Yeast strain development for ethanol production

Abstract

Disclosed herein are yeast strains and derivatives thereof, as well as compositions comprising the yeast strains for use in ethanol manufacture. The disclosure also relates to processes for producing ethanol from biomass using the yeast strains and compositions. In particular, one or more of the yeast strains produce higher ethanol, leave less residual fructose, and have a higher temperature tolerance and higher fermentation rate than strains and products currently used in ethanol production processes.

Description

YEAST STRAIN DEVELOPMENT FOR ETHANOL PRODUCTIONREFERENCE TO SEQUENCE LISTING

[0001] This application was filed with a Sequence Listing XML in ST.26 XML format in accordance with 37 C.F.R. § 1.821. The Sequence Listing XML file submitted in the USPTO Patent Center, “211879-0004-W001.xml,” was created on June 29, 2024, contains 4 sequences, has a file size of 4.26 Kbytes, and is hereby incorporated by reference in its entirety into the specification.FIELD

[0002] This disclosure relates to non-naturally occurring yeast strains and derivatives thereof, as well as compositions comprising the yeast strains for use in ethanol manufacture. The disclosure also relates to processes for producing ethanol from biomass using the yeast strains and compositions. In particular, one or more of the yeast strains produce higher ethanol and lower glycerol, exhibit higher fructose utilization, and exhibit higher temperature tolerances and higher fermentation rates than strains and products currently used in ethanol production processes.INTRODUCTION

[0003] Ethanol can be produced from biological organisms using different biochemical pathways inherent to the organism. Ethanol produced from biological organisms is termed bioethanol and is thereby distinguished from ethanol produced by purely chemical methods. Bioethanol is manufactured commercially and can be used as a liquid fuel in internal combustion engines (fuel ethanol), as an ingredient in industrial products (industrial ethanol), or as a component in alcoholic beverages (potable ethanol).

[0004] Biological organisms such as yeasts produce bioethanol from a variety of biomass, including sucrose, also known as table sugar. Selected yeasts are advantageous for ethanol production from sucrose so that the production processes and profitability can be optimized. Inbiomass that contains sucrose, a dimer of the sugars glucose and fructose, yeast cells hydrolyze sucrose into glucose and fructose utilizing enzymes located on the outside wall of the cell and both glucose and fructose can be converted to ethanol by the yeast. Glucose is preferred over fructose for yeast such as Saccharomyces cerevisiae and is preferentially used by the cell, leaving high concentrations of fructose outside the cell. Yeast often cannot utilize the fructose remaining outside of the cell and that fructose represents a loss in the potential ethanol made from sucrose by the yeast. High ethanol concentrations exacerbate the limited utilization of fructose by yeast. There is a need for Saccharomyces cerevisiae that can effectively utilize fructose during fermentation.

[0005] By-product formation by yeast during fermentation (e.g., glycerol) uses sugar as a substrate and thus decreases potential ethanol yield from sugar. Glycerol is an important metabolite with a protective role against several types of stress and is important for maintenance of intracellular redox balance in anaerobic fermentation conditions. Glycerol formation varies considerably among strains of Saccharomyces cerevisiae. It is particularly useful to use yeast for fermentation that exhibit relatively low glycerol production while maintaining good protection against stresses. In particular, yeast that exhibit a high ethanol-to- glycerol ratio to maximize ethanol produced from sugar are needed.

[0006] Metabolic activity in yeast during fermentation generates heat which increases the temperature of the fermentation medium. High temperatures during fermentation are detrimental to production of ethanol. In industrial ethanol fermentation, fermentation vessels must be cooled to maintain an optimal temperature range for ethanol fermentation by the yeast. Cooling fermentation vessels adds significant costs to the fermentation process, particularly in factories that are in regions that experience high temperatures and high humidity, such as tropical and subtropical regions. In geographic areas with high humidity and temperature, ethanol factories struggle to cool fermentation vessels with cooling systems based on evaporative cooling. Loss of fermentation cooling control results in an unintentional increase in fermentation temperature exceeding the optimal temperature range, known as a temperature excursion, that makes fermentation to ethanol less efficient and decreases ethanol yields. Thus, yeast that can withstand fermentation temperature excursions are also needed.

[0007] Yeast in products that are used for commercial production of ethanol require several characteristics including adequate ethanol metabolic yield, adequate ethanol tolerance, acceptable by-product yield, adequate fermentation kinetics, ability to consume fructose, organic acid tolerance, and temperature tolerance during fermentation. Yeast of the genus Saccharomyces exhibit some but not all these characteristics required for commercial production of ethanol. Commercial yeast products that comprise Saccharomyces include: Ethanol Red® (Fermentis®), Thermosacc® (Lallemand®), Angel Super Alcohol® (Angel®), 46 EDV (Lallemand®), Superstart® (Lallemand®), DistilaMax® CN (Lallemand®), PE-2 (Fermentec), CAT- 1 (Fermentec), Fali® M (AB Mauri®), and Fali® S (AB Mauri®). Although commercial yeast strains and products have advantageous characteristics for production of ethanol, there is an increasing need for improvements in the efficiency of ethanol production to reduce cost of manufacture.

[0008] Improvements in the efficiency of ethanol production can be attained by selecting between yeast that display genetic and phenotypic diversity. Phenotypes, or traits, of particular yeast strains can be changed by alterations in the genetic material, or genome, of the yeast strain. Alterations in the genome of yeast can be achieved by several means known in the art. One means by which the genome and phenotype of yeast strain can be altered is by subjecting yeast to directed evolution to generate non-naturally occurring yeast strains. Directed evolution takes advantage of naturally occurring mutations in the yeast genetic material (DNA), or genome, which occur spontaneously in all organisms, including yeast such as Saccharomyces cerevisiae. By selecting yeast for desired beneficial phenotypes caused by spontaneous, random mutations in the yeast DNA, evolved yeast strains are generated that otherwise would not be found in nature. The genomes of evolved strains are distinct from the original strain before undergoing directed evolution. Distinctions can be uncovered by DNA sequencing of yeast genomes.

[0009] Naturally occurring mutations in the genome can be augmented by treatment of yeast cells with a mutagen, a chemical or physical agent which causes mutations in DNA. Such mutagens include, but are not limited to, ultraviolet light, X-rays, and ethyl methanesulfonate. Following treatment of yeast with a mutagen, beneficial traits arising from mutations in the yeast genome can be selected for as in directed evolution. Mutagenesis of yeast followed by selection of beneficial traits generate additional diversity in yeast, from which advantageouscharacteristics for production of ethanol can be derived. The yeast strains resulting from mutagenesis are genomically distinct from the original strain before mutagenesis and are non- naturally occurring yeast strains and would not be found in nature.

[0010] Genomic and phenotypic diversity in yeast can be further increased by sexual reproduction of yeast, including Saccharomyces cerevisiae. In sexual reproduction of yeast, a single diploid yeast cell undergoes the process of meiosis and produces genetically distinct haploid spores. Mating haploid spores resulting from a single parental diploid yeast cell, or selfcrossing, results in the generation of a diploid progeny that are genetically distinct from the parental cell, the original diploid cell, and would otherwise not be found in nature. More advantageously, haploid spores from different parental cells exhibiting different characteristics can be mated to form genomically distinct progeny. Mating spores from two parents, termed directed mating, results in progeny with increased genomic diversity. Even more advantageously, spores from 3 or more parental cells can be mated at random in a process known as mass mating. Mass mating generates a number of progeny which are all genomically distinct from the parental strains. Thus, sexual reproduction in yeast by self-crossing, directed mating, or mass mating, increases the genomic and phenotypic diversity available and from which advantageous characteristics for production of ethanol can be derived. The yeast strains derived from sexual reproduction would otherwise not be found in nature.

[0011] The genetic diversity of yeast strains resulting from spontaneous mutations, artificial mutagenesis, and sexual reproduction can be assessed in a variety of ways. These include, but are not limited to, genetic marker analysis, polymerase chain reaction (PCR) amplification of microsatellite DNA, next-generation sequencing technologies, or a combination thereof. Microsatellite DNA are genetic loci that comprise of tandem repeats of one to six bases. Some microsatellite DNA loci have a high degree of allelic polymorphism and hence can be used as genetic markers for assessing strain diversity in yeast. PCR assays designed to detect such polymorphisms can provide a means to rapidly discriminate between strains and assess their genotypes. Another more advantageous method for surveying the genetic diversity of yeast strains is through whole genome sequencing which can provide information on single nucleotide polymorphisms and structural variations such as genomic insertions or deletions. Taken together, these approaches can be used for assessing the genetic diversity of yeast strains obtained through directed evolution, mutagenesis, and sexual reproduction.

[0012] There is a need for new and improved strains of Saccharomyces from which to produce new and improved yeast products. The improved yeast strains and products need to be capable of improving the efficiency of commercial ethanol production by providing a higher conversion of sugar to ethanol, higher temperature tolerance, higher tolerance to fermentation inhibitors, and more rapid fermentation kinetics than yeast strains and products currently in commercial use. Increasing the genomic and phenotypic diversity in yeast strains by mutation or sexual reproduction increases the number of yeasts that display improved traits.SUMMARY

[0013] In an aspect, the disclosure relates to a non-naturally occurring Saccharomyces yeast strain selected from: (a) Saccharomyces strain Y2175, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68316; (b) Saccharomyces strain Y2177, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68318; and (c) Saccharomyces strain Y2178, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68317.

[0014] In a further aspect, the disclosure relates to a non-naturally occurring derivative of a Saccharomyces yeast strain selected from: (a) Saccharomyces strain Y2175, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y- 68316; (b) Saccharomyces strain Y2177, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68318; and (c) Saccharomyces strain Y2178, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68317. In an embodiment, the yeast strain or the derivative comprise one or more defining characteristics selected from: (a) a higher ethanol yield than the Y1953 strain under the same fermentation conditions; (b) an increased temperature tolerance compared to the Y1953 strain; (c) a higher fructose utilization than the Y1953 strain under the same fermentation conditions; (d) a higher ethanol to glycerol ratio than the Y1953 strain under the same fermentation conditions; and (e) an increased fermentation rate compared to the Y1953 strain under the same fermentation conditions. In another embodiment, the yeast strain or the derivative has at least about 1.0% higher ethanol yield after 48 hours of fermentationrelative to the Y1953 strain. In another embodiment, the yeast strain or the derivative has at least about 15% higher fructose utilization after 48 hours of fermentation relative to the Y1953 strain. In another embodiment, the yeast strain or the derivative has an ethanol to glycerol ratio that is at least about 1.0% higher than the Y1953 strain after 48 hours of fermentation. In another embodiment, the yeast strain or the derivative has a fermentation rate that is at least about 1.0% higher than the Y1953 strain after 26 hours of fermentation. In another embodiment, the yeast strain or the derivative has a higher temperature tolerance relative to the Y1953 strain at fermentation temperatures ranging from 34°C to 38°C.

[0015] Another aspect of the disclosure provides a method of producing the derivative of a Saccharomyces yeast strain as described herein comprising: (a) providing: (i) a first yeast strain, wherein the first yeast strain is selected from Saccharomyces strains Y2175, Y2177, Y2178, and derivatives thereof; and (ii) a second yeast strain, wherein the second yeast strain is in the Saccharomyces sensu stricto clade; (b) inducing sporulation of the first yeast and the second yeast strain; (c) optionally generating haploid segregants from the first strain and the second strain; (d) optionally screening and selecting haploid segregants from the first yeast and haploid segregants from the second yeast strain; (d) hybridizing or fusing the selected haploid segregants or germinating spores of the first yeast strain with the selected haploid segregants or germinating spores of the second yeast strain; and (e) screening or selecting for a derivative strain which has higher any of higher temperature tolerance, higher ethanol yield, higher fructose utilization, higher ethanokglycerol ratio, higher rate, relative to the first yeast strain. In an embodiment, step (c) comprises screening or selecting haploid segregants which exhibit one or more defining characteristics of Saccharomyces strains Y2175, Y2177, Y2178, or a derivative thereof. In another embodiment, step (e) comprises screening or selecting a hybrid which exhibits one or more defining characteristics of Saccharomyces strains Y2175, Y2177, Y2178, or a derivative thereof.

[0016] Another aspect of the disclosure provides a method of producing the derivative of a Saccharomyces yeast strain as described herein comprising: (a) providing: (i) a first yeast strain, wherein the first yeast strain is selected from Saccharomyces strains Y2175, Y2177, Y2178, and derivatives thereof; and (ii) one or more additional yeast strains that are in the Saccharomyces sensu stricto clade; (b) inducing sporulation of the first yeast and the one or more additional yeast strains to produce spores; (c) mixing all of the spores of step (b) to allowfor hybridization of the spores; and (d) screening or selecting for a derivative strain. In an embodiment, step (d) comprises screening or selecting a hybrid which exhibits one or more defining characteristics of Saccharomyces strains Y2175, Y2177, or Y2178.

[0017] Another aspect of the disclosure provides a mutant yeast of a yeast strain as described herein or a derivative as described herein.

[0018] Another aspect of the disclosure provides a method of producing the mutant yeast as described herein, wherein the mutant yeast is mutated by contacting the yeast strain with a mutagen. In an embodiment, the mutagen is ethyl methanesulfonate (EMS), ultraviolet light (UV), X-rays, methylmethane sulphonate (MMS), nitrous acid, nitrosoguanidine (NNG), acridine mustard, 2-methoxy-6-chloro-9[3- (ethyl-2-chloroethyl)aminopropylamino]acridine-2 (ICR-170), or nitrogen mustard.

[0019] Another aspect of the disclosure provides a method of producing the mutant yeast as described herein, wherein the mutant yeast is mutated by contacting the derivative with a mutagen. In an embodiment, the mutagen is ethyl methanesulfonate (EMS), ultraviolet light (UV), X-rays, methylmethane sulphonate (MMS), nitrous acid, nitrosoguanidine (NNG), acridine mustard, 2-methoxy-6-chloro-9[3- (ethyl-2-chloroethyl)aminopropylamino]acridine-2 (ICR-170), or nitrogen mustard.

[0020] Another aspect of the disclosure provides an evolved yeast of a yeast strain as described herein or a derivative as described herein.

[0021] Another aspect of the disclosure provides a method of producing the evolved yeast as described herein, wherein evolution is induced by applying selective pressure to the yeast strain.

[0022] Another aspect of the disclosure provides a method of producing the evolved yeast as described herein, wherein evolution is induced by applying selective pressure to the derivative.

[0023] Another aspect of the disclosure provides a genetically modified yeast of a yeast strain as described herein or a derivative as described herein. In an embodiment, a nucleic acid sequence of the genetically modified yeast is changed using gene editing.

[0024] Another aspect of the disclosure provides a recombinant yeast of a yeast strain as described herein or a derivative as described herein. In an embodiment, the recombinant yeast comprises a modification to suppress expression of a gene, enhance expression of a gene, introduce a gene, or delete a gene.

[0025] Another aspect of the disclosure provides a process for producing ethanol from a substrate by contacting the substrate with a fermenting organism, wherein the fermenting organism is selected from: (a) Saccharomyces strain Y2175, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68316, or a derivative thereof; (b) Saccharomyces strain Y2177, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68318, or a derivative thereof; and (c) Saccharomyces strain Y2178, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68317, or a derivative thereof. In an embodiment, the substrate comprises or originates from sugar cane, sugar beet, sweet sorghum, agave, corn, wheat, rice, barley, rye, sorghum, triticale, potato, sweet potato, cassava, or a combination thereof. In another embodiment, the yeast comprises one or more defining characteristics selected from: (a) a higher ethanol yield than the Y1953 strain under the same fermentation conditions; (b) an increased temperature tolerance compared to the Y1953 strain;(c) a higher fructose utilization than the Y1953 strain under the same fermentation conditions;(d) a higher ethanol to glycerol ratio than the Y1953 strain under the same fermentation conditions; and (e) an increased fermentation rate compared to the Y1953 strain under the same fermentation conditions. In another embodiment, the yeast has a higher temperature tolerance during fermentation than the Y1953 strain from 34°C to 38°C. In another embodiment, the ethanol is used for fuel ethanol, industrial ethanol, potable ethanol, or a combination thereof. In another embodiment, the ethanol is produced using a starch. In another embodiment, simultaneous saccharification and fermentation (SSF) or continuous fermentation is used to produce the ethanol. In another embodiment, the ethanol is produced using a sugar. In another embodiment, batch fermentation or continuous fermentation is used to produce the ethanol. In another embodiment, the ethanol is produced using a lignocellulosic sugar. In anotherembodiment, simultaneous saccharification and fermentation (SSF) or Separate Hydrolysis and Fermentation (SHF) is used to produce the ethanol.

[0026] Another aspect of the disclosure provides a composition comprising the yeast strain as described herein or the derivative as described herein and one or more components selected from surfactants, emulsifiers, gums, swelling agents, protectants, and antioxidants. In an embodiment, the composition comprises one or more defining characteristics selected from: (a) a higher ethanol yield than Y1953 under the same fermentation conditions; (b) an increased temperature tolerance compared to Y1953; (c) a higher fructose utilization than Y1953 under the same fermentation conditions; (d) a higher ethanol to glycerol ratio compared to Y1953 under the same fermentation conditions; and (e) an increased fermentation rate compared to Y1953 under the same fermentation conditions. In another embodiment, the yeast has a higher temperature tolerance than the Y1953 strain from 34°C to 38°C.

[0027] Another aspect of the disclosure provides a process for producing ethanol from a biomass by contacting the biomass with the composition as described herein. In an embodiment, the ethanol is used for fuel ethanol, industrial ethanol, potable ethanol, or a combination thereof. In another embodiment, the ethanol is produced using a starch. In another embodiment, simultaneous saccharification and fermentation (SSF) or continuous fermentation is used to produce the ethanol. In another embodiment, the ethanol is produced using a sugar. In another embodiment, batch fermentation or continuous fermentation is used to produce the ethanol. In another embodiment, the ethanol is produced using a lignocellulosic sugar. In another embodiment, simultaneous saccharification and fermentation (SSF) or Separate Hydrolysis and Fermentation (SHF) is used to produce the ethanol.

[0028] Another aspect of the disclosure provides a method of producing a fermentation product from a substrate by contacting the substrate with a fermenting organism, wherein the fermenting organism is selected from: (a) Saccharomyces strain Y2175, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y- 68316, or a derivative thereof; (b) Saccharomyces strain Y2177, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68318, or a derivative thereof; and (c) Saccharomyces strain Y2178, a representative sample of the strainhaving been deposited under NRRL Patent Deposit Designation No. Y-68317, or a derivative thereof. In an embodiment, the substrate comprises or originates from sugar cane, sugar beet, sweet sorghum, agave, corn, wheat, rice, barley, rye, sorghum, triticale, potato, sweet potato, cassava, or a combination thereof. In another embodiment, the fermentation product is ethanol. In another embodiment, the ethanol is used for fuel ethanol, industrial ethanol, potable ethanol, or a combination thereof. In another embodiment, batch fermentation, continuous fermentation, simultaneous saccharification and fermentation (SSF), or Separate Hydrolysis and Fermentation (SHF) is used to produce the fermentation product.

[0029] The disclosure provides for other aspects and embodiments that will be apparent in light of the following detailed description and accompanying figures.BRIEF DESCRIPTION OF THE DRAWINGS

[0030] FIGS. 1A-D are schematics showing processes for making new yeast strains. FIG. 1A is a schematic showing directed mating. FIG. 1B is a schematic showing mass mating.FIG. 1C is a schematic showing directed evolution of yeast strains. FIG. 1D is a schematic showing mutagenesis of yeast strains.

[0031] FIGS. 2A-E are graphs showing fermentation results from yeast products derived from yeast strains Fali® S strain, Y2175, Y2177, and Y2178 in cane syrup fermentation media containing -26.5 %w / v fermentable sugars. FIG. 2A is a graph showing ethanol concentration after a 48-hour fermentation; FIG. 2B is a graph showing ethanol yield after a 48-hour fermentation; FIG. 2C is a graph showing ethanol to glycerol ratio after a 48-hour fermentation; and FIG. 2D is a graph showing fructose concentration after a 48-hour fermentation. FIG. 2E is a graph showing the rate defined as the mass loss at 26 hours of fermentation.

[0032] FIG. 3 shows a heatmap of the percentage of the merged genomic variants dataset that have different genotypes in the compared strains. Variant calling was performed using Illumina sequencing data.

[0033] FIG. 4 shows the gel image generated by the QIAxcel ScreenGel 1.6.0 software capturing the results from capillary electrophoresis of PCR amplification products of genomic DNA using primers for detecting variation in YDR170C and YLR278C loci. The loading order is as follows: 1) Y2175; 2) Y2177; 3) Y2178; 4) AB Mauri Fali® M; 5) Indian Yeast Company HRC3; 6) Zillo Lorenzetti Group BG1 ; 7) Mauri Brasil Industria Ltd C7; 8) Fleischmann’s LTU- 26; 9) Fermentec Brasil PE-2; 10) Fermentec Brasil CAT-1 ; 11) Lallemand EDV46; 12) Fermentis Ethanol Red; 13) Radico Indian Molasses strain; 14) Nature Biochem Y-Max isolate C1 ; 15) AB Mauri Fali® S; 16) Novozymes Innova Fit; 17) Rymco Pty Ltd (Anchor Yeast) Thermosacc XL; 18) No Template Control; 19) Salmon DNA (20 ng). Fragment sizing was performed using the QX DNA Size Marker 100 bp - 2.5 kb (Qiagen Catalog Number: 929559) and the QX Alignment Marker 15 bp / 5 kb (Qiagen Catalog Number: 929524).DETAILED DESCRIPTION

[0034] Described herein are fermenting organisms that comprise one or more defining characteristics that include a higher ethanol yield, higher fructose utilization, higher temperature and inhibitor tolerance, and higher fermentation rate relative to current industry standard yeasts used in yeast products such as Fali® S, under the same fermentation conditions. Also described herein are Saccharomyces yeast strains that have improved properties compared to the yeast strain used in Fali® S. The present disclosure relates to processes for manufacturing yeast products from yeast strains. The present disclosure also relates to improved processes of producing ethanol from different fermentable biomass materials using the fermenting organisms described herein.1. Definitions

[0035] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In case of conflict, the present document, including definitions, will control. Preferred methods and materials are described below, although methods and materials similar or equivalent to those described herein can be used in practice or testing of the present invention. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference intheir entirety. The materials, methods, and examples disclosed herein are illustrative only and not intended to be limiting.

