Composition comprising pyrazole derivative for treating cancer

Abstract

The present invention provides: a pharmaceutical composition for preventing, alleviating or treating cancer, comprising a compound of chemical formula 1 or 2, which is a pyrazole derivative, or a pharmaceutically acceptable salt, solvate, stereoisomer or combination thereof; and a pharmaceutical composition for preventing, alleviating or treating cancer, comprising a compound of chemical formula 1 or 2, or a pharmaceutically acceptable salt, solvate, stereoisomer or combination thereof, and an immune checkpoint inhibitor or an immune checkpoint pathway inhibitor.

Description

Composition for treating cancer comprising a pyrazole derivative

[0001] The present invention relates to a pharmaceutical composition for preventing or treating cancer comprising a pyrazole derivative useful for preventing or treating cancer, or a use thereof for preventing or treating cancer, and a therapy in combination with an immune checkpoint inhibitor or an immune checkpoint pathway inhibitor.

[0002] Recently, interactions between the tumor microenvironment and cancer cells have been recognized to play a key role in tumor growth, metastasis, and the development of anticancer drug resistance. Cancer-associated fibroblasts (CAFs) play a crucial role in this process. CAFs promote tumor immune evasion, contributing to cancer malignancy and metastasis. CAF-rich carcinomas not only evade anticancer immunotherapies such as immune checkpoint inhibitors and cancer vaccines, but also increase interstitial fluid pressure, acting as a barrier to drug delivery and hindering the anticancer effects of chemotherapeutics in tumors. Recently, CAFs have emerged as a new target for cancer therapy (Exp Mol Med. 2023 Jul; 55(7):1322-1332).

[0003] Therefore, to effectively prevent or treat cancer, a pharmaceutical composition that can efficiently inhibit cancer-related fibroblasts and related pathways while enhancing anti-tumor immunity is required.

[0004] The present inventors, noting that a therapeutic agent for cancer can be developed by suppressing cancer-associated fibroblasts, discovered that the pyrazole compound of the present invention exhibits a therapeutic effect in cancers rich in cancer-associated fibroblasts and exhibits a synergistic anticancer effect when combined with an immune checkpoint anticancer agent or an immune checkpoint pathway inhibitor, thereby confirming that it can be used for the treatment of cancer, thereby completing the present invention.

[0005]

[0006] Meanwhile, no prior literature discloses that the pyrazole compound of the present invention has a preventive or therapeutic effect on cancer.

[0007] [Prior Art Literature]

[0008] [Patent Document]

[0009] (Patent Document 1) Korean Patent Registration No. 10-2473680

[0010] [Non-patent literature]

[0011] (Non-patent literature 1) Exp Mol Med. 2023 Jul; 55(7):1322-1332

[0012] An object of the present invention is to provide a pharmaceutical composition for preventing or treating cancer comprising a pyrazole compound that can be used in combination with an immune checkpoint anticancer agent or an immune checkpoint pathway inhibitor.

[0013] Another object of the present invention is to provide a method for preventing or treating cancer using the pyrazole compound and an immune checkpoint pathway inhibitor or an immune checkpoint pathway inhibitor.

[0014] In order to achieve the above purpose, one aspect of the present invention is a pharmaceutical composition for preventing, improving or treating cancer, comprising a pyrazole derivative compound represented by the following chemical formula 1 or 2, or a pharmaceutically acceptable salt thereof.

[0015] [Chemical Formula 1]

[0016]

[0017] (Each element of the above formula is defined below)

[0018]

[0019] [Chemical Formula 2]

[0020]

[0021] (Each element of the above formula is defined below)

[0022]

[0023] One aspect of the present invention is characterized in that the pharmaceutical composition is administered in combination with an immune checkpoint inhibitor or an immune checkpoint pathway inhibitor.

[0024]

[0025] One aspect of the present invention is a pharmaceutical composition for preventing, improving or treating cancer, comprising a compound of the above chemical formula 1 or 2, which is a pyrazole derivative, or a pharmaceutically acceptable salt, solvate, stereoisomer or combination thereof, and an immune checkpoint inhibitor or an immune checkpoint pathway inhibitor.

[0026]

[0027] One aspect of the present invention is a method for preventing, improving or treating cancer by administering a compound of the above chemical formula 1 or 2 or a pharmaceutically acceptable salt thereof to a tumor entity.

[0028] One aspect of the present invention relates to a method for preventing, improving or treating cancer by administering a compound of the above chemical formula 1 or 2 or a pharmaceutically acceptable salt thereof to a tumor entity rich in cancer-related fibroblasts.

[0029] One aspect of the present invention relates to the use of preventing, improving or treating cancer by administering to a tumor subject a compound of the above chemical formula 1,2 or a pharmaceutically acceptable salt thereof in combination with an immune checkpoint inhibitor or an immune checkpoint pathway inhibitor.

[0030] The present invention relates to a method for reviving sensitivity to immunotherapeutic treatment and converting a cold tumor into a hot tumor by administering in combination a compound of the above chemical formula 1 or 2 or a pharmaceutically acceptable salt thereof and an immune checkpoint inhibitor or an immune checkpoint pathway inhibitor, the method comprising a step of administering to a subject in need of treatment an effective amount of one or more compounds of the chemical formula 1 or 2 in combination with an immune checkpoint inhibitor.

[0031] The pyrazole compound according to the present invention, or a pharmaceutically acceptable salt thereof, can effectively suppress cancer-related fibroblasts by suppressing oxidative stress, and thus can be usefully used for the prevention or treatment of cancer.

[0032] In addition, the pyrazole compound according to the present invention, or a pharmaceutically acceptable salt thereof, can be used to prevent or treat cancer by administering it in combination with an immune checkpoint inhibitor or an immune checkpoint pathway inhibitor, thereby reviving sensitivity to immunotherapeutic treatment and converting a cold tumor into a hot tumor, thereby enhancing the therapeutic effect. Therefore, the pyrazole compound according to the present invention can be usefully used to prevent or treat cancer by administering it in combination with an immune checkpoint inhibitor.

[0033] Figure 1a is a diagram showing the results of effective suppression of tumor volume when compound 3 is administered alone in a CAF-rich colon cancer model (****p<0.0001, t-test).

[0034] Figure 1b is a diagram showing the results of effectively reducing the distribution of α-SMA (alpha smooth muscle actin) protein in tumor tissues when compound 3 was administered alone in a CAF-rich colon cancer model. (*p<0.05, t-test).

[0035] Figure 1c is a diagram showing the results of good infiltration of CD8+T cells into tumor tissues when compound 3 is administered alone in a CAF-rich colon cancer model (****p<0.0001, t-test).

[0036] Figure 1d is a diagram showing the results of effectively reducing the expression of NOX1, NOX2, and NOX4 mRNA in tumor tissues when compound 3 is administered alone in a CAF-rich colon cancer model (**p<0.01, ***p<0.001, t-test).

[0037] Figure 2a is a diagram showing the results of effective suppression of tumor volume when compound 5 is administered alone in a CAF-rich colon cancer model (**p<0.01, t-test).

[0038] Figure 2b is a diagram showing the results of effectively inhibiting the protein expression of α-SMA (alpha smooth muscle actin) in tumor tissues when compound 5 was administered alone in a CAF-rich colon cancer model (*p<0.05, t-test).

[0039] Figure 3a is a diagram showing the results of effectively suppressing tumor volume when compound 3 is administered alone in a pancreatic cancer model (****p<0.0001, t-test).

[0040] Figure 3b is a diagram showing the results of effectively reducing the expression of NOX1, NOX2, and NOX4 mRNA in tumor tissue when compound 3 is administered alone in a pancreatic cancer model (*p<0.05, **p<0.01, t-test).

[0041] Figure 4a shows that the combination of compound 3 and an immune checkpoint inhibitor (anti-PD-1) synergistically suppressed tumor volume in a CAF-enriched colon cancer model. This figure shows that the combination of compound 3 and an immune checkpoint inhibitor (anti-PD-1) improved resistance to the immune checkpoint inhibitor (***p<0.001, t-test).

[0042] Figure 4b is a diagram showing the results of synergistic infiltration of CD8+ T cells into tumor tissue in a combination of compound 3 and an immune checkpoint inhibitor (anti-PD-1) in a CAF-enriched colon cancer model (***p<0.001, t-test).

[0043] Figure 4c shows that the combination of compound 3 and an immune checkpoint inhibitor (anti-PD-1) effectively reduces the protein expression of α-SMA (alpha smooth muscle actin) in a CAF-rich colon cancer model. That is, this is a diagram showing that compound 1 significantly reduces α-SMA-positive CAFs, which in turn improves the resistance of immune checkpoint inhibitors (anti-PD-1) by allowing CD8+ T cells to access the tumor and reduce cancer cells, thereby synergistically reducing tumor size (*p<0.05, t-test).

[0044] Figure 5 is a diagram showing the results of synergistic inhibition of tumor volume in a combination of compound 3 and an immune checkpoint inhibitor (anti-CTLA4) in a CAF-enriched colon cancer model (**p<0.01, ****p<0.0001, t-test).

[0045] Figure 6a shows that the combination of compound 5 and an immune checkpoint inhibitor (anti-PD-1) synergistically inhibited tumor volume in a CAF-enriched colon cancer model. This figure shows that the combination of compound 5 and an immune checkpoint inhibitor (anti-PD-1) improved resistance to the immune checkpoint inhibitor (***p<0.001, t-test).

