Method and means for detecting gene by single nucleotide extension reaction

By modifying template DNA with terminal transferase enzymes to form a 3'-overhanging end structure, the method effectively reduces noise in fluorescent single-base extension reactions, enabling accurate and sensitive genetic testing for fragmented DNA samples.

WO2026013914A1PCT designated stage Publication Date: 2026-01-15HITACHI HIGH TECH CORP
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
PCT/JP2024/025369
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2024-07-12
Publication Date
2026-01-15

Smart Images

  • Figure JP2024025369_15012026_PF_FP_ABST
    Figure JP2024025369_15012026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a method, a reagent, and a kit each for detecting a gene by a single nucleotide extension reaction. Specifically, the present invention relates to a method, a reagent, and a kit for detecting a gene while reducing noise coming from a template nucleic acid, wherein the template nucleic acid is treated with an enzyme having a terminal transfer activity to form a 3'-terminal-protruding terminal structure in the template nucleic acid before a single nucleotide extension reaction is performed.
Need to check novelty before this filing date? Find Prior Art

Description

Method and means for detecting genes by single-base extension reaction

[0001] The present invention relates to a method, a reagent and a kit for gene detection by single-base extension reaction.

[0002] There are various individual differences in genomes, and these differences in genome sequence are useful biomarkers for disease and drug response. Genomic mutations are mainly detected by polymerase chain reaction (PCR), base sequence analysis using a sequencer, and single-base extension reaction analysis (Patent Document 1).

[0003] Recent advances in genomic science have made it possible to perform panel testing for genome mutations using massively parallel sequencers, which are capable of large-scale analysis. Simultaneous analysis of numerous gene mutations makes it possible to simultaneously determine many diseases and treatment options. Liquid biopsy-based cancer screening, in particular, is expected to see significant advances in the future. Because liquid biopsy is a blood-based test, it is minimally invasive and can be used to test for cancer throughout the body, making it a promising new cancer screening method. However, the cost of analysis poses a challenge when considering the practical implementation of these liquid biopsy-based cancer screening technologies. Therefore, the development of a low-cost, multi-mutation testing technology that can replace massively parallel sequencers is necessary for the practical implementation of liquid biopsy-based cancer screening.

[0004] U.S. Patent No. 5,888,819 International Publication No. WO2022 / 265032

[0005] Coutinho, A. et al., PLOS ONE Vol. 9, No. 3, e93292 (2014); ABI PRISM SNaPshot Multiplex Kit protocol; Alix-Panabieres, C. et al., Cancer Discov Vol. 6, pp. 479-491 (2016); Alcaide, M. et al., Scientific Reports Vol. 10, pp. 12564 (2020);

[0006] The fluorescent single-base extension reaction method uses electrophoretic mobility as an indicator for gene identification, and thus allows for simultaneous detection of multiple items by changing the position at which signals are detected by adjusting the length of the primers used or by adding a label to the primer that changes its mobility (Non-Patent Document 1). In this technique, the position at which signals are detected is determined by the mobility of the primers used for detection, which serves as an indicator for identifying the target gene. Furthermore, the type of fluorescent wavelength observed at the position determined by the primer serves as an indicator for distinguishing the type of base.

[0007] However, when using this technique, peak signals different from those of the primers selected can sometimes be observed in the electrophoretic waveform. The manual for the kit, which uses this technique, reports that one of the causes is due to the template DNA molecule used in the fluorescent single-base extension reaction (Non-Patent Document 2). Specifically, fluorescently labeled bases are incorporated not only into the primers but also into the 3' end of the template DNA molecule, resulting in signal noise from the fluorescently labeled bases incorporated into the template DNA molecule. Solutions to reduce this template-related noise include reducing the amount of template added to the reaction and reducing the presence of short DNA fragments through purification during template preparation. Reducing the amount of template reduces the reaction efficiency of the fluorescent single-base extension reaction, thereby reducing signal intensity. Furthermore, reducing the amount of short DNA fragments is effective only when the detection range of the typical fluorescent single-base extension reaction is 30-120 mers. In other words, it is possible to design the length of the template DNA fragment to be larger than this detection range and eliminate short DNA fragments resulting from nonspecific amplification, such as primer dimers. If the amplified size of the template DNA molecule can be designed to be larger than 120 bp, which is the detection range of the general fluorescent single-base extension reaction method, the fluorescent signal from the template will be outside the detection range and will not overlap with the target detection signal, so this manual measure is effective.