[0036] The terms “comprise(s),” “include(s),” “having,” “has,” “can,” “contain(s),” and variants thereof, as used herein, are intended to be open-ended transitional phrases, terms, or words that do not preclude the possibility of additional acts or structures. The singular forms “a,” “and,” and “the” include plural references unless the context clearly dictates otherwise. The present disclosure also contemplates other embodiments “comprising,” “consisting of,” and “consisting essentially of,” the embodiments or elements presented herein, whether explicitly set forth or not.

[0037] For the recitation of numeric ranges herein, each intervening number there between with the same degree of precision is explicitly contemplated. For example, for the range of 6-9, the numbers 7 and 8 are contemplated in addition to 6 and 9; for the range 6.0-7.0, the number 6.0, 6.1 , 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are explicitly contemplated; and for the range from 1 to 5, the numbers 2, 3, and 4 are contemplated in addition to 1 and 5. The term “about” or “approximately” as used herein as applied to one or more values of interest, refers to a value that is similar to a stated reference value, or within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, such as the limitations of the measurement system. In certain aspects, the term “about” refers to a range of values that fall within 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value). Alternatively, “about” can mean within 3 or more than 3 standard deviations, per the practice in the art. Alternatively, such as with respect to biological systems or processes, the term “about” can mean within an order of magnitude, preferably within 5-fold, and more preferably within 2-fold, of a value.

[0038] As used herein the term “biomass” refers to any organic matter of plant origin that can become a carbohydrate source after conversion. Preferably, the biomass may be derived from agricultural or food-processing products and / or coproducts. In particular, the biomass maybe rich in sucrose or in starch, and is chosen from, or is derived from, for example, sorghum, sugar cane, sugar beet, sweet sorghum, agave, corn, wheat, rice, barley, rye, sorghum, triticale, potato, sweet potato, cassava, or a mixture thereof.

[0039] As used herein, “combining of DNA” between yeast strains refers to combining of all or a part of the genome of the yeast strains. Combining of DNA between yeast strains may be by any method suitable for combining DNA of at least two yeast cells, and may include, for example, mating methods which comprise sporulation of the yeast strains to produce haploid cells and subsequent hybridizing or mating of compatible haploid cells; cytoduction; or cell fusion such as protoplast fusion.

[0040] As used herein, a “derivative” is a yeast strain derived from a yeast strain disclosed herein (e.g., Saccharomyces or in the Saccharomyces sensu stricto clade), including through sporulation, hybridization, mutagenesis, recombinant DNA technology, genome editing technology, mating, cell fusion, or cytoduction between yeast strains. The derivative strain may be a direct progeny (i.e., the product of a mating between a strain of the invention and another strain or itself).

[0041] As used herein, “ethanol yield from glucose” is the yield of ethanol that would be achieved from glucose alone or in combination with other fermentable sugars present in the biomass expressed as “glucose equivalents”. In one embodiment, the ethanol yield from glucose is represented by the statement: one molecule of glucose yields two molecules of ethanol and two molecules of carbon dioxide. In another embodiment, the ethanol yield from glucose is represented by the chemical formula: CeH^Oe — > 2 C2H5OH + 2 CO2, where CeH^Oe is the chemical formula for glucose and fructose, C2H5OH is the chemical formula for ethanol, and CO2 is the chemical formula for carbon dioxide. In another embodiment, the ethanol yield from glucose is represented on a mass basis, where 1 .0 gram glucose or fructose yields 0.511 gram ethanol and 0.489 gram carbon dioxide. The highest ethanol yield from glucose or fructose is two molecules of ethanol from one molecule of glucose or fructose. The highest ethanol yield on a mass basis is 0.511 gram ethanol from one gram glucose or fructose.

[0042] As used herein, the term “glucose equivalent” or “glucose equivalents” refers to the mass of fermentation molecules other than glucose expressed as the equivalent mass of glucose. For example, 1 .0 gram sucrose is equivalent to 1.053 gram glucose and 1 gram ethanol is equivalent to 1.957 gram glucose.

[0043] The term “the control” is used interchangeably with “Fali® S strain” when discussing yeast strains and “Fali® S” when discussing yeast products. The “Fali® S strain” is identical to the Y1953 strain residing in the AB Mauri culture collection. The Fali® S strain is used to manufacture the yeast product Fali® S. Fali® S can be manufactured as an active dried yeast product, as a crumble yeast product, and as a liquid yeast product for use in fermentation of substrates to fuel ethanol, industrial ethanol, and to potable ethanol. Fali® S is particularly well- suited for use in fermentation of sucrose, glucose, and fructose liberated from biomass containing those sugars and in fermentation of sugar liberated from starch-containing biomass following liberation of sugars by the action of enzymatic or chemical processes. Fali® S can be used in batch fermentation, continuous fermentation, and simultaneous saccharification fermentations (SSF) of starch substrates. It has a high tolerance to liberated glucose, a moderate ethanol and temperature tolerance, and moderate organic acid tolerance. It rehydrates well in direct pitch applications and can be used in conjunction with glucoamylase and alpha amylase enzyme systems. Fali® S has an optimal performance within a pH range of 4.0 to 5.0 but can ferment well in a pH range of 3.5 to 6.0. Optimal fermentation temperature of Fali® S is dependent on stresses present (e.g., organic acid, ethanol, and pH) but generally ferments well in a temperature range of about 32°C to 34°C. Fali® S is commercially available from AB Mauri®.

[0044] The term “fermentation medium” refers to the environment in which fermentation, using a fermenting organism, is carried out and which includes the fermentable substrate, that is, a carbohydrate source (e.g., sucrose, glucose, or fructose) that can be metabolized by the fermenting organism into a desired fermentation product, such as ethanol. The fermentation medium may comprise fermentation nutrients for the fermenting organism. Fermentation nutrients are widely used in the art of fermentation and include nitrogen sources (e.g., ammonia, urea), vitamins, minerals, or combinations thereof. “Feed” is a fermentation medium; however, the feed may have a different composition than the fermentation medium.

[0045] “High-yield ethanol production,” as used herein, means an ethanol production by fermentation wherein the ethanol yield is near theoretical ethanol yield from glucose or other fermentable sugars. In the case of sugar substrates comprising or consisting of sucrose, fructose and glucose, high-yield ethanol production requires the ability to utilize fructose. High- yield ethanol production requires limited formation of byproducts, such as glycerol, and yeast growth during fermentation.

[0046] The terms “improved,” “increased,” “enhanced,” or “greater” as used herein refer to the heightening or bettering of a particular characteristic or trait as compared to other similar organisms, a control, or a wild-type organism. Typically, this is a fermentation-related advantageous trait.

[0047] The term “inoculum” is intended to mean an amount of the microorganism that is added to the main fermenter in order to start the fermentation process. In case of a fermentation process using seed fermenter the inoculum is typically an amount of the preculture corresponding to 5 to 20% of the volume of the main fermenter.

[0048] The term “isolated” means a substance in a form or environment that does not occur in nature. Non-limiting examples of isolated substances include (1) any non-naturally occurring substance, (2) any substance including, but not limited to, any enzyme, variant, nucleic acid, protein, peptide or cofactor, that is at least partially removed from one or more or all of the naturally occurring constituents with which it is associated in nature; (3) any substance modified by the hand of man relative to that substance found in nature; or (4) any substance modified by increasing the amount of the substance relative to other components with which it is naturally associated (e.g., recombinant production in yeast; multiple copies of a gene encoding the substance; and use of a stronger promoter than the promoter naturally associated with the gene encoding the substance). In particular, the isolated substance may be an isolated yeast cell, a yeast culture, or a yeast product containing viable yeast (e.g., active dry yeast). An isolated substance may be present in a fermentation broth sample; for example, a yeast may be genetically modified to express a particular polypeptide. The fermentation broth from that yeast will comprise the isolated polypeptide.

[0049] The term “low pH” as used herein refers to a pH from about 2.5 to about 4.5. A low pH is preferably less than about 4.5. The term “normal pH” as used herein refers to a pH from about 4.0 to about 6.0. A normal pH is preferably about 5.0.

[0050] The term “main fermenter” as used herein is used for the final fermenter used in a fermentation process for producing a fermentation product, wherein the intended fermentation product is produced.

[0051] The terms “parental” or “parent” strain refers to a yeast strain from which a derivative strain is derived. In some embodiments, a derivative may also be a parent.

[0052] The term “preculture” is understood as a liquid actively growing culture of the microorganism (i.e. , yeast) used for inoculating the main fermenter. Actively growing is intended to mean that the culture is in a stage where the microorganism is increasing the number of cells. The preculture is in general used as inoculation material in order to avoid or reduce the lag phase in the main fermenter. In fermentation to manufacture ethanol, cells in a pre-fermenter are typically conditioned. The idea is not to produce yeast biomass, as the carbon in the biomass reduces the carbon going to ethanol. There is fermentative growth, but it is not desirable to promote aerobic growth (e.g., using a seed fermenter). Alternatively, yeast may be added directly to the main fermenter by “direct pitch.”

[0053] As used herein, the terms “properties” and “defining characteristics” of the Saccharomyces cerevisiae strains as detailed herein include at least increased ethanol yield compared to the control (i.e., Fali® S or the Fali® S strain) under the same process conditions. Other “properties” and “defining characteristics” include, inter alia, increased temperature tolerance, increased fermentation rate, increased ethanol production, and decreased glycerol production. A fermenting organism described herein, for example, used in a process described herein may have one or more the above mentioned “properties” and “defining characteristics.”

[0054] The term “pre-fermenter” is intended to mean a fermenter wherein the preculture is formed by fermenting the microorganism until the yeast are activated and conditioned for inoculation into the main fermenter. When a pre-fermenter is not used, “direct pitch” is used.

[0055] As used herein, a “substrate” is a molecule that can be directly or indirectly metabolized to ethanol by fermentation by Saccharomyces or any of the yeast or yeast products described herein.

[0056] The term “temperature excursion”, as used herein, refers to the unintentional increase in the fermentation medium temperature by at least 0.5°C above the programmed fermentation temperature set points (e.g., due to loss in cooling controls). In some instances, temperature excursions may be represented by a constant temperature exceeding the temperature set point. In other instances, temperature excursions may be represented by a gradual increase in temperature above the programmed fermentation temperature.

[0057] The term “wild-type” as used herein refers to the typical form of an organism or its genetic material, as it normally occurs, as distinguished from a selected organism.

[0058] The term “yeast product” and “composition” are used interchangeably herein and as used herein refers to a composition that includes, among other things, dry yeast, starches and emulsifiers. A yeast product may also be a liquid composition that includes, among other things, cream yeast, glycerol, and xanthan gum.

[0059] Unless otherwise defined herein, scientific and technical terms used in connection with the present disclosure shall have the meanings that are commonly understood by those of ordinary skill in the art. For example, any nomenclatures used in connection with, and techniques of, cell biology, molecular biology, microbiology, genetics, and protein and nucleic acid chemistry described herein are those that are well known and commonly used in the art. The meaning and scope of the terms should be clear; in the event however of any latent ambiguity, definitions provided herein take precedent over any dictionary or extrinsic definition.Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular.2. Yeast Strains and Yeast Strain Derivatives

[0060] Yeast strains and yeast strain derivatives, as used herein, can be any yeast useful for ethanol production, including, but not limited to, Saccharomyces, Zygosaccharomyces, Brettanomyces, and Kluyveromyces. Preferably, the yeast may be a Saccharomyces sp., even more preferably it may be a Saccharomyces cerevisiae.

[0061] In addition, the Saccharomyces yeast strains and the derivatives thereof described herein can be readily distinguished from: (a) naturally occurring strains of Saccharomyces’, (b) contaminating strains of Saccharomyces’, and (c) other strains used in the ethanol industry that do not have the ethanol producing capabilities and defining characteristics of the strains described herein.

[0062] In some embodiments, one or more of the yeast strains and the derivatives thereof as described herein have a statistically significantly higher ethanol yield than typical yeast strains used for fermentation (e.g., the Fali® S strain). In some embodiments, one or more of the yeast strains and the derivatives thereof as described herein have a statistically significantly higher ethanol yield than typical yeast strains used for fermentation (e.g., the Fali® S strain) at a temperature range from 20°C to 40°C, preferably a range from 34°C to 38°C. For example, one or more of the yeast strains and the derivatives thereof as described herein have a statistically significantly higher ethanol yield than typical yeast strains used for fermentation (e.g., the Fali® S strain) when subjected to a temperature ramp from 20°C to 40°C, preferably a range from 34°C to 38°C, simulating a temperature excursion. A temperature ramp protocol may comprise an incubation at from about 20°C to about 36°C, a linear ramp of from about +1°C / hour to about +2°C / hour, an incubation at from about 36°C to about 40°C, a linear ramp of from about -0.1 °C / hour to about -0.8°C / hour, and the yeast stains may be held at the final ramp temperature for up to 48 hours. For example, a temperature ramp protocol may be as follows: about 34°C for about 2 hours, linear ramp to about 38°C over about 3 hours, hold at about 38°C for about 1 hour, linear ramp to about 36°C over about 4 hours, final hold at about 36°C for the remainderof time up to 48 hours. In a particular embodiment, one or more of the yeast strains and the derivatives thereof as described herein have a statistically significantly higher ethanol yield than typical yeast strains used for fermentation (e.g., the Fali® S strain) when the fermentation temperature profile is set to a high temperature ramp. The inventors have surprisingly found that the yeast strains described herein result in a statistically significantly higher ethanol yield compared to the Fali® S strain under the same fermentation conditions. The inventors have also surprisingly found that the derivatives described herein generally result in a statistically significantly higher ethanol yield compared to the Fali® S strain under the same conditions.

[0063] In some embodiments, one or more of the yeast strains and the derivatives thereof as described herein has at least about 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 1.1%, 1.2%, 1.3%, 1.4%, 1.5%, 1.6%, 1.7%, 1.8%, 1.9%, 2.0%, 2.1 %, 2.2%, 2.3%, 2.4%, 2.5%, 2.6%, 2.7%, 2.8%, 2.9%, 3.0%, 3.1%, 3.2%, 3.3%, 3.4%, 3.5%, 3.6%, 3.7%, 3.8%, 3.9%, or 4.0% higher ethanol yield after 48 hours of fermentation relative to typical yeast strains used for fermentation (e.g., the Fali® S strain). In some embodiments, one or more of the yeast strains and the derivatives thereof as described herein have at most about 1.0%, 1.1%, 1.2%, 1.3%, 1.4%, 1.5%, 1.6%, 1.7%, 1.8%, 1.9%, 2.0%, 2.1%, 2.2%, 2.3%, 2.4%, 2.5%, 2.6%, 2.7%, 2.8%, 2.9%, 3.0%, 3.1%, 3.2%, 3.3%, 3.4%, 3.5%, 3.6%, 3.7%, 3.8%, 3.9%, or 4.0% higher ethanol yield after 48 hours of fermentation relative to typical yeast strains used for fermentation (e.g., the Fali® S strain). In some embodiments, one or more of the yeast strains and the derivatives thereof as described herein have about 0.1%-4.0% (i.e. from about 0.1 % to about 4.0%), 0.2%-4.0%, 0.3%-4.0%, 0.4%-4.0%, 0.5%-4.0%, 0.6%-4.0%, 0.7%-4.0%, 0.8%-4.0%, 0.9%-4.0%, 1.0%-4.0%, 1.1%-4.0%, 1.2%-4.0%, 1.3%-4.0%, 1.4%-4.0%, 1.5%-4.0%, 1.6%- 4.0%, 1.7%-4.0%, 1.8%-4.0%, 1.9%-4.0%, 2.0%-4.0%, 2.1 %-4.0%, 2.2%-4.0%, 2.3%-4.0%, 2.4%-4.0%, 2.5%-4.0%, 2.6%-4.0%, 2.7%-4.0%, 2.8%-4.0%, 2.9%-4.0%, 3.0%-4.0%, 3.1 %- 4.0%, 3.2%-4.0%, 3.3%-4.0%, 3.4%-4.0%, 3.5%-4.0%, 3.6%-4.0%, 3.7%-4.0%, 3.8%-4.0%, 3.9%-4.0%, 0.1%-3.0%, 0.2%-3.0%, 0.3%-3.0%, 0.4%-3.0%, 0.5%-3.0%, 0.6%-3.0%, 0.7%- 3.0%, 0.8%-3.0%, 0.9%-3.0%, 1.0%-3.0%, 1.1 %-3.0%, 1 ,2%-3.0%, 1.3%-3.0%, 1.4%-3.0%, 1 ,5%-3.0%, 1.6%-3.0%, 1.7%-3.0%, 1.8%-3.0%, 1.9%-3.0%, 2.0%-3.0%, 2.1%-3.0%, 2.2%- 3.0%, 2.3%-3.0%, 2.4%-3.0%, 2.5%-3.0%, 2.6%-3.0%, 2.7%-3.0%, 2.8%-3.0%, 2.9%-3.0%, 0.1 %-2.0%, 0.2%-2.0%, 0.3%-2.0%, 0.4%-2.0%, 0.5%-2.0%, 0.6%-2.0%, 0.7%-2.0%, 0.8%- 2.0%, 0.9%-2.0%, 1.0%-2.0%, 1.1%-2.0%, 1.2%-2.0%, 1 ,3%-2.0%, 1.4%-2.0%, 1.5%-2.0%, 1.6%-2.0%, 1.7%-2.0%, 1.8%-2.0%, 1.9%-2.0%, 0.1 %-1.0%, 0.2%-1.0%, 0.3%-1.0%, 0.4%-1.0%, 0.5%-1.0%, 0.6%-1.0%, 0.7%-1.0%, 0.8%-1.0%, or 0.9%-1.0% higher ethanol yield after48 hours of fermentation relative to typical yeast strains used for fermentation (e.g., the Fali® S strain).

[0064] In some embodiments, one or more of the yeast strains and the derivatives thereof as described herein have a statistically significantly higher fructose utilization than typical yeast strains used for fermentation (e.g., the Fali® S strain). In some embodiments, one or more of the yeast strains and the derivatives thereof as described herein have a statistically significantly higher relative fructose utilization than typical yeast strains used for fermentation (e.g., the Fali® S strain) at a temperature ranging from 20°C to 40°C, preferably from 34°C to 38°C. For example, one or more of the yeast strains and the derivatives thereof as described herein have a statistically significantly higher relative fructose utilization than typical yeast strains used for fermentation (e.g., the Fali® S strain) when subjected to a temperature ramp from 20°C to 40°C, preferably a range from 34°C to 38°C, simulating a temperature excursion. A temperature ramp protocol may comprise an incubation at from about 20°C to about 36°C, a linear ramp of from about +1 °C / hour to about +2°C / hour, an incubation at from about 36°C to about 40°C, a linear ramp of from about -0.1 °C / hour to about -0.8°C / hour, and the yeast stains may be held at the final ramp temperature for up to 48 hours. For example, a temperature ramp protocol may be as follows: about 34°C for about 2 hours, linear ramp to about 38°C over about 3 hours, hold at about 38°C for about 1 hour, linear ramp to about 36°C over about 4 hours, final hold at about 36°C for the remainder of time up to 48 hours. In a particular embodiment, the one or more of yeast strains and the derivatives thereof as described herein have a statistically significantly higher fructose utilization than typical yeast strains used for fermentation (e.g., the Fali® S strain) when the fermentation temperature profile is set to a high temperature ramp. The inventors have surprisingly found that one or more of the yeast strains described herein result in a statistically significantly higher fructose utilization compared to the Fali® S strain under the same fermentation conditions. The inventors have also surprisingly found that the derivatives described herein result in a statistically significantly higher fructose utilization compared to the Fali® S strain under the same conditions.

[0065] In some embodiments, one or more of the yeast strains and the derivatives thereof as described herein have at least about 15%, 16%, 17%, 18%, 19%, 20%, 21 %, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%,40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, or 55% higher fructose utilization after 48 hours of fermentation relative to typical yeast strains used for fermentation (e.g., the Fali® S strain). In some embodiments, one or more of the yeast strains and the derivatives thereof as described herein have at most about 20%, 21 %, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, or 55% higher fructose utilization after 48 hours of fermentation relative to typical yeast strains used for fermentation (e.g., the Fali® S strain). In some embodiments, one or more of the yeast strains and the derivatives thereof as described herein have about 15%-55% (i.e. from about 15% to about 55%), 16%-55%, 17%-55%, 18%-55%, 19%-55%, 20%-55%, 21%-55%, 22%-55%, 23%- 55%, 24%-55%, 25%-55%, 26%-55%, 27%-55%, 28%-55%, 29%-55%, 30%-55%, 31 %-55%, 32%-55%, 33%-55%, 34%-55%, 35%-55%, 36%-55%, 37%-55%, 38%-55%, 39%-55%, 40%- 55%, 41%-55%, 42%-55%, 43%-55%, 44%-55%, 45%-55%, 46%-55%, 47%-55%, 48%-55%, 49%-55%, 50%-55%, 51%-55%, 52%-55%, 53%-55%, 54%-55%, 15%-50%, 16%-50%, 17%- 50%, 18%-50%, 19%-50%, 20%-50%, 21 %-50%, 22%-50%, 23%-50%, 24%-50%, 25%-50%, 26%-50%, 27%-50%, 28%-50%, 29%-50%, 30%-50%, 31 %-50%, 32%-50%, 33%-50%, 34%- 50%, 35%-50%, 36%-50%, 37%-50%, 38%-50%, 39%-50%, 40%-50%, 41%-50%, 42%-50%, 43%-50%, 44%-50%, 45%-50%, 46%-50%, 47%-50%, 48%-50%, 49%-50%, 15%-45%, 16%- 45%, 17%-45%, 18%-45%, 19%-45%, 20%-45%, 21%-45%, 22%-45%, 23%-45%, 24%-45%, 25%-45%, 26%-45%, 27%-45%, 28%-45%, 29%-45%, 30%-45%, 31%-45%, 32%-45%, 33%- 45%, 34%-45%, 35%-45%, 36%-45%, 37%-45%, 38%-45%, 39%-45%, 40%-45%, 41%-45%, 42%-45%, 43%-45%, 44%-45%, 15%-40%, 16%-40%, 17%-40%, 18%-40%, 19%-40%, 20%- 40%, 21%-40%, 22%-40%, 23%-40%, 24%-40%, 25%-40%, 26%-40%, 27%-40%, 28%-40%, 29%-40%, 40%-40%, 31%-40%, 32%-40%, 33%-40%, 34%-40%, 35%-40%, 36%-40%, 37%- 40%, 38%-40%, 39%-40%, 15%-35%, 16%-35%, 17%-35%, 18%-35%, 19%-35%, 20%-35%, 21 %-35%, 22%-35%, 23%-35%, 24%-35%, 25%-35%, 26%-35%, 27%-35%, 28%-35%, 29%- 35%, 35%-35%, 31%-35%, 32%-35%, 33%-35%, 34%-35%, 15%-30%, 16%-30%, 17%-30%, 18%-30%, 19%-30%, 20%-30%, 21 %-30%, 22%-30%, 23%-30%, 24%-30%, 25%-30%, 26%- 30%, 27%-30%, 28%-30%, 29%-30%, 15%-29%, 16%-29%, 17%-29%, 18%-29%, 19%-29%, 20%-29%, 21 %-29%, 22%-29%, 23%-29%, 24%-29%, 25%-29%, 26%-29%, 27%-29%, 28%- 29%, 15%-28%, 16%-28%, 17%-28%, 18%-28%, 19%-28%, 20%-28%, 21%-28%, 22%-28%, 23%-28%, 24%-28%, 25%-28%, 26%-28%, 27%-28%, 15%-27%, 16%-27%, 17%-27%, 18%- 27%, 19%-27%, 20%-27%, 21 %-27%, 22%-27%, 23%-27%, 24%-27%, 25%-27%, 26%-27%, 15%-26%, 16%-26%, 17%-26%, 18%-26%, 19%-26%, 20%-26%, 21%-26%, 22%-26%, 23%-26%, 24%-26%, 25%-26%, 15%-25%, 16%-25%, 17%-25%, 18%-25%, 19%-25%, 20%-25%, 21%-25%, 22%-25%, 23%-25%, 24%-25%, 15%-24%, 16%-24%, 17%-24%, 18%-24%, 19%- 24%, 20%-24%, 21%-24%, 22%-24%, 23%-24%, 15%-23%, 16%-23%, 17%-23%, 18%-23%, 19%-23%, 20%-23%, 21 %-23%, 22%-23%, 15%-22%, 16%-22%, 17%-22%, 18%-22%, 19%- 22%, 20%-22%, 21%-22%, 15%-21 %, 16%-21 %, 17%-21 %, 18%-21%, 19%-21%, 20%-21%, 15%-20%, 16%-20%, 17%-20%, 18%-20%, 19%-20%, 15%-19%, 16%-19%, 17%-19%, 18%- 19%, 15%-18%, 16%-18%, 17%-18%, 15%-17%, 16%-17%, or 15%- 16% higher fructose utilization after 48 hours of fermentation relative to typical yeast strains used for fermentation (e.g., the Fali® S strain).