[0046] Figure 6b is a diagram showing the results of synergistic infiltration of CD8+T cells into tumor tissue in a combination of compound 5 and an immune checkpoint inhibitor (anti-PD-1) in a CAF-enriched colon cancer model (****p<0.0001, t-test).

[0047] Figure 6c shows that the combination of compound 5 and an immune checkpoint inhibitor (anti-PD-1) effectively reduces the protein expression of α-SMA (alpha smooth muscle actin) in a CAF-enriched colon cancer model. That is, compound 5 significantly reduces α-SMA-positive CAFs, which in turn improves the resistance of immune checkpoint inhibitors (anti-PD-1) by allowing CD8+ T cells to access the tumor and reduce cancer cells, thereby synergistically reducing tumor size (*p<0.05, t-test).

[0048] Figure 7a shows the results of synergistic inhibition of tumor volume in a pancreatic cancer model in combination with compound 3 and an immune checkpoint inhibitor (anti-CTLA4). This figure shows that the combination of compound 3 and an immune checkpoint inhibitor (anti-CTLA4) improves resistance to the immune checkpoint inhibitor (anti-CTLA4) (****p<0.0001, t-test).

[0049] Figure 7b is a diagram showing the results of effective reduction of mRNA of ACTA2 and Collagen Iα, which are CAF fibrosis indicators in tumor tissue, in a combination of compound 3 and an immune checkpoint inhibitor (anti-CTLA4) in a pancreatic cancer model (*p<0.05, ***p<0.001, t-test).

[0050] Figure 8 is a diagram showing the results of synergistic inhibition of tumor volume in a combination of compound 3 and an immune checkpoint inhibitor (anti-PD-L1) in a CAF-enriched colon cancer model (***p<0.001, t-test).

[0051] Figure 9 is a drawing showing the results showing that the mRNA of ACTA2, a fibrosis indicator, was increased at a high rate in pCAF (pancreatic cancer-associate fibroblasts) compared to pancreatic fibroblasts, and that the mRNA of ACTA2 was effectively reduced when 12 compounds were treated in pCAF (***p<0.001, ****p<0.0001, t-test).

[0052] Hereinafter, the present invention will be described in detail with implementation examples.

[0053]

[0054] However, these are provided as examples and are not intended to limit the present invention. The present invention is defined solely by the scope of the claims set forth below. Furthermore, even if a configuration is essential for practicing the present invention, a detailed description of the configuration, which can be easily implemented by a person skilled in the art based on publicly available technology, will be omitted.

[0055] Terms or words used in this specification and claims should not be interpreted as limited to their usual or dictionary meanings, but should be interpreted as meanings and concepts that conform to the technical idea of ​​the present invention, based on the principle that the inventor can appropriately define the concept of the term to explain his or her own invention in the best way.

[0056] The terminology used in the present invention is only used to describe specific embodiments and is not intended to limit the present invention. The singular expression includes the plural expression unless the context clearly indicates otherwise. In the present invention, it should be understood that the terms "comprise" or "have" are intended to specify the presence of a feature, number, step, operation, component, part, or combination thereof described in the specification, but do not exclude in advance the possibility of the presence or addition of one or more other features, numbers, steps, operations, components, parts, or combinations thereof.

[0057]

[0058] Pharmaceutical composition comprising a pyrazole derivative according to the present invention

[0059] The present invention provides a pharmaceutical composition for preventing, improving or treating cancer, comprising a compound of the following chemical formula 1 or 2, which is a pyrazole derivative, or a pharmaceutically acceptable salt, solvate, stereoisomer or combination thereof, and an immune checkpoint inhibitor or an immune checkpoint pathway inhibitor.

[0060] [Chemical Formula 1]

[0061]

[0062] In the above formula,

[0063] R is H or C1-C3 alkyl,

[0064] n is an integer from 0 to 2,

[0065] L is CR', CH-C(=O)R', NR' or N-(C=O)R', wherein R' is H, C1-C4 alkyl, C2-C4 alkenyl, C1-C4 alkoxy, or C3-C8 cycloalkyl,

[0066] D, E, F, G and J are each independently N or CR”, wherein R” is H, halo or C1-C3 alkyl.

[0067]

[0068] [Chemical Formula 2]

[0069]

[0070] In the above formula,

[0071] R is H or C1-C3 alkyl,

[0072] K and M are each independently H, C1-C3 alkyl, -C1-C3 alkyl-C6-C9 aryl, -SO2-C6-C9 aryl, -C(=O)NH-C6-C9 aryl, 5- to 12-membered heteroaryl, 7- to 12-membered heterobicycle, or C1-C3 alkyl-5- to 12-membered heteroaryl or C1-C3 alkyl-7- to 12-membered heterobicycle, wherein the C6-C9 aryl of -C1-C3 alkyl-C6-C9 aryl may be optionally substituted with -NH2 or -N(C1-C3 alkyl)2,

[0073] D, E, F, G and J are each independently N or CR”, wherein R” is H, halo or C1-C3 alkyl.

[0074]

[0075] Specifically, in the chemical formula 1 or 2,

[0076] R can be H or methyl.

[0077] Also, n can be an integer of 0 or 1.

[0078] In addition, L is CH-C(=O)R', NR' or N-(C=O)R', wherein R' may be H, C1-C3 alkyl, C2-C3 alkenyl, C1-C3 alkoxy or C3-C6 cycloalkyl. More specifically, the L is CH-C(=O)R', NR' or N-(C=O)R', wherein R' may be H, methyl, ethyl, ethenyl, methoxy or cyclopropyl. More specifically, the above may be selected from the following structures:

[0079] , , , , , .

[0080]

[0081] In addition, D, E, F, G and J are each independently N or CR", wherein R" can be H or methyl. More specifically, the D, E, F, G and J can each independently be N or CH. More specifically, the above may be a pyridyl group.

[0082] In addition, K and M may each independently be H, C1-C2 alkyl, -C1-C3 alkyl-C6 aryl, -SO2-C6 aryl, -C(=O)NH-C6 aryl, 5- to 6-membered heteroaryl, 7- to 10-membered heterobicycle, or C1-C2 alkyl-5- to 6-membered heteroaryl or C1-C3 alkyl-7- to 10-membered heterobicycle, wherein the C6 aryl in the -C1-C3 alkyl-C6 aryl may be optionally substituted with -N(CH3)2. The heteroaryl may include 1 to 2 heteroatoms selected from the group consisting of N, O, and S.

[0083] More specifically,

[0084] may be selected from the following structures:

[0085] , , , , .

[0086]

[0087] In a specific embodiment, the compound of formula 1 or 2 according to the present invention may be the following compound.

[0088] 1) 5-(4-methylpiperazin-1-yl)-2-(pyridin-2-yl)-4,5,6,7-tetrahydro-2H-indazol-3-ol;

[0089] 2) 5-(methyl(5,6,7,8-tetrahydroquinolin-8-yl)amino)-2-(pyridin-2-yl)-4,5,6,7-tetrahydro-2H-indazol-3-ol;

[0090] 3) Cyclopropyl[4-(3-hydroxy-2-(pyridin-2-yl)-4,5,6,7-tetrahydro-2H-indazol-5-yl)piperazin-1-yl]methanone hydrochloride;

[0091] 4) 5-((2-(dimethylamino)benzyl)(methyl)amino)-2-(pyridin-2-yl)-4,5,6,7-tetrahydro-2H-indazol-3-ol;

[0092] 5) 5-[(isoquinolin-3-ylmethyl)methylamino]-2-(pyridin-2-yl)-4,5,6,7-tetrahydro-2H-indazol-3-ol] hydrochloride;

[0093] 6) 5-(4-ethylpiperazin-1-yl)-2-(pyridin-2-yl)-4,5,6,7-tetrahydro-2H-indazol-3-ol;

[0094] 7) 1-(4-(3-hydroxy-2-(pyridin-2-yl)-4,5,6,7-tetrahydro-2H-indazol-5-yl)piperazin-1-yl)prop-2-en-1-one;

[0095] 8) 5-(4-methylpiperazin-1-yl)-2-(pyrimidin-2-yl)-4,5,6,7-tetrahydro-2H-indazol-3-ol;

[0096] 9) N-(3-hydroxy-2-(pyridin-2-yl)-4,5,6,7-tetrahydro-2H-indazol-5-yl)benzenesulfonamide;

[0097] 10) 1-(3-hydroxy-2-(pyridin-2-yl)-4,5,6,7-tetrahydro-2H-indazol-5-yl)-3-phenylurea;

[0098] 11) 1-(4-(3-hydroxy-2-(pyridin-2-yl)-4,5,6,7-tetrahydro-2H-indazol-5-yl)piperazin-1-yl)propan-1-one; and

[0099] 12) Methyl 4-(3-hydroxy-2-(pyridin-2-yl)-4,5,6,7-tetrahydro-2H-indazol-5-yl)piperazine-1-carboxylate.

[0100]

[0101] The compound of the above chemical formula 1 or 2 can inhibit the expression of α-SMA (alpha smooth muscle actin) protein in tumor tissue, ACTA2 and Collagen Iα in tumor tissue, and the expression of NADH oxidase (NOX) genes (e.g., NOX1, NOX2, and NOX4).

