Linkage groups, oligonucleotide conjugates, and methods thereof

Abstract

This disclosure concerns linkage groups and uses thereof for conjugating ligands to nucleic acids. Also provided are oligonucleotide-ligand conjugates containing the linkage group, and uses thereof for targeted nucleic acid delivery and as a medicament.

Description

[0001] Linkage Groups, Oligonucleotide Conjugates, and Methods Thereof

[0002] Technical field

[0003] The present invention relates, in general terms, to linkage groups, oligonucleotide conjugates, and methods of preparation and methods of use thereof. In particular, the present invention relates to linkage groups and methods for conjugating ligands to nucleic acids.

[0004] Background

[0005] Therapeutic oligonucleotides such as siRNA and antisense oligonucleotides have been approved in recent years for a range of clinical applications. They can address unmet clinical needs in diseases caused by known genetic or RNA processing defects, many of which are recalcitrant to treatment with conventional small molecule drugs and biologies. Unlike biologies that target cell membrane receptors, therapeutic oligonucleotides act intracellularly, and the functional uptake of oligonucleotides by cells is a significant ratelimiting factor due to the relatively large size and charge of oligonucleotides as compared to small molecules. Methods that can efficiently deliver oligonucleotides into cells and do not interfere with their on-target activity are critical to confer a therapeutic index through reduced dosages to avoid potential side effects.

[0006] Several strategics have been proposed to improve oligonucleotide delivery to cells, such as using nanoparticles, and by chemical modification or conjugation of cell-targeting ligands to the oligonucleotides. The latter approach takes advantage of membrane receptors expressed on specific cell types that undergo endocytosis upon cognate ligand binding. During this process, the ligand-bound receptor shuttles into the cell cytoplasm where the ligand is released intracellularly and the receptor is recycled back to the cell membrane ready for the next ligand binding event. These ligands can be chemically bonded to oligonucleotides so that the ligand-conjugated oligonucleotides are shuttled into the cells with the receptor. By conjugating to various ligands, it is possible to exploit receptors that are differentially expressed on cells / tissues for cell-targeted delivery of oligonucleotides. The design and synthesis of the linker group that enables conjugation of the ligand to the oligonucleotide is not trivial for two key factors. Firstly, an effective linker needs to satisfy specific biophysical (e.g., ligand orientation) and biochemical requirements (e.g., number of ligands to be presented) to mimic endogenous ligand-receptor binding kinetics. Secondly, it is necessary for the linker to be biocompatible and not diminish the biological on-target activity of the oligonucleotide payload due to steric interference or endosomal trapping.

[0007] It would be desirable to overcome or alleviate at least one of the above-described problems.

[0008] Summary

[0009] Disclosed herein is a compound of Formula (la), or a salt, solvate or stereoisomer thereof: wherein Ri and R2 are independently selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted silyl, optionally substituted acyl, and optionally substituted phosphoramidityl;

[0010] Rs and R4 are independently selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted silyl, and optionally substituted acyl;

[0011] X is a carbon atom or a heteroatom;

[0012] Li is an optionally substituted linker having a chain length of 0 to 50 atoms;

[0013] Rs is selected from H, cyano, halo, oxo, thio, azido, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted acyl, optionally substituted oxyacyl, optionally substituted acyloxy, optionally substituted amino, optionally substituted aryl, and optionally substituted heteroaryl; and wherein at least one of R1 and R2 is optionally substituted phosphoramidityl.

[0014] Disclosed herein is a compound of Formula (I), or a salt, solvate or stereoisomer thereof: wherein Ri and R2 are independently selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted silyl, optionally substituted acyl, and optionally substituted phosphoramidityl;

[0015] Rs and R4 are independently selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted silyl, and optionally substituted acyl; Li is an optionally substituted linker having a chain length of 0 to 50 atoms;

[0016] Rs is selected from H, cyano, halo, oxo, thio, azido, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted acyl, optionally substituted oxyacyl, optionally substituted acyloxy, optionally substituted amino, optionally substituted aryl, and optionally substituted hctcroaryl; and wherein at least one of Ri and R2 is optionally substituted phosphoramidityl.

[0017] Disclosed herein is a compound of Formula (TV), or a salt, solvate or stereoisomer thereof: wherein Ri and R2 arc independently selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted silyl, optionally substituted acyl, and optionally substituted phosphoramidityl;

[0018] Rs and R4 are independently selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted silyl, and optionally substituted acyl; L2 is an optionally substituted linker having a chain length of 1 to 50 atoms;

[0019] Lig is a ligand capable of binding to a cell surface antigen or receptor; and wherein at least one of Ri and R2 is optionally substituted phosphoramidityl.

