.11140.06Myr-GQNLSTSNPLGFFPDH*QLDPA-OH1240.21240.77Myr-GQNLSTSNPLGFFPDH*QLDPA-O H1231.21231.48Myr-GQNLKTSNPLGFFPDH*QLDPA-OH1251.71251.69Myr-GQNLDprSNPLGFFPDH*QLDPA-OH1230.71 231.110Myr-GTNLKVPNPLGFFPDH*QLDPA-OH1242.21242.211Myr-GTNLKVPNPLGFFPDH*QLDPA-NH21241.71241.81 2Myr-GTNLKVPNPLGFFPDR*QLDPA-OH1251.71251.813Myr-GTNLKVPNPLGFFPDR*QLDPA-NH21251.21251.214Myr-G The desired product was obtained by macrocyclization between the two bold amino acid residues. a Side-chain-tail cyclization gave the desired compound. H*, N-methylated histidine; Dpr, diaminopropionic acid; R*, N-methyl-arginine. Lowercase p is D-proline.
[0190]
[0191] 보조제 X(Without adjuvant)Negative control(n= 5)MyrB, 2 mg / kg(n= 5)Peptide 13, 2 mg / kg(n= 5)γ-GT (U / L)1.001.001.00ALT (U / L)20 ± 322 ± 220 ± 1AST (U / L)60 ± 1058 ± 1362 ± 12ALP (U / L)540 ± 80600 ± 50600 ± 40Glucose (mg / dL)340 ± 30360 ± 20360 ± 40TG (mg / dL)114 ± 6113 ± 5100 ± 6T-CHO (mg / dL)86 ± 886 ± 389 ± 7BUN (mg / dL)18 ± 221 ± 219 ± 1Creatinine (mg / dL)0.18 ± 0.010.18 ± 0.050.16 ± 0.01Total protein (gdL)5.4 ± 0.25.5 ± 0.25.2 ± 0.2Albumin (g / dL)2.9 ± 0.23.0 ± 0.12.7 ± 0.1Total bilirubin (mg / dL)0.44 ± 0.080.36 ± 0.050.42 ± 0.04Ca (mg / dL)12.0 ± 0.312.1 ± 0.312.2 ± 0.2P (mg / dL)7.3 ± 1.16.7 ± 0.66.2 ± 0.6Mg (mg / dL)2.9 ± 0.32.7 ± 0.22.6 ± 0.1보조제 O(With adjuvant)Negative control(n= 5)MyrB, 2 mg / kg(n= 5)Peptide 13, 2 mg / kg(n= 5)γ-GT (U / L)1.001.001.00ALT (U / L)20 ± 321 ± 419 ± 1AST (U / L)66 ± 12103 ± 2758 ± 7ALP (U / L)370 ± 50270 ± 80380 ± 40Glucose (mg / dL)340 ± 30340 ± 60330 ± 10TG (mg / dL)120 ± 30120 ± 10110 ± 10T-CHO (mg / dL)91 ± 388 ± 686 ± 2BUN (mg / dL)21 ± 318 ± 223 ± 3Creatinine (mg / dL)0.23 ± 0.020.25 ± 0.02 0.33 ± 0.06 Total protein (gdL) 5.4 ± 0.3 5.3 ± 0.1 5.3 ± 0.1 Albumin (g / dL) 2.8 ± 0.2 2.4 ± 0.2 2.7 ± 0.3 Total bilirubin (mg / dL) 0.32 ± 0.07 0.34 ± 0.15 0.30 ± 0.00 Ca (mg / dL) 12.5 ± 0.3 12.1 ± 0.3 12.2 ± 0.5 P (mg / dL) 7.0 ± 0.4 8.0 ± 1.5 7.6 ± 0.3 Mg (mg / dL) 2.5 ± 0.2 2.7 ± 0.1 2.6 ± 0.3 Data are expressed as mean ± standard deviation. The MyrB group and the peptide 13 group did not differ significantly from the negative control group (p-value > 0.05). Groups were compared using the Kruskal-Wallis statistic. Abbreviations: γ-GT, gamma-glutamyl transferase; ALT, alanine transaminase; AST, aspartate transaminase; ALP, alkaline phosphatase; TG, triglyceride; T-CHO, total cholesterol; BUN, blood urea nitrogen; Ca, calcium; P, phosphorus; Mg, magnesium.