[0008] However, cancer genetic testing using blood samples as liquid biopsies has recently attracted attention (Non-Patent Document 3), and the target molecule, cfDNA, is fragmented to lengths of approximately 120 to 220 bp (Non-Patent Document 4). Because amplifying large template DNA molecules from such fragmented DNA is unstable, it is desirable to design template DNA with lengths shorter than the observed length of 120 to 220 bp. In other words, the size of the template DNA overlaps with the detection range of 30 to 120 mers, which is the detection range of the general fluorescent single-base extension reaction (FSE), making the countermeasures described in the manual less effective.

[0009] Furthermore, the present inventors have independently developed a technology to extend the detection range of the fluorescent single-base extension reaction (FSE) method to 200 mer or more (Patent Document 2). When using this developed technology to perform genetic testing of liquid biopsies, the size of the template DNA molecule overlaps with the analytical chain length range of the FSE method, making conventional countermeasures inapplicable. Therefore, there remains a need for methods and means to reduce template-derived noise peaks in the FSE method.

[0010] As a result of investigating methods for solving the problems, the present inventors have confirmed that noise originating from the template DNA molecule can be reduced by modifying the 3' end of the template DNA molecule with an enzyme having terminal transfer activity as a preliminary step to the fluorescent labeling reaction in the fluorescent single-base extension method.

[0011] Therefore, in one aspect, the present invention relates to a gene detection method using a single-base extension reaction, comprising the steps of: amplifying a sample nucleic acid to prepare a template nucleic acid; treating the template nucleic acid with an enzyme having terminal transfer activity to add a base to the 3' end and form a template nucleic acid having a 3'-overhanging end structure; performing a single-base extension reaction using a single-base extension reaction primer and a fluorescently labeled substrate for detecting a target gene, with the template nucleic acid having the 3'-overhanging end structure as a template; and subjecting a reaction product of the single-base extension reaction to electrophoresis, and detecting the gene based on the fluorescence and the chain length of the single-base extension reaction primer, wherein the added base is a base that can be distinguished from the fluorescently labeled substrate in terms of wavelength.

[0012] In another aspect, the present invention relates to a reagent for reducing a template-derived signal in a single-base extension reaction, comprising: an enzyme having terminal transfer activity for adding a base to the 3' end of a template nucleic acid.

[0013] In yet another aspect, the present invention relates to a kit for gene detection by single-base extension reaction, comprising an enzyme having terminal transfer activity for adding a base to the 3'-end of a template nucleic acid.

[0014] The present invention provides a method, reagent, and kit for gene detection using single-base extension reactions. By reducing the fluorescent noise signal derived from the template nucleic acid molecule in the single-base extension reaction, it becomes possible to clearly detect the signal derived from the single-base extension primer. Furthermore, since the amplified strand length of the template nucleic acid can be designed to be approximately the same as that of the single-base extension primer, it is now possible to design the amplified strand length of the template nucleic acid to be shorter than 120 bp, which is suitable for cfDNA amplification, for example.

[0015] 1 is a flow chart showing an outline of the method according to the present invention in comparison with the prior art. It shows the effect of terminal modification treatment using Ex-Taq (registered trademark), a Pol I enzyme, as a DNA polymerase with terminal transfer activity. (1) shows the result without terminal modification treatment, (2) shows the result after terminal modification treatment using dNTP as a substrate, and (3) shows the result after terminal modification treatment using ddNTP as a substrate. It shows the effect of the method according to the present invention in comparison with the prior art. It shows the effect of the method according to the present invention in comparison with the prior art. TMThe figures show the effect of terminal modification using TDT (Terminal Deoxynucleotidyl Transferase) as an enzyme with terminal transfer activity. (1) shows the results without terminal modification, (2) shows the results with terminal modification using dNTP as a substrate, and (3) shows the results with terminal modification using ddNTP as a substrate. The figures show the effect of terminal modification using TDT (Terminal Deoxynucleotidyl Transferase) as an enzyme with terminal transfer activity. (1) shows the results without terminal modification, (2) shows the results with terminal modification using ddNTP as a substrate, and (3) shows the results with terminal modification using a mixture of dNTP and ddNTP as a substrate. An example of a multiplex reaction is shown. (1) shows the results of a fluorescent single-base extension reaction without terminal modification and without adding a primer, (2) shows the results with terminal modification without adding a primer, and (3) shows the results with terminal modification using dNTP as a substrate and then adding a primer.

[0016] The present invention relates to a method, reagent and kit for detecting genes by single-base extension reaction, particularly fluorescent single-base extension reaction, with reduced noise signals (template-derived noise signals) in the detection of genes.