[0020] Disclosed herein is an oligomer comprising two or more compounds as defined herein, wherein the two or more compounds are linked by an internucleoside linkage formed between Ri and R2 of adjacent compounds. Disclosed herein is an oligonucleotide conjugate, comprising: a) a compound or oligomer as defined herein; and b) an oligonucleotide; wherein the compound or oligomer is linked to the oligonucleotide by an intemucleoside linkage formed between Ri or R2 of the compound or oligomer and the oligonucleotide.

[0021] Disclosed herein is a pharmaceutical composition comprising an oligonucleotide conjugate as defined herein and a pharmaceutically acceptable carrier.

[0022] Disclosed herein is an oligonucleotide conjugate or pharmaceutical composition as defined herein, for use as a medicament.

[0023] Disclosed herein is a method of delivering an oligonucleotide to a cell, the method comprising contacting the cell with an oligonucleotide conjugate or pharmaceutical composition as defined herein.

[0024] Disclosed herein is a method of modulating protein expression or function in a cell, the method comprising contacting the cell with an oligonucleotide conjugate or pharmaceutical composition as defined herein.

[0025] Disclosed herein is a method of treating or preventing a disease or disorder in a subject, the method comprising administering a therapeutically effective amount of an oligonucleotide conjugate or pharmaceutical composition as defined herein to the subject.

[0026] Disclosed herein is an oligonucleotide conjugate or pharmaceutical composition as defined herein, for use in treating or preventing a liver or kidney disease or disorder in a subject.

[0027] Disclosed herein is the use of an oligonucleotide conjugate or pharmaceutical composition as defined herein in the manufacture of a medicament for treating or preventing a liver or kidney disease or disorder in a subject.

[0028] Brief description of the drawings

[0029] Embodiments of the present invention will now be described, by way of non-limiting example, with reference to the drawings in which:

[0030] Figure 1 shows exemplary linkage groups in the prior art (Formula A, B, C), and an exemplar}' linkage group of the present disclosure (Formula D).

[0031] Figure 2 is an exemplary reaction scheme for the synthesis of a linkage group of Formula (I)-

[0032] Figure 3 shows that the G1 ligand is comparable to an FDA-approved GalNAc ligand (GA) in vitro. (A) HuH7 and HepG2 hepatoma cells stably expressing a minigene containing a splice- altering mutation SLC25A13 c.469-2922G>T, and (B) HuH7 cells with a minigene harbouring the OTC c.540+265G>A mutation, were exposed to SSOs conjugated to trivalcnt GalNAc via either the GA or G1 ligand, in calcium-enriched medium (CEM). Each mutation created a distinct pseudoexon in the respective transcripts. Both SSO1 and SSO2 were each designed to skip the pseudoexon in SLC2 A13 transcripts whereas SSO3 was designed to skip the pseudoexon in OTC transcripts. % splicing correction measures the percentage of transcripts with the respective pseudoexon skipped. (C) HuH7 or ASGRl-overexpressing U87 cells that stably express the CALIMERO gene (Tabaglio, T. et al, Mol Ther Nucleic Acids, 36: 1 (2025)) were treated with unconjugatcd AVA1 SSO or AVA1 SSO conjugated to the G1 ligand at the 5’ end or 3’ end by free uptake without CEM. Higher % protein splice-out indicates higher AVA1 efficiency. (D) iPS cells containing the SLC25A13 c.469- 2922G>T mutation were differentiated to hepatocytes and treated with non-targeting control (NTC, i.e., a control oligonucleotide that does not target the mutation) or SSO1 unconjugated or conjugated to the G1 ligand. (E) Toxicity was ascertained by MTS assay on HuH7 cells treated by CEM-mediated free uptake with the indicated amounts of SSOs for 72 hours. LNA32 is the negative control and LNA41 is the positive control. (F) Immunogenicity was tested by B JAB assay, whereby B JAB cells were treated with 2pM of SSOs for 24 hours and analyzed for CCL22, FCRL3 and TNF by qPCR. The CpG-rich ODN2216 served as a positive control and the minimally inflammatory ISIS104838 as a negative control.