[0192]
[0193] [Experimental Results]
[0194] [Example 1] First Library: Optimizing Modification Strategies
[0195] Entry SequenceGenerationHBV PreS1(MyrB-old)Myr-GQNLSTSNPLGFFPDHQLDPAFRANTANPDWDFNPNKDTWPDANKVG-NH21Myr-GQNLSTSNPLLGFFPDHQLDPAFRANS-OH1 stlibrary2Myr-GQNLSTSNPLGFFPEHQLDPAFRANS-OH3Myr-GQNLSTSNPLGFFPDHQLDPA-OH4Myr-GQNLSTSNPLGFFPDHQLD-OH5Myr-GQNLSTSNPLGFFPDHQLD6Myr -GQNLSTSNPLGFFPDH*QLDPA-OH7Myr-GQNLSTSNPLGFFPDH*QLDPA-OH8Myr-GQNLKTSNPLGFFPDH*QLDPA-OH9Myr-GQNLDprSNPLGFFPDH*QLDPA-OHMyrcludex B(MyrB)Myr-GTNLSVPNPLGFFPDHQLDPAFGANSNNPDWDFNPNKDHWPEANKVG-NH210Myr-GTNLKVPNPLGFFPDH*QLDPA-OH2 nd library11Myr-GTNLKVPNPLGFFPDH*QLDPA-NH212Myr-GTNLKVPNPLGFFPDR*QLDPA-OH13Myr-GTNLKVPNPLGFFPDR*QLDPA-NH214Myr-GTNLKVPNPLGFFPD-NH23 rd library15Myr-GTNLKVPNPLGFFPDR*QLDP-NH216Myr-GTNLKVPNPLGFFPDR*QLDp-NH217Myr-GTNLKVPNPLGFFPDR*QLDP-NEt218Myr-GTNLKVPNPLGFFPDR*QLDP-R (morpholinyl)Macrocyclic peptides were obtained by side-chain-to-side-chain macrocyclization. Macrocyclization was performed between two underlined, bolded amino acids. a Side-chain-to-tail macrocyclization yielded the desired compounds. Dpr, diaminopropionic acid; H*, N-methyl-histidine; R*, N-methyl-arginine. Lowercase p represents D-proline.
[0196] The PreS1 sequence, which mediates protein-protein interactions between the large surface protein of HBV and NTCP in hepatocytes, is already known. Based on this sequence, we aimed to design PreS1 derivatives with enhanced stability and antiviral activity through C-terminal truncation, macrocyclization, and side chain modification (see Table 2). Previously, a pharmacophore and accessory domain were reported for PreS1. To improve synthetic cost and yield, the accessory domain was truncated to yield peptides 1 and 3. However, aspartimide formation was observed during the macrocyclization step. Macrolactonization between Ser5 and Asp15 of peptides 1 and 3 produced aspartimide compounds instead of macrocyclic peptides. Peptide 2 was designed by replacing aspartic acid with glutamic acid, which has one more carbon, but glutarimide was still observed. Therefore, it was thought that aspartimide formation occurred by the deprotonated amide attacking the activated carboxylic acid, and it was decided to remove the reactive site to solve the aspartimide problem.
[0197] First, peptide 4 was obtained by removing two more amino acids compared to peptide 3 to eliminate the amide proton associated with aspartimide formation. Peptide 5 was obtained through C-terminal macrocyclization in the side chain. Second, an N-methyl amino acid was adopted at position 16 to avoid aspartimide formation during on-resin cyclization. Peptide 6 was designed by substituting an N-methylated histidine at position 16, and a cyclized compound (peptide 7) was observed. However, peptides 5 and 7 faced low stability and low synthetic yields, respectively. Peptide 5 was observed to spontaneously decompose in aqueous media, and the macrolactonization conversion of peptide 6 was less than 5%. Therefore, macrolactamization was utilized instead of macrolactonization to improve stability and yield, and peptides 8 and 10 were designed by adopting a macrolactam ring.