[0066] In some embodiments, one or more of the yeast strains and the derivatives thereof as described herein have a statistically significantly higher ethanol to glycerol ratio than typical yeast strains used for fermentation (e.g., the Fali® S strain). In some embodiments, one or more of the yeast strains and the derivatives thereof as described herein have a statistically significantly higher ethanol to glycerol ratio than typical yeast strains used for fermentation (e.g., the Fali® S strain) at a temperature ranging from 20°C to 40°C, preferably from 34°C to 38°C. For example, one or more of the yeast strains and the derivatives thereof as described herein have a statistically significantly higher ethanol to glycerol ratio than typical yeast strains used for fermentation (e.g., the Fali® S strain) when subjected to a temperature ramp from 20°C to 40°C, preferably a range from 34°C to 38°C, simulating a temperature excursion. A temperature ramp protocol may comprise an incubation at from about 20°C to about 36°C, a linear ramp of from about +1 °C / hour to about +2°C / hour, an incubation at from about 36°C to about 40°C, a linear ramp of from about -0.1 °C / hour to about -0.8°C / hour, and the yeast stains may be held at the final ramp temperature for up to 48 hours. For example, a temperature ramp protocol may be as follows: about 34°C for about 2 hours, linear ramp to about 38°C over about 3 hours, hold at about 38°C for about 1 hour, linear ramp to about 36°C over about 4 hours, final hold at about 36°C for the remainder of time up to 48 hours. In a particular embodiment, one or more of the yeast strains and the derivatives thereof as described herein have a statistically significantly higher ethanol to glycerol ratio than typical yeast strains used for fermentation (e.g., the Fali® S strain) when the fermentation temperature profile is set to a high temperature ramp. The inventors have surprisingly found that the yeast strains described herein result in a statistically significantly higher ethanol to glycerol ratio compared to the Fali® S strain under the same fermentation conditions. The inventors have also surprisingly found that the derivativesdescribed herein result in a statistically significantly higher ethanol to glycerol ratio compared to the Fali® S strain under the same conditions.

[0067] In some embodiments, one or more of the yeast strains and the derivatives thereof as described herein have at least about 0.5%, 0.8%, 1.1 %, 1.4%, 1.7%, 2.0%, 2.3%, 2.6%, 2.9%, 3.2%, 3.5%, 3.8%, 4.1 %, 4.4%, 4.7%, 5.0%, 5.3%, 5.6%, 5.9%, 6.2%, 6.5%, 6.8%, 7.1 %, 7.4%, 7.7%, 8.0%, 8.3%, 8.6%, 8.9%, 9.2%, 9.5%, 9.8%, 10.1 %, 10.4%, 10.7%, 11.0%, 11.3%, 11.6%, 11.9%, 12.2%, 12.5%, 12.8%, 13.1%, 13.4%, 13.7%, 14.0%, 14.3%, 14.6%, 14.9%, 15.2%, 15.5%, 15.8%, 16.1%, 16.4%, 16.7%, 17.0%, 17.3%, 17.6%, 17.9%, 18.2%, 18.5%, 18.8%, 19.1%, 19.4%, 19.7%, or 20.0% higher ethanol to glycerol ratio after 48 hours of fermentation relative to typical yeast strains used for fermentation (e.g., the Fali® S strain). In some embodiments, one or more of the yeast strains and the derivatives thereof as described herein have at most about 2.0%, 2.3%, 2.6%, 2.9%, 3.2%, 3.5%, 3.8%, 4.1%, 4.4%, 4.7%, 5.0%, 5.3%, 5.6%, 5.9%, 6.2%, 6.5%, 6.8%, 7.1 %, 7.4%, 7.7%, 8.0%, 8.3%, 8.6%, 8.9%, 9.2%, 9.5%, 9.8%, 10.1%, 10.4%, 10.7%, 11.0%, 11.3%, 11.6%, 11.9%, 12.2%, 12.5%, 12.8%, 13.1%, 13.4%, 13.7%, 14.0%, 14.3%, 14.6%, 14.9%, 15.2%, 15.5%, 15.8%, 16.1%, 16.4%, 16.7%, 17.0%, 17.3%, 17.6%, 17.9%, 18.2%, 18.5%, 18.8%, 19.1%, 19.4%, 19.7%, or 20.0% higher ethanol to glycerol ratio after 48 hours of fermentation relative to typical yeast strains used for fermentation (e.g., the Fali® S strain). In some embodiments, the yeast strains and the derivatives thereof as described herein have about 0.5%-20% (i.e. from about 0.5% to about 20%), 0.5%-20%, 0.8%-20%, 1.1%-20%, 1.4%-20%, 1.7%-20%, 2%-20%, 2.3%-20%, 2.6%- 20%, 2.9%-20%, 3.2%-20%, 3.5%-20%, 3.8%-20%, 4.1 %-20%, 4.4%-20%, 4.7%-20%, 5%- 20%, 5.3%-20%, 5.6%-20%, 5.9%-20%, 6.2%-20%, 6.5%-20%, 6.8%-20%, 7.1 %-20%, 7.4%- 20%, 7.7%-20%, 8%-20%, 8.3%-20%, 8.6%-20%, 8.9%-20%, 9.2%-20%, 9.5%-20%, 9.8%- 20%, 10.1%-20%, 10.4%-20%, 10.7%-20%, 11%-20%, 11.3%-20%, 11.6%-20%, 11 ,9%-20%, 12.2%-20%, 12.5%-20%, 12.8%-20%, 13.1 %-20%, 13.4%-20%, 13.7%-20%, 14%-20%, 14.3%- 20%, 14.6%-20%, 14.9%-20%, 15.2%-20%, 15.5%-20%, 15.8%-20%, 16.1 %-20%, 16.4%-20%, 16.7%-20%, 17%-20%, 17.3%-20%, 17.6%-20%, 17.9%-20%, 18.2%-20%, 18.5%-20%, 18.8%- 20%, 19.1%-20%, 19.4%-20%, 19.7%-20%, 0.5%-19.1%, 0.8%-19.1 %, 1.1 %-19.1 %, 1.4%- 19.1%, 1 ,7%-19.1%, 2%-19.1%, 2.3%-19.1 %, 2.6%-19.1 %, 2.9%-19.1 %, 3.2%-19.1%, 3.5%- 19.1%, 3.8%-19.1%, 4.1%-19.1 %, 4.4%-19.1 %, 4.7%-19.1%, 5%-19.1 %, 5.3%-19.1%, 5.6%- 19.1%, 5.9%-19.1%, 6.2%-19.1 %, 6.5%-19.1 %, 6.8%-19.1%, 7.1%-19.1%, 7.4%-19.1%, 7.7%- 19.1%, 8%-19.1%, 8.3%-19.1%, 8.6%-19.1 %, 8.9%-19.1 %, 9.2%-19.1 %, 9.5%-19.1%, 9.8%-.1%, 10.1%-19.1 %, 10.4%-19.1%, 10.7%-19.1%, 11%-19.1%, 11.3%-19.1%, 11.6%-19.1 %,.9%-19.1%, 12.2%-19.1%, 12.5%-19.1%, 12.8%-19.1%, 13.1%-19.1%, 13.4%-19.1 %, 13.7%-.1%, 14%-19.1 %, 14.3%-19.1%, 14.6%-19.1%, 14.9%-19.1%, 15.2%-19.1%, 15.5%-19.1%,.8%-19.1%, 16.1 %-19.1%, 16.4%-19.1 %, 16.7%-19.1%, 17%-19.1%, 17.3%-19.1 %, 17.6%-.1%, 17.9%-19.1 %, 18.2%-19.1%, 18.5%-19.1%, 18.8%-19.1%, 0.5%-17.9%, 0.8%-17.9%, %-17.9%, 1.4%-17.9%, 1 ,7%-17.9%, 2%-17.9%, 2.3%-17.9%, 2.6%-17.9%, 2.9%-17.9%,%-17.9%, 3.5%-17.9%, 3.8%-17.9%, 4.1%-17.9%, 4.4%-17.9%, 4.7%-17.9%, 5%-17.9%,%-17.9%, 5.6%-17.9%, 5.9%-17.9%, 6.2%-17.9%, 6.5%-17.9%, 6.8%-17.9%, 7.1 %-17.9%,%-17.9%, 7.7%-17.9%, 8%-17.9%, 8.3%-17.9%, 8.6%-17.9%, 8.9%-17.9%, 9.2%-17.9%,%-17.9%, 9.8%-17.9%, 10.1 %-17.9%, 10.4%-17.9%, 10.7%-17.9%, 11%-17.9%, 11.3%-.9%, 11.6%-17.9%, 11.9%-17.9%, 12.2%-17.9%, 12.5%-17.9%, 12.8%-17.9%, 13.1 %-17.9%,.4%-17.9%, 13.7%-17.9%, 14%-17.9%, 14.3%-17.9%, 14.6%-17.9%, 14.9%-17.9%, 15.2%-.9%, 15.5%-17.9%, 15.8%-17.9%, 16.1%-17.9%, 16.4%-17.9%, 16.7%-17.9%, 17%-17.9%,.3%-17.9%, 17.6%-17.9%, 0.5%-15.8%, 0.8%-15.8%, 1.1%-15.8%, 1 ,4%-15.8%, 1.7%-.8%, 2%-15.8%, 2.3%-15.8%, 2.6%-15.8%, 2.9%-15.8%, 3.2%-15.8%, 3.5%-15.8%, 3.8%-.8%, 4.1 %-15.8%, 4.4%-15.8%, 4.7%-15.8%, 5%-15.8%, 5.3%-15.8%, 5.6%-15.8%, 5.9%-.8%, 6.2%-15.8%, 6.5%-15.8%, 6.8%-15.8%, 7.1 %-15.8%, 7.4%-15.8%, 7.7%-15.8%, 8%-.8%, 8.3%-15.8%, 8.6%-15.8%, 8.9%-15.8%, 9.2%-15.8%, 9.5%-15.8%, 9.8%-15.8%,.1%-15.8%, 10.4%-15.8%, 10.7%-15.8%, 11%-15.8%, 11.3%-15.8%, 11.6%-15.8%, 11.9%-.8%, 12.2%-15.8%, 12.5%-15.8%, 12.8%-15.8%, 13.1%-15.8%, 13.4%-15.8%, 13.7%-15.8%,%-15.8%, 14.3%-15.8%, 14.6%-15.8%, 14.9%-15.8%, 15.2%-15.8%, 15.5%-15.8%, 0.5%-%, 0.8%-14%, 1.1%-14%, 1 _4%-14%, 1.7%-14%, 2%-14%, 2.3%-14%, 2.6%-14%, 2.9%-%, 3.2%-14%, 3.5%-14%, 3.8%-14%, 4.1 %-14%, 4.4%-14%, 4.7%-14%, 5%-14%, 5.3%-%, 5.6%-14%, 5.9%-14%, 6.2%-14%, 6.5%-14%, 6.8%-14%, 7.1 %-14%, 7.4%-14%, 7.7%-%, 8%-14%, 8.3%-14%, 8.6%-14%, 8.9%-14%, 9.2%-14%, 9.5%-14%, 9.8%-14%, 10.1 %-%, 10.4%-14%, 10.7%-14%, 11%-14%, 11.3%-14%, 11.6%-14%, 11.9%-14%, 12.2%-14%,.5%-14%, 12.8%-14%, 13.1%-14%, 13.4%-14%, 13.7%-14%, 0.5%-12.8%, 0.8%-12.8%, %-12.8%, 1.4%-12.8%, 1 ,7%-12.8%, 2%-12.8%, 2.3%-12.8%, 2.6%-12.8%, 2.9%-12.8%,%-12.8%, 3.5%-12.8%, 3.8%-12.8%, 4.1%-12.8%, 4.4%-12.8%, 4.7%-12.8%, 5%-12.8%,%-12.8%, 5.6%-12.8%, 5.9%-12.8%, 6.2%-12.8%, 6.5%-12.8%, 6.8%-12.8%, 7.1 %-12.8%,%-12.8%, 7.7%-12.8%, 8%-12.8%, 8.3%-12.8%, 8.6%-12.8%, 8.9%-12.8%, 9.2%-12.8%,%-12.8%, 9.8%-12.8%, 10.1 %-12.8%, 10.4%-12.8%, 10.7%-12.8%, 11%-12.8%, 11.3%-.8%, 11.6%-12.8%, 11 ,9%-12.8%, 12.2%-12.8%, 12.5%-12.8%, 0.5%-9.8%, 0.8%-9.8%, %-9.8%, 1.4%-9.8%, 1.7%-9.8%, 2%-9.8%, 2.3%-9.8%, 2.6%-9.8%, 2.9%-9.8%, 3.2%-9.8%,3.5%-9.8%, 3.8%-9.8%, 4.1%-9.8%, 4.4%-9.8%, 4.7%-9.8%, 5%-9.8%, 5.3%-9.8%, 5.6%-9.8%, 5.9%-9.8%, 6.2%-9.8%, 6.5%-9.8%, 6.8%-9.8%, 7.1 %-9.8%, 7.4%-9.8%, 7.7%-9.8%, 8%-9.8%, 8.3%-9.8%, 8.6%-9.8%, 8.9%-9.8%, 9.2%-9.8%, 9.5%-9.8%, 0.5%-6.8%, 0.8%-6.8%, 1.1 %- 6.8%, 1.4%-6.8%, 1.7%-6.8%, 2%-6.8%, 2.3%-6.8%, 2.6%-6.8%, 2.9%-6.8%, 3.2%-6.8%, 3.5%-6.8%, 3.8%-6.8%, 4.1%-6.8%, 4.4%-6.8%, 4.7%-6.8%, 5%-6.8%, 5.3%-6.8%, 5.6%-6.8%, 5.9%-6.8%, 6.2%-6.8%, 6.5%-6.8%, 0.5%-5%, 0.8%-5%, 1 .1 %-5%, 1.4%-5%, 1.7%-5%, 2%- 5%, 2.3%-5%, 2.6%-5%, 2.9%-5%, 3.2%-5%, 3.5%-5%, 3.8%-5%, 4.1 %-5%, 4.4%-5%, 4.7%- 5%, 0.5%-2.9%, 0.8%-2.9%, 1 .1 %-2.9%, 1.4%-2.9%, 1.7%-2.9%, 2%-2.9%, 2.3%-2.9%, 2.6%- 2.9%, or 0.5%-0.8% higher ethanol to glycerol ratio after 48 hours of fermentation relative to typical yeast strains used for fermentation (e.g., the Fali® S strain).

[0068] In some embodiments, one or more of the yeast strains and the derivatives thereof as described herein have a higher fermentation rate than typical yeast strains used for fermentation (e.g., the Fali® S strain). In some embodiments, one or more of the yeast strains and the derivatives thereof as described herein have a statistically significantly higher fermentation rate than typical yeast strains used for fermentation (e.g., the Fali® S strain) at a temperature from 20°C to 40°C, preferably from 34°C to 38°C. For example, one or more of the yeast strains and the derivatives thereof as described herein have a statistically significantly higher fermentation rate than typical yeast strains used for fermentation (e.g., the Fali® S strain) when subjected to a temperature ramp from 20°C to 40°C, preferably a range from 34°C to 38°C, simulating a temperature excursion. A temperature ramp protocol may comprise an incubation at from about 20°C to about 36°C, a linear ramp of from about +1°C / hour to about +2°C / hour, an incubation at from about 36°C to about 40°C, a linear ramp of from about -0.1 °C / hour to about -0.8°C / hour, and the yeast stains may be held at the final ramp temperature for up to 48 hours. For example, a temperature ramp protocol may be as follows: about 34°C for about 2 hours, linear ramp to about 38°C over about 3 hours, hold at about 38°C for about 1 hour, linear ramp to about 36°C over about 4 hours, final hold at about 36°C for the remainder of time up to 48 hours. In a particular embodiment, one or more of the yeast strains and the derivatives thereof as described herein have a statistically significantly higher fermentation rate than typical yeast strains used for fermentation (e.g., the Fali® S strain) when the fermentation temperature profile is set to a high temperature ramp. The inventors have surprisingly found that the yeast strains described herein result in a statistically significantly higher fermentation rate compared to the Fali® S strain under the same fermentation conditions. The inventors havesurprisingly found that the derivatives described herein result in a statistically significantly higher fermentation rate compared to the Fali® S strain under the same conditions.