[0017] In one aspect, the present invention provides a gene detection method using a single-base extension reaction, comprising: amplifying a sample nucleic acid to prepare a template nucleic acid; treating the template nucleic acid with an enzyme having terminal transfer activity to add a base to the 3' end and form a template nucleic acid having a 3'-overhanging end structure; performing a single-base extension reaction using a single-base extension reaction primer and a fluorescently labeled substrate for detecting a target gene, with the template nucleic acid having the 3'-overhanging end structure as a template; and subjecting a reaction product of the single-base extension reaction to electrophoresis, and detecting the gene based on the fluorescence and the chain length of the single-base extension reaction primer, wherein the added base is a base that can be distinguished from the fluorescently labeled substrate in terms of wavelength.

[0018] The present invention is based on a gene detection method that combines a single-base extension reaction and electrophoresis, and such gene detection methods are well known in the art, as described, for example, in Non-Patent Document 1 and Patent Document 1. A flow diagram of an overview of the method according to the present invention (when template DNA is used as the template nucleic acid) is shown in Figure 1 in comparison with the prior art.

[0019] In the present invention, a gene to be detected, i.e., a target gene, refers to a gene for which detection (and quantification) is desired. The target gene may be one type or two or more types. Gene detection is preferably performed in a multiplex manner, and for example, two or more types (e.g., 20 to 100 types), preferably 50 or more types (e.g., 50 to 100 types) of target genes are targeted for detection.

[0020] For example, the target gene is a base sequence containing a genetic mutation, and the target gene is detected (and quantified) by distinguishing between the wild type and the mutant type. Examples of such genetic mutations include, but are not limited to, single nucleotide polymorphisms (SNPs), insertion mutations, and deletion mutations. Furthermore, the mutant type of the target gene may include one type of mutation or multiple types of mutations. For example, there are genetic mutations in which the wild type and two or three types of mutations exist, and such multiple types of mutations can also be distinguished and detected (and quantified) according to the present invention.

[0021] The sample nucleic acid (specimen) used in the method of the present invention is not particularly limited as long as it is the nucleic acid to be detected for the target gene, and includes deoxyribonucleic acid (DNA), such as genomic DNA and cDNA, and ribonucleic acid (RNA), such as messenger RNA (mRNA), and fragments thereof. In the present invention, it is preferable to use, for example, cell-free DNA (cfDNA, DNA free in the blood) or circulating tumor DNA (ctDNA) as the sample nucleic acid. Sample nucleic acid preparation can be performed by methods known in the art. Numerous manufacturers sell kits for nucleic acid preparation, allowing for convenient purification of the target nucleic acid.

[0022] In the method of the present invention, a sample nucleic acid is amplified to prepare a template nucleic acid. The template nucleic acid contains at least a portion of the target gene to be detected (the portion to be detected). It may be DNA or RNA, but is preferably DNA. The template nucleic acid can be prepared by amplification, preferably by polymerase chain reaction (PCR), using primers designed based on the sequence of the target gene to be detected and the region adjacent to the target gene. The primers used can be designed by conventional methods depending on the type of sample nucleic acid, the sequence of the target gene and the region adjacent to the target gene, the type of template nucleic acid, the type of polymerase used, and the like. When detecting two or more target genes, template nucleic acids can be prepared for each target gene. Alternatively, a single template nucleic acid covering two or more target genes can be prepared. In conventional techniques, the chain length of the template nucleic acid was set longer than that of the primer used for single-base extension reaction. However, in the present invention, the chain length of the template nucleic acid is not limited and can be set to, for example, 50 to 1000 bp, and may be shorter than 120 bp, which is suitable for cfDNA amplification.

[0023] Subsequently, the template nucleic acid is treated with an enzyme having terminal transfer activity to add a base to the 3' end, forming a template nucleic acid with a 3' overhanging end structure (this process is also referred to as terminal modification treatment in this specification). An enzyme having terminal transfer activity (transferase) refers to an enzyme that transfers a specific transfer group to the end of a nucleic acid (DNA or RNA). In the present invention, an enzyme that adds a base to the end of the template nucleic acid to form a 3' overhanging end structure is used. Examples of such enzymes include Pol I-type enzymes, such as Ex-Taq (registered trademark) (Takara Bio) and Therminator. TM and terminal transferases such as Terminal Deoxynucleotidyl Transferase (NEB) (New England Biolabs), all of which are readily available as individual enzymes or as kits containing buffers. The amount of enzyme used and the time of enzyme treatment can be adjusted appropriately depending on the type of enzyme used.