[0198] PreS1 derivatives from the first library were synthesized using the solid-phase peptide synthesis (SPPS) protocol. Wang resin was generally used for peptide synthesis, with 2-chlorotrityl resin used only for peptide 5, which had a macrolactonization at the C-terminus. Fmoc deprotection was performed with 20% (v / v) piperidine in DMF, and peptide coupling was performed at room temperature with the addition of HATU, the desired amino acid, and DIEA. Each linear sequence was extended through repeated Fmoc deprotection and peptide coupling. After obtaining the desired linear peptide, partial protecting groups were removed under each condition. The allyl protecting group was treated with Pd(PPh3)4 and PhSiH3, and the trityl protecting group was treated with a weak acidic cocktail (TFA:TIS:CH2Cl2 2.5:2.5:95). On-resin cyclization of peptides 8 and 9 was performed with the addition of PyBOP and HOBt, and >99% conversion was observed by LC-MS and HPLC. Macrolactonization of peptide 5 was performed under the same conditions, but low conversion was confirmed by LC-MS. Then, myristic acid and HATU were added to attach a myristoyl group to the N-terminus. The desired product was cleaved by TFA:TIS:CH2Cl2 95:2.5:2.5 (v / v / v). Scheme 1 below shows a method for synthesizing peptides 7, 8, and 9 using resin-based macrolactonization or macrolactamization.
[0199]
[0200] In vitro HBV entry inhibition activity was confirmed for PreS1 derivatives (MyrB-old and peptides 6-9) (see Fig. 1). Peptides 6-9 showed similar HBV entry inhibition activity compared to MyrB-old. Peptide 8 showed the highest efficacy in inhibiting HBV entry (IC 50 = 6.5 nM). Whole blood stability was monitored for peptides 6-9 at time points (0, 3, 6, and 24 h) up to 24 h (see Figure 2). As expected, the linear peptide and the macrocyclic peptides containing ester bonds (peptides 6 and 7) were degraded faster in blood than the macrocyclic peptides adopting amide bonds (peptides 8 and 9). They showed > 95% of the intact peptide after 24 h of incubation, which is consistent with the half-life (t 1 / 2 ) > means 24 hours.
[0201]
[0202] [Example 2] Second Library: Optimizing Inhibitory Activity
[0203] In the first library, the parent sequence was modified by C-terminal truncation and side chain cyclization (e.g., peptide 8) to improve the synthetic route and stability while maintaining HBV entry inhibition activity. Recently, Myrcludex B (MyrB) was unveiled as a pioneering entry inhibitor whose sequence was optimized to exhibit potent HBV entry inhibition activity. It showed increased inhibitory activity compared to previously reported ones and is in ongoing phase 3 clinical trials. Here, the established modification strategy in the first library, including C-terminal truncation, cyclization, and backbone N-methylation of the MyrB sequence, was adopted. Four derivatives were designed based on amino acid substitutions and C-terminal modifications (see Figure 3).
[0204]
[0205] The synthesis of peptide 13, representing a derivative of the second library, is represented by Scheme 2 above.
[0206] PreS1 derivatives from the second library were synthesized using the SPPS protocol. A representative overall synthetic scheme is illustrated in Scheme 2 above. The solid support resin was selected based on the C-terminal group: Wang resin for the carboxylic acid group and Rink amide MBHA resin for the amide group. Fmoc deprotection was performed with 20% (v / v) piperidine in DMF, and peptide coupling was performed at room temperature with the addition of HATU, the desired amino acid, and DIEA. Each linear sequence was extended through repeated Fmoc deprotection and peptide coupling. After obtaining the desired linear peptide, Pd(PPh3)4 and PhSiH3 were added to CH2Cl2 solution to remove the allied group, followed by three 2-minute treatments under mild acidic conditions (2.5% TFA solution) to wash away the residual palladium adduct. The resin was stirred in a 10% (v / v) DIEA solution in DMF to neutralize the reactive sites. On-resin cyclization was performed by adding PyBOP and HOAt, and >99% conversion was observed by LC-MS and HPLC. Myristic acid and HATU were then added to attach a myristoyl group to the N-terminus. The desired product was cleaved from the solid-supported resin by a solution of TFA:TIS:CH2Cl2 95:2.5:2.5 (v / v / v) for Rink amide resin or TFA:TIS:H2O 95:2.5:2.5 (v / v / v) for solid Wang resin.