[0069] In some embodiments, one or more of the yeast strains and the derivatives thereof as described herein have a fermentation rate at least about 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 1.1%, 1.2%, 1.3%, 1.4%, 1.5%, 1.6%, 1.7%, 1.8%, 1.9%, 2.0%,2.1 %, 2.2%, 2.3%, 2.4%, 2.5%, 2.6%, 2.7%, 2.8%, 2.9%, 3.0%, 3.1%, 3.2%, 3.3%, 3.4%, 3.5%,3.6%, 3.7%, 3.8%, 3.9%, 4.0%, 4.1%, 4.2%, 4.3%, 4.4%, 4.5%, 4.6%, 4.7%, 4.8%, 4.9%, 5.0%,5.1 %, 5.2%, 5.3%, 5.4%, 5.5%, 5.6%, 5.7%, 5.8%, 5.9%, 6.0%, 6.1%, 6.2%, 6.3%, 6.4%, 6.5%,6.6%, 6.7%, 6.8%, 6.9%, or 7.0% higher than typical yeast strains used for fermentation (e.g., the Fali® S strain) after 26 hours of fermentation. In some embodiments, one or more of the yeast strains and the derivatives thereof as described herein have a fermentation rate at most about 1.0%, 1.1 %, 1.2%, 1.3%, 1.4%, 1.5%, 1.6%, 1.7%, 1.8%, 1.9%, 2.0%, 2.1%, 2.2%, 2.3%,2.4%, 2.5%, 2.6%, 2.7%, 2.8%, 2.9%, 3.0%, 3.1%, 3.2%, 3.3%, 3.4%, 3.5%, 3.6%, 3.7%, 3.8%,3.9%, 4.0%, 4.1 %, 4.2%, 4.3%, 4.4%, 4.5%, 4.6%, 4.7%, 4.8%, 4.9%, 5.0%, 5.1 %, 5.2%, 5.3%,5.4%, 5.5%, 5.6%, 5.7%, 5.8%, 5.9%, 6.0%, 6.1%, 6.2%, 6.3%, 6.4%, 6.5%, 6.6%, 6.7%, 6.8%,6.9%, or 7.0% higher than typical yeast strains used for fermentation (e.g., the Fali® S strain) after 26 hours of fermentation. In some embodiments, one or more of the yeast strains and the derivatives thereof as described herein have a fermentation rate about 0.1%-7.0% (i.e. from about 0.1% to about 7.0%), 0.2%-7.0%, 0.3%-7.0%, 0.4%-7.0%, 0.5%-7.0%, 0.6%-7.0%, 0.7%- 7.0%, 0.8%-7.0%, 0.9%-7.0%, 1.0%-7.0%, 1.1%-7.0%, 1.2%-7.0%, 1.3%-7.0%, 1.4%-7.0%, 1 ,5%-7.0%, 1 ,6%-7.0%, 1.7%-7.0%, 1.8%-7.0%, 1 ,9%-7.0%, 2.0%-7.0%, 2.1%-7.0%, 2.2%- 7.0%, 2.3%-7.0%, 2.4%-7.0%, 2.5%-7.0%, 2.6%-7.0%, 2.7%-7.0%, 2.8%-7.0%, 2.9%-7.0%, 3.0%-7.0%, 3.1 %-7.0%, 3.2%-7.0%, 3.3%-7.0%, 3.4%-7.0%, 3.5%-7.0%, 3.6%-7.0%, 3.7%- 7.0%, 3.8%-7.0%, 3.9%-7.0%, 4.0%-7.0%, 4.1%-7.0%, 4.2%-7.0%, 4.3%-7.0%, 4.4%-7.0%, 4.5%-7.0%, 4.6%-7.0%, 4.7%-7.0%, 4.8%-7.0%, 4.9%-7.0%, 5.0%-7.0%, 5.1 %-7.0%, 5.2%- 7.0%, 5.3%-7.0%, 5.4%-7.0%, 5.5%-7.0%, 5.6%-7.0%, 5.7%-7.0%, 5.8%-7.0%, 5.9%-7.0%, 6.0%-7.0%, 6.1%-7.0%, 6.2%-7.0%, 6.3%-7.0%, 6.4%-7.0%, 6.5%-7.0%, 6.6%-7.0%, 6.7%- 7.0%, 6.8%-7.0%, 6.9%-7.0%, 0.1 %-6.0%, 0.2%-6.0%, 0.3%-6.0%, 0.4%-6.0%, 0.5%-6.0%, 0.6%-6.0%, 0.7%-6.0%, 0.8%-6.0%, 0.9%-6.0%, 1.0%-6.0%, 1.1 %-6.0%, 1.2%-6.0%, 1.3%- 6.0%, 1.4%-6.0%, 1.5%-6.0%, 1 ,6%-6.0%, 1 ,7%-6.0%, 1.8%-6.0%, 1.9%-6.0%, 2.0%-6.0%, 2.1 %-6.0%, 2.2%-6.0%, 2.3%-6.0%, 2.4%-6.0%, 2.5%-6.0%, 2.6%-6.0%, 2.7%-6.0%, 2.8%- 6.0%, 2.9%-6.0%, 3.0%-6.0%, 3.1%-6.0%, 3.2%-6.0%, 3.3%-6.0%, 3.4%-6.0%, 3.5%-6.0%,3.6%-6.0%, 3.7%-6.0%, 3.8%-6.0%, 3.9%-6.0%, 4.0%-6.0%, 4.1 %-6.0%, 4.2%-6.0%, 4.3%- 6.0%, 4.4%-6.0%, 4.5%-6.0%, 4.6%-6.0%, 4.7%-6.0%, 4.8%-6.0%, 4.9%-6.0%, 5.0%-6.0%, 5.1 %-6.0%, 5.2%-6.0%, 5.3%-6.0%, 5.4%-6.0%, 5.5%-6.0%, 5.6%-6.0%, 5.7%-6.0%, 5.8%- 6.0%, 5.9%-6.0%, 0.1 %-5.0%, 0.2%-5.0%, 0.3%-5.0%, 0.4%-5.0%, 0.5%-5.0%, 0.6%-5.0%, 0.7%-5.0%, 0.8%-5.0%, 0.9%-5.0%, 1.0%-5.0%, 1.1 %-5.0%, 1 ,2%-5.0%, 1.3%-5.0%, 1.4%- 5.0%, 1.5%-5.0%, 1.6%-5.0%, 1 ,7%-5.0%, 1 ,8%-5.0%, 1.9%-5.0%, 2.0%-5.0%, 2.1%-5.0%, 2.2%-5.0%, 2.3%-5.0%, 2.4%-5.0%, 2.5%-5.0%, 2.6%-5.0%, 2.7%-5.0%, 2.8%-5.0%, 2.9%- 5.0%, 3.0%-5.0%, 3.1 %-5.0%, 3.2%-5.0%, 3.3%-5.0%, 3.4%-5.0%, 3.5%-5.0%, 3.6%-5.0%, 3.7%-5.0%, 3.8%-5.0%, 3.9%-5.0%, 4.0%-5.0%, 4.1 %-5.0%, 4.2%-5.0%, 4.3%-5.0%, 4.4%- 5.0%, 4.5%-5.0%, 4.6%-5.0%, 4.7%-5.0%, 4.8%-5.0%, 4.9%-5.0%, 0.1 %-4.0%, 0.2%-4.0%, 0.3%-4.0%, 0.4%-4.0%, 0.5%-4.0%, 0.6%-4.0%, 0.7%-4.0%, 0.8%-4.0%, 0.9%-4.0%, 1.0%- 4.0%, 1.1%-4.0%, 1.2%-4.0%, 1.3%-4.0%, 1.4%-4.0%, 1.5%-4.0%, 1.6%-4.0%, 1.7%-4.0%, 1.8%-4.0%, 1.9%-4.0%, 2.0%-4.0%, 2.1%-4.0%, 2.2%-4.0%, 2.3%-4.0%, 2.4%-4.0%, 2.5%- 4.0%, 2.6%-4.0%, 2.7%-4.0%, 2.8%-4.0%, 2.9%-4.0%, 3.0%-4.0%, 3.1%-4.0%, 3.2%-4.0%, 3.3%-4.0%, 3.4%-4.0%, 3.5%-4.0%, 3.6%-4.0%, 3.7%-4.0%, 3.8%-4.0%, 3.9%-4.0%, 0.1 %- 3.0%, 0.2%-3.0%, 0.3%-3.0%, 0.4%-3.0%, 0.5%-3.0%, 0.6%-3.0%, 0.7%-3.0%, 0.8%-3.0%, 0.9%-3.0%, 1.0%-3.0%, 1.1%-3.0%, 1.2%-3.0%, 1.3%-3.0%, 1.4%-3.0%, 1.5%-3.0%, 1.6%- 3.0%, 1.7%-3.0%, 1.8%-3.0%, 1.9%-3.0%, 2.0%-3.0%, 2.1 %-3.0%, 2.2%-3.0%, 2.3%-3.0%, 2.4%-3.0%, 2.5%-3.0%, 2.6%-3.0%, 2.7%-3.0%, 2.8%-3.0%, 2.9%-3.0%, 0.1%-2.0%, 0.2%- 2.0%, 0.3%-2.0%, 0.4%-2.0%, 0.5%-2.0%, 0.6%-2.0%, 0.7%-2.0%, 0.8%-2.0%, 0.9%-2.0%, 1.0%-2.0%, 1.1%-2.0%, 1.2%-2.0%, 1.3%-2.0%, 1.4%-2.0%, 1.5%-2.0%, 1.6%-2.0%, 1.7%- 2.0%, 1.8%-2.0%, 1.9%-2.0%, 0.1%-1.0%, 0.2%-1.0%, 0.3%-1.0%, 0.4%-1.0%, 0.5%-1.0%, 0.6%-1.0%, 0.7%-1.0%, 0.8%-1.0%, or 0.9%-1.0% higher than typical yeast strains used for fermentation (e.g., the Fali® S strain) after 26 hours of fermentation.

[0070] In some embodiments, one or more of the yeast strains and the derivatives thereof as described herein have a statistically significantly higher temperature tolerance than typical yeast strains used for fermentation (e.g., the Fali® S strain). Temperature tolerance may be exhibited by one or more of: increased ethanol yield, increased fructose utilization, higher ethanol to glycerol ratio, and increased fermentation rate. In a particular embodiment, one or more of the yeast strains and the derivatives thereof as described herein can tolerate a temperature of about 20°C, about 21°C, about 22°C, about 23°C, about 24°C, about 25°C, about 26°C, about 27°C, about 28°C, about 29°C, about 30°C, about 31 °C, about 32°C, about33°C, about 34°C, about 35°C, about 36°C, about 37°C, about 38°C, about 39°C, and / or about 40°C. The inventors have surprisingly found that the yeast strains and the derivatives thereof described herein have a statistically significantly higher temperature tolerance as compared to the Fali® S strain under the same fermentation conditions.

[0071] The yeast strains and the derivatives thereof as described herein may be in any viable form, including crumbled, dry (including active dry and instant), compressed, cream form, yeast culture, etc. In a particular embodiment, the Saccharomyces cerevisiae yeast strain or derivative thereof is dry yeast, such as active dry yeast. In another embodiment, the Saccharomyces cerevisiae yeast strain or derivative thereof is a compressed yeast. In another embodiment, the Saccharomyces cerevisiae yeast strain or derivative thereof is a cream yeast. a. Yeast Strains

[0072] One embodiment described herein are Saccharomyces yeast strains designated: Y2175 (deposited under NRRL Patent Deposit Designation No. Y-68316); Y2177 (deposited under NRRL Patent Deposit Designation No. Y-68318); Y2178 (deposited under NRRL Patent Deposit Designation No. Y-68317). These yeast strains are referred to herein as “the yeast strains”, “the Saccharomyces yeast strains”, or by their designations (i.e. “Y2175” or “Y-68316”; “Y2177” or “Y-68318”; “Y2178” or “Y-68317”). The yeast strains (i.e. Y2175, Y2177, and Y2178) were produced from one or more different Saccharomyces yeast strains by one or more of the methods as shown in FIG. 1. In one aspect, the yeast strains described herein comprise one or more defining characteristics including a higher ethanol yield, higher fructose utilization, higher ethanol to glycerol ratio, higher temperature tolerance, and higher fermentation rates than other yeast strains and typical yeast strains used for fermentation, in particular in comparison to the Fali® S strain, the yeast strain used in the product Fali® S. Representative samples of the yeast strains have been deposited under the above-identified accession numbers at the Agricultural Research Service Patent Culture Collection (NRRL), Northern Regional Research Center, 1815 University Street, Peoria, IL, USA.b. Yeast Strain Derivatives

[0073] Another embodiment described herein is a derivative of a Saccharomyces yeast strain selected from the Saccharomyces yeast strains designated: Y2175 (deposited under NRRL Patent Deposit Designation No. Y-68316); Y2177 (deposited under NRRL Patent Deposit Designation No. Y-68318); Y2178 (deposited under NRRL Patent Deposit Designation No. Y- 68317). In one aspect, the derivatives comprise one or more defining characteristics including a higher ethanol yield, higher fructose utilization, higher ethanol to glycerol ratio, higher temperature tolerance, and higher fermentation rates than other yeast strains and typical yeast strains used for fermentation, in particular in comparison to the Pali® S strain, the yeast strain used in the product Pali® S. In another aspect, the derivative can be a parental strain and be used to generate other derivatives. c. Mutant Yeast and Derivatives

[0074] Another embodiment described herein is a mutant of a Saccharomyces yeast strain selected from the Saccharomyces yeast strains designated: Y2175 (deposited under NRRL Patent Deposit Designation No. Y-68316); Y2177 (deposited under NRRL Patent Deposit Designation No. Y-68318); Y2178 (deposited under NRRL Patent Deposit Designation No. Y- 68317). In an embodiment, the Saccharomyces yeast strains designated Y2175, Y2177, and Y2178 may be derived from one or more different Saccharomyces yeast strains by the process shown in FIG. 1 D, so that one or more of Y2175, Y2177, or Y2178 may be a mutant yeast strain. In one aspect, the mutant yeast strains and mutant derivatives comprise one or more defining characteristics including a higher ethanol yield, higher fructose utilization, higher ethanol to glycerol ratio, higher temperature tolerance, and higher fermentation rates than other yeast strains and typical yeast strains used for fermentation, in particular in comparison to the Fali® S strain, the yeast strain used in the product Fali® S. In another aspect, the mutant yeast strains and mutant derivatives can be a parental strain and be used to generate other derivatives. An example of mutagenesis is provided in FIG. 1D. In an embodiment, the mutant yeast strains and mutant derivatives as described herein were derived from the method shown in FIG. 1 D.

[0075] The mutant yeast strains and mutant derivatives may be made by contacting any of the yeast strains described herein with a mutagen. The mutagen may be any mutagen known in the art. For example, the mutagen may be ethyl methanesulfonate (EMS), ultraviolet light (UV), X-rays, methylmethane sulphonate (MMS), nitrous acid, nitrosoguanidine (NNG), acridine mustard, 2-methoxy-6-chloro-9[3- (ethyl-2-chloroethyl)aminopropylamino]acridine-2 (ICR-170), nitrogen mustard, etc. d. Evolved Yeast and Derivatives

[0076] Another embodiment described herein is an evolved yeast strain or derivative of a Saccharomyces yeast strain selected from the Saccharomyces yeast strains designated Y2175 (deposited under NRRL Patent Deposit Designation No. Y-68316); Y2177 (deposited under NRRL Patent Deposit Designation No. Y-68318); Y2178 (deposited under NRRL Patent Deposit Designation No. Y-68317). In an embodiment, the Saccharomyces yeast strains designated Y2175, Y2177, and Y2178 may be derived from one or more different Saccharomyces yeast strains by the process shown in FIG. 1C, so that one or more of Y2175, Y2177, or Y2178 may be an evolved yeast strain. In one aspect, the evolved yeast strains and evolved derivatives comprise one or more defining characteristics including a higher ethanol yield, higher fructose utilization, higher ethanol to glycerol ratio, higher temperature tolerance, and higher fermentation rates than other yeast strains and typical yeast strains used for fermentation, in particular in comparison to Fali® S strain, the yeast strain used in the product Fali® S. In another aspect, the evolved yeast strains and evolved derivatives can be a parental strain and be used to generate other derivatives. An example of evolution is provided in FIG. 1C. In an embodiment, the evolved yeast strains and evolved derivatives as described herein were derived from the method shown in FIG. 1C.

[0077] The evolved yeast strains and evolved derivatives may be made by applying selective pressure to any of the yeast strains described herein. The selective pressure can be negative (decreases the occurrence of a trait) or positive (increases the proportion of a trait). The selective pressure may be constant or may be intermittent. The selective pressure may be applied by altering the presence of resources (e.g., starches and sugars) and / or alteringenvironmental conditions (e.g., temperature, the presence of organic acids, pH, and length of fermentation). e. Recombinant Yeast and Derivatives

[0078] An additional embodiment described herein is recombinant yeast strains and recombination derivatives. The recombinant yeast strains and derivatives may be derived from the Saccharomyces cerevisiae yeast strains or derivatives thereof described herein. The recombinant yeast strain may comprise a modification to suppress expression of a gene, enhance expression of a gene, introduce a gene, delete a gene, or modify the sequence of a gene. An aspect described herein is a method of making a recombinant of the yeast strain or derivative thereof. The method may comprise introducing a nucleic acid into the Saccharomyces yeast described herein using recombinant DNA technology. Methods for the introduction of nucleic acids into Saccharomyces yeast cells, and in particular strains of Saccharomyces, are known in the art and are described in, for example, Ausubel et al. (1997), Current Protocols in Molecular Biology, 2:13.7.1-13.7.7 and Yang and Blenner, (2020), Curr Opin Biotechnol., 66:255-266, both incorporated by reference herein. The method may comprise changing the nucleic acid sequence of the Saccharomyces yeast or derivatives described herein using gene editing or similar technology.3. Compositions

[0079] Further provided herein are compositions comprising the above-described yeast strains or the derivatives thereof. In an embodiment, a composition may comprise at least one of the yeast strains described herein, the derivatives described herein, or a combination thereof, and a naturally occurring and / or a non-naturally occurring component. For example, the composition may comprise one or more components selected from surfactants, emulsifiers, gums, swelling agents, antioxidants, starches, metabolites, and other processing aids. In an embodiment, a composition may comprise a dry yeast of any of the yeast strains and / or the derivatives thereof, starches, and emulsifiers. In another embodiment, a composition may comprise a cream yeast of any of the yeast strains and / or the derivatives thereof, glycerol, and xanthan gum. In an embodiment an enriched culture of any of the yeast strains describedherein is provided wherein enriched is 90%-99% pure. In another embodiment, a pure culture of any of the yeast strains described herein is provided wherein pure is 100% pure and thus no additional yeasts present.

[0080] The composition may comprise a Saccharomyces yeast as described herein, and any suitable surfactant. In an embodiment the surfactant(s) is / are an anionic surfactant, cationic surfactant, and / or nonionic surfactant.

[0081] The composition may comprise a Saccharomyces yeast as described herein, and any suitable emulsifier. In an embodiment the emulsifier is a fatty-acid ester of sorbitan. In an embodiment the emulsifier is selected from the group of sorbitan monostearate (SMS), citric acid esters of monoglycerides or diglycerides, polyglycerolester, and fatty acid esters of propylene glycol.

[0082] The composition may comprise a Saccharomyces yeast as described herein, and Olindronal SMS, Olindronal SK, or Olindronal SPL including a composition concerned in European Patent No. 1 ,724,336. These products are commercially available from Bussetti, Austria, for active dry yeast.

[0083] The composition may comprise a Saccharomyces yeast as described herein, and any suitable gum. In an embodiment the gum is acacia gum, in particular for cream, compressed and dry yeast.

[0084] The composition may comprise a Saccharomyces yeast as described herein, and any suitable swelling agent. In an embodiment the swelling agent is methyl cellulose or carboxymethyl cellulose.

[0085] The composition may comprise a Saccharomyces yeast as described herein, and any suitable antioxidant. In an embodiment the antioxidant is butylated hydroxyanisol (BHA) and / or butylated hydroxytoluene (BHT), or ascorbic acid (vitamin C), in particular for active dry yeast.

[0086] The composition may comprise a Saccharomyces yeast as described herein, and any suitable starch. In an embodiment the starch is potato starch, corn starch, or pea starch.

[0087] The composition may comprise a Saccharomyces yeast as described herein, and any suitable yeast protectant. In an embodiment the protectant is glycerol. a. Composition Characteristics

[0088] In one aspect, the composition comprises one or more defining characteristics including a higher ethanol production, higher fructose utilization, higher ethanol to glycerol ratio, higher temperature tolerance, and higher fermentation rates than other yeast products and typical yeast products used for fermentation, in particular in comparison to the yeast product Fali® S. In addition, the compositions described herein can be readily distinguished from other yeast products used in the ethanol industry that do not have the ethanol producing capabilities and defining characteristics of the compositions described herein.

[0089] In some embodiments, the compositions as described herein have a higher ethanol yield than typical yeast products used for fermentation (e.g., Fali® S, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1). In some embodiments, the compositions as described herein have a higher ethanol yield than typical yeast products used for fermentation (e.g., Fali® S, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1) at a temperature ranging from 20°C to 40°C, preferably ranging from 34°C to 38°C. For example, compositions as described herein have a statistically significantly higher ethanol yield than typical yeast products used for fermentation (e.g., Fali® S, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1) when subjected to a temperature ramp from 20°C to 40°C, preferably a range from 34°C to 38°C, simulating a temperature excursion. A temperature ramp protocol may comprise an incubation at from about 20°C to about 36°C, a linear ramp of from about +1 °C / hour to about +2°C / hour, an incubation at from about 36°C to about 40°C, a linear ramp of from about -0.1 °C / hour to about -0.8°C / hour, and the yeast stains may be held at the final ramp temperature for up to 48 hours. For example, a temperature ramp protocol may be as follows: about 34°C for about 2 hours, linear ramp to about 38°C over about3 hours, hold at about 38°C for about 1 hour, linear ramp to about 36°C over about 4 hours, final hold at about 36°C for the remainder of time up to 48 hours.

[0090] In some embodiments, the compositions as described herein have at least about 0.1 %, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 1.1%, 1.2%, 1.3%, 1.4%, 1.5%,1.6%, 1.7%, 1.8%, 1.9%, 2.0%, 2.1%, 2.2%, 2.3%, 2.4%, 2.5%, 2.6%, 2.7%, 2.8%, 2.9%, 3.0%,3.1 %, 3.2%, 3.3%, 3.4%, 3.5%, 3.6%, 3.7%, 3.8%, 3.9%, or 4.0% higher ethanol yield after 48 hours of fermentation relative to typical yeast products used for fermentation (e.g., Fali® S,Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, Superstart™, DistilaMax® CN, PE- 2, CAT-1). In some embodiments, the compositions as described herein have at most about 1.0%, 1.1%, 1.2%, 1.3%, 1.4%, 1.5%, 1.6%, 1.7%, 1.8%, 1.9%, 2.0%, 2.1 %, 2.2%, 2.3%, 2.4%, 2.5%, 2.6%, 2.7%, 2.8%, 2.9%, 3.0%, 3.1%, 3.2%, 3.3%, 3.4%, 3.5%, 3.6%, 3.7%, 3.8%, 3.9%, or 4.0% higher ethanol yield after 48 hours of fermentation relative to typical yeast products used for fermentation (e.g., Fali® S, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1). In some embodiments, the compositions as described herein have about 0.1 %-4.0% (i.e. from about 0.1% to about 4.0%), 0.2%-4.0%, 0.3%-4.0%, 0.4%-4.0%, 0.5%-4.0%, 0.6%-4.0%, 0.7%-4.0%, 0.8%-4.0%, 0.9%-4.0%, 1.0%- 4.0%, 1.1%-4.0%, 1.2%-4.0%, 1.3%-4.0%, 1.4%-4.0%, 1.5%-4.0%, 1.6%-4.0%, 1.7%-4.0%, 1.8%-4.0%, 1.9%-4.0%, 2.0%-4.0%, 2.1%-4.0%, 2.2%-4.0%, 2.3%-4.0%, 2.4%-4.0%, 2.5%- 4.0%, 2.6%-4.0%, 2.7%-4.0%, 2.8%-4.0%, 2.9%-4.0%, 3.0%-4.0%, 3.1%-4.0%, 3.2%-4.0%, 3.3%-4.0%, 3.4%-4.0%, 3.5%-4.0%, 3.6%-4.0%, 3.7%-4.0%, 3.8%-4.0%, 3.9%-4.0%, 0.1 %- 3.0%, 0.2%-3.0%, 0.3%-3.0%, 0.4%-3.0%, 0.5%-3.0%, 0.6%-3.0%, 0.7%-3.0%, 0.8%-3.0%, 0.9%-3.0%, 1.0%-3.0%, 1.1%-3.0%, 1.2%-3.0%, 1.3%-3.0%, 1.4%-3.0%, 1.5%-3.0%, 1.6%- 3.0%, 1.7%-3.0%, 1.8%-3.0%, 1.9%-3.0%, 2.0%-3.0%, 2.1 %-3.0%, 2.2%-3.0%, 2.3%-3.0%, 2.4%-3.0%, 2.5%-3.0%, 2.6%-3.0%, 2.7%-3.0%, 2.8%-3.0%, 2.9%-3.0%, 0.1%-2.0%, 0.2%- 2.0%, 0.3%-2.0%, 0.4%-2.0%, 0.5%-2.0%, 0.6%-2.0%, 0.7%-2.0%, 0.8%-2.0%, 0.9%-2.0%, 1.0%-2.0%, 1.1%-2.0%, 1.2%-2.0%, 1.3%-2.0%, 1.4%-2.0%, 1.5%-2.0%, 1.6%-2.0%, 1.7%- 2.0%, 1.8%-2.0%, 1.9%-2.0%, 0.1%-1.0%, 0.2%-1.0%, 0.3%-1.0%, 0.4%-1.0%, 0.5%-1.0%, 0.6%-1.0%, 0.7%-1.0%, 0.8%-1.0%, or 0.9%-1.0% higher ethanol yield after 48 hours of fermentation relative to typical yeast products used for fermentation (e.g., Fali® S, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT-1).