[0102]

[0103] The pharmaceutically acceptable salt may be a salt that does not cause serious irritation to an organism to which the compound is administered and does not impair the biological activity and physical properties of the compound. The salt may be, for example, an inorganic acid salt, an organic acid salt, or a metal salt. The inorganic acid salt may be a hydrochloride, a bromate, a phosphate, a sulfate, or a disulfate. The organic acid salt may be a formate, an acetate, a propionate, a lactate, an oxalate, a tartrate, a malate, a maleate, a citrate, a fumarate, a besylate, a camsylate, an edicyl salt, a trichloroacetic acid, a trifluoroacetate, a benzoate, a gluconate, a methanesulfonate, a glycolate, a succinate, a 4-toluenesulfonate, a galacturonate, an embronate, a glutamate, an ethanesulfonic acid, a benzenesulfonic acid, a p-toluenesulfonic acid, or an aspartate. The metal salt may be a calcium salt, sodium salt, magnesium salt, strontium salt, or potassium salt.

[0104] The above solvate may be a compound formed by the attraction between solute and solvent molecules. The solvate may be, for example, a hydrate.

[0105] The above stereoisomer refers to a compound having the same molecular formula and the same method of connecting constituent elements, but with different spatial arrangements between atoms. The above stereoisomer may be a diastereoisomer or an enantiomer of the compound of the above chemical formula I.

[0106]

[0107] One aspect of the present invention is characterized in that the pharmaceutical composition is administered in combination with an immune checkpoint inhibitor or an immune checkpoint pathway inhibitor.

[0108]

[0109] In addition, another aspect of the present invention provides a pharmaceutical composition for preventing, improving or treating cancer, comprising a compound of the above chemical formula 1 or 2, which is a pyrazole derivative, or a pharmaceutically acceptable salt, solvate, stereoisomer or combination thereof, and an immune checkpoint inhibitor or an immune checkpoint pathway inhibitor.

[0110] The pharmaceutical composition may comprise an effective amount of a compound of the above chemical formula 1 or 2, a pharmaceutically acceptable salt, solvate, stereoisomer or combination thereof; and an immune checkpoint inhibitor or an immune checkpoint pathway inhibitor.

[0111]

[0112] The above immune checkpoint inhibitors or immune checkpoint pathway inhibitors are described in more detail in the following co-administration (combination).

[0113]

[0114] The cancer may be a solid cancer or a non-solid cancer. Solid cancer refers to cancerous tumors that develop in organs such as the liver, lungs, breasts, and skin, while non-solid cancers are cancers that develop in the blood and are also called hematological cancers. The cancer may be a carcinoma, a sarcoma, a cancer derived from hematopoietic cells, a germ cell tumor, or a blastoma. Carcinoma may be a cancer derived from epithelial cells, and sarcoma may be a cancer derived from connective tissue (bone, cartilage, fat, and nerves) that develops from cells derived from mesenchymal cells outside the bone marrow. Germ cell tumors may be cancers derived from pluripotent cells. The pluripotent cells may be present in the testis or ovary, and blastomas may be derived from immature precursor cells or embryonic tissue. The cancer may be selected from the group consisting of colon cancer, Hodgkin's lymphoma, urothelial cancer, melanoma, esophageal cancer, renal cell cancer, small intestine cancer, rectal cancer, colorectal cancer, triple-negative breast cancer, kidney cancer, non-small cell lung cancer, small cell lung cancer, head and neck cancer, thymoma, mesothelioma, kidney cancer, bladder cancer, prostate cancer, testicular cancer, germ cell tumor, ovarian cancer, endometrial cancer, cervical cancer, uterine sarcoma, stomach cancer, liver cancer, brain cancer, pancreatic cancer, biliary tract cancer, colon cancer, hepatocellular carcinoma, breast cancer, Merkel cell carcinoma, thyroid cancer, sarcoma, skin cancer, lymphoma, myelodysplastic syndromes (MDS), myelofibrosis, acute leukemia, chronic leukemia, and multiple myeloma.

[0115]

[0116] The pharmaceutical composition of the present invention can be administered to mammals such as rats, mice, livestock, and humans via various routes. In the present invention, the routes of administration of the pharmaceutical composition include, but are not limited to, oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual, or rectal.

[0117] Additionally, oral and parenteral administration are preferred methods of administering the pharmaceutical composition. The term "parenteral" as used herein includes subcutaneous, intradermal, intravenous, intramuscular, intraarticular, intrasynovial, intrasternal, intrathecal, intralesional, and intracranial injection or infusion techniques.

[0118] The pharmaceutical composition according to the present invention may additionally comprise one or more pharmaceutically acceptable carriers, one or more excipients and / or diluents.

[0119] Non-limiting examples of pharmaceutically suitable carriers include solids and / or liquids, such as ethanol, glycerol, water, and the like. The amount of carrier in the therapeutic composition can range from about 5 to about 99 weight percent, based on the total weight of the therapeutic composition or therapeutic combination. Non-limiting examples of suitable pharmaceutically acceptable excipients and diluents include non-toxic compatible fillers, binders, disintegrants, buffers, preservatives, wetting agents, bulking agents, antioxidants, lubricants, flavoring agents, thickening agents, coloring agents, surfactants, emulsifiers, thickening agents, and the like. Such excipients and diluents include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate and mineral oil, and it will be apparent to those skilled in the art that any other pharmaceutically acceptable carrier, excipient and diluent may be used.

[0120] The composition of the present invention can be formulated and used in the form of oral formulations such as tablets, powders, granules, pills, capsules, suspensions, emulsions, liquids, emulsions, syrups, external preparations, suppositories, or sterile injection solutions, each according to a conventional method.

[0121] The pharmaceutical composition according to the present invention may be in the form of a sterile injectable aqueous or oily suspension. This suspension may be formulated according to techniques known in the art using suitable dispersing or wetting agents (e.g., Tween 80) and suspending agents. The sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic, parenterally acceptable diluent or solvent (e.g., a solution in 1,3-butanediol). Acceptable vehicles and solvents include mannitol, water, Ringer's solution, or isotonic sodium chloride solution. In addition, a sterile fixed oil is typically used as a solvent or suspending medium. For this purpose, any fixed oil with minimal irritation, including synthetic mono- or diglycerides, may be used. Fatty acids such as oleic acid and its glyceride derivatives are useful in injectable preparations, as are pharmaceutically acceptable natural oils (e.g., olive oil or castor oil), especially their polyoxyethylated forms.

[0122] The pharmaceutical composition according to the present invention may be administered orally in any orally acceptable dosage form, including but not limited to capsules, tablets, and aqueous suspensions and solutions.

[0123] The pharmaceutical composition of the present invention may also be administered in the form of a suppository for rectal administration. These compositions can be prepared by mixing the compound of the present invention with a suitable non-irritating excipient that is solid at room temperature but liquid at rectal temperature. Such materials include, but are not limited to, cocoa butter, beeswax, and polyethylene glycol.

[0124] Topical administration of the pharmaceutical composition according to the present invention is particularly useful when the desired treatment involves a site or organ easily accessible by topical application. When applied topically to the skin, the pharmaceutical composition should be formulated as a suitable ointment containing the active ingredient suspended or dissolved in a carrier. Carriers for topical administration of the compounds of the present invention include, but are not limited to, mineral oil, liquid paraffin, white petrolatum, propylene glycol, polyoxyethylene, polyoxypropylene compounds, emulsifying waxes, and water. Alternatively, the pharmaceutical composition may be formulated as a suitable lotion or cream containing the active compound suspended or dissolved in a carrier. Suitable carriers include, but are not limited to, mineral oil, sorbitan monostearate, polysorbate 60, cetyl ester wax, cetearyl alcohol, 2-octyldodecanol, benzyl alcohol, and water. The pharmaceutical composition of the present invention may also be applied topically to the lower intestinal tract by rectal suppository or as a suitable enema. Topically applied transdermal patches are also encompassed by the present invention.

[0125] The pharmaceutical composition of the present invention can be administered by nasal aerosol or inhalation. Such compositions are prepared according to techniques well known in the pharmaceutical field and may be prepared as a solution in saline using benzyl alcohol or other suitable preservatives, absorption promoters to enhance bioavailability, fluorocarbons, and / or other solubilizing or dispersing agents known in the art.

[0126] The pharmaceutical composition of the present invention contains the compound described above in a therapeutically effective amount or a prophylactically effective amount. The preferred dosage of the compound according to the present invention varies depending on the patient's condition and weight, the extent of the disease, the drug form, the route and duration of administration, and can be appropriately selected by those skilled in the art. The dosage of the pharmaceutical composition may range, for example, from about 0.002 mg / kg to about 200 mg / kg, or from about 0.01 mg / kg to 100 mg / kg for adults. The administration may be administered once a day, multiple times a day, or once or multiple times every two days to a year.

[0127] Treatment method

[0128] In another aspect, one aspect of the present invention relates to a method for preventing, improving or treating cancer by administering a compound of the above chemical formula 1 or 2 or a pharmaceutically acceptable salt thereof to a tumor subject.

[0129] One aspect of the present invention relates to a method for preventing, improving or treating cancer by administering a compound of the above chemical formula 1 or 2 or a pharmaceutically acceptable salt thereof to a tumor entity rich in cancer-related fibroblasts.