[0024] The base to be added is not particularly limited as long as it is a base capable of forming a 3'-overhanging end structure, and dNTP, ddNTP, DIG-dUTP, etc. can be used. In one embodiment, the base to be added can be dNTP, ddNTP, or a mixture of dNTP and ddNTP (the mixing ratio can be any ratio, for example, 1-10:1-10). The base to be added can be unlabeled or labeled (for example, it can be labeled with a fluorescent dye, an enzyme substrate, a hapten, etc.). However, a base that can be distinguished by wavelength from the fluorescent-labeled substrate described below is used.

[0025] Subsequently, a single-base extension reaction is carried out using the template nucleic acid having a 3'-overhang structure as a template, in the presence of a fluorescently labeled substrate (e.g., dideoxynucleotide triphosphate: ddNTP) labeled with a fluorescent dye, using a single-base extension primer for detecting the target gene.

[0026] The primer for the single-base extension reaction may be either DNA or RNA, and is determined depending on the types of template nucleic acid and target gene, and the type of polymerase used in the single-base extension reaction. Preferably, the primer is DNA, and the single-base extension reaction is carried out using DNA or mRNA as a template.

[0027] In the present invention, primers for single-base extension reactions include primers having different base sequences and base lengths for detecting target genes. Because a primer is required for each target gene, the number of primers is designed according to the type of target gene to be detected. For example, two or more primers having different base sequences and base lengths are used to detect two or more target genes. The primers include primers having different base sequences and base lengths for detecting, for example, two or more types (e.g., 20 to 100 types), preferably 50 or more types (e.g., 50 to 100 types) of target genes.

[0028] Each primer is designed to have a sequence that specifically binds to the target gene, i.e., a sequence complementary to the target gene. The target gene to be detected is determined from the base sequence of the primer. Furthermore, the base length of the primer affects the base length (size) of the reactant in the single-base extension reaction, and therefore the electrophoretic mobility is determined from the base length of the primer. In the present invention, it is necessary to appropriately design the base sequence and base length of the primer.

[0029] Primer design techniques are well known in the art, and primers usable in the present invention are designed to satisfy conditions enabling specific annealing, for example, to have a length and base composition (melting temperature) that enable specific annealing. For example, the length that functions as a primer (the length of the portion that anneals to the template nucleic acid, and the entire length of the single-base extension reaction primer is set to a length that allows distinction in electrophoresis) is preferably 10 bases or more, more preferably 15 to 50 bases, and even more preferably 15 to 30 bases, for example, approximately 20 bases. Furthermore, during design, it is preferable to confirm the GC content and melting temperature (Tm) of the primer. Known primer design software can be used to confirm the Tm. The designed primers can be chemically synthesized using known oligonucleotide synthesis techniques, but are typically synthesized using a commercially available chemical synthesizer.

[0030] The primer may have a tag (molecular weight) for adjusting electrophoretic mobility, such as an interstrand-crosslinked double-stranded DNA tag. The inventors previously developed a fragment analysis method using capillary electrophoresis, enabling the number of simultaneously detectable gene mutations to be expanded to tens to hundreds. Specifically, by linking an interstrand-crosslinked double-stranded DNA tag to a primer, the base length of the primer can be extended by changing the length of the double-stranded DNA tag, thereby stably extending the electrophoretic distance to 120 bp or more, thereby increasing the number of simultaneously detectable gene mutations (e.g., WO 2022 / 265032A). The double-stranded DNA tag has a length that can be distinguished by mobility and has at least one interstrand crosslink. In the present invention, "interstrand crosslink" means that one strand of a double-stranded DNA is crosslinked to the other strand at at least one location. The method for intramolecularly crosslinking two such strands is not particularly limited as long as it is known in the art. Preferably, the interstrand crosslinking is achieved by photocrosslinking. Double-stranded DNA tags with interstrand crosslinks determine the migration distance (mobility) during electrophoresis. In other words, by linking double-stranded DNA tags of different lengths to primers, the migration distance during electrophoresis can be changed. Capillary electrophoresis can detect nucleic acids up to approximately 600 bases long, so the length of the double-stranded DNA tag can range from 1 to approximately 590 bases, excluding the length of the primer (10-30 bases) that binds to the target gene. The base sequence of the double-stranded DNA tag is not particularly limited, as long as it is a nucleic acid with an interstrand crosslink. Furthermore, double-stranded DNA tags can be chemically synthesized using known oligonucleotide synthesis techniques, but are typically synthesized using commercially available chemical synthesizers.