[0091] In some embodiments, the compositions as described herein have a higher fructose utilization than typical yeast products used for fermentation (e.g., Fali® S, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1). In some embodiments, the compositions as described herein have a higher fructose utilization than typical yeast products used for fermentation (e.g., Fali® S, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1) at a temperature from 20°C to 40°C, preferably from 34°C to 38°C. For example, compositions as described herein have a statistically significantly higher fructose utilization than typical yeast products used for fermentation (e.g., Fali® S, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1) when subjected to a temperature ramp from 20°C to 40°C, preferably a range from 34°C to 38°C, simulating a temperature excursion. A temperature ramp protocol may comprise an incubation at from about 20°C to about 36°C, a linear ramp of from about +1 °C / hour to about +2°C / hour, an incubation at from about 36°C to about 40°C, a linear ramp of from about -0.1 °C / hour to about -0.8°C / hour, and the yeast stains may be held at the final ramp temperature for up to 48 hours. For example, a temperature ramp protocol may be as follows: about 34°C for about 2 hours, linear ramp to about 38°C over about 3 hours, hold at about 38°C for about 1 hour, linear ramp to about 36°C over about 4 hours, final hold at about 36°C for the remainder of time up to 48 hours.

[0092] In some embodiments, the compositions as described herein have at least about 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, or 55% higher fructose utilization after 48 hours of fermentation relative to typical yeast products used for fermentation (e.g., Fali® S, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1). In some embodiments, the compositions as described herein have at most about 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31 %, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51 %, 52%, 53%, 54%, or 55% higher fructose utilization after 48 hours of fermentation relative to typical yeast products used for fermentation (e.g., Fali® S, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1). In some embodiments, one or more of the yeast strains and the derivatives thereof as described herein have about 15%-55% (i.e. from about 15% to about 55%), 16%-55%, 17%-55%, 18%-55%, 19%-55%, 20%-55%, 21%-55%,22%-55%, 23%-55%, 24%-55%, 25%-55%, 26%-55%, 27%-55%, 28%-55%, 29%-55%, 30%- 55%, 31%-55%, 32%-55%, 33%-55%, 34%-55%, 35%-55%, 36%-55%, 37%-55%, 38%-55%, 39%-55%, 40%-55%, 41%-55%, 42%-55%, 43%-55%, 44%-55%, 45%-55%, 46%-55%, 47%- 55%, 48%-55%, 49%-55%, 50%-55%, 51 %-55%, 52%-55%, 53%-55%, 54%-55%, 15%-50%, 16%-50%, 17%-50%, 18%-50%, 19%-50%, 20%-50%, 21 %-50%, 22%-50%, 23%-50%, 24%- 50%, 25%-50%, 26%-50%, 27%-50%, 28%-50%, 29%-50%, 30%-50%, 31 %-50%, 32%-50%, 33%-50%, 34%-50%, 35%-50%, 36%-50%, 37%-50%, 38%-50%, 39%-50%, 40%-50%, 41 %- 50%, 42%-50%, 43%-50%, 44%-50%, 45%-50%, 46%-50%, 47%-50%, 48%-50%, 49%-50%, 15%-45%, 16%-45%, 17%-45%, 18%-45%, 19%-45%, 20%-45%, 21%-45%, 22%-45%, 23%- 45%, 24%-45%, 25%-45%, 26%-45%, 27%-45%, 28%-45%, 29%-45%, 30%-45%, 31%-45%, 32%-45%, 33%-45%, 34%-45%, 35%-45%, 36%-45%, 37%-45%, 38%-45%, 39%-45%, 40%- 45%, 41%-45%, 42%-45%, 43%-45%, 44%-45%, 15%-40%, 16%-40%, 17%-40%, 18%-40%, 19%-40%, 20%-40%, 21%-40%, 22%-40%, 23%-40%, 24%-40%, 25%-40%, 26%-40%, 27%- 40%, 28%-40%, 29%-40%, 40%-40%, 31 %-40%, 32%-40%, 33%-40%, 34%-40%, 35%-40%, 36%-40%, 37%-40%, 38%-40%, 39%-40%, 15%-35%, 16%-35%, 17%-35%, 18%-35%, 19%- 35%, 20%-35%, 21%-35%, 22%-35%, 23%-35%, 24%-35%, 25%-35%, 26%-35%, 27%-35%, 28%-35%, 29%-35%, 35%-35%, 31 %-35%, 32%-35%, 33%-35%, 34%-35%, 15%-30%, 16%- 30%, 17%-30%, 18%-30%, 19%-30%, 20%-30%, 21%-30%, 22%-30%, 23%-30%, 24%-30%, 25%-30%, 26%-30%, 27%-30%, 28%-30%, 29%-30%, 15%-29%, 16%-29%, 17%-29%, 18%- 29%, 19%-29%, 20%-29%, 21 %-29%, 22%-29%, 23%-29%, 24%-29%, 25%-29%, 26%-29%, 27%-29%, 28%-29%, 15%-28%, 16%-28%, 17%-28%, 18%-28%, 19%-28%, 20%-28%, 21 %- 28%, 22%-28%, 23%-28%, 24%-28%, 25%-28%, 26%-28%, 27%-28%, 15%-27%, 16%-27%, 17%-27%, 18%-27%, 19%-27%, 20%-27%, 21 %-27%, 22%-27%, 23%-27%, 24%-27%, 25%- 27%, 26%-27%, 15%-26%, 16%-26%, 17%-26%, 18%-26%, 19%-26%, 20%-26%, 21%-26%, 22%-26%, 23%-26%, 24%-26%, 25%-26%, 15%-25%, 16%-25%, 17%-25%, 18%-25%, 19%- 25%, 20%-25%, 21%-25%, 22%-25%, 23%-25%, 24%-25%, 15%-24%, 16%-24%, 17%-24%, 18%-24%, 19%-24%, 20%-24%, 21 %-24%, 22%-24%, 23%-24%, 15%-23%, 16%-23%, 17%- 23%, 18%-23%, 19%-23%, 20%-23%, 21 %-23%, 22%-23%, 15%-22%, 16%-22%, 17%-22%, 18%-22%, 19%-22%, 20%-22%, 21 %-22%, 15%-21 %, 16%-21 %, 17%-21%, 18%-21%, 19%- 21%, 20%-21%, 15%-20%, 16%-20%, 17%-20%, 18%-20%, 19%-20%, 15%-19%, 16%-19%, 17%-19%, 18%-19%, 15%-18%, 16%-18%, 17%-18%, 15%-17%, 16%-17%, or 15%-16% higher fructose utilization after 48 hours of fermentation relative to typical yeast products used for fermentation (e.g., Fali® S, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, Superstart™, Distil a Max® CN, PE-2, CAT-1).

[0093] In some embodiments, the compositions as described herein have a higher ethanol to glycerol ratio than typical yeast products used for fermentation (e.g., Fali® S, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1). In some embodiments, the compositions as described herein have a higher ethanol to glycerol ratio than typical yeast products used for fermentation (e.g., Fali® S, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1) at a temperature from 20°C to 40°C, preferably from 34°C to 38°C. For example, compositions as described herein have a statistically significantly higher ethanol to glycerol ratio than typical yeast products used for fermentation (e.g., Fali® S, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1) when subjected to a temperature ramp from 20°C to 40°C, preferably a range from 34°C to 38°C, simulating a temperature excursion. A temperature ramp protocol may comprise an incubation at from about 20°C to about 36°C, a linear ramp of from about +1°C / hour to about +2°C / hour, an incubation at from about 36°C to about 40°C, a linear ramp of from about -0.1 °C / hour to about -0.8°C / hour, and the yeast stains may be held at the final ramp temperature for up to 48 hours. For example, a temperature ramp protocol may be as follows: about 34°C for about 2 hours, linear ramp to about 38°C over about 3 hours, hold at about 38°C for about 1 hour, linear ramp to about 36°C over about 4 hours, final hold at about 36°C for the remainder of time up to 48 hours.

[0094] In some embodiments, the compositions as described herein have at least about 0.5%, 0.8%, 1.1 %, 1.4%, 1.7%, 2.0%, 2.3%, 2.6%, 2.9%, 3.2%, 3.5%, 3.8%, 4.1 %, 4.4%, 4.7%, 5.0%, 5.3%, 5.6%, 5.9%, 6.2%, 6.5%, 6.8%, 7.1%, 7.4%, 7.7%, 8.0%, 8.3%, 8.6%, 8.9%, 9.2%, 9.5%, 9.8%, 10.1%, 10.4%, 10.7%, 11.0%, 11.3%, 11.6%, 11.9%, 12.2%, 12.5%, 12.8%, 13.1%, 13.4%, 13.7%, 14.0%, 14.3%, 14.6%, 14.9%, 15.2%, 15.5%, 15.8%, 16.1 %, 16.4%, 16.7%, 17.0%, 17.3%, 17.6%, 17.9%, 18.2%, 18.5%, 18.8%, 19.1 %, 19.4%, 19.7%, or 20.0% higher ethanol to glycerol ratio after 48 hours of fermentation relative to typical yeast products used for fermentation (e.g., Fali® S, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1). In some embodiments, the compositions as described herein have at most about 2.0%, 2.3%, 2.6%, 2.9%, 3.2%, 3.5%, 3.8%, 4.1%, 4.4%, 4.7%, 5.0%, 5.3%, 5.6%, 5.9%, 6.2%, 6.5%, 6.8%, 7.1%, 7.4%, 7.7%, 8.0%, 8.3%, 8.6%, 8.9%, 9.2%, 9.5%, 9.8%, 10.1%, 10.4%, 10.7%, 11.0%, 11.3%, 11.6%, 11.9%, 12.2%, 12.5%, 12.8%, 13.1%, 13.4%, 13.7%, 14.0%, 14.3%, 14.6%, 14.9%, 15.2%, 15.5%, 15.8%, 16.1 %, 16.4%, 16.7%, 17.0%, 17.3%, 17.6%, 17.9%, 18.2%, 18.5%, 18.8%, 19.1 %, 19.4%, 19.7%, or 20.0%higher ethanol to glycerol ratio after 48 hours of fermentation relative to typical yeast products used for fermentation (e.g., Fali® S, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1). In some embodiments, compositions as described herein have about 0.5%-20% (i.e. from about 0.5% to about 20%), 0.5%-20%, 0.8%- 20%, 1 .1 %-20%, 1.4%-20%, 1.7%-20%, 2%-20%, 2.3%-20%, 2.6%-20%, 2.9%-20%, 3.2%- 20%, 3.5%-20%, 3.8%-20%, 4.1 %-20%, 4.4%-20%, 4.7%-20%, 5.0%-20%, 5.3%-20%, 5.6%- 20%, 5.9%-20%, 6.2%-20%, 6.5%-20%, 6.8%-20%, 7.1 %-20%, 7.4%-20%, 7.7%-20%, 8.0%- 20%, 8.3%-20%, 8.6%-20%, 8.9%-20%, 9.2%-20%, 9.5%-20%, 9.8%-20%, 10.1%-20%, 10.4%- 20%, 10.7%-20%, 11%-20%, 11.3%-20%, 11.6%-20%, 11.9%-20%, 12.2%-20%, 12.5%-20%, 12.8%-20%, 13.1 %-20%, 13.4%-20%, 13.7%-20%, 14%-20%, 14.3%-20%, 14.6%-20%, 14.9%- 20%, 15.2%-20%, 15.5%-20%, 15.8%-20%, 16.1%-20%, 16.4%-20%, 16.7%-20%, 17%-20%, 17.3%-20%, 17.6%-20%, 17.9%-20%, 18.2%-20%, 18.5%-20%, 18.8%-20%, 19.1 %-20%, 19.4%-20%, 19.7%-20%, 0.5%-19.1 %, 0.8%-19.1%, 1.1%-19.1%, 1 ,4%-19.1%, 1.7%-19.1%, 2%-19.1 %, 2.3%-19.1%, 2.6%-19.1%, 2.9%-19.1%, 3.2%-19.1%, 3.5%-19.1%, 3.8%-19.1 %, 4.1 %-19.1 %, 4.4%-19.1%, 4.7%-19.1%, 5%-19.1%, 5.3%-19.1%, 5.6%-19.1%, 5.9%-19.1 %, 6.2%-19.1 %, 6.5%-19.1%, 6.8%-19.1%, 7.1%-19.1%, 7.4%-19.1 %, 7.7%-19.1 %, 8%-19.1 %, 8.3%-19.1 %, 8.6%-19.1%, 8.9%-19.1%, 9.2%-19.1%, 9.5%-19.1 %, 9.8%-19.1 %, 10.1%-19.1 %, 10.4%-19.1%, 10.7%-19.1%, 11%-19.1 %, 11.3%-19.1%, 11.6%-19.1%, 11.9%-19.1%, 12.2%- 19.1%, 12.5%-19.1 %, 12.8%-19.1%, 13.1%-19.1%, 13.4%-19.1%, 13.7%-19.1%, 14%-19.1 %, 14.3%-19.1%, 14.6%-19.1%, 14.9%-19.1 %, 15.2%-19.1%, 15.5%-19.1%, 15.8%-19.1 %, 16.1%- 19.1%, 16.4%-19.1 %, 16.7%-19.1%, 17%-19.1 %, 17.3%-19.1%, 17.6%-19.1%, 17.9%-19.1 %, 18.2%-19.1%, 18.5%-19.1%, 18.8%-19.1 %, 0.5%-17.9%, 0.8%-17.9%, 1.1%-17.9%, 1.4%- 17.9%, 1 ,7%-17.9%, 2%-17.9%, 2.3%-17.9%, 2.6%-17.9%, 2.9%-17.9%, 3.2%-17.9%, 3.5%- 17.9%, 3.8%-17.9%, 4.1%-17.9%, 4.4%-17.9%, 4.7%-17.9%, 5%-17.9%, 5.3%-17.9%, 5.6%- 17.9%, 5.9%-17.9%, 6.2%-17.9%, 6.5%-17.9%, 6.8%-17.9%, 7.1%-17.9%, 7.4%-17.9%, 7.7%- 17.9%, 8%-17.9%, 8.3%-17.9%, 8.6%-17.9%, 8.9%-17.9%, 9.2%-17.9%, 9.5%-17.9%, 9.8%- 17.9%, 10.1%-17.9%, 10.4%-17.9%, 10.7%-17.9%, 11%-17.9%, 11.3%-17.9%, 11.6%-17.9%, 11.9%-17.9%, 12.2%-17.9%, 12.5%-17.9%, 12.8%-17.9%, 13.1%-17.9%, 13.4%-17.9%, 13.7%- 17.9%, 14%-17.9%, 14.3%-17.9%, 14.6%-17.9%, 14.9%-17.9%, 15.2%-17.9%, 15.5%-17.9%, 15.8%-17.9%, 16.1 %-17.9%, 16.4%-17.9%, 16.7%-17.9%, 17%-17.9%, 17.3%-17.9%, 17.6%- 17.9%, 0.5%-15.8%, 0.8%-15.8%, 1.1 %-15.8%, 1 ,4%-15.8%, 1 ,7%-15.8%, 2%-15.8%, 2.3%- 15.8%, 2.6%-15.8%, 2.9%-15.8%, 3.2%-15.8%, 3.5%-15.8%, 3.8%-15.8%, 4.1 %-15.8%, 4.4%- 15.8%, 4.7%-15.8%, 5%-15.8%, 5.3%-15.8%, 5.6%-15.8%, 5.9%-15.8%, 6.2%-15.8%, 6.5%- 15.8%, 6.8%-15.8%, 7.1 %-15.8%, 7.4%-15.8%, 7.7%-15.8%, 8%-15.8%, 8.3%-15.8%, 8.6%-15.8%, S.9%-15.8%, 9.2%-15.8%, 9.5%-15.8%, 9.8%-15.8%, 10.1%-15.8%, 10.4%-15.8%, 10.7%-15.8%, 11 %-15.8%, 11.3%-15.8%, 11.6%-15.8%, 11.9%-15.8%, 12.2%-15.8%, 12.5%- 15.8%, 12.8%-15.8%, 13.1%-15.8%, 13.4%-15.8%, 13.7%-15.8%, 14%-15.8%, 14.3%-15.8%, 14.6%-15.8%, 14.9%-15.8%, 15.2%-15.8%, 15.5%-15.8%, 0.5%-14%, 0.8%-14%, 1.1%-14%, 1 _4%-14%, 1.7%-14%, 2%-14%, 2.3%-14%, 2.6%-14%, 2.9%-14%, 3.2%-14%, 3.5%-14%, 3.8%-14%, 4.1%-14%, 4.4%-14%, 4.7%-14%, 5%-14%, 5.3%-14%, 5.6%-14%, 5.9%-14%, 6.2%-14%, 6.5%-14%, 6.8%-14%, 7.1%-14%, 7.4%-14%, 7.7%-14%, 8%-14%, 8.3%-14%, 8.6%-14%, 8.9%-14%, 9.2%-14%, 9.5%-14%, 9.8%-14%, 10.1 %-14%, 10.4%-14%, 10.7%- 14%, 11%-14%, 11.3%-14%, 11.6%-14%, 11.9%-14%, 12.2%-14%, 12.5%-14%, 12.8%-14%, 13.1%-14%, 13.4%-14%, 13.7%-14%, 0.5%-12.8%, 0.8%-12.8%, 1.1%-12.8%, 1 ,4%-12.8%, 1 ,7%-12.8%, 2%-12.8%, 2.3%-12.8%, 2.6%-12.8%, 2.9%-12.8%, 3.2%-12.8%, 3.5%-12.8%, 3.8%-12.8%, 4.1 %-12.8%, 4.4%-12.8%, 4.7%-12.8%, 5%-12.8%, 5.3%-12.8%, 5.6%-12.8%, 5.9%-12.8%, 6.2%-12.8%, 6.5%-12.8%, 6.8%-12.8%, 7.1 %-12.8%, 7.4%-12.8%, 7.7%-12.8%, 8%-12.8%, 8.3%-12.8%, 8.6%-12.8%, 8.9%-12.8%, 9.2%-12.8%, 9.5%-12.8%, 9.8%-12.8%, 10.1%-12.8%, 10.4%-12.8%, 10.7%-12.8%, 11%-12.8%, 11.3%-12.8%, 11.6%-12.8%, 11.9%- 12.8%, 12.2%-12.8%, 12.5%-12.8%, 0.5%-9.8%, 0.8%-9.8%, 1.1%-9.8%, 1.4%-9.8%, 1.7%- 9.8%, 2%-9.8%, 2.3%-9.8%, 2.6%-9.8%, 2.9%-9.8%, 3.2%-9.8%, 3.5%-9.8%, 3.8%-9.8%, 4.1 %-9.8%, 4.4%-9.8%, 4.7%-9.8%, 5%-9.8%, 5.3%-9.8%, 5.6%-9.8%, 5.9%-9.8%, 6.2%-9.8%, 6.5%-9.8%, 6.8%-9.8%, 7.1%-9.8%, 7.4%-9.8%, 7.7%-9.8%, 8%-9.8%, 8.3%-9.8%, 8.6%-9.8%, 8.9%-9.8%, 9.2%-9.8%, 9.5%-9.8%, 0.5%-6.8%, 0.8%-6.8%, 1.1%-6.8%, 1.4%-6.8%, 1.7%- 6.8%, 2%-6.8%, 2.3%-6.8%, 2.6%-6.8%, 2.9%-6.8%, 3.2%-6.8%, 3.5%-6.8%, 3.8%-6.8%, 4.1 %-6.8%, 4.4%-6.8%, 4.7%-6.8%, 5%-6.8%, 5.3%-6.8%, 5.6%-6.8%, 5.9%-6.8%, 6.2%-6.8%, 6.5%-6.8%, 0.5%-5%, 0.8%-5%, 1.1%-5%, 1.4%-5%, 1.7%-5%, 2%-5%, 2.3%-5%, 2.6%-5%, 2.9%-5%, 3.2%-5%, 3.5%-5%, 3.8%-5%, 4.1 %-5%, 4.4%-5%, 4.7%-5%, 0.5%-2.9%, 0.8%- 2.9%, 1.1%-2.9%, 1.4%-2.9%, 1.7%-2.9%, 2%-2.9%, 2.3%-2.9%, 2.6%-2.9%, or 0.5%-0.8% higher ethanol to glycerol ratio after 48 hours of fermentation relative to typical yeast products used for fermentation (e.g., Fali® S, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1).

[0095] In some embodiments, the compositions as described herein have a higher fermentation rate than typical yeast products used for fermentation (e.g., Fali® S, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1). In some embodiments, the compositions as described herein have a higher fermentation rate thantypical yeast products used for fermentation (e.g., Fali® S, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, Superstart™, DistilaMax®CN, PE-2, CAT-1) at a temperature from 20°C to 40°C, preferably from 34°C to 38°C. For example, compositions as described herein have a statistically significantly higher fermentation rate than typical yeast products used for fermentation (e.g., Fali® S, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, Superstart™, Distil a Max® CN, PE-2, CAT-1) when subjected to a temperature ramp from 20°C to 40°C, preferably a range from 34°C to 38°C, simulating a temperature excursion. A temperature ramp protocol may comprise an incubation at from about 20°C to about 36°C, a linear ramp of from about +1 °C / hour to about +2°C / hour, an incubation at from about 36°C to about 40°C, a linear ramp of from about -0.1 °C / hour to about -0.8°C / hour, and the yeast stains may be held at the final ramp temperature for up to 48 hours. For example, a temperature ramp protocol may be as follows: about 34°C for about 2 hours, linear ramp to about 38°C over about 3 hours, hold at about 38°C for about 1 hour, linear ramp to about 36°C over about 4 hours, final hold at about 36°C for the remainder of time up to 48 hours.