[0130] At this time, the compound of chemical formula 1 or 2 of the present invention, a pharmaceutically acceptable salt, solvate, stereoisomer or combination thereof is administered in a pharmaceutically effective amount. It can be used in combination with methods using surgery, radiotherapy, hormone therapy, chemotherapy and biological response modifiers. The concentration of the effective ingredient included in the composition of the present invention can be determined in consideration of the treatment purpose, the patient's condition, the required period, etc., and is not limited to a specific range of concentrations. The term "pharmaceutically effective amount" of the present invention means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment and not causing side effects, and the effective dosage level can be determined according to the patient's health condition, the type and severity of the disease, the activity of the drug, the sensitivity to the drug, the administration method, the administration time, the administration route and the excretion rate, the treatment period, the drug used in combination or concurrently, and other factors well known in the medical field. The composition of the present invention can be administered as an individual therapeutic agent or in combination with other therapeutic agents, such as immune checkpoint inhibitors. It can be administered sequentially or simultaneously with conventional therapeutic agents, or in single or multiple doses. Taking all of the above factors into account, it is important to administer the amount that achieves maximum efficacy with the minimum amount possible without adverse effects, a determination readily available to those skilled in the art.

[0131] For example, the dosage may increase or decrease depending on the route of administration, severity of disease, gender, weight, age, etc., and thus the dosage does not limit the scope of the present invention in any way.

[0132] The preferred dosage of the compound of the present invention varies depending on the patient's condition and weight, the degree of the disease, the form of the drug, the route and period of administration, but can be appropriately selected by a person skilled in the art.

[0133]

[0134] combination therapy

[0135] The compound of the above chemical formula 1 or 2 of the present invention or a pharmaceutically acceptable salt thereof and a pharmaceutical composition comprising the same may be used alone or in combination with one or more additional therapies (e.g., non-drug treatment or therapeutic agent).

[0136] Combination therapy may, for example, combine two therapies, three therapies (e.g., triple therapy with three therapeutic agents), or more. The dosage of one or more of the additional therapies (e.g., non-pharmacological or therapeutic agents) may be reduced from the standard dosage when administered alone.

[0137]

[0138] The compound of the above chemical formula 1 or 2 of the present invention or a pharmaceutically acceptable salt thereof and a pharmaceutical composition comprising them may be administered before, after or simultaneously with one or more of these additional therapies.

[0139] The compound of the present invention and additional therapies, such as anticancer agents, may be administered together, for example, in a single pharmaceutical composition, or may be administered separately, and if administered separately, may occur simultaneously or sequentially. Such sequential administration may be close in time or distantly spaced.

[0140]

[0141] In a specific embodiment, the additional therapy may be the administration of a side effect-limiting agent. Examples of such side effect-limiting agents include agents that can be used to treat nausea, such as dronabinol, granisetron, metoclopramide, ondansetron, and prochlorperazine, or pharmaceutically acceptable salts thereof.

[0142]

[0143] In a specific embodiment, the additional therapy comprises a non-pharmacological therapy (e.g., surgery or radiation therapy). Examples of non-pharmacological therapies include, but are not limited to, radiation therapy, hormonal therapy, cryotherapy, hyperthermia, surgery (e.g., surgical resection of tumor tissue), and T cell adoptive transfer (ACT) therapy.

[0144] The possible combination treatment may be a compound used in the treatment of cancer or its associated symptoms, and suitable steroids include 21-acetoxypregnenolone, alclomethasone, algestone, amcinonide, beclomethasone, betamethasone, budesonide, chloroprednisone, clobetasol, clocortolone, cloprednol, corticosterone, cortisone, cortivazol, deflazacort, desonide, desoximetasone, dexamethasone, diflorasone, diflucortolone, difuprednate, enoxolone, fluazacort, fluchloronide, flumethasone, flunisolide, fluocinolone acetonide, fluocinonide, fluocortin butyl, fluocortolone, fluorometholone, fluperolone acetate, fluprednidene. Acetate, fluprednisolone, flurandrenolide, fluticasone propionate, formocortal, halosinonide, halobetasol propionate, halometasone, hydrocortisone, loteprednol etabonate, mazipredone, medrysone, meprednisone, methylprednisolone, mometasone furoate, paramethasone, prednicarbate, prednisolone, prednisolone 25-diethylaminoacetate, prednisolone sodium phosphate, prednisone, prednival, prednylidene, rimexolone, tixocortol, triamcinolone, triamcinolone acetonide, triamcinolone benetonide, triamcinolone hexacetonide and salts or derivatives thereof, but are not limited thereto.

[0145] The biologic agent may be a biological agent (e.g., a cytokine (e.g., an interferon or an interleukin such as IL-2)) used to treat cancer or a symptom associated therewith. In some embodiments, the biologic agent is an immunoglobulin-based biologic agent, such as a monoclonal antibody (e.g., a humanized antibody, a fully human antibody, an Fc fusion protein, or a functional fragment thereof) that acts on a target to stimulate an anti-cancer response or antagonizes an antigen important to the cancer. Antibody-drug conjugates (ADCs) are also included.

[0146] In one embodiment, the checkpoint inhibitor can be a single specific antibody, such as a monoclonal antibody, a fusion protein, such as an Fc-receptor fusion protein, and more specifically, but not limited to, an inhibitor (e.g., an inhibitory antibody or small molecule inhibitor) of CTLA-4 (e.g., an anti-CTLA-4 antibody or fusion protein), an inhibitor or antagonist of PD-1 (e.g., an inhibitory antibody or small molecule inhibitor), an inhibitor or antagonist of PDL-1 (e.g., an inhibitory antibody or small molecule inhibitor), an inhibitor or antagonist of PDL-2 (e.g., an inhibitory antibody or Fc fusion or small molecule inhibitor) (e.g., a PDL-2 / Ig fusion protein), and the like.

[0147] In one embodiment, the anticancer agent can be, for example, a chemotherapeutic agent or a targeted therapy. Specifically, the anticancer agent includes a mitotic inhibitor, an intercalating antibiotic, a growth factor inhibitor, a cell cycle inhibitor, an enzyme, a topoisomerase inhibitor, a biological response modifier, an alkylating agent, an antimetabolite, a folic acid analog, a pyrimidine analog, a purine analog and related inhibitors, a vinca alkaloid, an epipodophyllotoxin, an antibiotic, L-asparaginase, a topoisomerase inhibitor, an interferon, a platinum coordination complex, anthracenedione-substituted urea, a methyl hydrazine derivative, an adrenocorticosteroid, a progestin, an estrogen, an antiestrogen, an androgen, an antiandrogen, and a gonadotropin analog. Additional anticancer agents include leucovorin (LV), irenotecan, oxaliplatin, capecitabine, paclitaxel, docetaxel, inhibitors of downstream members of ALK inhibitor receptor tyrosine kinase (RTK) / growth factor receptor (e.g., SHP2 inhibitor), SOS1 inhibitor, Raf inhibitor, MEK inhibitor, ERK inhibitor, PI3K inhibitor, PTEN inhibitor, AKT inhibitor, or mTOR inhibitor, Ras inhibitor, Ras vaccine, inhibitors of the MAP kinase (MAPK) pathway (or "MAPK inhibitor"), disrupters or inhibitors of the RAS-RAF-ERK or PI3K-AKT-TOR or PI3K-AKT signaling pathway, PD-1 or PD-L1 antagonists, immunomodulatory imides (IMiDs), GITR agonists, genetically engineered T-cells (e.g., CAR-T cells), bispecific antibodies (e.g., BiTE) and anti-PD-1, anti-PDL-1, anti-CTLA4, anti-LAG1 and anti-OX40 agents), EGFR inhibitors, IGF-1R inhibitors, etc., but are not limited thereto.

[0148] In one embodiment, the anti-angiogenic agent includes, but is not limited to, in vitro synthesized chemical compositions, antibodies, antigen binding domains, radionuclides, and combinations and conjugates thereof.

[0149] In one embodiment, the autophagy inhibitor includes, but is not limited to, chloroquine, 3-methyladenine, hydroxychloroquine (Plaquenil™), bafilomycin A1, 5-amino-4-imidazole carboxamide riboside (AICAR), okadaic acid, an autophagy inhibitory algal toxin that inhibits protein phosphatase of type 2A or type 1, an analog of cAMP, and drugs that increase cAMP levels, such as adenosine, LY204002, N6-mercaptopurine riboside, and vinblastine.

[0150]

[0151] The compounds of the present invention may be used in combination with the agents described herein or other suitable agents, depending on the condition being treated. Thus, in some embodiments, one or more compounds of the present disclosure will be co-administered with another therapy as described herein. When used in combination therapy, the compounds described herein may be administered simultaneously or separately from the second agent. Such combined administration may include simultaneous administration of the two agents in the same dosage form, simultaneous administration in separate dosage forms, and separate administration. That is, the compounds described herein and any of the agents described herein may be co-formulated in the same dosage form and administered simultaneously. Alternatively, the compounds of the present invention and any of the agents described herein may be administered simultaneously, wherein the two agents are present in separate formulations. In another alternative, the compounds of the present disclosure may be administered followed by any of the agents described herein, or vice versa. In some embodiments of separate administration protocols, the compounds of the present invention and any of the agents described herein may be administered minutes apart, hours apart, or days apart.