[0033] Figure 4 shows that Gl-conjugated SSO works in vivo and is not toxic nor immunogenic. (A) Schematic of G1-SSO2 (see Figure 3A) dosage regime. (B) qPCR of SLC25A13 c.469- 2922G>T minigcnc (sec Figure 3A) expression in left medial lobe (LML), right medial lobe (RML) and left lateral lobe (LLL) of the liver in different treatment groups. (C) Capillary electrophoresis image of selected LLL samples from the different G1-SSO2 treatment groups after fragment length analysis PCR. (D) Body weight, (E) plasma ALT, and (F) plasma AST at different time points throughout the treatment regime. (G) qPCR for immune cell markers in left lateral lobe of the liver, normalized to Eef2 and shown relative to Control. (H) Representative H&E image of liver sections. Scale bar indicates 100pm. (I) Plasma creatinine at different time points throughout treatment. (J) qPCR for immune cell markers in kidney (K) and immune activation markers in spleen. (L) Platelet count analyzed from whole blood at end point.

[0034] Detailed description

[0035] The inventors have designed and synthesised a linkage group for conjugating ligands to oligonucleotides. The linkage group has a ribose-like backbone mimicking the nucleic acid backbone, but no nucleobase-like moieties that may interfere with the on-target activity of an appended oligonucleotide. A conjugating moiety, such as an alkynyl moiety, on a side chain of the ribose-like backbone enables attachment of a linker or ligand. Phosphoramidite groups on the 3 ’-hydroxyl or 6’ -hydroxyl group of the ribose-like backbone allow the linkage group to be incorporated into oligonucleotides using standard phosphoramidite- based chemistry used for oligonucleotide synthesis. Phosphoramiditc-bascd chemistry can also be used for multimerization of the linkage group, thereby enabling the formation of multivalent conjugates. The 1’- and 2’-hydroxyl groups on the ribose-like backbone of the linkage group may be protected by an acetal or ketal group to prevent side reactions during conjugation. Linkage groups with defined chirality may be selected to produce enantiopure products after the conjugation to oligonucleotides. The linkage group offers several advantages: (i) ease of conjugation to ligands and oligonucleotides, (ii) flexibility in attaching to both 5’ and 3’ ends of an oligonucleotide, (iii) capability to add multiple ligands, and (iv) minimal interference with the nucleic acid payload.

[0036] As an example, the inventors sequentially conjugated three GalNAc linkage groups to form a trivalent GalNAc conjugate (referred to as G1 herein), which was attached to singlestranded oligonucleotides using standard phosphoramidite-based protocols. GalNAc binds to cells expressing the asialoglycoprotein receptor (ASGPR). In vitro studies with ASGPR- o verexpressing cells and hepatocytes and in vivo studies with mice showed that the Gl- conjugated oligonucleotides were efficiently taken up by asialoglycoprotein receptor- expressing cells and tissues with little toxicity, with the GalNAc conjugate promoting targeted uptake of the oligonucleotides into the liver. The oligonucleotides produced on- target effects upon delivery in both in vitro and in vivo studies.

[0037] Accordingly, this disclosure provides linkage groups for ligand conjugation to nucleic acids, ligand-linkage group conjugates, oligonucleotides containing the linkage groups, oligonucleotide conjugates, and methods of using the oligonucleotide conjugates.

[0038] General definitions

[0039] As used herein, the term “unsubstituted” means that there is no substituent or that the only substituent is hydrogen.

[0040] As used herein, the term “heteroatom” refers to any atom other than carbon (C) or hydrogen (H). Common heteroatoms include, but are not limited to, nitrogen (N), oxygen (O), sulphur (S), phosphorus (P), silicon (Si), and boron (B).

[0041] The term “optionally substituted” herein denotes that the group may or may not be further substituted or fused (so as to form a condensed polycyclic system), with one or more nonhydrogen substituent groups. In certain embodiments the substituent groups are one or more groups independently selected from the group consisting of halogen, =0, =S, alkyl, alkenyl, alkynyl, azidoalkyl, haloalkyl, haloalkenyl, haloalkynyl, heteroalkyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, heterocycloalkenyl, aryl, heteroaryl, cycloalkylalkyl, heterocycloalkylalkyl, heteroarylalkyl, arylalkyl, cycloalkylalkenyl, heterocycloalkylalkenyl, arylalkenyl, heteroarylalkenyl, cycloalkylheteroalkyl, hctcrocycloalkylhctcroalkyl, arylhctcroalkyl, hctcroarylhctcroalkyl, hydroxy, hydroxyalkyl, alkoxy, alkoxyalkyl, alkoxycycloalkyl, alkoxyheterocycloalkyl, alkoxyaryl, alkoxyheteroaryl, alkoxycarbonyl, alkylaminocarbonyl, alkenyloxy, alkynyloxy, cycloalkyloxy, cycloalkenyloxy, heterocycloalkyloxy, heterocycloalkenyloxy, aryloxy, phenoxy, benzyloxy, heteroaryloxy, arylalkyloxy, arylalkyl, heteroarylalkyl, cycloalkylalkyl, heterocycloalkylalkyl, arylalkyloxy, amino, alkylamino, acylamino, aminoalkyl, arylamino, sulphonylamino, sulphinylamino, sulphonyl, alkylsulphonyl, arylsulphonyl, aminosulphonyl, sulphinyl, alkylsulphinyl, arylsulphinyl, aminosulphinylaminoalkyl, COOH, C=O, C(O)O, C(O)NH, NHC(O), NHC(O)O, NHC(O)NH, C(=NOH), SH, S, O and acyl.