[0096] In some embodiments, the compositions as described herein have a fermentation rate at least about 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 1.1%, 1.2%,1.3%, 1.4%, 1.5%, 1.6%, 1.7%, 1.8%, 1.9%, 2.0%, 2.1%, 2.2%, 2.3%, 2.4%, 2.5%, 2.6%, 2.7%,2.8%, 2.9%, 3.0%, 3.1%, 3.2%, 3.3%, 3.4%, 3.5%, 3.6%, 3.7%, 3.8%, 3.9%, 4.0%, 4.1 %, 4.2%,4.3%, 4.4%, 4.5%, 4.6%, 4.7%, 4.8%, 4.9%, 5.0%, 5.1%, 5.2%, 5.3%, 5.4%, 5.5%, 5.6%, 5.7%,5.8%, 5.9%, 6.0%, 6.1%, 6.2%, 6.3%, 6.4%, 6.5%, 6.6%, 6.7%, 6.8%, 6.9%, or 7.0% higher than typical yeast products used for fermentation (e.g., Fali® S, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1) after 26 hours of fermentation. In some embodiments, the compositions as described herein have a fermentation rate at most about 1.0%, 1.1 %, 1.2%, 1.3%, 1.4%, 1.5%, 1.6%, 1.7%, 1.8%, 1.9%, 2.0%, 2.1%,2.2%, 2.3%, 2.4%, 2.5%, 2.6%, 2.7%, 2.8%, 2.9%, 3.0%, 3.1%, 3.2%, 3.3%, 3.4%, 3.5%, 3.6%,3.7%, 3.8%, 3.9%, 4.0%, 4.1 %, 4.2%, 4.3%, 4.4%, 4.5%, 4.6%, 4.7%, 4.8%, 4.9%, 5.0%, 5.1 %,5.2%, 5.3%, 5.4%, 5.5%, 5.6%, 5.7%, 5.8%, 5.9%, 6.0%, 6.1%, 6.2%, 6.3%, 6.4%, 6.5%, 6.6%,6.7%, 6.8%, 6.9%, or 7.0% higher than typical yeast products used for fermentation (e.g., Fali® S, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1) after 26 hours of fermentation. In some embodiments, the compositions as described herein have a fermentation rate about 0.1 %-7.0% (i.e. from about 0.1 % to about 7.0%), 0.2%-7.0%, 0.3%-7.0%, 0.4%-7.0%, 0.5%-7.0%, 0.6%-7.0%, 0.7%-7.0%, 0.8%-7.0%,.9%-7.0%, 1.0%-7.0%, 1.1%-7.0%, 1.2%-7.0%, 1.3%-7.0%, 1.4%-7.0%, 1.5%-7.0%, 1.6%-.0%, 1.7%-7.0%, 1.8%-7.0%, 1 ,9%-7.0%, 2.0%-7.0%, 2.1%-7.0%, 2.2%-7.0%, 2.3%-7.0%,.4%-7.0%, 2.5%-7.0%, 2.6%-7.0%, 2.7%-7.0%, 2.8%-7.0%, 2.9%-7.0%, 3.0%-7.0%, 3.1%-.0%, 3.2%-7.0%, 3.3%-7.0%, 3.4%-7.0%, 3.5%-7.0%, 3.6%-7.0%, 3.7%-7.0%, 3.8%-7.0%,.9%-7.0%, 4.0%-7.0%, 4.1%-7.0%, 4.2%-7.0%, 4.3%-7.0%, 4.4%-7.0%, 4.5%-7.0%, 4.6%-.0%, 4.7%-7.0%, 4.8%-7.0%, 4.9%-7.0%, 5.0%-7.0%, 5.1 %-7.0%, 5.2%-7.0%, 5.3%-7.0%,.4%-7.0%, 5.5%-7.0%, 5.6%-7.0%, 5.7%-7.0%, 5.8%-7.0%, 5.9%-7.0%, 6.0%-7.0%, 6.1 %-7.0%,.2%-7.0%, 6.3%-7.0%, 6.4%-7.0%, 6.5%-7.0%, 6.6%-7.0%, 6.7%-7.0%, 6.8%-7.0%, 6.9%-.0%, 0.1%-6.0%, 0.2%-6.0%, 0.3%-6.0%, 0.4%-6.0%, 0.5%-6.0%, 0.6%-6.0%, 0.7%-6.0%,.8%-6.0%, 0.9%-6.0%, 1.0%-6.0%, 1.1%-6.0%, 1 ,2%-6.0%, 1.3%-6.0%, 1.4%-6.0%, 1.5%-.0%, 1.6%-6.0%, 1.7%-6.0%, 1 ,8%-6.0%, 1 ,9%-6.0%, 2.0%-6.0%, 2.1 %-6.0%, 2.2%-6.0%,.3%-6.0%, 2.4%-6.0%, 2.5%-6.0%, 2.6%-6.0%, 2.7%-6.0%, 2.8%-6.0%, 2.9%-6.0%, 3.0%-.0%, 3.1%-6.0%, 3.2%-6.0%, 3.3%-6.0%, 3.4%-6.0%, 3.5%-6.0%, 3.6%-6.0%, 3.7%-6.0%,.8%-6.0%, 3.9%-6.0%, 4.0%-6.0%, 4.1%-6.0%, 4.2%-6.0%, 4.3%-6.0%, 4.4%-6.0%, 4.5%-.0%, 4.6%-6.0%, 4.7%-6.0%, 4.8%-6.0%, 4.9%-6.0%, 5.0%-6.0%, 5.1 %-6.0%, 5.2%-6.0%,.3%-6.0%, 5.4%-6.0%, 5.5%-6.0%, 5.6%-6.0%, 5.7%-6.0%, 5.8%-6.0%, 5.9%-6.0%, D.1%-5.0%,.2%-5.0%, 0.3%-5.0%, 0.4%-5.0%, 0.5%-5.0%, 0.6%-5.0%, 0.7%-5.0%, 0.8%-5.0%, 0.9%-.0%, 1.0%-5.0%, 1.1 %-5.0%, 1.2%-5.0%, 1 ,3%-5.0%, 1.4%-5.0%, 1.5%-5.0%, 1.6%-5.0%, ,7%-5.0%, 1 ,8%-5.0%, 1.9%-5.0%, 2.0%-5.0%, 2.1 %-5.0%, 2.2%-5.0%, 2.3%-5.0%, 2.4%-.0%, 2.5%-5.0%, 2.6%-5.0%, 2.7%-5.0%, 2.8%-5.0%, 2.9%-5.0%, 3.0%-5.0%, 3.1%-5.0%,.2%-5.0%, 3.3%-5.0%, 3.4%-5.0%, 3.5%-5.0%, 3.6%-5.0%, 3.7%-5.0%, 3.8%-5.0%, 3.9%-.0%, 4.0%-5.0%, 4.1%-5.0%, 4.2%-5.0%, 4.3%-5.0%, 4.4%-5.0%, 4.5%-5.0%, 4.6%-5.0%,.7%-5.0%, 4.8%-5.0%, 4.9%-5.0%, 0.1 %-4.0%, 0.2%-4.0%, 0.3%-4.0%, 0.4%-4.0%, 0.5%-.0%, 0.6%-4.0%, 0.7%-4.0%, 0.8%-4.0%, 0.9%-4.0%, 1.0%-4.0%, 1.1%-4.0%, 1.2%-4.0%, ,3%-4.0%, 1.4%-4.0%, 1.5%-4.0%, 1.6%-4.0%, 1.7%-4.0%, 1.8%-4.0%, 1.9%-4.0%, 2.0%-.0%, 2.1%-4.0%, 2.2%-4.0%, 2.3%-4.0%, 2.4%-4.0%, 2.5%-4.0%, 2.6%-4.0%, 2.7%-4.0%,.8%-4.0%, 2.9%-4.0%, 3.0%-4.0%, 3.1%-4.0%, 3.2%-4.0%, 3.3%-4.0%, 3.4%-4.0%, 3.5%-.0%, 3.6%-4.0%, 3.7%-4.0%, 3.8%-4.0%, 3.9%-4.0%, 0.1 %-3.0%, 0.2%-3.0%, 0.3%-3.0%,.4%-3.0%, 0.5%-3.0%, 0.6%-3.0%, 0.7%-3.0%, 0.8%-3.0%, 0.9%-3.0%, 1.0%-3.0%, 1.1 %-.0%, 1.2%-3.0%, 1.3%-3.0%, 1.4%-3.0%, 1.5%-3.0%, 1.6%-3.0%, 1.7%-3.0%, 1.8%-3.0%, ,9%-3.0%, 2.0%-3.0%, 2.1%-3.0%, 2.2%-3.0%, 2.3%-3.0%, 2.4%-3.0%, 2.5%-3.0%, 2.6%-.0%, 2.7%-3.0%, 2.8%-3.0%, 2.9%-3.0%, 0.1 %-2.0%, 0.2%-2.0%, 0.3%-2.0%, 0.4%-2.0%,.5%-2.0%, 0.6%-2.0%, 0.7%-2.0%, 0.8%-2.0%, 0.9%-2.0%, 1.0%-2.0%, 1.1%-2.0%, 1.2%-.0%, 1.3%-2.0%, 1.4%-2.0%, 1.5%-2.0%, 1.6%-2.0%, 1.7%-2.0%, 1.8%-2.0%, 1.9%-2.0%,0.1 %-1.0%, 0.2%-1 .0%, 0.3%-1 .0%, 0.4%-1.0%, 0.5%-1.0%, 0.6%-1.0%, 0.7%-1.0%, 0.8%- 1.0%, or 0.9%-1.0% higher than typical yeast products used for fermentation (e.g., Fali® S, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, Superstart™, DistilaMax® CN, PE- 2, CAT-1) after 26 hours of fermentation.

[0097] In some embodiments, the compositions as described herein have a higher temperature tolerance than typical yeast products used for fermentation (e.g., Fali® S, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, Superstart™, DistilaMax® CN, PE-2, CAT- 1). Temperature tolerance may be exhibited by one or more of: increased ethanol yield, increased fructose utilization, higher ethanol to glycerol ratio, and increased fermentation rate. In a particular embodiment, the compositions as described herein can tolerate a temperature of about 20°C, about 21 °C, about 22°C, about 23°C, about 24°C, about 25°C, about 26°C, about 27°C, about 28°C, about 29°C, about 30°C, about 31 °C, about 33°C, about 33°C, about 34°C, about 35°C, about 38°C, about 37°C, about 38°C, about 39°C, and / or about 40°C. i) Ethanol Production

[0098] Described herein are processes for producing ethanol from a substrate by contacting the substrate with a fermenting organism or a composition comprising a fermenting organism. The fermenting organism is selected from the yeast strains described herein and the derivatives thereof. Saccharomyces cerevisiae Y2175, Y2177, Y2178, or a fermenting organism having properties that are about the same as those of the yeast strains described herein or a derivative of the yeast strains described herein having the defining characteristics may be used in a process described herein. Also described herein is a fermented product comprising any of the yeasts described herein. Further described herein is a fermented product obtained by the methods described herein. The fermented product can include, but is not limited to, fuel ethanol, industrial ethanol, potable ethanol, bioethanol, fermented foods such as alcoholic beverages, cultured milk and yogurt, wine, beer, cider, tempeh, miso, kimchi, sauerkraut, and fermented sausage.