[0152]

[0153] In some embodiments of any of the methods described herein, the first therapy (e.g., a compound of the invention) and one or more additional therapies can be administered in any order, simultaneously or sequentially.

[0154]

[0155] According to one embodiment of the present invention, the compound of Chemical Formula 1 or 2 or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising the same, may be administered in combination with an immune checkpoint inhibitor or an immune checkpoint pathway inhibitor.

[0156]

[0157] Accordingly, one aspect of the present invention relates to a use for preventing, improving or treating cancer by administering to a tumor subject a compound of the above chemical formula 1 or 2 or a pharmaceutically acceptable salt thereof and an immune checkpoint inhibitor or an immune checkpoint pathway inhibitor in combination.

[0158] The present invention relates to a method for reviving sensitivity to immunotherapeutic treatment and converting a cold tumor into a hot tumor by administering in combination a compound of the above chemical formula 1 or 2 or a pharmaceutically acceptable salt thereof and an immune checkpoint inhibitor or an immune checkpoint pathway inhibitor, the method comprising a step of administering to a subject in need of treatment an effective amount of one or more compounds of the chemical formula 1 or 2 in combination with an immune checkpoint inhibitor.

[0159] The compounds of the above chemical formula 1 and 2, pharmaceutically acceptable salts, solvates, stereoisomers, cancer, and prevention, improvement and treatment thereof are as described above.

[0160] The subject may be a mammal, such as a human, cow, horse, pig, dog, sheep, goat, or cat. The subject may be an individual suffering from or likely to suffer from cancer.

[0161]

[0162] The immune checkpoint pathway refers to an intracellular signaling pathway that induces immune tolerance or induces immune system inhibition. The immune checkpoint pathway may be a signaling pathway that inhibits T cell activation. Therefore, an immune checkpoint pathway inhibitor may inhibit an intracellular signaling pathway that inhibits immune tolerance induction or induces immune system inhibition, or a signaling pathway that inhibits T cell activation.

[0163] Meanwhile, the immune checkpoint blockade may inhibit immune tolerance or activate the immune system. The immune checkpoint inhibition may encompass any signaling pathway that activates T cells to enhance anti-tumor immune responses. The immune checkpoint inhibition may be achieved, for example, by an agent that induces T cell activation or an agent that relieves T cell inhibition.

[0164] The above immune checkpoint inhibitor may be an agent that inhibits signal transduction or reduces expression of a receptor of a T cell selected from the group consisting of programmed cell death protein 1 (PD1), cytotoxic T-lymphocyte-associated antigen 4 (CTLA4), B and T lymphocyte attenuator (BTLA), killer cell immunoglobulin-like receptor (KIR), lymphocyte activation gene 3 (LAG3), T-cell immunoreceptor with immunoglobulin and ITIM domains (TIGIT), T cell membrane protein 3 (TIM3), and adenosine A2a receptor (A2aR).

[0165] Therefore, the above immune checkpoint inhibitor can activate T cells by inhibiting signaling or reducing expression of PD1, CTLA4, BTLA, KIR, LAG3, TIM3, A2aR, or a combination thereof.

[0166] The above immune checkpoint pathway inhibitor may be an agent that inhibits signal transduction or reduces the expression of a surface protein of an antigen-presenting cell (APC) selected from the group consisting of programmed cell death-ligand 1 (PD-L1), programmed cell death-ligand 2 (PD-L2), cluster of differentiation (CD) 80, CD86, B7-H3, B7-H4, herpesvirus centry mediator (HVEM), and galectin 9 (GAL9).

[0167] PD-L1, PD-L2, CD80, CD86, B7-H3, B7-H4, HVEM, GAL9, or a combination thereof are surface proteins of APCs, and they can bind to receptors on T cells that transmit inhibitory signals to T cells. Therefore, the immune checkpoint pathway inhibitor can activate T cells by inhibiting signal transduction or reducing expression of PD-L1, PD-L2, CD80, CD86, B7-H3, B7-H4, HVEM, GAL9, or a combination thereof.

[0168] The above immune checkpoint pathway inhibitor may be an agent that activates a receptor of a T lymphocyte. The immune checkpoint pathway inhibitor may be an agent that activates signal transduction or increases expression of a receptor of a T lymphocyte selected from the group consisting of CD28, inducible T cell co-stimulator (ICOS), CD137, OX40, and CD27. CD28, ICOS, CD137, OX40, and CD27 are receptors of the T lymphocyte that transmit T cell activation signals, and T cells can be activated by activating signal transduction or increasing expression thereof. Therefore, T cells can be activated by activating signal transduction or increasing expression of CD28, ICOS, CD137, OX40, CD27, or a combination thereof.

[0169] The above immune checkpoint pathway inhibitor may be any one selected from the group consisting of transforming growth factor-β (TGF-β), interleukin (IL)-1, IL-6, IL-10, IL-12, and IL-18, or an agent that modulates them. The modulation may be inhibition or activation of a function, or a decrease or increase in expression. TGF-β, IL-1, IL-6, IL-10, IL-12, and IL-18 are cytokines, and they or an agent that modulates them can activate T cells.

[0170] The agent may be a polypeptide, a sugar, a nucleic acid, a small molecule compound, or a combination thereof. The polypeptide may be an antibody or an antigen-binding fragment thereof, wherein the term “antibody” is used interchangeably with the term “immunoglobulin (Ig).” A complete antibody has a structure having two full-length light chains and two full-length heavy chains, each light chain being bound to a heavy chain by a disulfide bond (SS-bond). The antibody may be, for example, IgA, IgD, IgE, IgG, or IgM. The term “antigen-binding fragment” refers to a portion of a polypeptide that is a fragment of the overall immunoglobulin structure, which includes a portion capable of binding an antigen. The antigen-binding fragment may be, for example, F(ab')2m Fab', Fab, Fv, or scFv. The antibody may be a monoclonal antibody or a polyclonal antibody.

[0171] The above immune checkpoint inhibitor or immune checkpoint pathway inhibitor may be a PD-1 inhibitor, a PD-L1 inhibitor, a CTLA4 inhibitor, or a combination thereof. PD-L1 inhibitors include, for example, atezolizumab (Tecentriq, Genentech), avelumab (Bavencio, Pfizer), durvalumab (Imfinzi, Astrazeneca, BMS-936559 (MDX1105, Bristol Myers Squibb), MPDL3280A (Roche), and MSB0010718 (MercK). PD-1 inhibitors include, for example, AMP-224 (Amplimmune, GlaxoSmith Klein), AMP-514 (MEDI0680, Amplimmune, GlaxoSmith Klein), nivolumab (Nivolumab, Opdivo, Bristol Myers Squibb), pembrolizumab (Pembrolizumab, Keytruda, Merck), and Pidilizumab (CureRech) is one example. CTLA4 inhibitors include ipilimumab (Yervoy, Bristol Myers Squibb) and tremelimumab (Pfizer).

[0172] In addition, depending on the specific aspect, the immune checkpoint inhibitor according to the present invention may be selected from a TIM3 inhibitor, a LAG3 inhibitor, a TIGIT inhibitor or a BTLA inhibitor.

[0173]

[0174] When administered in combination, the pharmaceutical composition according to the present invention may be administered before, after or simultaneously with the administration of one or more such additional immune checkpoint inhibitors.

[0175] The above-described immune checkpoint inhibitor may be included in a pharmaceutical composition comprising a pyrazole derivative according to the present invention, administered together in a single pharmaceutical composition, or administered separately as separate formulations. If administered separately, this may occur simultaneously or sequentially. This sequential administration may be close in time or distant in time. For example, the pharmaceutical composition comprising a pyrazole derivative according to the present invention and the immune checkpoint inhibitor may be administered within a few minutes, a few hours, or a few days of each other.

[0176]

[0177] To facilitate understanding of the present invention, preferred embodiments are presented. However, the following embodiments are provided solely to facilitate understanding of the present invention and are not intended to limit the scope of the present invention.

[0178]

[0179] <Synthesis example>

[0180] <Synthesis Example 1> Synthesis of compounds 1, 3, and 5-10

[0181] Compounds 1, 3, and 5-10 were prepared according to the method described in Korean Patent Registration No. 10-2473680.

[0182]

[0183] <Synthetic Example 2> Synthesis of 5-(methyl(5,6,7,8-tetrahydroquinolin-8-yl)amino)-2-(pyridin-2-yl)-4,5,6,7-tetrahydro-2H-indazol-3-ol (Compound 2)

[0184] 3-Hydroxy-2-(pyridin-2-yl)-2,4,6,7-tetrahydro-5H-indazol-5-one was prepared according to the method described in Korean Patent Registration No. 10-2473680.

[0185] 3-Hydroxy-2-(pyridin-2-yl)-2,4,6,7-tetrahydro-5H-indazol-5-one (0.7 g, 3.0 mmol) was dissolved in 40 mL of dichloromethane / dichloroethane (1 / 1), and N,N-dimethyl-2-((methylamino)methyl)aniline (0.5 g, 3.0 mmol, 1.0 eq) and acetic acid (0.2 mL, 3.0 mmol, 1.0 eq) were added. The reaction mixture was stirred at room temperature for 1 hour, and then sodium triacetoxyborohydride (0.6 g, 3.0 mmol, 1.0 eq) was added. The reaction mixture was stirred at room temperature for 18 hours, and then 2 M aqueous sodium hydroxide solution was added to adjust the pH to approximately 8.0. The reaction mixture was extracted with dichloromethane (20 mL x 2), and the organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The residue was purified through silica gel column chromatography (dichloromethane / methanol = 5 / 1) to obtain the title compound (0.091 g, 29.5%) as a black solid.