[0031] In the method of the present invention, a single-base extension reaction is carried out using the above-mentioned primer in the presence of a fluorescently labeled substrate. Single-base extension reactions are known in the art and are typically performed using a polymerase. The polymerase used is selected depending on the type of template nucleic acid and the type of primer used. For example, a DNA-dependent or RNA-dependent DNA polymerase is used for a single-base extension reaction using a DNA primer with DNA or RNA as a template, respectively.

[0032] Single-base extension reactions are widely known in the art, and methods for efficiently extending one base by a cyclic reaction are described, for example, in Dias-Santagata, D. et al., EMBO Molecular Medicine, Vol. 2, pp. 146-158 (2010).

[0033] If a target gene is present, the primer anneals to the target gene, and a nucleotide is incorporated as a substrate from the 3' end of the primer by the polymerase synthesis reaction. In this case, by using, for example, dideoxynucleotides (ddNTPs) as the nucleotides (substrates) to be incorporated, the synthesis reaction is completed with only one base extension.

[0034] In the present invention, a fluorescently labeled substrate is used as a substrate for a single-base extension reaction. The fluorescent dye used for labeling is useful for easily detecting whether or not the substrate has been incorporated or for determining the type of incorporated base, and any fluorescent dye known in the art can be used. Examples of fluorescent dyes include, but are not limited to, fluorescein, fluorescein isothiocyanate (FITC), sulforhodamine (TR), tetramethylrhodamine (TRITC), carboxy-X-rhodamine (ROX), carboxytetramethylrhodamine (TAMRA), NED, 5-carboxyfluorescein (5-FAM), 6-carboxyfluorescein (6-FAM), 5'-hexachlorofluorescein CE-phosphoramidite (HEX), 6-carboxy-4',5'-dichloro-2',7'-dimethoxyfluorescein (JOE), 5'-tetrachlorofluorescein CE-phosphoramidite (TET), rhodamine 110 (R110), rhodamine 6G (R6G), VIC (registered trademark), ATTO series, Alexa Fluor (registered trademark) series, Texas red, Cy series, and the like. Fluorescent dyes that do not cause deviation in electrophoretic size include dR110 (carboxy-dichloro rhodamine Examples of suitable fluorescent dyes include 110), dR6G (dihydro rhodamine 6G), dTAMRA (tetramethyl rhodamine), and dROX (carboxy-X-rhodamine). For example, when determining the type of base, five fluorescent dyes that are excited and detected at different wavelengths can be used in combination to distinguish between four types of bases and five types of reference bases (for detecting and correcting base length from a reference ladder DNA). There are no particular limitations on the type of fluorescent dye or the method of introduction, and various conventionally known methods can be used.

[0035] After the single-base extension reaction, the resulting reaction product is subjected to electrophoresis for analysis. The electrophoresis method is not particularly limited as long as it is a measurement method capable of fragment analysis by electrophoresis. For example, capillary electrophoresis (CE) or electrophoresis in a microchannel such as a MEMS (Micro-Electro-Mechanical Systems) can be used. In a preferred embodiment, the electrophoresis is capillary electrophoresis (CE).

[0036] Electrophoresis, such as CE, is a technique for separating introduced components based on differences in mobility due to charge, size, shape, etc. Based on mobility, the type of target gene (based on the type of primer) can be identified. Furthermore, based on the fluorescent signal, the presence or absence of the target gene or the type of specific base in the target gene (based on the type of substrate incorporated by the single-base extension reaction), for example, wild-type or mutant, can be distinguished.

[0037] In the present invention, the signal (noise) derived from the template nucleic acid is reduced, so that analysis based on the fluorescent signal after electrophoresis can be performed with high accuracy, and genes can be detected with high sensitivity and accuracy.

[0038] The gene detection method according to the present invention can be easily and quickly carried out using a gene detection kit containing the necessary components. The present invention can also be applied to reduce template-derived noise signals in single-base extension reactions.

[0039] Therefore, in another aspect, the present invention provides a kit for gene detection by a single-base extension reaction, comprising an enzyme having terminal transfer activity for adding a base to the 3'-end of a template nucleic acid.

[0040] In yet another aspect, the present invention provides a reagent for reducing a template-derived signal in a single-base extension reaction, comprising: an enzyme having terminal transfer activity for adding a base to the 3' end of a template nucleic acid.

[0041] The kit and reagent according to the present invention may further comprise a fluorescently labeled substrate to be added to the single-base extension reaction. As described above, the base added by the enzyme having terminal transfer activity is a base that can be distinguished in terms of wavelength from the fluorescently labeled substrate to be added to the single-base extension reaction.