[0207] In vitro HBV entry inhibition activity was confirmed for controls (MyrB-old, peptide 8, and MyrB) and PreS1 derivatives (peptides 10-13) (see Fig. 4a). MyrB had a lower IC for HBV entry inhibition than MyrB-old or peptide 8. 50The values indicated that the newly established sequence was more potent than the previous sequence. Peptides 10-13 showed similar HBV entry inhibitory activity compared to MyrB. Derivatives containing MeArg16 (N-methyl arginine at position 16) (peptides 11 and 13) showed slightly improved inhibitory activity than derivatives containing MeHis16 (N-methyl histidine at position 16) (peptides 10 and 12). IC of MyrB, peptides 12 and 13 50 Because the values were determined by the lowest concentration point, they were re-evaluated at five points in a lower range (0–2.5 nM) (see Fig. 4b). IC of peptides 12 and 13 50 The values were still similar to MyrB, and peptide 13 showed the greatest efficacy in inhibiting HBV entry (IC 50 = 0.7 ± 0.1 nM), which is higher than MyrB (IC 50 IC 2-fold lower than (= 1.6 ± 0.1 nM) 50 It's worth it.
[0208] To demonstrate the enhanced stability of the macrocyclic PreS1 derivatives, we assessed their blood stability. Using rat whole blood, the blood stability of MyrB-old, MyrB, peptide 8, and peptide 13 was monitored at time points (0, 3, 6, and 24 h) for up to 24 h (see Figure 5 ). As expected, the linear peptides (MyrB-old and MyrB) were rapidly degraded in blood, with half-lives of less than 3 and 6 h, respectively. In contrast, the macrocyclic derivatives (peptides 8 and 13) exhibited longer half-lives than their corresponding linear peptides. The half-life of peptide 8 was approximately 24 h, which was five times longer than that of MyrB-old (t1 / 2 = ca. 5 h), and peptide 13 showed 89% of the intact peptide after 24 h, indicating that it was more stable than MyrB in blood. When peptides 8 and 13 were compared, more peptide 13 remained after 24 h than peptide 8 (46% vs. 89% for peptides 8 and 13), indicating that peptide 13 is more stable than peptide 8 in blood. Peptide 13 showed improved inhibitory activity and whole blood stability compared to the linear peptide or peptide 8.
[0209] The HBV entry inhibition activity of peptide 13 was evaluated in an in vivo assay system using a humanized mouse model (see Figure 6). Serum HBV DNA was bound in both groups, the control and peptide 13, after 1 week, but serial observations revealed different profiles. At week 4, serum HBV DNA levels in the control group did not change significantly compared to week 1, but serum HBV DNA levels in the peptide 13-treated group decreased by 3 log compared to week 1. In addition, intracellular cccDNA was significantly reduced by 8 log compared to untreated groups (see Figure 6b). The decreases in serum HBV DNA and intracellular cccDNA indicate a decrease in the number of infected hepatocytes producing HBV DNA, suggesting that peptide 13 prevents viral transmission to host cells and clears infected viruses by the immune system. However, no changes were observed in HBV surface antigen (HBsAg) or e antigen (HBeAg) after 4 weeks (see Figures 6c and 6d). This is consistent with previous findings on MyrB, which did not affect the levels of released viral components such as HBsAg, HBeAg, or HBxAg.
[0210] For peptide 13, an in vivo pharmacokinetic (PK) study was performed in mice administered intravenously (see Figure 7). Peptide 13 exhibited rapid clearance, supported by a half-life of 1.9 hours and a low volume distribution. Although cyclic peptide derivatives have a longer half-life than linear peptides, this may not be sufficient for the targeted once-weekly dosing frequency. Therefore, further modification of the PreS1 derivative was necessary to improve in vivo stability.
[0211] Parameters MyrB Peptide 13 (DL-5-99) IV, 1 mpk SC, 10 mpk IV, 1 mpk SC, 10 mpk Tmax (h) - 4.00 - 4.67 Cmax (ng / mL) - 162 49.43 - 690.13 AUC last(mgh / mL)671.2093215.441864.416412.39AUC 00 (mgh / mL)694.0893227.861908.766814.60CL (mL / min / kg)24.73-9.16-V ss (L / kg)1.67-1.77-V d (L / kg)2.76-4.33-T 1 / 2 (h)1.301.615.435.26MRT 00 (h)0.925.172.418.03%FN.D-35.7
[0212]
[0213] [Example 3] Third Library: Stability Optimization
[0214] Based on the sequence of peptide 13, the cyclized sequence was identified as an essential epitope for binding to NTCP. Although peptide 13 was more stable than the parent peptide MyrB, we investigated whether there was a protease that specifically recognized the sequence. Access by the protease from the N-terminus was blocked by N-acylation using a myristoyl group. The cyclized loop sequence was excluded from modification because it is a pharmacophore. Therefore, the C-terminus was modified considering a carboxypeptidase that recognizes a specific amino acid at the first or second position from the C-terminus. During the research, a specific carboxypeptidase that cleaves the two C-terminal amino acids of peptide 13 (Pro-Ala) was discovered, and five additional derivatives (peptides 14-18) were designed from a third library to avoid degradation by this carboxypeptidase (see Figure 11). Typically, the sequence is based on peptide 13, and the C-terminus was modified by truncation, D-amino acid substitution, or N-alkylation. Changes in length and insertion of D-amino acids at the C-terminus generated peptides 14-16. When carboxypeptidase recognizes a peptide, the carboxylic acid forms two H-bonds in the binding pocket. N-alkyl amidation of the C-terminus was expected to weaken the electrostatic interaction between the carboxylic acid and the peptidase binding pocket. The in vitro HBV entry inhibition activity of the derivatives was evaluated, and peptide 18, among the third library peptide, showed the best efficacy in inhibiting HBV entry (IC 50 = 2.07 ± 0.11 nM). MyrB, used as a control in the same experiment, had an IC 50 = 1.43 ± 0.12 nM, IC for peptide 13 50 = 0.61 ± 0.14 nM value was shown.