[0186]

[0187] 1H NMR (600 MHz, CD3OD): δ 8.38 - 8.35 (m, 1H), 8.23 ​​(d, J = 8.4 Hz, 1H), 7.86 - 7.81 (m, 1H), 7.44 - 7.37 (m, 2H), 7.34 (d, J = 7.4 Hz, 1H), 7.20 - 7.14 (m, 2H), 4.31 (s, 2H), 3.38 (tdd, J = 5.2, 4.5, 2.7 Hz, 1H), 2.83 (ddd, J = 16.8, 5.3, 2.5 Hz, 1H), 2.80 - 2.74 (m, 1H), 2.71 (s, 6H), 2.69 - 2.64 (m, 1H), 2.65 (s, 3H) 2.61 (dd, J = 13.8, 11.1 Hz, 1H), 2.29 (ddd, J = 7.0, 5.2, 2.7 Hz, 1H), 2.02 (qd, J = 11.9, 5.5 Hz, 1H). MS Calcd.: 377.2; MS Found: 378.3 ([M+H]+).

[0188]

[0189] <Synthetic Example 3> Synthesis of 5-((2-(dimethylamino)benzyl)(methyl)amino)-2-(pyridin-2-yl)-4,5,6,7-tetrahydro-2H-indazol-3-ol (Compound 4)

[0190] 3-Hydroxy-2-(pyridin-2-yl)-2,4,6,7-tetrahydro-5H-indazol-5-one (0.7 g, 3.0 mmol) was dissolved in 40 mL of dichloromethane / dichloroethane (1 / 1), and N,N-dimethyl-2-((methylamino)methyl)aniline (0.5 g, 3.0 mmol, 1.0 eq) and acetic acid (0.2 mL, 3.0 mmol, 1.0 eq) were added. The reaction mixture was stirred at room temperature for 1 hour, and then sodium triacetoxyborohydride (0.6 g, 3.0 mmol, 1.0 eq) was added. The reaction mixture was stirred at room temperature for 18 hours, and then 2 M aqueous sodium hydroxide solution was added to adjust the pH to approximately 8.0. The reaction mixture was extracted with dichloromethane (20 mL x 2), and the organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The residue was purified through silica gel column chromatography (dichloromethane / methanol = 5 / 1) to obtain the title compound (0.091 g, 29.5%) as a black solid.

[0191]

[0192] 1H NMR (600 MHz, CD3OD): δ 8.38 - 8.35 (m, 1H), 8.23 ​​(d, J = 8.4 Hz, 1H), 7.86 - 7.81 (m, 1H), 7.44 - 7.37 (m, 2H), 7.34 (d, J = 7.4 Hz, 1H), 7.20 - 7.14 (m, 2H), 4.31 (s, 2H), 3.38 (tdd, J = 5.2, 4.5, 2.7 Hz, 1H), 2.83 (ddd, J = 16.8, 5.3, 2.5 Hz, 1H), 2.80 - 2.74 (m, 1H), 2.71 (s, 6H), 2.69 - 2.64 (m, 1H), 2.65 (s, 3H) 2.61 (dd, J = 13.8, 11.1 Hz, 1H), 2.29 (ddd, J = 7.0, 5.2, 2.7 Hz, 1H), 2.02 (qd, J = 11.9, 5.5 Hz, 1H). MS Calcd.: 377.2; MS Found: 378.3 ([M+H]+).

[0193]

[0194] <Synthetic Example 4> Synthesis of 1-(4-(3-hydroxy-2-(pyridin-2-yl)-4,5,6,7-tetrahydro-2H-indazol-5-yl)piperazin-1-yl)propan-1-one (Compound 11)

[0195] 5-(piperazin-1-yl)-2-(pyridin-2-yl)-4,5,6,7-tetrahydro-2H-indazol-3-ol dihydrochloride was prepared according to the method described in Korean Patent Registration No. 10-2473680.

[0196] 5-(Piperazin-1-yl)-2-(pyridin-2-yl)-4,5,6,7-tetrahydro-2H-indazol-3-ol dihydrochloride (0.5 g, 128 mmol) was dissolved in 20 mL of dichloromethane, and triethylamine (0.5 ml, 3.8 mmol, 3.0 eq) was added. The reaction mixture was stirred at 0 °C for 10 minutes. Propionyl chloride (0.12 mL, 1.4 mmol, 1.1 eq) was added, and the mixture was stirred at room temperature for 2 hours. The mixture was neutralized with aqueous sodium bicarbonate. The reaction mixture was extracted with dichloromethane (10 mL x 2), and the organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The residue was purified through silica gel column chromatography (dichloromethane / methanol=5 / 1+1% ammonia water) to obtain the title compound (0.25 g, 54.9%) as a beige solid.

[0197]

[0198] 1H NMR (600 MHz, CD3OD): δ 8.41 (dd, J = 4.9, 0.9 Hz, 1H), 8.33 (d, J = 8.1 Hz, 1H), 7.93 - 7.86 (m, 1H), 7.26 - 7.19 (m, 1H), 3.68 - 3.56 (m, 4H), 2.85 - 2.56 (m, 8H), 2.44 (q, J = 7.5 Hz, 2H), 2.33 (dd, J = 14.4, 10.2 Hz, 1H), 2.18 (dd, J = 7.5, 3.9 Hz, 1H), 1.77 (qd, J = 11.5, 5.5 Hz, 1H), 1.14 (t, J = 7.5 Hz, 3H). MS Calcd.:355.2; MS Found: 356.5([M+H]+).

[0199]

[0200] <Synthetic Example 5> Synthesis of methyl 4-(3-hydroxy-2-(pyridin-2-yl)-4,5,6,7-tetrahydro-2H-indazol-5-yl)piperazine-1-carboxylate (Compound 12)

[0201] 5-(Piperazin-1-yl)-2-(pyridin-2-yl)-4,5,6,7-tetrahydro-2H-indazol-3-ol dihydrochloride (1.9 g, 4.7 mmol) was dissolved in 50 mL of dichloromethane, and triethylamine (3.3 ml, 23.7 mmol, 5.0 eq) was added. The reaction mixture was stirred at 0 °C for 10 minutes. Methyl chloroformate (1.2 mL, 9.5 mmol, 2 eq) was added, and the mixture was stirred at room temperature for 2 hours. The mixture was neutralized with aqueous sodium bicarbonate. The reaction mixture was extracted with dichloromethane (10 mL x 2), and the organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The residue was purified through silica gel column chromatography (dichloromethane / methanol=5 / 1+1% ammonia water) to obtain the title compound (1.4 g, 82.6%) as a beige solid.

[0202]

[0203] 1H NMR (500 MHz, DMSO-d6) δ 11.45 (s, 1H), 8.50 - 8.32 (m, 2H), 7.88 (t, J = 7.2 Hz, 1H), 7.18 (d, J = 5.2 Hz, 1H), 3.60 (s, 3H), 3.39 - 3.29 (m, 8H), 2.64 (d, J = 20.7 Hz, 2H), 2.59 - 2.45 (m, 1H), 2.33 (d, J = 12.0 Hz, 1H), 2.18 - 2.05 (m, 1H), 1.98 (d, J = 12.4 Hz, 1H), 1.60 (qd, J = 11.7, 5.5 Hz, 1H). MS Calcd.:357.2; MS Found: 358.2([M+H]+).

[0204]

[0205] <Example 1> Confirmation of tumor growth inhibition effect in a mouse model with cancer cell allografting

[0206] 1. Mouse model and drug preparation

[0207] To determine the anti-tumor effect in a CAF-rich solid tumor model, 5-week-old female C57BL / 6N mice (Orientbio) were purchased and used in the experiment after a 1-week acclimatization period.

[0208] MC38 (Kerafast, Cat. No. ENH204-FP), a colon cancer cell line derived from C57BL / 6 mice, and MEF (ATCC, Cat. No. SCRC-1008), a fibroblast cell line, were grown in a culture environment of 5% CO2 at 37°C. The medium used was DMEM (Dulbecco's Modified Eagle's Medium, HyClone™, Cat. No. SH30243.01) containing 10% FBS (Fetal bovine serum, Gibco, Cat. No. 16000044). Before cell transplantation, MEF cells were pretreated with mouse transforming growth factor-β (Mouse TGF-β, R&D Systems, Cat. No. 7666-MB-005). Pan02 (Creative Biolabs, Cat. No. IOC-ZP322), pancreatic cancer cells derived from C57BL / 6 mice, were grown in DMEM medium containing 5% FBS.

[0209] For the CAF-rich colon cancer model, MC38 and MEF cells were mixed and suspended in phosphate-buffered saline (PBS, HyClone™, Cat. No. SH30028.02) and implanted subcutaneously into the right flank of each mouse at 100 μl per mouse. For the pancreatic cancer model, Pan02 cells were suspended in PBS and implanted subcutaneously into the right flank of each mouse at 100 μl per mouse.