[0042] In addition to the above components, the kit and reagent according to the present invention may include a buffer constituting a reaction solution, enzymes (e.g., a polymerase for single-base extension reaction, a polymerase for template nucleic acid amplification), a standard sample for calibration, etc. By providing the enzyme used in the terminal modification treatment performed prior to the single-base extension reaction as a kit or reagent, gene detection by the single-base extension reaction can be performed more quickly and easily.

[0043] As used herein, elements referred to in the singular are intended to include the plural unless the context clearly indicates otherwise.

[0044] The present invention will be specifically described below by way of examples, but these examples are provided merely to illustrate the present invention and are not intended to limit or restrict the scope of the invention disclosed in this application.

[0045] Example 1 In this example, it was tested whether the template-derived noise signal in a fluorescent single-base extension reaction could be reduced by forming a 3'-overhanging end structure on a template DNA molecule using an enzyme with terminal transfer activity.

[0046] A commercially available human genomic DNA sample (Twist cfDNA Pan-cancer Reference Standard, Twist) was used as the specimen (sample), and the 140-bp target gene GNAS was amplified using the following primer set: GNAS R201 F: ATTACTGTTTCGGTTGGCTTTG (SEQ ID NO: 1) GNAS R201 R: ACAGTTGGCTTACTGGAAGTT (SEQ ID NO: 2) with the following composition and procedure using KOD-Plus- Ver.2 (Toyobo), an alpha-enzyme without terminal transposition activity. A total of 50 μL of template DNA, 1 μL of primer (final concentration 0.3 μM), dNTP mix (final concentration 0.2 mM), 4 μL of 25 mM MgSO, 5 μL of 10× Buffer for KOD-Plus-Ver.2, and 1 μL of KOD-Plus-Ver.2 were mixed and subjected to 35 thermal cycles (94°C for 10 seconds, 55°C for 30 seconds, 72°C for 30 seconds). The resulting amplified product was purified using a NucleoSpin Gel and PCR Clean-up Kit (Machrei-Nagel) and then used in a fluorescent single-base extension reaction.

[0047] The fluorescent single-base extension reaction was performed using the SNaPshot kit (Thermo Fisher Scientific) according to the kit's instructions, and the following 70-mer primer was used for analysis, detecting the base at the R201 coordinate of GNAS: GNAS_R201: ctctctctctctctctctctctctctctctctctctctctctctctctctcttcagGACCTGCTTCGCTGCC (SEQ ID NO: 3, uppercase letters indicate the portion that binds to the GNAS gene).

[0048] The results are shown in Figure 2 (1). In the test using template DNA that had not been subjected to end-modification, the target signal (101) was observed at the 70-mer position, and a template-derived signal (noise) (102) was also observed around the 140-mer position.

[0049] A reaction using the Pol I enzyme Ex-Taq® (Takara Bio Inc.) as an enzyme with terminal transfer activity was performed using the following composition and procedure: 5 μL of purified amplification product, 2 μL of 10x EXTaq buffer, 2 μL of dNTP mix (each substrate concentration 2.5 mM), and 1 μL of Ex-Taq were mixed in a total volume of 20 μL and subjected to enzyme treatment at 72°C for 30 minutes. After the enzyme reaction, the product was purified using the NucleoSpin Gel and PCR Clean-up Kit and then used in a fluorescent single-base extension reaction.

[0050] The results are shown in Figure 2 (2). In the test using template DNA that had been end-modified using dNTP as a substrate, the signal (noise) derived from the template, which appeared at approximately 140 bp and was observed without end-modification, was reduced, but the target signal was clearly observed.

[0051] Similarly, in the terminal modification treatment using Ex-Taq® described above, a test was performed in which the substrate dNTP mix was replaced with ddNTP mix. The results are shown in Figure 2 (3). In the test in which terminal modification treatment was performed using ddNTP as the substrate, the signal (noise) derived from the template was also reduced, but the target signal was clearly observed.

[0052] The results of this example demonstrated that the formation of a 3'-overhanging end structure on a template DNA molecule using the Pol I enzyme Ex-Taq® can reduce template-derived noise signals in fluorescent single-base extension reactions. Furthermore, it was demonstrated that both dNTPs and ddNTPs are effective substrates for end modification.

[0053] Example 2 The target gene GNAS was amplified and subjected to fluorescent single-base extension reaction in the same manner as in Example 1. The results are shown in Figure 3 (1). In a test using template DNA that had not been subjected to terminal modification, a signal (noise) derived from the template (202) was observed in addition to the target signal (201).