[0042] “Alkyl” as a group or part of a group refers to a straight or branched aliphatic hydrocarbon group, preferably a C1-C50 alkyl. Examples of suitable straight and branched alkyl substituents include methyl, ethyl, n-propyl, isopropyl, n-butyl, sec-butyl, t-butyl, hexyl, and the like. The group may be a terminal group or a bridging group.

[0043] “Alkenyl” as a group or part of a group denotes an aliphatic hydrocarbon group containing at least one carbon-carbon double bond and which may be straight or branched, preferably having 2-50 carbon atoms. The group may contain a plurality of double bonds in the normal chain and the orientation about each is independently E or Z. Exemplary alkenyl groups include, but are not limited to, ethenyl, propenyl, butenyl, pentenyl, hexenyl, heptenyl, octenyl and nonenyl. The group may be a terminal group or a bridging group.

[0044] “Alkynyl” as a group or part of a group means an aliphatic hydrocarbon group containing a carbon-carbon triple bond and which may be straight or branched, preferably having from 2-50 carbon atoms. Exemplary structures include, but are not limited to, ethynyl and propynyl. The group may be a terminal group or a bridging group.

[0045] “Aryl” as a group or part of a group denotes (i) an optionally substituted monocyclic, or fused polycyclic, aromatic carbocycle (ring structure having ring atoms that are all carbon) preferably having from 5 to 12 atoms per ring. Examples of aryl groups include phenyl, naphthyl, and the like; (ii) an optionally substituted partially saturated bicyclic aromatic carbocyclic moiety in which a phenyl and a C5-7 cycloalkyl or C5-7 cycloalkenyl group are fused together to form a cyclic structure, such as tetrahydronaphthyl, indenyl or indanyl. The group may be a terminal group or a bridging group.

[0046] “Cycloalkyl” refers to a saturated or partially saturated, monocyclic or fused or spiro polycyclic, carbocycle preferably containing from 3 to 9 carbons per ring, such as cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl and the like, unless otherwise specified. It includes monocyclic systems such as cyclopropyl and cyclohexyl, bicyclic systems such as decalin, and polycyclic systems such as adamantane. The group may be a terminal group or a bridging group. “Cycloalkenyl” means a non-aromatic monocyclic or multicyclic ring system containing at least one carbon-carbon double bond and preferably having from 5-10 carbon atoms per ring. The cycloalkenyl group may be substituted by one or more substituent groups. Exemplary monocyclic cycloalkenyl rings include cyclopentenyl, cyclohexenyl and cyclohcptcnyl. The group may be a terminal group or a bridging group.

[0047] “Cycloalkynyl” means a non-aromatic monocyclic or multicyclic ring system containing at least one carbon-carbon triple bond and preferably having from 5-10 carbon atoms per ring, cycloalkenyl group may be substituted by one or more substituent groups. Exemplary cycloalkynyl rings include cyclooctynyl and dibenzocyclooctynyl. The cycloalkynyl group may be substituted by one or more substituent groups. The group may be a terminal group or a bridging group.

[0048] “Alkoxy” refers to an -O-alkyl group in which alkyl is defined herein. Preferably the alkoxy is a C1-C50 alkoxy. Examples include, but are not limited to, methoxy and ethoxy. The group may be a terminal group or a bridging group.

[0049] “Acyl” means an alkyl-CO- group in which the alkyl group is as described herein. Examples of acyl include acetyl and benzoyl. The alkyl group is preferably a C1 -C50 alkyl group. The group may be a terminal group or a bridging group.

[0050] The prefix “hetero-” denotes that the group following contains at least one heteroatom, e.g., O, N, S or P. For example, heteroalkyls include alkyl ethers, secondary and tertiary alkyl amines, amides, alkyl sulphides, and the like. Examples of heterocyclyls and heteroaryls include, but arc not limited to, azctidinc, furan, tetrahydrofuran, pyrrole, pyrrolidine, imidazole, pyrazole, tetrazole, oxazole, acridine, pyridine, pyrazine, piperidine, pyrimidine, pyridazinc, indolizinc, isoindolc, indole, dihydroindolc, indazole, purine, quinolizinc, isoquinoline, quinoline, phthalazine, naphthylpyridine, quinoxaline, quinazoline, cinnoline, pteridine, carbazole, carboline, phenanthridine, acridine, phenanthroline, isothiazole, phenazine, isoxazole, phenoxazine, phenothiazine, imidazolidine, imidazoline, piperidine, piperazine, indoline, phthalimide, 1,2,3,4-tetrahydroisoquinoline, thiophene, 4, 5,6,7- tetrahydrobenzo[b]thiophene, thiazole, thiazolidine, benzo[b]thiophene, and the like. “Halo” or “halogen” refers to fluoro, chloro, bromo or iodo substituents.