[0210] As administered drugs, compounds 3 and 5 were dissolved in DW and prepared at 100 mg / 10 ml / kg body weight, and as other administered drugs, immune checkpoint inhibitors, PD-1 inhibitor (BioXcell, Cat. No. BE0146), CTLA4 inhibitor (BioXcell, Cat. No. BE0164), and PD-L1 inhibitor (BioXcell, Cat. No. BE0101) were prepared at 10 mg / 5 ml / kg body weight. Rat IgG2a (BioXcell, Cat. No. BE0089), mouse IgG2b (BioXcell, Cat. No. BE0086), and rat IgG2b (BioXcell, Cat. No. BE0090) were prepared as respective controls.

[0211]

[0212] 2. Drug administration to mouse models and confirmation of tumor growth inhibition effects

[0213] Compound 3 was orally administered twice a day and compound 5 was orally administered once a day to the mouse model specified in 1. The drug was administered to tumors with a volume of approximately 25 mm 3 Administration was initiated when the target was reached and continued for 10 days. The immune checkpoint inhibitor was administered intraperitoneally three times at 3- to 4-day intervals from the time of drug initiation.

[0214] Tumor volume was measured using a digital caliper at intervals of 2 to 3 days from the time of drug initiation, and the tumor volume was calculated using the mathematical formula 1 specified below.

[0215]

[0216] (Equation 1)

[0217] Tumor volume (mm) 3 ) = ½ х long axis of tumor (mm) х [short axis of tumor (mm)] 2

[0218]

[0219] As shown in Figures 1a and 2a, single administration of Compound 3 or 5 effectively reduced tumor volume in a CAF-enriched colon cancer model. Furthermore, Figure 3a shows that single administration of Compound 3 also exhibits an effective tumor growth inhibition effect in a pancreatic cancer model.

[0220] As shown in Figures 4a, 5, and 8, in a CAF-enriched colon cancer model, a PD-1 inhibitor, a CTLA4 inhibitor, or a PD-L1 inhibitor synergistically inhibited tumor growth when administered in combination with compound 3. This demonstrates that compound 3 improves resistance to immune checkpoint inhibitors.

[0221] Figure 6a shows that the combined administration of compound 5 and a PD-1 inhibitor in a CAF-enriched colon cancer model exhibited a combined effect on tumor growth inhibition.

[0222] As can be seen in Figure 7a, in the pancreatic cancer model, when compound 3 and a CTLA4 inhibitor were co-administered, the tumor volume was synergistically reduced.

[0223]

[0224] <Example 2> Evaluation of CD8+ T-cell infiltration in tumor tissue (immunohistochemistry)

[0225] To determine the extent of CD8+ T cell infiltration into tumor tissue, immunohistochemistry (IHC) was used. Mice were sacrificed after the last drug administration, and tumors were resected. The resected tumors were fixed in 4% paraformaldehyde (PFA, T&I, Cat. No. BPP-9004) for 24 hours and embedded in paraffin. The embedded tissues were mounted on slides at 4 μm thickness, deparaffinized, and rehydrated. After antigen retrieval, they were treated with citric acid buffer (Vector, Cat. No. H-3300). CD8a primary antibody (eBioscience™, Cat. No. 14-0808-82) was diluted 1:100 and reacted at room temperature for 1 hour. Biotinylated linkers were reacted for 30 minutes and treated using an avidin / biotin kit (ABC-HRP kit, Vector, Cat. No. PK-6100). Color development was performed using 3,3'-diaminobenzidine (DAB), and a liquid DAB kit (Vector, Cat. No. SK-4100) was used.

[0226] Slides were observed under a microscope, and the number of CD8+ T cells expressed was quantified by dividing the total tumor area by the number of cells. An independent-samples t-test was used for analysis, and a p-value of 0.05 or less was considered statistically significant.

[0227] t-test: * p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001

[0228] As can be seen in Fig. 1c, single administration of compound 3 in the CAF-enriched colon cancer model resulted in an increase in CD8+ T-cells.

[0229] Additionally, Figures 4b and 6b show that the distribution of CD8+ T cells increased even when compound 3 or 5 was co-administered with a PD-1 inhibitor in a CAF-enriched colon cancer model.

[0230]

[0231] <Example 3> Evaluation of α-SMA (alpha smooth muscle actin) expression in tumor tissue (immunohistochemistry)

[0232] Immunohistochemistry (IHC) was used to confirm the expression of α-SMA (alpha smooth muscle actin) protein in tumor tissue. α-SMA primary antibody (Dako, Cat. No. M0851) was diluted 1:200 and reacted at room temperature for 1 hour. The remaining procedures were the same as described in Example 2.

[0233] Slides were observed under a microscope, and the area of ​​stained α-SMA was measured to calculate the distribution ratio (%) of α-SMA relative to the total tumor area. An independent samples t-test was used for analysis, and a p-value of 0.05 or less was considered statistically significant.

[0234] t-test: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001

[0235] As shown in Figures 1b and 2b, single administration of compounds 3 or 5 effectively reduced the area of ​​α-SMA in the CAF-enriched colon cancer model.

[0236] Additionally, it can be confirmed in Figures 4c and 6c that the area of ​​α-SMA is reduced when compound 3 or 5 is co-administered with a PD-1 inhibitor in a CAF-enriched colon cancer model.

[0237]

[0238] <Example 4> Evaluation of ACTA2, Collagen Iα, and NADH oxidase (NOX) gene expression in tumor tissue (real-time polymerase chain reaction, quantitative real-time PCR)

[0239] Quantitative Real-Time PCR was used to confirm the mRNA expression of ACTA2 (actin alpha 2, α-SMA gene), Collagen Iα, and NADH oxidase (NOX) mRNA, which are indicators of CAF fibrosis in tumor tissues. RNA was extracted from the excised tumor tissues (RNeasy Mini Kit, Qiagen, Cat. No. 74106), and cDNA was synthesized using a cDNA synthesis kit (iScript™ cDNA Synthesis Kit, Bio-Rad, Cat. No. 1708890) by sequentially reacting at 25°C for 5 minutes, 46°C for 20 minutes, and 95°C for 1 minute.

[0240] Forward and reverse primers were designed to detect ACTA2 and Collagen Iα, NOX1, NOX2, and NOX4, and their sequences are described in Table 1.

[0241] Sequence number name sequence (5'→ 3')1ACTA2-FAAGAGAGGGATCCTGACGCT2ACTA2-RAGAGGCATAGAGGGGACAGCA3ColIα-FACGGCTGCACGAGTCACAC4ColIα-RGGCAGGCGGGAGGTCTT5NOX1-FCAGTTATTCATATCATTGCACACCT ATTT6NOX1-RCAGAAGCGAGAGATCCATCCA7NOX2-FCCAACTGGGATAACGAGTTCA8NOX2-RGAGAGTTCAGCCAAGGCTTC9NOX4-FTTGCCTGGAAGAACCCAAGT10NOX4-RTCCGCACAATAAAGGCACAA

[0242] Real-time polymerase chain reaction was performed by adding the synthesized cDNA, 0.5 μM forward primer, 0.5 μM reverse primer, 2X iTaq Universal SYBR Green Supermix (Bio-Rad, Cat. No. 172-5120), and DEPC-treated DW (Biosesang, Cat. No. WR2004-050) to a total volume of 10 μl. As shown in Fig. 1d, when compound 3 was administered alone in the CAF-rich colon cancer model, the mRNA expression of NOX1, NOX2, and NOX4 was reduced.

[0243] Figure 3b shows that compound 3 alone also reduces mRNA expression of the NOX gene in a CAF-enriched pancreatic cancer model.

[0244] As shown in Fig. 7b, co-administration of compound 3 and a CTLA4 inhibitor in a CAF-rich pancreatic cancer model effectively reduced the mRNA of ACTA2 and Collagen Iα, which are markers of fibrosis.

[0245]

[0246] <Example 5> Evaluation of ACTA2 gene expression in pCAF (pancreatic cancer-associated fibroblasts) cells (real-time polymerase chain reaction, quantitative real-time PCR)

[0247] 5-1. PF / pCAF cell culture and drug treatment

[0248] Human pancreatic fibroblasts (PF; Neuromics, Cat. No. SC00A5) and pCAFs (Neuromics, Cat. No. CAF08) derived from human pancreas were grown in a 5% CO2 culture environment at 37℃. MSCGro, Low Serum Medium (SC00B1) and Pancreatic Stellate CAFs Maintenance Medium (Vitro Biopharma, Cat. No. PC00B5) were used as media, respectively. To test the direct effect of compounds on pCAF cells, pCAF cells were evenly distributed in 6-well plates and treated with 12 compounds according to the present invention at concentrations of 5 to 50 μM. After 72 hours, the culture medium was removed and the cells were collected.

[0249]

[0250] 5-2. Confirmation of ACTA2 gene expression in pCAF cells

[0251] To confirm the mRNA expression of ACTA2 (actin alpha 2, α-SMA gene), a fibrosis marker, in pCAF cells, a quantitative real-time PCR method was used. RNA was extracted from the collected pCAF cells (RNeasy Mini Kit, Qiagen, Cat. No. 74106), and cDNA was synthesized using a cDNA synthesis kit (iScript™ cDNA Synthesis Kit, Bio-Rad, Cat. No. 1708890) by sequentially reacting at 25°C for 5 minutes, 46°C for 20 minutes, and 95°C for 1 minute.