[0054] Therminator, a Pol I-type enzyme with terminal transfer activity TM(NEB) and dNTPs were used as substrates for end modification treatment using the following composition and procedure: 5 μL of purified amplification product, 2 μL of 10X ThermoPol Reaction Buffer, 2 μL of dNTP mix with a substrate concentration of 2.5 mM, and Therminator TM The mixture was mixed with 1 μL of DNA polymerase in a total volume of 20 μL and subjected to enzymatic treatment at 72°C for 30 minutes. After the enzymatic reaction, the mixture was purified using a NucleoSpin Gel and PCR Clean-up Kit (Machrei-Nagel) and then used in a fluorescent single-base extension reaction. The reagents and primers used in the fluorescent single-base extension reaction were the same as those in Example 1.

[0055] The results are shown in Figure 3 (2). Similar to the terminal modification treatment using Ex taq in Example 1, the Therminator TM In this test, the target signal is clearly observed, although the template-derived signal (noise) at approximately 140 bp observed in the unmodified template DNA is reduced in the test using the template DNA that has been end-modified using dNTP as a substrate.

[0056] Also Therminator TM In the end-modification treatment using dNTP, the substrate dNTP mix was replaced with ddNTP mix, and the test results are shown in Figure 3 (3). In the test where end-modification treatment was performed using ddNTP as the substrate, the signal (noise) derived from the template was also reduced, but the target signal was clearly observed.

[0057] The results of this example demonstrated that Pol I enzymes with terminal transfer activity can be used to form 3'-overhanging end structures on template DNA molecules and are effective in reducing template-derived noise signals in fluorescent single-base extension reactions.

[0058] [Example 3] The target gene was amplified and subjected to a fluorescent single-base extension reaction in the same manner as in Example 1. The results are shown in Figure 4 (1). In a test using template DNA that had not been subjected to terminal modification, a signal derived from the template (302) was observed in addition to the target signal (301).

[0059] Terminal modification treatment using the terminal transferase TDT (Terminal Deoxynucleotidyl Transferase) (NEB) as the enzyme with terminal transfer activity and ddNTP as the substrate was performed using the following composition and procedure. 5 μL of purified amplification product, 2 μL of 10x TDT buffer, 2 μL of the enzyme's CoCl2 solution, 2 μL of ddNTP mix (each substrate concentration 2.5 mM), and 1 μL of terminal transferase were mixed in a total volume of 20 μL. The mixture was treated with the enzyme at 37°C for 30 minutes, followed by enzyme inactivation at 72°C for 30 minutes. After heat treatment, the product was purified using a NucleoSpin Gel and PCR Clean-up Kit (Machrei-Nagel) and then used in a fluorescent single-base extension reaction. The reagents and primers used in the fluorescent single-base extension reaction were the same as those in Example 1.

[0060] The results are shown in Figure 3(2). In tests using end-modified template DNA, the signal (noise) derived from the template was reduced, but the target signal was clearly observed. Similar results were obtained in tests in which the end-modification substrate was changed to a mixture of 1 μL of ddNTP mix and 1 μL of dNTP, each with a substrate concentration of 2.5 mM, as shown in Figure 3(3).

[0061] The results of this example demonstrated that TDT, a terminal transferase, can also be used to form 3'-overhanging end structures on template DNA molecules and is effective in reducing template-derived noise signals in fluorescent single-base extension reactions.

[0062] Example 4: Multiplex PCR was performed using a commercially available human genomic DNA sample (Twist) and the primer set shown in Table 1. PCR enzymes were KOD-Multi & Epi- (Toyobo) and the following composition and procedure were used. 1 μL of template DNA, primers (final concentration 0.25 μM), 25 μL of 2× PCR Buffer for KOD-Multi & Epi-, and 1 μL of KOD-Multi & Epi- were mixed in a total volume of 50 μL and subjected to 35 thermal cycles (98°C: 10 seconds, 60°C: 30 seconds, 68°C: 15 seconds). The resulting amplified product was purified using a NucleoSpin Gel and PCR Clean-up Kit (Machrei-Nagel) and then used in a fluorescent single-base extension reaction.

[0063]

[0064] For the multiplex fluorescent single-base extension reaction, the primer group shown in Table 2 was used, each primer being used at a final concentration of 0.2 μM, and the reaction was carried out using the SNaPshot kit.

[0065]

[0066] The results are shown in Figure 5. In an example where fluorescent single-base extension reaction was performed using unend-modified template DNA without adding primers (Figure 5(1)), many peak waveforms of template-derived noise signals were observed. Figure 5(2) shows an example where fluorescent single-base extension reaction was performed using unend-modified template DNA with the primers listed in Table 2 added. The peak waveforms observed are a mixture of primer-derived signals and template-derived noise signals.