[0215] The following reaction scheme 3 shows the synthesis method of peptide 15, 17, and 18 derivatives.
[0216]
[0217] The synthesis of peptides 14-18 was generally performed according to the SPPS protocol described above (Scheme 3). Only the order of the myristoylation and cyclization steps was reversed in Scheme 3. For peptides 17 and 19, the fully protected linear peptides were cleaved from 2-chlorotrityl resin using a 20% HFIP / CH2Cl2 solution. The residual cleaved solution was evaporated with a N2 gas flow, and N-alkyl amidation was performed without further purification after cleavage. While DMF was typically used as the solvent for amide coupling, reactions with diethylamine or morpholine at the C-terminus were performed in CH2Cl2. After removing the solvent with a N2 gas flow, a 95% TFA cocktail was added to the mixture to remove the protecting group from the side chain. The residual TFA was then removed with N2 gas, and the crude material was dissolved in a 1:1 ACN / H2O solution, filtered, and purified by preparative RP-HPLC. Purity was confirmed by analytical HPLC, and only fractions with a purity of 97% or more were collected to obtain the pure product.
[0218]
[0219] In this study, novel MyrB derivatives were designed and synthesized through backbone modifications such as length, cyclization, and N-methyl amino acids, and dendritic macrocyclization was performed. All derivatives exhibited HBV entry inhibitory activity similar to MyrB, and among them, peptide 13 exhibited the lowest IC in an in vitro assay. 50The value (0.7 ± 0.1 nM) was observed, and a significant reduction in serum HBV DNA and cccDNA (covalently closed circular DNA) was observed in an in vivo humanized mouse model. The improved stability of peptide 13 was also observed in whole blood stability and in vivo PK studies, suggesting that the drug design strategy may lead to the development of additional promising entry inhibitors that achieve enhanced inhibitory activity and stability.
[0220]
[0221] While specific aspects of the present invention have been described in detail above, it should be apparent to those skilled in the art that these specific descriptions are merely preferred implementation examples and do not limit the scope of the present invention. Therefore, the substantial scope of the present invention is defined by the appended claims and their equivalents.
[0222] Sequence number 1: GQNL
[0223] Sequence number 2: GTNL
[0224] Sequence number 3: STSNPLGFFP D
[0225] Sequence number 4: STSNPLGFFP E
[0226] Sequence number 5: STSNPLGFFP DHQLD
[0227] Sequence number 6: KVPNPLGFFP D
[0228] Sequence number 7: KTSNPLGFFP D
[0229] Sequence number 8: DprTSNPLGFFP D
[0230] Sequence number 9: HQLD
[0231] Sequence number 10: HQLDPA
[0232] Sequence number 11: H*QLDPA
[0233] Sequence number 12: HQLDPAFRAN S
[0234] Sequence number 13: R*QLDPA
[0235] Sequence number 14: R*QLDP
[0236] Sequence number 15: R*QLDp
[0237]
Claims
1. A linear or cyclic peptide represented by the following chemical formula 1 or chemical formula 2: [Chemical Formula 1] [Chemical Formula 2] In the above chemical formulas 1 and 2, m is an integer from 10 to 14, n is an integer from 1 to 6, o is an integer from 1 to 3, A is O or NH, R1 is a peptide having an amino acid sequence of either SEQ ID NO: 1 or SEQ ID NO: 2, R2 is a peptide having an amino acid sequence of any one of sequence numbers 3 to 8, R3 is a direct bond or a peptide having an amino acid sequence of any one of SEQ ID NOs. 9 to 15, R4 is hydroxy, -NR5R6 or morpholinyl, The above R5 and R6 are each independently hydrogen or C1 to C3 alkyl.