[0252] Forward and reverse primers were designed to detect human ACTA2, and their sequences are described in Table 2.

[0253]

[0254] Sequence number Name Sequence (5'→ 3') 11 Human ACTA2-FGAGCGTGGCTATTCCTTCGT 12 Human ACTA2-RTTCAAAGTCCAGAGCTACATAACACAGT

[0255] Real-time polymerase chain reaction was performed by adding the synthesized cDNA, 0.5 μM forward primer, 0.5 μM reverse primer, 2X iTaq Universal SYBR Green Supermix (Bio-Rad, Cat. No. 172-5120), and DEPC-treated DW (Biosesang, Cat. No. WR2004-050) to a total volume of 10 μL.

[0256] As can be seen in Fig. 9, the basal level of expression of ACTA2, a representative biomarker of CAF, was significantly increased in pCAF cells compared to PF cells, which are general fibroblasts, and when pCAF cells were treated with 12 compounds for 72 hours, the mRNA expression of ACTA2 was effectively reduced. This is an experimental result proving that the 12 compounds according to the present invention have the efficacy of effectively inhibiting the function of CAF through a mechanism of suppressing the expression of fibrosis indicators in CAF cells.

Claims

A pharmaceutical composition for preventing, improving or treating cancer, comprising a compound of the following chemical formula 1 or 2 or a pharmaceutically acceptable salt, solvate, stereoisomer or combination thereof: [Chemical Formula 1] [Chemical Formula 2] In the above chemical formula 1 or 2, R is H or C1-C3 alkyl, n is an integer from 0 to 2, L is CR', CH-C(=O)R', NR' or N-(C=O)R', wherein R' is H, C1-C4 alkyl, C2-C4 alkenyl, C1-C4 alkoxy, or C3-C8 cycloalkyl, K and M are each independently H, C1-C3 alkyl, -C1-C3 alkyl-C6-C9 aryl, -SO2-C6-C9 aryl, -C(=O)NH-C6-C9 aryl, 5- to 12-membered heteroaryl, 7- to 12-membered heterobicycle, C1-C3 alkyl-5- to 12-membered heteroaryl or C1-C3 alkyl-7- to 12-membered heterobicycle, wherein the C6-C9 aryl of -C1-C3 alkyl-C6-C9 aryl may be optionally substituted with -NH2 or -N(C1-C3 alkyl)2, D, E, F, G and J are each independently N or CR”, wherein R” is H, halo, or C1-C3 alkyl. In claim 1, a pharmaceutical composition for preventing, improving or treating cancer, wherein the compound of chemical formula 1 or chemical formula 2 is selected from the group consisting of the following compounds: 1) 5-(4-methylpiperazin-1-yl)-2-(pyridin-2-yl)-4,5,6,7-tetrahydro-2H-indazol-3-ol; 2) 5-(methyl(5,6,7,8-tetrahydroquinolin-8-yl)amino)-2-(pyridin-2-yl)-4,5,6,7-tetrahydro-2H-indazol-3-ol; 3) Cyclopropyl[4-(3-hydroxy-2-(pyridin-2-yl)-4,5,6,7-tetrahydro-2H-indazol-5-yl)piperazin-1-yl]methanone hydrochloride; 4) 5-((2-(dimethylamino)benzyl)(methyl)amino)-2-(pyridin-2-yl)-4,5,6,7-tetrahydro-2H-indazol-3-ol; 5) 5-[(isoquinolin-3-ylmethyl)methylamino]-2-(pyridin-2-yl)-4,5,6,7-tetrahydro-2H-indazol-3-ol] hydrochloride; 6) 5-(4-ethylpiperazin-1-yl)-2-(pyridin-2-yl)-4,5,6,7-tetrahydro-2H-indazol-3-ol; 7) 1-(4-(3-hydroxy-2-(pyridin-2-yl)-4,5,6,7-tetrahydro-2H-indazol-5-yl)piperazin-1-yl)prop-2-en-1-one; 8) 5-(4-methylpiperazin-1-yl)-2-(pyrimidin-2-yl)-4,5,6,7-tetrahydro-2H-indazol-3-ol; 9) N-(3-hydroxy-2-(pyridin-2-yl)-4,5,6,7-tetrahydro-2H-indazol-5-yl)benzenesulfonamide; 10) 1-(3-hydroxy-2-(pyridin-2-yl)-4,5,6,7-tetrahydro-2H-indazol-5-yl)-3-phenylurea; 11) 1-(4-(3-hydroxy-2-(pyridin-2-yl)-4,5,6,7-tetrahydro-2H-indazol-5-yl)piperazin-1-yl)propan-1-one; and 12) Methyl 4-(3-hydroxy-2-(pyridin-2-yl)-4,5,6,7-tetrahydro-2H-indazol-5-yl)piperazine-1-carboxylate. In claim 1, a pharmaceutical composition for preventing, improving or treating cancer, wherein the compound of chemical formula 1 or chemical formula 2 inhibits NOX1, NOX2, NOX4, α-SMA (ACTA2) or Collagen Iα. A pharmaceutical composition for preventing, improving or treating cancer, characterized in that it is used in combination with an anticancer agent in claim 1. A pharmaceutical composition for preventing, improving or treating cancer, characterized in that it is used in combination with an immune checkpoint inhibitor or an immune checkpoint pathway inhibitor in claim 1. A pharmaceutical composition for preventing, improving or treating cancer, further comprising an immune checkpoint inhibitor or an immune checkpoint pathway inhibitor in claim 1. A pharmaceutical composition for preventing, improving, or treating cancer, wherein the immune checkpoint pathway inhibitor is an agent that inhibits signal transduction or reduces expression of a receptor of a T lymphocyte selected from the group consisting of programmed cell death protein 1 (PD1), cytotoxic T-lymphocyte-associated antigen 4 (CTLA4), B and T lymphocyte attenuator (BTLA), killer cell immunoglobulin-like receptor (KIR), lymphocyte activation gene 3 (LAG3), T cell membrane protein 3 (TIM3), and adenosine A2a receptor (A2aR). A pharmaceutical composition for preventing, improving, or treating cancer, wherein the immune checkpoint pathway inhibitor is an agent that inhibits signal transduction or reduces expression of a surface protein of an antigen-presenting cell (APC) selected from the group consisting of programmed death-ligand 1 (PD-L1), programmed death-ligand 2 (PDL2), cluster of differentiation (CD) 80, CD86, B7-H3, B7-H4, herpesvirus entry mediator (HVEM), and galectin 9 (GAL9). A pharmaceutical composition for preventing, improving, or treating cancer, wherein the immune checkpoint pathway inhibitor is an agent that activates signaling or increases expression of a receptor of T lymphocytes selected from the group consisting of CD28, inducible T cell costimulator (ICOS), CD137, OX40, and CD27. A pharmaceutical composition for preventing, improving or treating cancer, wherein the immune checkpoint pathway inhibitor is one selected from the group consisting of transforming growth factor-β (TGFβ), interleukin (IL)-1, IL-6, IL-10, IL-12, and IL18, or an agent that regulates the same. A pharmaceutical composition for preventing, improving or treating cancer, wherein in claim 6, the PD-1 inhibitor is at least one selected from the group consisting of AMP-224, AMP-514, nivolumab, pembrolizumab and pidilizumab, the PD-L1 inhibitor is at least one selected from the group consisting of atezolizumab, avelumab, duruvalumab, MPDL3280A and MSB0010718, and the CTLA-4 inhibitor is at least one selected from the group consisting of ipilimumab and trilimumab. A pharmaceutical composition for preventing, improving or treating cancer, wherein the cancer in claim 1 is selected from the group consisting of colon cancer, Hodgkin's lymphoma, urothelial cancer, melanoma, esophageal cancer, renal cell cancer, small intestine cancer, rectal cancer, colorectal cancer, triple-negative breast cancer, kidney cancer, non-small cell lung cancer, small cell lung cancer, head and neck cancer, thymoma, mesothelioma, kidney cancer, bladder cancer, prostate cancer, testicular cancer, germ cell tumor, ovarian cancer, endometrial cancer, cervical cancer, uterine sarcoma, stomach cancer, liver cancer, brain cancer, pancreatic cancer, biliary tract cancer, colon cancer, hepatocellular carcinoma, breast cancer, Merkel cell carcinoma, thyroid cancer, sarcoma, skin cancer, lymphoma, myelodysplastic syndrome, myelofibrosis, acute leukemia, chronic leukemia and multiple myeloma. A pharmaceutical composition for preventing, improving or treating cancer, which is administered simultaneously or sequentially with an immune checkpoint inhibitor or an immune checkpoint pathway inhibitor in claim 5. In claim 5, the pharmaceutical composition comprises a compound of Chemical Formula 1 or Chemical Formula 2 or a pharmaceutically acceptable salt, solvate, stereoisomer or combination thereof and an immune checkpoint inhibitor or an immune checkpoint pathway inhibitor as a single composition, or a pharmaceutical composition comprising a compound of Chemical Formula 1 or Chemical Formula 2 or a pharmaceutically acceptable salt, solvate, stereoisomer or combination thereof and an immune checkpoint inhibitor as separate compositions.

Images