[0067] Next, a test was carried out to perform terminal modification treatment on the PCR amplification product. In this example, Therminator was used as an enzyme having terminal transfer activity using dNTP as a substrate. TM The terminal modification treatment was carried out using the following composition and procedure: 10 μL of purified amplification product, 5 μL of 10X ThermoPol Reaction Buffer, 5 μL of dNTP mix with a substrate concentration of 2.5 mM, and Therminator TM2 μL of DNA polymerase was added to a total volume of 50 μL and the mixture was treated at 72°C for 30 minutes. After the enzymatic reaction, the mixture was purified using a NucleoSpin Gel and PCR Clean-up Kit (Machrei-Nagel) and then used in a fluorescent single-base extension reaction. Five μL of the terminally modified DNA product was used as template DNA, and the primers listed in Table 2 were added to perform a fluorescent single-base extension reaction.

[0068] The results are shown in Figure 5 (3). Due to the effect of reducing the noise signal derived from the template, the signal derived from the primer became clearly observable.

[0069] In all the drawings for explaining the present embodiment, the same reference numerals are used to designate components having the same functions, and repeated explanations are omitted as much as possible. Furthermore, the present invention should not be interpreted as being limited to the description of the embodiments shown in this specification. Those skilled in the art will easily understand that the specific configuration can be changed within the scope of the idea or purpose of the present invention.

[0070] All publications and patent applications cited herein are incorporated by reference in their entirety.

[0071] 101 Target signal 102 Template-derived noise signal 201 Target signal 202 Template-derived noise signal 301 Target signal 302 Template-derived noise signal Sequence-free text

[0072] SEQ ID NOs: 1 to 36: Synthetic constructs (synthetic oligonucleotides)

Claims

1. A gene detection method using a single-base extension reaction, comprising the steps of: amplifying a sample nucleic acid to prepare a template nucleic acid; treating the template nucleic acid with an enzyme having terminal transfer activity to add a base to the 3' end and form a template nucleic acid having a 3' overhanging end structure; performing a single-base extension reaction using a single-base extension reaction primer and a fluorescently labeled substrate for detecting a target gene, with the template nucleic acid having the 3' overhanging end structure as a template; and subjecting the reaction product of the single-base extension reaction to electrophoresis, and detecting the gene based on the fluorescence and the chain length of the single-base extension reaction primer, wherein the added base is a base that can be distinguished from the fluorescently labeled substrate in terms of wavelength.

2. The method of claim 1, wherein the enzyme having terminal transfer activity is a Pol I-type enzyme.

3. The method of claim 1, wherein the enzyme having terminal transfer activity is terminal deoxynucleotidyl transferase.

4. The method of claim 1, wherein the added base is a dNTP, a ddNTP, or a mixture of dNTPs and ddNTPs.

5. The method of claim 1, wherein the target gene comprises a single nucleotide polymorphism (SNP).

6. The method of claim 1, wherein the template nucleic acid is a template DNA.

7. The method of claim 1, wherein the electrophoresis is capillary electrophoresis (CE).

8. A reagent for reducing template-derived signals in a single-base extension reaction, comprising an enzyme having terminal transfer activity for adding a base to the 3' end of a template nucleic acid.

9. The reagent according to claim 8, wherein the enzyme having terminal transfer activity is a Pol I-type enzyme or terminal deoxynucleotidyl transferase.

10. A gene detection kit using a single-base extension reaction, comprising an enzyme having terminal transfer activity for adding a base to the 3' end of a template nucleic acid.

11. The kit according to claim 10, further comprising a fluorescently labeled substrate added to the single-base extension reaction, wherein the added base is a base that is wavelength-distinguishable from the fluorescently labeled substrate.

12. The kit according to claim 10, wherein the enzyme having terminal transfer activity is a Pol I-type enzyme or terminal deoxynucleotidyl transferase.

13. A kit according to claim 10 for carrying out the method according to claim 1.

Citation Information

Patent Citations

  • Parallel polymer sequencing methods

    EP2431481A1

  • Method for protein expression starting from stabilized linear short dna in cell-free in vitro transcription / translation system with exonuclease-containing lysate or in cellular system containing exonuclease

    JP2002320497A

  • Nucleic acid analysis using non-templated nucleotide addition

    JP2004526448A

  • Compositions and methods for sequential, ordered synthesis of complementary DNA (cDNA) from multiple, discontinuous templates

    JP2021533751A

  • Gene detection using modified substrate that modifies mobility of electrophoresis

    WO2024106109A1