2. In paragraph 1, A peptide characterized in that the sum of n and o is 2 to 8.
3. In paragraph 1, The linear peptide represented by the above chemical formula 1 is R1 is a peptide having the amino acid sequence of sequence number 1, R2 is a peptide having an amino acid sequence of sequence number 3 or 4, R3 is a peptide having an amino acid sequence of any one of SEQ ID NOs: 9 to 12, R4 is hydroxy, peptide.
4. In paragraph 1, The cyclic peptide represented by the above chemical formula 2 is R1 is a peptide having an amino acid sequence of sequence number 1 or 2, R2 is a peptide having an amino acid sequence of any one of sequence numbers 3, 5, 6 to 8, R3 is a direct bond or a peptide having an amino acid sequence of any one of SEQ ID NOs: 11, 13 to 15, R4 is hydroxy, -NR5R6 or morpholinyl, A peptide wherein R5 and R6 are each independently hydrogen or C1 to C3 alkyl.
5. A pharmaceutical composition for the prevention or treatment of hepatitis virus infection, comprising the peptide of clauses 1 to 4 or a pharmaceutically acceptable salt thereof as an active ingredient.
6. In paragraph 5, A pharmaceutical composition wherein the hepatitis virus is at least one selected from the group consisting of hepatitis A virus (HAV), hepatitis B virus (HBV), hepatitis C virus (HCV), hepatitis D virus (HDV), hepatitis E virus (HEV), hepatitis G virus (HGV), Epstein-Barr virus, and cytomegalovirus (CMV).
7. In paragraph 1, A pharmaceutical composition characterized in that the composition is inhibited from decomposition by in vivo hydrolytic enzymes.
8. A food composition for preventing or improving hepatitis virus infection, comprising the peptide of clauses 1 to 4 or a pharmaceutically acceptable salt thereof as an active ingredient.
9. In paragraph 8, A food composition, wherein the hepatitis virus is at least one selected from the group consisting of hepatitis A virus (HAV), hepatitis B virus (HBV), hepatitis C virus (HCV), hepatitis D virus (HDV), hepatitis E virus (HEV), hepatitis G virus (HGV), Epstein-Barr virus, and cytomegalovirus (CMV).
10. A step for obtaining a drug for stabilization purposes; and A method for improving the stability of a drug, comprising a step of forming a macrocycle by forming a cyclic amide on at least two amino acids among the amino acid sequences contained in the drug.
11. In paragraph 10, A method characterized in that the above cyclic amide is cyclized through lactamization or lactonization.
12. In paragraph 10, A method characterized in that the above cyclic amide comprises N-methylation, C-term modification, or a combination thereof at an amino acid residue adjacent to an amino acid participating in cyclization.
13. In paragraph 10, A method characterized in that the above cyclic amide forms a ring through lactamization or lactonization between lysine (Lys, K) or serine (Ser, S) and aspartic acid (Asp, D) among a specific amino acid sequence of the drug.
14. In paragraph 10, A method characterized in that the lactamization or lactonization ring in the above cyclic amide is composed of 5 to 9 ring atoms.
15. In paragraph 10, A method wherein the drug is at least one selected from the group consisting of a viral entry inhibitor, a cccDNA targeting drug, a nucleocapsid inhibitor, a polymerase inhibitor, an HBsAg inhibitor, and an immunosuppressant.
16. In paragraph 15, A method wherein the above drug is a viral entry inhibitor.
17. In paragraph 16, A method wherein the viral entry inhibitor is at least one selected from the group consisting of Myrcludex B (MyrB), Cyclosporin A, and Ezetimibe.
Citation Information
Patent Citations
Cyclic NTCP-targeting peptides and their uses as entry inhibitors
EP3181146A1
Peptide and human hepatocyte-selective drug delivery conjugate
JP2015120657A
Hydrophobic modified pres-derived peptides of hepatitis b virus (HBV) and their use as hbv and hdv entry inhibitors
KR1020100136960A
Hepatitis B virus pre-S1 derived synthetic polypeptides and uses thereof
US7892754B2