[0099] Fermentation is carried out in a fermentation medium. The fermentation medium includes a fermentation substrate, that is, the carbohydrate source that is metabolized by thefermenting organism, such as a biomass. The fermentation medium may comprise nutrients for the fermenting organism(s). Nutrients are widely used in the art of fermentation and include nitrogen sources, vitamins, minerals, or combinations thereof.[000100] In one embodiment, the strain or derivative, or composition as described herein is incubated with a substrate comprising fermentable sugars from a biomass such as a plant biomass from forests and / or from agricultural or food-processing products and / or coproducts that constitute a considerable source of carbon for the production of molecules of interest. The strain or derivative is incubated with the substrate under conditions that allow fermentation of the fermentable sugars. The fermentable sugars may be glucose, galactose, maltose, fructose, sucrose, mannose, or a combination thereof. Typically, the fermentable sugars are glucose, fructose, and sucrose. The source of the fermentable sugar in the substrate may be any source which contains fermentable sugar. The fermentable sugar in the substrate may be, for example, from any one or more of the following sources: hydrolyzed starch, hydrolyzed cellulose, molasses from sugar cane, sugar beet or sweet sorghum, sugar cane juice, agave, sugar beet juice, grape juice, fruit juice, glucose, fructose, hydrolyzed maltodextrins, raw sugar juice, galactose, sucrose, any other forms of fermentable sugars, or combinations thereof. Starch may be obtained from any starch rich crops. Examples of starch rich crops include, but are not limited to, corn, wheat, barley, cassava, sorghum, sweet potato, millet, rice, or any other starch rich crops. In preparing the substrate, the crop is typically crushed and mixed with water and hydrolytic enzyme(s) under conditions which result in hydrolysis of the starch and release of fermentable sugars such as glucose. Typical enzymes for hydrolysis of the starch include a- amylase, amyloglucosidase, pullulanase, [3-amylase, glucoamylase, or mixtures thereof.[000101] Generally, fermenting organisms such as yeast, including Saccharomyces cerevisiae yeast, require an adequate source of nitrogen for propagation and fermentation. Many sources of nitrogen can be used, and such sources of nitrogen are well known in the art. The nitrogen source may be organic, such as urea or corn mash, or inorganic, such as ammonia or ammonium hydroxide or ammonium salts.[000102] In a particular embodiment, the biomass may comprise or originate from sugar cane, sugar beet, sweet sorghum, agave, corn, wheat, rice, barley, rye, sorghum, triticale, potato,sweet potato, cassava, or a combination thereof. In a particular embodiment, the substrate is provided in the form of molasses. Methods for production of molasses are known in the art and are described in, for example, Olbrich, (2006) Biotechnologie-Kempe GmbH, 128 and in Clarke, and Godshall, (2013) Chemistry and processing of sugarbeet and sugarcane: proceedings of the Symposium on the Chemistry and Processing of Sugarbeet, Denver, Colorado, April 6, 1987 and the Symposium on the Chemistry and Processing of Sugarcane, New Orleans, Louisiana, September 3-4, 1987, Elsevier. In a particular embodiment, the substrate is provided in the form of a syrup. In a particular embodiment, the substrate is provided in the form of corn mash or a Synthetic Corn Medium (SCM). Methods for preparation of corn mash are known in the art and are described in, for example, Thomas et al., (2001) Journal of Applied Microbiology, 90, 819-828. Methods for preparation of substrates similar in function to SCM are known in the art and are described in, for example, U.S. Patent No. 10,106,823, which is incorporated herein by reference in its entirety. Methods for the preparation of starch-based substrates are also described in, for example, PCT Publication No. 2006 / 113683 and U.S. Patent Publication No. 2007 / 0014905.[000103] The sugar content of the fermentation medium may be adjusted so that it is as high as possible while at the same time ensuring that the sugar is converted to ethanol as rapidly and as completely as possible. It is preferred that the yeast convert all of the sugars of the medium to ethanol, and that the overall yield of conversion of the consumed sugars to ethanol is as high as possible and, consequently, the fewest coproducts such as glycerol are generated during the fermentation.[000104] The fermentation is carried out at a temperature which permits fermentation of the fermentable sugars. In general, the higher the temperature at which the fermentation can be carried out, the more economical the industrial process. Typically, the temperature at which the fermentation is carried out is from about 20-42°C (i.e. from about 20°C to about 42°C). Suitable temperature ranges include 21-42°C, 22-42°C, 23-42°C, 24-42°C, 25-42°C, 25-41 °C, 26- 40°C, 27-40° C, 28-40°C, 29-40°C, 30-40°C, 25-39°C, 26-39°C, 27-39°C, 28-39°C, 29-39°C, 30-39°C, 31-39°C, 32-39°C, 33-39°C, 25-38°C, 26-38°C, 27-38°C, 28-38°C, 29-38°C, 30-38°C, 31-38°C, 32-38°C, 33-38°C, 25-27°C, 26-37°C, 27-37°C, 28-37°C, 29-37°C, 30-37°C, 31-37°C, 32-37°C, 33-37°C, 25-36°C, 26-36°C, 27-36°C, 28-36°C, 29-36°C, 30-36°C, 31-36°C, 32-36°C, 33-36°C, 25-35°C, 26-35°C, 27-35°C, 28-35°C, 29-35°C, 30-35°C, 31-35°C, 32-35°C, or 33-35°C. A temperature ramp from about 20°C to about 40°C, preferably a range from about 34°C to about 38°C may be used, simulating a temperature excursion. A temperature ramp protocol may comprise an incubation at from about 20°C to about 36°C, a linear ramp of from about 1 °C / hour to about 2°C / hour, an incubation at from about 36°C to about 40°C, a linear ramp of from about -0.1 °C / hour to about -0.8°C / hour, and the yeast stains may be held at the final ramp temperature for up to 48 hours. For example, a temperature ramp protocol may be as follows: about 34°C for about 2 hours, linear ramp to about 38°C over about 3 hours, hold at about 38°C for about 1 hour, linear ramp to about 36°C over about 4 hours, final hold at about 36°C for the remainder of time up to 48 hours.[000105] Methods for fermentation and distillation are known in the art and are described in, for example, PCT Publication No. 2006 / 113683 and US Patent Publication No. 2007 / 0014905. In particular, ethanol production as described herein may be carried out using simultaneous saccharification and fermentation (“SSF”), batch fermentation, semi-batch fermentation, or continuous fermentation. a. Fermentation from Sucrose-based Substrates[000106] Utilization of molasses and other sugar refinery products as feedstocks is a common practice in the industrial scale production of bioethanol and distilled spirits. The ethanol fermentation process may utilize the sugars obtained at during refining originating at any of the refining steps. The fermentation process is usually a fed-batch fermentation. Yeast can be propagated before fermentation, or the propagation step be omitted by direct pitching active dry yeast product. Fermentation may be carried out at a temperature from about 20°C to about 40°C, such as from about 25°C to about 33°C, about 30°C to about 34°C, 32°C to about 36°C, or 34°C to about 38°C. For bioethanol applications, temperature is preferable around 33°C. In an embodiment, fermentation is ongoing from about 6 hours to about 120 hours, in particular from about 18 hours to about 72 hours, and preferably about 24 hours to about 48 hours. In an embodiment, the pH is from about 3.0 to about 6.0, preferably from about 4.0 to about 5.0. A temperature ramp from about 20°C to about 40°C, preferably a range from about 34°C to about 38°C may be used, simulating a temperature excursion. A temperature ramp protocol may comprise an incubation at from about 20°C to about 36°C, a linear ramp of from about 1°C / hourto about 2°C / hour, an incubation at from about 36°C to about 40°C, a linear ramp of from about -0 1oC / hour to about -0.8°C / hour, and the yeast stains may be held at the final ramp temperature for up to 48 hours. For example, a temperature ramp protocol may be as follows: about 34°C for about 2 hours, linear ramp to about 38°C over about 3 hours, hold at about 38°C for about 1 hour, linear ramp to about 36°C over about 4 hours, final hold at about 36°C for the remainder of time up to 48 hours. b. Simultaneous Saccharification and Fermentation (“SSF”)[000107] SSF is widely used in industrial scale fermentation product production processes, especially ethanol production processes. When doing SSF the saccharification step and the fermentation step are carried out simultaneously. There is no holding stage for the saccharification, meaning that a fermenting organism, such as yeast, and enzyme(s), may be added together. However, it is also contemplated to add the fermenting organism and enzyme(s) separately (i.e. separate hydrolysis and fermentation (SHF)). SSF may be carried out at a temperature from about 20°C to about 40°C, such as from about 28°C to about 35°C, such as from about 30°C to about 34°C, preferably about 33°C. In an embodiment fermentation is ongoing for about 6 hours to about 120 hours, in particular about 24 hours to about 96 hours, and preferably about 48 hours. A temperature ramp from about 20°C to about 40°C, preferably a range from about 34°C to about 38°C may be used, simulating a temperature excursion. A temperature ramp protocol may comprise an incubation at from about 20°C to about 36°C, a linear ramp of from about 10C / hour to about 2°C / hour, an incubation at from about 36°C to about 40°C, a linear ramp of from about -0.1 °C / hour to about -0.8°C / hour, and the yeast stains may be held at the final ramp temperature for up to 48 hours. For example, a temperature ramp protocol may be as follows: about 34°C for about 2 hours, linear ramp to about 38°C over about 3 hours, hold at about 38°C for about 1 hour, linear ramp to about 36°C over about 4 hours, final hold at about 36°C for the remainder of time up to 48 hours. In an embodiment the pH is from about 3.0-6.0, preferably from about 4.0-5.0.c. Ethanol Recovery[000108] Subsequent to fermentation, e.g., SSF, the ethanol may be separated from the spent fermentation medium or beer. The beer may be rectified or distilled to recover / extract the desired fermentation products (i.e. ethanol and higher alcohols). Alternatively, the desired fermentation product (i.e. ethanol) may be extracted from the fermentation medium by micro or membrane filtration techniques known in the art. The fermentation product (i.e. ethanol) may also be recovered by stripping or other method well known in the art.[000109] In some embodiments, the ethanol is not recovered / extracted from the fermentation medium or beer, such as in the production of alcoholic beverages. d. Batch Fermentation[000110] Batch fermentation is where fermentation is done in separate batches. A batch fermentation is a process where the fermentation medium is provided in the fermenter from the start, where the fermenter is inoculated with an intended microorganism (i.e. yeast, yeast product) and the fermentation process is running until a predetermined condition has been reached, typically depletion of the substrate in the fermentation medium and the cessation of ethanol production caused by the depletion. Once the process is complete, the products are removed from the fermenter and the fermenter is sterilized before the next fermentation takes place. Then the contents are the end-product (e.g., wine) or can be rectified / distilled (e.g., fuel ethanol and whisky). e. Fed-batch Fermentation[000111] A fed-batch process may also be used. A fed-batch process is a fermentation where a part of the fermentation medium is provided from the start of the fermentation process where the inoculum is added, and at a certain time point after the start of the fermentation additional substrate, feed is fed to the fermenter at a rate that may be predetermined or determined by the conditions in the fermenter; until the maximal volume has been reached. The feed may or maynot have the same composition as the initial fermentation medium. Then the contents are the end-product (e.g., wine) or can be rectified / distilled (e.g., fuel ethanol and whisky). f. Continuous Fermentation[000112] Continuous fermentation allows for fermentation to be done over long periods of time without fermenting in separate batches. A continuous fermentation process is a process where new growth medium is continuously fed to the fermenter and ferment is simultaneously removed from the fermenter at the same rate so the volume in the fermenter is constant. Then the contents are the end-product (e.g., wine) or can be rectified / distilled (e.g., fuel ethanol and whisky).5. Ethanol[000113] The ethanol produced by the yeast and the derivatives thereof as described herein may be fuel ethanol, industrial ethanol, and / or potable ethanol. Fuel ethanol, industrial ethanol, and potable alcohol can be produced from starch-containing biomass, including starch found in cereal grains (e.g., corn, wheat, rice, sorghum / milo, barley, etc.) and from starch in tubers and root vegetables (e.g., potato, cassava, etc.); and from vegetative portions of plants containing the sugars sucrose, glucose, and fructose (e.g., sugar cane, sweet sorghum, sugar beets, agave, etc.); and from the fruits and berries of plants containing sucrose, glucose, and fructose (e.g., grapes, oranges, peaches, cherries, etc.).[000114] Fuel ethanol and industrial ethanol can also be produced from plant biomass containing cellulose and hemicellulose, such as cereal grain crop residues (e.g., wheat and rice straw, corn stover, corn cobs, etc.), from corn fiber, from so-called energy crops such as switchgrass and poplar, from woody material waste including residues from sawmills (e.g., saw dust and wood chips), from residues from pulp and paper manufacture, and from waste paper and cardboard. a. Fuel Ethanol[000115] Fuel ethanol is manufactured for use in internal combustion engines and may manufactured as anhydrous or hydrous fuel ethanol. Anhydrous fuel ethanol can be mixed with gasoline to form an ethanol / gasoline mixture or with diesel to form an ethanol / diesel mixture. Hydrous fuel ethanol can be used directly as a fuel in internal combustion engines. b. Industrial Ethanol[000116] Industrial ethanol is manufactured for use in a variety of applications including as a solvent in pharmaceuticals, cosmetics, detergents, household cleaners and disinfectants, and coatings and inks; and as a chemical intermediate in manufacture of ethyl acetate, ethyl acrylate, polyethylene, acetic acid, and other organic molecules of industrial importance. c. Potable Ethanol[000117] Potable ethanol is manufactured for human consumption and includes the ethanol found in wine, beer, cider, sake, mead, kombucha, and distilled spirits including whisky, bourbon, cachaga, Chinese white liquor, baijiu, and others.6. Yeast Strain Production a. Directed Mating[000118] Provided herein are methods of producing the derivative of a Saccharomyces yeast strain Y2175 described herein. The methods may include providing a first yeast strain that is selected from Saccharomyces strains Y2175, Y2177, and Y2178 and a second yeast strain that is any yeast strain, such as a yeast strain in the Saccharomyces sensu stricto clade, such as a Saccharomyces cerevisiae strain. The second strain may also be any of the yeast strains described herein. The methods may further include inducing sporulation of the first yeast strain and the second yeast strain. The methods may also include screening and selecting spores from the first yeast strain and spores from the second yeast strain. In addition, the method mayinclude hybridizing a selected spore of the first yeast strain with a selected spore of the second yeast strain, and screening or selecting for a derivative strain. The method may include screening or selecting for spores which exhibit one or more defining characteristics of the Saccharomyces strains as described herein. The method may further include screening or selecting a hybrid which exhibits one or more defining characteristics of the Saccharomyces strains as described herein. An example of directed mating is provided in FIG. 1A. Therefore, the parents (i.e. donors of the “a” and “alpha” haploids) that generate a hybrid are known. In an embodiment, the yeast strains and derivatives thereof as described herein are made from a process as shown in FIGS. 1 A-D. In an embodiment, the Saccharomyces yeast strains designated Y2175, Y2177, and Y2178, are derived from one or more different Saccharomyces yeast strains by a process shown in FIGS. 1A-D, for example by the process shown in FIG. 1A, so that one or more of Y2175, Y2177, or Y2178 is a product of directed mating. Methods of directed mating are known in the art and are described in U.S. Patent No. 10,308,963 and U.S. Patent No. 10,106,823, which are incorporated herein by reference. b. Mass Mating[000119] Provided herein are methods of producing the derivative of a Saccharomyces yeast strain Y2175 described herein. The methods may include providing a first yeast strain that is selected from Saccharomyces strains Y2175, Y2177, and Y2178 and one or more additional yeast strains that are any yeast strain, such as a yeast strain in the Saccharomyces sensu stricto clade, such as a Saccharomyces cerevisiae strain. The one or more additional yeast strains may also be any of the yeast strains described herein. The methods may further include inducing sporulation of the first yeast strain and the one or more additional yeast strains. The methods may also include mixing all of the spores to allow for hybridization of the spores and screening or selecting for a derivative strain. The method may include screening or selecting a hybrid which exhibits one or more defining characteristics of the Saccharomyces strains as described herein. An example of mass mating is provided in FIG. 1B. Therefore, the parents (i.e. donors of the “a” and “alpha” haploids) that generate a hybrid are unknown. In an embodiment, the yeast strains and derivatives thereof as described herein are derived from a process as shown in FIGS. 1 A-D. In an embodiment, the Saccharomyces yeast strains designated Y2175, Y2177, and Y2178 are derived from one or more different Saccharomyces yeast strains by a process shown in FIGS. 1A-D.7. Examples[000120] The foregoing may be better understood by reference to the following examples, which are presented for purposes of illustration and are not intended to limit the scope of the invention. The present disclosure has multiple aspects and embodiments, illustrated by the appended non-limiting examples.Example 1Materials and Methods[000121] Diluted sugarcane syrup medium. A diluted sugar cane syrup medium was used to monitor the performance of the rehydrated yeast product during a batch fermentation process, in which the fermentable sugars were added at the start of fermentation. Cane syrup (Steen's 100% Pure Cane Syrup, Abbeville, Louisiana, USA) was mixed in a 9:1 ratio with Indian B- molasses prior to being diluted to -27.2% w / v total fermentable sugars (glucose and fructose) and supplemented with salts (1x final concentrations of salt mixes 1 and 2) and nutrients (4 g per 100 g total fermentation weight). Salt mix 1 (100x solution) comprised of 90 g water, 6 g Urea (Sigma U5378), 2.5 g Ammonium phosphate dibasic (Sigma A5764). Salt mix 2 (1000x solution) comprised of 9.4 g water, 0.4 g Magnesium sulfate heptahydrate (Sigma M2773), 0.2 g Zinc sulfate heptahydrate (Sigma Z0635). The nutrient solution comprised of 39 g of water, 0.0714 g Yeast extract (Criterion C7342), 0.0714 g Thiamine hydrochloride (Sigma T1270), 0.0714 g D-Pantothenic acid hemicalcium salt (Sigma P5155), 0.571 g myo-lnositol (Sigma I7508), 0.0714 g Nicotinamide (Sigma N0636), 0.143 g Pyridoxine hydrochloride (Sigma P6280). The amounts of salt and nutrient solutions were scaled proportionally as needed for media preparation. Nutrient solution was added to the media after autoclaving and cooling to room temperature. The initial pH of the fermentation media was -4.92 with a lactic acid concentration of -0.155 %w / v and an acetic acid concentration of -0.09 %w / v. To minimize the growth of contaminants during the fermentation, virginiamycin was added at a final concentration of 1.0 ppm and penicillin G was added at a final concentration of 5.0 ppm. A representative sample of the fermentation medium was collected for measurement of specific gravity and for HPLC analysis.[000122] Synthetic sucrose-based medium. A synthetic sucrose-based medium was used for 96-well plate-based screening of fermentation performance. To prepare 1000 g of the medium the following components were added with constant stirring: 1.56 g Potassium phosphate monobasic (Sigma P0662), 0.384 g Calcium chloride dihydrate (Sigma 223506), 5.05 g Magnesium sulfate heptahydrate (Sigma M2773), 1.02 g Urea (Sigma U5378), 0.151 g Yeast extract (Criterion C7342), 240 g Sucrose (Sigma S1888), 10 ml of mineral solution, and 10 ml of vitamin solution. The pH was adjusted to 5.2 with NaOH and final media weight was adjusted to 1000 g with water. The mineral solution was prepared by adding the following components and adjusting the final weight to 100 g with water: 114.26 mg Iron(ll) sulfate heptahydrate (Sigma F8633), 27.14 mg Copper(ll) sulfate pentahydrate (Sigma C8027), 86.86 mg Manganese(ll) sulfate monohydrate (Sigma M7899), and 252.54 mg of Zinc sulfate heptahydrate (Sigma Z0635). The vitamin solution was prepared by adding the following components and adjusting the final weight to 300 g with water: 122.48 mg myo-lnositol (Sigma I7508), 15.33 mg Biotin (Sigma B4639), 15.33 mg Nicotinic acid (Sigma N0761), 30.57 mg D-Pantothenic acid hemicalcium salt (Sigma P5155), 37.33 mg Pyridoxine hydrochloride (Sigma P6280), 19.62 mg Thiamine hydrochloride (Sigma T1270).[000123] Yeast product rehydration. Yeast dry product was resuspended in 0.9% sodium chloride (0.094 g / g) and allowed to hydrate at room temperature for 30 minutes before inoculation.[000124] Batch fermentations with rehydrated yeast product. 97.50 ± 0.02 mL of the diluted sugar cane syrup medium was added to each test sample vessel for each yeast strain. 2.5 g of rehydrated yeast product was inoculated into the sample vessels. The sample vessels were closed with an airlock cap filled with water. High temperature excursions were simulated through temperature ramp as follows: The sample vessels were subjected to a fermentation temperature profile of 34°C for two hours, linear ramp to 38°C over three hours, hold at 38°C for one hour, linear ramp to 36°C over four hours, final hold at 36°C for the remainder of the time up to 48 hours with 150 rpm shaking and 50% humidity. The weight of each sample vessel was measured before incubation and at timepoints between 19 h and 48 h of incubation. After 48 hours of incubation, the fermentation was ended, and the sample vessels were removed from the incubator and sampled for HPLC analysis.[000125] End of fermentation HPLC analysis. Sample composition at the end of fermentation was analyzed for residual sugars, lactic acid, acetic acid, glycerol, and ethanol using state of the art methodology.[000126] Ethanol yield. The ratio of ethanol glucose equivalents present at the end of the fermentation to the total end of fermentation glucose equivalents is used to determine ethanol yield. The relative difference in ethanol yield was determined as the difference between the percent ratio of ethanol yield over the mean ethanol yield for the Fali® S strain minus one hundred percent.' Ethanol YieldEthanol yield change =strainxioo - 100%.EthanolYieldFaListrain[000127] Ethanol to Glycerol ratio. The net glycerol produced during the fermentation was determined as the difference between the total glycerol at the end of the fermentation and the initial glycerol present in the medium. The ethanol to glycerol ratio (ethanol: glycerol) was determined as the ratio of ethanol to net glycerol. The relative percent change in ethanol: glycerol with respect to the Fali® S strain was determined as the difference between the percent ratio of ethanol: glycerol over the mean of ethanol: glycerol for the Fali® S strain minus one hundred percent.■ Ethanol-. GlycerolstrainEthanol-. Glycerol relative change = xlOO - 100% .Ethanol-. GlycerolFali s strain[000128] Fructose utilization. The concentration of residual fructose at the end of the fermentation was used as an indicator of fructose utilization capacity, e.g., lower residual fructose indicates higher fructose utilization. The relative percent change in fructose utilization with respect to the Fali® S strain was determined as the difference between the percent ratio of residual fructose over the mean of residual fructose for the Fali® S strain minus one hundred percent.[000129] Fermentation rate. The amount of CO2 in grams produced during ethanol fermentation is proportional to the amount of ethanol in grams produced during the same reaction. Therefore, mass loss in grams can be used to evaluate the progress of the fermentation reaction without breaking the anaerobic seal. The mass loss in grams at 26 hours of fermentation was used as an indication of fermentation rate. The relative change in fermentation rate of a given strain with respect to the Fali® S strain was determined as the difference between the percent ratio of fermentation rate for that strain over the mean fermentation rate for the Fali® S strain minus one hundred percent.[000130] Statistical analysis. Students’ T-test was performed for ethanol, ethanol yield, ethanol to glycerol ratio, residual fructose, and rate. The 95% confidence interval (95% Cl) and standard error for each analyte was calculated.Example 2Generation of Hybrid Strains with Improved Temperature Tolerance[000131] Hybrid strains obtained in this invention were generated by combining multiple rounds of hybridization and screening of fermentation performance. Initial hybridizations were carried out by direct matings using spores obtained from the Fali® S strain and internal AB Mauri intermediate strains with improved fructose utilization. Isolates resulting from the hybridizations were screened for fermentation performance at temperatures of 33°C and 36°C in 96-well plates using a synthetic sucrose-based medium. Improved isolates were sporulated and used insubsequent rounds of hybridizations to continue the strain improvement cycle toward increased thermotolerance and fermentation performance.Example 3Sporulation of Yeast Cultures[000132] Formation of meiotic yeast spores can be induced following methods well known in the art (e.g., as described in “Methods in Yeast Genetics, A Cold Spring Harbor Laboratory Course Manual, 2000 Edition” de D. Burke, D. Dawson et T. Stearns, Cold Spring Harbor Laboratory Press (ISBN 0-87969-588-9). Formation of meiotic yeast spores was facilitated by resuspending a fresh yeast culture grown in acetate medium (1 %w / v yeast extract, 2 %w / v bactopeptone, 2% w / v potassium acetate) into sporulation media and incubating for 5 days at 30°C with agitation at 250 rpm. Spore suspensions were stored at 4°C until use.[000133] Spore germination. Spore suspensions from strains with desirable traits were treated with 5 units / mL zymolyase for 15 minutes to break the ascus wall and facilitate spore separation. Spore germination was induced by incubation on YPS medium.Example 4Haploid Strain Isolation[000134] To isolate individual haploid strains, germinating meiotic spores were immediately dissected from the ascus with the help of a micromanipulator and incubated on a YPS agar plate at 32°C until growth was observed. The haploid mating type was confirmed by PCR amplification of the MAT locus (Huxley et al., TIG, vol 6 No. 8, 1990, page 236).Example 5Directed Mating[000135] Breeding occurs when physical contact between two haploid cells or germinating meiotic spores from opposite mating types (MATalpha and MATa) results in cell fusion and the formation of a diploid cell. Direct mating is the result of manually induced breeding by which the person skilled in the art facilitates the physical contact between the two cells. The use of a micromanipulator (e g., Singer model number 1377 A3) can be used to facilitate the placing of the two cells into physical contact.[000136] In some cases, following treatment with 5 units / mL zymolyase, a random meiotic spore from a first strain with desirable characteristics was physically dissected and separated from the other meiotic spores in the same ascus and placed on a YPS agar plate with the help of a micromanipulator. A random meiotic spore from a second strain with desirable characteristics was dissected in the same way and physically placed next to the first spore to allow for physical contact on the YPS agar plate. The spore pair was allowed to germinate and fuse by incubation at 32°C until growth was observed.[000137] In other cases, one zymolyase-treated random spore from a first strain with desirable characteristics was physically contacted with an individual cell from a stable haploid strain showing desirable characteristics on a YPS agar plate with the help of a micromanipulator and incubated at 32°C until growth was observed.[000138] Colonies obtained by directed mating were reisolated onto new YPS agar plates and the diploid status was confirmed by PCR amplification of the MAT locus (Huxley et al., TIG, vol 6 No. 8, 1990, page 236).Example 6Strain Description[000139] The Saccharomyces yeast strains as described herein, and representative samples of the strains having been deposited under NRRL Patent Deposit Designation No. Y-68316 (Y2175), NRRL Patent Deposit Designation No. Y-68318 (Y2177), and NRRL Patent Deposit Designation No. Y-68317 (Y2178) were observed to possess the following characteristics, based on experiments conducted in cane syrup based media using a fermentation temperature profile of 34°C for two hours, linear ramp to 38°C over three hours, hold at 38°C for one hour, linear ramp to 36°C over four hours, final hold at 36°C for the remainder of the time up to 48 hours. Fali® S strain is shown for comparison and was analyzed under similar conditions.[000140] Notable and advantageous features of one or more of the yeast strains as described herein comprise increased ethanol yield, increased fructose utilization, increased ethanol to glycerol ratio, and increased initial fermentation rate as compared to the control. The advantageous fermentation characteristics of the yeast strains and their corresponding products as described herein are provided in the following examples.Example 7Ethanol Production, Glycerol Production, and Fermentation Rate[000141] Active dry yeast products derived from the yeast strains as described herein, were evaluated for ethanol production, fructose utilization, glycerol production, and fermentation rate in diluted cane syrup fermentation medium (TABLE 1 and FIGS. 2A-E). The fermentation temperature was programmed as follows: 34°C for two hours, linear ramp to 38°C over three hours, hold at 38°C for one hour, linear ramp to 36°C over four hours, final hold at 36°C for the remainder of the time up to 48 hours. The initial concentration of fermentable sugars was ~26.5 %w / v, initial lactic and acetic acid concentrations were 0.155 %w / v and ~0.09 %w / v respectively. The initial pH was -4.92. The control (Fali® S) is shown for comparison.TABLE 1. Active dry yeast products performance in cane syrup fermentation media in 48 h fermentations.Example 8Method to Analyze Strain Uniqueness using Bioinformatics Analysis[000142] To verify that strains Y2175, Y2177, and Y2178 are genetically unique and different from each other and from the Fali® S strain, Illumina sequencing was performed. The raw data was trimmed using cutadapt (version 3.5) and with quality-cutoff of 20. Trimmed data was aligned to the Fali® S reference sequence using bwa-mem2. The aligned data was subjected to variant calling using the GATK HaplotypeCaller (GATK 4.1.3.0) to obtain variant genomic regions. The individual variant call files were then merged into a single file for further analysis. Variant genomic positions in the merged variant dataset with a read depth greater than 70 (54,517 variant positions) were then compared between samples to determine pairwise genotypic differences between strains. The percentage of read depth filtered variant positions in the merged dataset with different genotypes in pairwise strain comparisons was expressed as a heatmap, where higher percentages indicate greater genomic variability between the compared strains (FIG. 3).Example 9Differentiation of strains Y2175, Y2177, and Y2178 from each other and other commercially available bioethanol yeast strains by PCR[000143] Several variant genomic positions were further investigated by sequence analysis and the variations in the genomic regions attributed to the YDR170C and YLR278C loci were chosen for verification by PCR analysis. Strain comparison employing PCR amplification of these loci was carried out to verify that strains Y2175, Y2177, and Y2178, (NRRL Patent Deposit Designation No. Y-68316, Y-68318, and Y-68317, respectively) have unique genotypes and can be differentiated from other strains isolated from commercial yeast products used in bioethanol production (see TABLE 2).TABLE 2. List of commercial yeast products used for PCR comparison.[000144] In this example, amplification products were generated through multiplex PCR using primers with binding sites in or near the YDR170C and YLR278C loci. The primers used were 001_DEL02_F: GCTGTTTGATGTATTTCCATCG (SEQ ID NO: 1), 001_DEL02_R: CAGAAAACGCTGGCAGTACG (SEQ ID NO: 2), 006_DEL02_F: GTGTTCTCTGTTGACGCTGC (SEQ ID NO: 3), and 006_DEL02_R: GAAAATTCACAAGTGGATTTGGC (SEQ ID NO: 4). Each primer was used at 0.4 M concentration. The reaction was performed in 20 pl final volume using 10 pl of OneTaq Hot Start 2x Master Mix with Standard Buffer (New England Biolabs, catalog number: M0484S). PCR amplification was performed using a Mastercycler Nexus Gradient Instrument (Eppendorf) with the following thermocycling conditions: an initial denaturation step at 94°C for 2 minutes, followed by 35 cycles of 94°C for 30 seconds, 57°C for 20 seconds and 68°C for 50 seconds, followed by a final extension step at 68°C for 5 minutes. PCR products were analyzed by capillary electrophoresis using the QIAxcel Advanced Instrument (Qiagen) using the following run settings: Rise Time: 0.3 sec; Applied Injection Time: 20 sec; Applied Separation Time: 425 sec; Method Injection Time: 10 sec; Method Separation Time: 420 sec; Method Injection Voltage: 5.0 kV; and Method Separation Voltage: 5.0 kV. Fragment sizes were compared against a reference marker table generated using the QX DNA Size Marker 100 bp - 2.5 kb (Qiagen Catalog Number: 929559) prepared in 1x PCR buffer to a final concentration of 20 ng / pl. The alignment marker used was QX Alignment Marker 15 bp / 5 kb (Qiagen Catalog Number: 929524).[000145] Through the results of this analysis, it is observed that strains Y2175, Y2177, and Y2178 are novel yeast strains which can be differentiated from the Fali® S strain and other prior art strains based on their genomic sequence variations and PCR profiles (FIG. 4).[000146] The foregoing description of the specific aspects will so fully reveal the general nature of the invention that others can, by applying knowledge within the skill of the art, readily modify and / or adapt for various applications such specific aspects, without undue experimentation, without departing from the general concept of the present disclosure.Therefore, such adaptations and modifications are intended to be within the meaning and range of equivalents of the disclosed aspects, based on the teaching and guidance presented herein.It is to be understood that the phraseology or terminology herein is for the purpose of description and not of limitation, such that the terminology or phraseology of the present specification is to be interpreted by the skilled artisan in light of the teachings and guidance.[000147] The breadth and scope of the present disclosure should not be limited by any of the above-described exemplary aspects but should be defined only in accordance with the following claims and their equivalents.[000148] All publications, patents, patent applications, and / or other documents cited in this application are incorporated by reference in their entirety for all purposes to the same extent as if each individual publication, patent, patent application, and / or other document were individually indicated to be incorporated by reference for all purposes.[000149] For reasons of completeness, various aspects of the invention are set out in the following numbered clauses:[000150] Clause 1 . A non-naturally occurring Saccharomyces yeast strain selected from: (a) Saccharomyces strain Y2175, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68316; (b) Saccharomyces strain Y2177, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68318; and (c) Saccharomyces strain Y2178, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68317.[000151] Clause 2. A non-naturally occurring derivative of a Saccharomyces yeast strain selected from: (a) Saccharomyces strain Y2175, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68316; (b) Saccharomyces strain Y2177, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68318; and (c) Saccharomyces strain Y2178, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y- 68317.[000152] Clause 3. The yeast strain of clause 1 or the derivative of clause 2, wherein the yeast strain or the derivative comprise one or more defining characteristics selected from: (a) a higher ethanol yield than the Y1953 strain under the same fermentation conditions; (b) an increased temperature tolerance compared to the Y1953 strain; (c) a higher fructose utilization than the Y1953 strain under the same fermentation conditions; (d) a higher ethanol to glycerol ratio than the Y1953 strain under the same fermentation conditions; and (e) an increased fermentation rate compared to the Y1953 strain under the same fermentation conditions.[000153] Clause 4. The yeast strain or the derivative of any one of clauses 1 to 3, wherein the yeast strain or the derivative has at least about 1.0% higher ethanol yield after 48 hours of fermentation relative to the Y1953 strain.[000154] Clause 5. The yeast strain or the derivative of any one of clauses 1 to 3, wherein the yeast strain or the derivative has at least about 15% higher fructose utilization after 48 hours of fermentation relative to the Y1953 strain.[000155] Clause 6. The yeast strain or the derivative of any one of clauses 1 to 3, wherein the yeast strain or the derivative has an ethanol to glycerol ratio that is at least about 1 .0% higher than the Y1953 strain after 48 hours of fermentation.[000156] Clause 7. The yeast strain or the derivative of any one of clauses 1 to 3, wherein the yeast strain or the derivative has a fermentation rate that is at least about 1.0% higher than the Y1953 strain after 26 hours of fermentation.[000157] Clause 8. The yeast strain or the derivative of any one of clauses 1-7, wherein the yeast strain or the derivative has a higher temperature tolerance relative to the Y1953 strain at fermentation temperatures ranging from 34°C to 38°C.[000158] Clause 9. A method of producing the derivative of a Saccharomyces yeast strain of any of clauses 1-8 comprising: (a) providing: (i) a first yeast strain, wherein the first yeast strain is selected from Saccharomyces strains Y2175, Y2177, Y2178, and derivatives thereof; and (ii) a second yeast strain, wherein the second yeast strain is in the Saccharomyces sensu stricto clade; (b) inducing sporulation of the first yeast and the second yeast strain; (c) optionally generating haploid segregants from the first strain and the second strain; (d) optionally screening and selecting haploid segregants from the first yeast and haploid segregants from the second yeast strain; (d) hybridizing or fusing the selected haploid segregants or germinating spores of the first yeast strain with the selected haploid segregants or germinating spores of the second yeast strain; and (e) screening or selecting for a derivative strain which has higher any of higher temperature tolerance, higher ethanol yield, higher fructose utilization, higher ethanol:glycerol ratio, higher rate, relative to the first yeast strain.[000159] Clause 10. The method of clause 9, wherein step (c) comprises screening or selecting haploid segregants which exhibit one or more defining characteristics of Saccharomyces strains Y2175, Y2177, Y2178, or a derivative thereof.[000160] Clause 11. The method of clause 9, wherein step (e) comprises screening or selecting a hybrid which exhibits one or more defining characteristics of Saccharomyces strains Y2175, Y2177, Y2178, or a derivative thereof.[000161] Clause 12. A method of producing the derivative of a Saccharomyces yeast strain of clause 2 comprising: (a) providing: (i) a first yeast strain, wherein the first yeast strain is selected from Saccharomyces strains Y2175, Y2177, Y2178, and derivatives thereof; and (ii) one or more additional yeast strains that are in the Saccharomyces sensu stricto clade; (b) inducing sporulation of the first yeast and the one or more additional yeast strains to produce spores; (c) mixing all of the spores of step (b) to allow for hybridization of the spores; and (d) screening or selecting for a derivative strain.[000162] Clause 13. The method of clause 12, wherein step (d) comprises screening or selecting a hybrid which exhibits one or more defining characteristics of Saccharomyces strains Y2175, Y2177, or Y2178.[000163] Clause 14. A mutant yeast of a yeast strain of clause 1 or a derivative of clause 2.[000164] Clause 15. A method of producing the mutant yeast of clause 14, wherein the mutant yeast is mutated by contacting the yeast strain with a mutagen.[000165] Clause 16. The method of clause 15, wherein the mutagen is ethyl methanesulfonate (EMS), ultraviolet light (UV), X-rays, methylmethane sulphonate (MMS), nitrous acid, nitrosoguanidine (NNG), acridine mustard, 2-methoxy-6-chloro-9[3- (ethyl-2- chloroethyl)aminopropylamino]acridine-2 (ICR-170), or nitrogen mustard.[000166] Clause 17. A method of producing the mutant yeast of clause 14, wherein the mutant yeast is mutated by contacting the derivative with a mutagen.[000167] Clause 18. The method of clause 17, wherein the mutagen is ethyl methanesulfonate (EMS), ultraviolet light (UV), X-rays, methylmethane sulphonate (MMS), nitrous acid, nitrosoguanidine (NNG), acridine mustard, 2-methoxy-6-chloro-9[3- (ethyl-2- chloroethyl)aminopropylamino]acridine-2 (ICR-170), or nitrogen mustard.[000168] Clause 19. An evolved yeast of a yeast strain of clause 1 or a derivative of clause 2.[000169] Clause 20. A method of producing the evolved yeast of clause 19, wherein evolution is induced by applying selective pressure to the yeast strain.[000170] Clause 21. A method of producing the evolved yeast of clause 19, wherein evolution is induced by applying selective pressure to the derivative.[000171] Clause 22. A genetically modified yeast of a yeast strain of clause 1 or a derivative of clause 2.[000172] Clause 23. The genetically modified yeast of clause 22, wherein a nucleic acid sequence of the genetically modified yeast is changed using gene editing.[000173] Clause 24. A recombinant yeast of a yeast strain of clause 1 or a derivative of clause 2.[000174] Clause 25. The recombinant yeast of clause 24, wherein the recombinant yeast comprises a modification to suppress expression of a gene, enhance expression of a gene, introduce a gene, or delete a gene.[000175] Clause 26. A process for producing ethanol from a substrate by contacting the substrate with a fermenting organism, wherein the fermenting organism is selected from: (a) Saccharomyces strain Y2175, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68316, or a derivative thereof; (b) Saccharomyces strain Y2177, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68318, or a derivative thereof; and (c) Saccharomyces strain Y2178, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68317, or a derivative thereof.[000176] Clause 27. The process of clause 26, wherein the substrate comprises or originates from sugar cane, sugar beet, sweet sorghum, agave, corn, wheat, rice, barley, rye, sorghum, triticale, potato, sweet potato, cassava, or a combination thereof.[000177] Clause 28. The process of clause 26, wherein the yeast comprises one or more defining characteristics selected from: (a) a higher ethanol yield than the Y1953 strain under the same fermentation conditions; (b) an increased temperature tolerance compared to the Y1953 strain; (c) a higher fructose utilization than the Y1953 strain under the same fermentation conditions; (d) a higher ethanol to glycerol ratio than the Y1953 strain under the samefermentation conditions; and (e) an increased fermentation rate compared to the Y1953 strain under the same fermentation conditions.[000178] Clause 29. The process of any one of clauses 26-28, wherein the yeast has a higher temperature tolerance during fermentation than the Y1953 strain from 34°C to 38°C.[000179] Clause 30. The process of any one of clauses 26-29, wherein the ethanol is used for fuel ethanol, industrial ethanol, potable ethanol, or a combination thereof.[000180] Clause 31. The process of any one of clauses 26-30, wherein the ethanol is produced using a starch.[000181] Clause 32. The process of clause 31 , wherein simultaneous saccharification and fermentation (SSF) or continuous fermentation is used to produce the ethanol.[000182] Clause 33. The process of any one of clauses 26-30, wherein the ethanol is produced using a sugar.[000183] Clause 34. The process of clause 33, wherein batch fermentation or continuous fermentation is used to produce the ethanol.[000184] Clause 35. The process of any one of clauses 26-30, wherein the ethanol is produced using a lignocellulosic sugar.[000185] Clause 36. The process of clause 35, wherein simultaneous saccharification and fermentation (SSF) or Separate Hydrolysis and Fermentation (SHF) is used to produce the ethanol.[000186] Clause 37. A composition comprising the yeast strain of clause 1 or the derivative of clause 2 and one or more components selected from surfactants, emulsifiers, gums, swelling agents, protectants, and antioxidants.[000187] Clause 38. The composition of clause 37, wherein the composition comprises one or more defining characteristics selected from: (a) a higher ethanol yield than Y1953 under the same fermentation conditions; (b) an increased temperature tolerance compared to Y1953; (c) a higher fructose utilization than Y1953 under the same fermentation conditions; (d) a higher ethanol to glycerol ratio compared to Y1953 under the same fermentation conditions; and (e) an increased fermentation rate compared to Y1953 under the same fermentation conditions.[000188] Clause 39. The composition of clause 37 or clause 38, wherein the yeast has a higher temperature tolerance than the Y1953 strain from 34°C to 38°C.[000189] Clause 40. A process for producing ethanol from a biomass by contacting the biomass with the composition of clause 37.[000190] Clause 41. The process of clause 40, wherein the ethanol is used for fuel ethanol, industrial ethanol, potable ethanol, or a combination thereof.[000191] Clause 42. The process of clause 40, wherein the ethanol is produced using a starch.[000192] Clause 43. The process of clause 42, wherein simultaneous saccharification and fermentation (SSF) or continuous fermentation is used to produce the ethanol.[000193] Clause 44. The process of clause 40, wherein the ethanol is produced using a sugar.[000194] Clause 45. The process of clause 44, wherein batch fermentation or continuous fermentation is used to produce the ethanol.[000195] Clause 46. The process of clause 40, wherein the ethanol is produced using a lignocellulosic sugar.[000196] Clause 47. The process of clause 46, wherein simultaneous saccharification and fermentation (SSF) or Separate Hydrolysis and Fermentation (SHF) is used to produce the ethanol.[000197] Clause 48. A method of producing a fermentation product from a substrate by contacting the substrate with a fermenting organism, wherein the fermenting organism is selected from: (a) Saccharomyces strain Y2175, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68316, or a derivative thereof; (b) Saccharomyces strain Y2177, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68318, or a derivative thereof; and (c) Saccharomyces strain Y2178, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68317, or a derivative thereof.[000198] Clause 49. The method of clause 48, wherein the substrate comprises or originates from sugar cane, sugar beet, sweet sorghum, agave, corn, wheat, rice, barley, rye, sorghum, triticale, potato, sweet potato, cassava, or a combination thereof.[000199] Clause 50. The method of clause 48, wherein the fermentation product is ethanol.[000200] Clause 51. The method of clause 50, wherein the ethanol is used for fuel ethanol, industrial ethanol, potable ethanol, or a combination thereof.[000201] Clause 52. The method of clause 48, wherein batch fermentation, continuous fermentation, simultaneous saccharification and fermentation (SSF), or Separate Hydrolysis and Fermentation (SHF) is used to produce the fermentation product.8. Biological Deposits[000202] Representative samples of the Saccharomyces yeast strains as described herein were deposited with the Agricultural Research Service Patent Culture Collection Northern Regional Research Center (NRRL), 1815 University Street, Peoria, IL, USA on September 25, 2023 and were assigned NRRL Patent Deposit Designation No. Y-68316 (Y2175), NRRL Patent Deposit Designation No. Y-68318 (Y2177), and NRRL Patent Deposit Designation No. Y-68317 (Y2178) on September 25, 2023. The deposit will be maintained at the NRRL depository under the terms of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure for a term of at least thirty years and at least five years after the most recent request for the furnishing of a sample of the deposit was received by the depository. Applicants have satisfied all the requirements of 37 C.F.R. §§ 1.801-1.809, including providing an indication of the viability of the sample. Additional deposits will be made at the NRRL as needed to ensure availability, subject to the conditions described herein. Applicants impose no restrictions on the availability of the deposited material from the NRRL after the issuance of a patent from this application. Applicants have no authority to wave any restrictions imposed by law on the transfer of biological material or its transportation in worldwide commerce. Applicants do not waive any of their rights granted under any patents issuing from this application in any country.SEQUENCESSEQ ID NO: 1001_DEL02_F PrimerGCTGTTTGATGTATTTCCATCGSEQ ID NO: 2001_DEL02_R PrimerCAGAAAACGCTGGCAGTACGSEQ ID NO: 3006_DEL02_F PrimerGTGTTCTCTGTTGACGCTGCSEQ ID NO: 4006_DEL02_R PrimerGAAAATTCACAAGTGGATTTGGC

Claims

CLAIMSWhat is claimed is:

1. A non-naturally occurring Saccharomyces yeast strain selected from:(a) Saccharomyces strain Y2175, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68316;(b) Saccharomyces strain Y2177, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68318; and(c) Saccharomyces strain Y2178, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68317.

2. A non-naturally occurring derivative of a Saccharomyces yeast strain selected from:(a) Saccharomyces strain Y2175, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68316;(b) Saccharomyces strain Y2177, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68318; and(c) Saccharomyces strain Y2178, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68317.

3. The yeast strain of claim 1 or the derivative of claim 2, wherein the yeast strain or the derivative comprise one or more defining characteristics selected from:(a) a higher ethanol yield than the Y1953 strain under the same fermentation conditions;(b) an increased temperature tolerance compared to the Y1953 strain;(c) a higher fructose utilization than the Y1953 strain under the same fermentation conditions;(d) a higher ethanol to glycerol ratio than the Y1953 strain under the same fermentation conditions; and(e) an increased fermentation rate compared to the Y1953 strain under the same fermentation conditions.

4. The yeast strain or the derivative of any one of claims 1 to 3, wherein the yeast strain or the derivative has at least about 1.0% higher ethanol yield after 48 hours of fermentation relative to the Y1953 strain.

5. The yeast strain or the derivative of any one of claims 1 to 3, wherein the yeast strain or the derivative has at least about 15% higher fructose utilization after 48 hours of fermentation relative to the Y1953 strain.

6. The yeast strain or the derivative of any one of claims 1 to 3, wherein the yeast strain or the derivative has an ethanol to glycerol ratio that is at least about 1 .0% higher than the Y1953 strain after 48 hours of fermentation.

7. The yeast strain or the derivative of any one of claims 1 to 3, wherein the yeast strain or the derivative has a fermentation rate that is at least about 1.0% higher than the Y1953 strain after 26 hours of fermentation.

8. The yeast strain or the derivative of any one of claims 1-7, wherein the yeast strain or the derivative has a higher temperature tolerance relative to the Y1953 strain at fermentation temperatures ranging from 34°C to 38°C.

9. A method of producing the derivative of a Saccharomyces yeast strain of any of claims 1-8 comprising:(a) providing:(i) a first yeast strain, wherein the first yeast strain is selected from Saccharomyces strains Y2175, Y2177, Y2178, and derivatives thereof; and(ii) a second yeast strain, wherein the second yeast strain is in the Saccharomyces sensu stricto clade;(b) inducing sporulation of the first yeast and the second yeast strain;(c) optionally generating haploid segregants from the first strain and the second strain;(d) optionally screening and selecting haploid segregants from the first yeast and haploid segregants from the second yeast strain;(d) hybridizing or fusing the selected haploid segregants or germinating spores of the first yeast strain with the selected haploid segregants or germinating spores of the second yeast strain; and(e) screening or selecting for a derivative strain which has higher any of higher temperature tolerance, higher ethanol yield, higher fructose utilization, higher ethanokglycerol ratio, higher rate, relative to the first yeast strain.

10. The method of claim 9, wherein step (c) comprises screening or selecting haploid segregants which exhibit one or more defining characteristics of Saccharomyces strains Y2175, Y2177, Y2178, or a derivative thereof.

11. The method of claim 9, wherein step (e) comprises screening or selecting a hybrid which exhibits one or more defining characteristics of Saccharomyces strains Y2175, Y2177, Y2178, or a derivative thereof.

12. A method of producing the derivative of a Saccharomyces yeast strain of claim 2 comprising:(a) providing:(i) a first yeast strain, wherein the first yeast strain is selected from Saccharomyces strains Y2175, Y2177, Y2178, and derivatives thereof; and(ii) one or more additional yeast strains that are in the Saccharomyces sensu stricto clade;(b) inducing sporulation of the first yeast and the one or more additional yeast strains to produce spores;(c) mixing all of the spores of step (b) to allow for hybridization of the spores; and(d) screening or selecting for a derivative strain.

13. The method of claim 12, wherein step (d) comprises screening or selecting a hybrid which exhibits one or more defining characteristics of Saccharomyces strains Y2175, Y2177, or Y2178.

14. A mutant yeast of a yeast strain of claim 1 or a derivative of claim 2.

15. A method of producing the mutant yeast of claim 14, wherein the mutant yeast is mutated by contacting the yeast strain with a mutagen.

16. The method of claim 15, wherein the mutagen is ethyl methanesulfonate (EMS), ultraviolet light (UV), X-rays, methylmethane sulphonate (MMS), nitrous acid, nitrosoguanidine (NNG), acridine mustard, 2-methoxy-6-chloro-9[3- (ethyl-2-chloroethyl)aminopropylamino]acridine-2 (ICR-170), or nitrogen mustard.

17. A method of producing the mutant yeast of claim 14, wherein the mutant yeast is mutated by contacting the derivative with a mutagen.

18. The method of claim 17, wherein the mutagen is ethyl methanesulfonate (EMS), ultraviolet light (UV), X-rays, methylmethane sulphonate (MMS), nitrous acid, nitrosoguanidine (NNG), acridine mustard, 2-methoxy-6-chloro-9[3- (ethyl-2-chloroethyl)aminopropylamino]acridine-2 (ICR-170), or nitrogen mustard.

19. An evolved yeast of a yeast strain of claim 1 or a derivative of claim 2.

20. A method of producing the evolved yeast of claim 19, wherein evolution is induced by applying selective pressure to the yeast strain.

21. A method of producing the evolved yeast of claim 19, wherein evolution is induced by applying selective pressure to the derivative.

22. A genetically modified yeast of a yeast strain of claim 1 or a derivative of claim 2.

23. The genetically modified yeast of claim 22, wherein a nucleic acid sequence of the genetically modified yeast is changed using gene editing.

24. A recombinant yeast of a yeast strain of claim 1 or a derivative of claim 2.

25. The recombinant yeast of claim 24, wherein the recombinant yeast comprises a modification to suppress expression of a gene, enhance expression of a gene, introduce a gene, or delete a gene.

26. A process for producing ethanol from a substrate by contacting the substrate with a fermenting organism, wherein the fermenting organism is selected from:(a) Saccharomyces strain Y2175, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68316, or a derivative thereof;(b) Saccharomyces strain Y2177, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68318, or a derivative thereof; and(c) Saccharomyces strain Y2178, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68317, or a derivative thereof.

27. The process of claim 26, wherein the substrate comprises or originates from sugar cane, sugar beet, sweet sorghum, agave, corn, wheat, rice, barley, rye, sorghum, triticale, potato, sweet potato, cassava, or a combination thereof.

28. The process of claim 26, wherein the yeast comprises one or more defining characteristics selected from:(a) a higher ethanol yield than the Y1953 strain under the same fermentation conditions;(b) an increased temperature tolerance compared to the Y1953 strain;(c) a higher fructose utilization than the Y1953 strain under the same fermentation conditions;(d) a higher ethanol to glycerol ratio than the Y1953 strain under the same fermentation conditions; and(e) an increased fermentation rate compared to the Y1953 strain under the same fermentation conditions.

29. The process of any one of claims 26-28, wherein the yeast has a higher temperature tolerance during fermentation than the Y1953 strain from 34°C to 38°C.

30. The process of any one of claims 26-29, wherein the ethanol is used for fuel ethanol, industrial ethanol, potable ethanol, or a combination thereof.

31. The process of any one of claims 26-30, wherein the ethanol is produced using a starch.

32. The process of claim 31 , wherein simultaneous saccharification and fermentation (SSF) or continuous fermentation is used to produce the ethanol.

33. The process of any one of claims 26-30, wherein the ethanol is produced using a sugar.

34. The process of claim 33, wherein batch fermentation or continuous fermentation is used to produce the ethanol.

35. The process of any one of claims 26-30, wherein the ethanol is produced using a lignocellulosic sugar.

36. The process of claim 35, wherein simultaneous saccharification and fermentation (SSF) or Separate Hydrolysis and Fermentation (SHF) is used to produce the ethanol.

37. A composition comprising the yeast strain of claim 1 or the derivative of claim 2 and one or more components selected from surfactants, emulsifiers, gums, swelling agents, protectants, and antioxidants.

38. The composition of claim 37, wherein the composition comprises one or more defining characteristics selected from:(a) a higher ethanol yield than Y1953 under the same fermentation conditions;(b) an increased temperature tolerance compared to Y1953;(c) a higher fructose utilization than Y1953 under the same fermentation conditions;(d) a higher ethanol to glycerol ratio compared to Y1953 under the same fermentation conditions; and(e) an increased fermentation rate compared to Y1953 under the same fermentation conditions.

39. The composition of claim 37 or claim 38, wherein the yeast has a higher temperature tolerance than the Y1953 strain from 34°C to 38°C.

40. A process for producing ethanol from a biomass by contacting the biomass with the composition of claim 37.

41. The process of claim 40, wherein the ethanol is used for fuel ethanol, industrial ethanol, potable ethanol, or a combination thereof.

42. The process of claim 40, wherein the ethanol is produced using a starch.

43. The process of claim 42, wherein simultaneous saccharification and fermentation (SSF) or continuous fermentation is used to produce the ethanol.

44. The process of claim 40, wherein the ethanol is produced using a sugar.

45. The process of claim 44, wherein batch fermentation or continuous fermentation is used to produce the ethanol.

46. The process of claim 40, wherein the ethanol is produced using a lignocellulosic sugar.

47. The process of claim 46, wherein simultaneous saccharification and fermentation (SSF) or Separate Hydrolysis and Fermentation (SHF) is used to produce the ethanol.

48. A method of producing a fermentation product from a substrate by contacting the substrate with a fermenting organism, wherein the fermenting organism is selected from:(a) Saccharomyces strain Y2175, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68316, or a derivative thereof;(b) Saccharomyces strain Y2177, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68318, or a derivative thereof; and(c) Saccharomyces strain Y2178, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68317, or a derivative thereof.

49. The method of claim 48, wherein the substrate comprises or originates from sugar cane, sugar beet, sweet sorghum, agave, corn, wheat, rice, barley, rye, sorghum, triticale, potato, sweet potato, cassava, or a combination thereof.

50. The method of claim 48, wherein the fermentation product is ethanol.

51. The method of claim 50, wherein the ethanol is used for fuel ethanol, industrial ethanol, potable ethanol, or a combination thereof.

2. The method of claim 48, wherein batch fermentation, continuous fermentation, simultaneous saccharification and fermentation (SSF), or Separate Hydrolysis and Fermentation (SHF) is used to produce the fermentation product.

Images