[0051] “Oxo” and “hydroxy” refers respectively to the groups =0 and HO .

[0052] “Phosphoramidityl” refers to a functional group with the chemical structure -P(ORa)(ORb) (NRcRd), where the phosphorus is in the trivalent state. The group is commonly used as an activated nucleoside derivative in the chemical synthesis of oligonucleotides. Rarepresents the attachment point to a 5’ end of a nucleoside. Rb may be alkyl, cyano or alkyl-substituted cyano. Rcand Rd are independently isopropyl or another alkyl group such as methyl, ethyl, propyl, butyl, pentyl, hexyl, heptyl, octyl, nonyl or heptyl. In a preferred embodiment, Rcand Rd arc independently isopropyl, and Rb is (CH2)2CN or CH3.

[0053] The term “nucleoside” refers to a molecule having a purine base (e.g., adenine, hypoxanthine, guanine, and their derivatives and analogues) or pyrimidine base (e.g., cytosine, uracil, thymine, and their derivatives and analogues) covalently linked to a ribose or deoxyribose sugar. Exemplary nucleosides include adenosine, guanosine, cytidine, uridine and thymidine. The term “nucleotide” refers to a nucleoside having one or more phosphate groups joined in phosphocster linkages to the sugar moiety. Exemplary nucleotides include nucleoside monophosphates, diphosphates and triphosphates.

[0054] Nucleotide analogues include nucleotides having modifications in the chemical structure of the base, sugar and / or phosphate, including, but not limited to, 5-position pyrimidine modifications, 8-position purine modifications, modifications at cytosine exocyclic amines, and substitution of 5-bromo-uracil; and 2’-position sugar modifications, including but not limited to, sugar- modified ribonucleotides in which the 2 ’-OH is replaced by a group such as an H, OR, R, halo, SH, SR, NH2, NHR, NR2, or CN, wherein R is an alkyl moiety. Nucleotide analogs are also meant to include nucleotides with bases such as inosine, queuosine, xanthine, sugars such as 2’-O-methyl ribose, 2’-O-methoxyethyl ribose, locked nucleic acids where the ribose ring is “locked” with a methylene bridge connecting the 2’-0 atom with the 4’-C atom, and non-natural phosphodiester linkages such as methyl phosphonates, phosphorothioates and peptides. Modified bases refer to nucleotide bases such as, for example, adenine, guanine, cytosine, thymine, uracil, xanthine, inosine, and queuosine that have been modified by the replacement or addition of one or more atoms or groups. Some examples of types of modifications that can comprise nucleotides that are modified with respect to the base moieties include but are not limited to, alkylated, halogenated, thiolated, aminated, amidated, or acetylated bases, individually or in combination. More specific examples include, for example, 5-propynyluridine, 5-propynylc tidine, 6-methyladenine, 6- methylguanine, N,N, -dimethyladenine, 2-propyladenine, 2-propylguanine, 2-aminoadenine, 1 -methylinosine, 3 -methyluridine, 5-methylcytidine, 5 -methyluridine and other nucleotides having a modification at the 5 position, 5-(2-amino)propyl uridine, 5-halocytidine, 5- halouridine, 4-acetylcytidine, 1 -methyladenosine, 2-methyladenosine, 3 -methylcytidine, 6- mcthyluridinc, 2-mcthylguanosinc, 7-mcthylguanosinc, 2,2-dimcthylguanosinc, 5- methylaminoethyluridine, 5-methyloxyuridine, deazanucleotides such as 7-deaza- adenosine, 6-azouridine, 6-azocytidine, 6-azothymidine, 5-methyl-2-thiouridine, other thio bases such as 2-thiouridine and 4-thiouridine and 2-thiocytidine, dihydrouridine, pseudouridine, queuosine, archaeosine, naphthyl and substituted naphthyl groups, any Gland N-alkylated purines and pyrimidines such as N6-methyladenosine, 5- methylcarbonylmethyluridine, uridine 5-oxyacetic acid, pyridine-4-one, pyridine-2-one, phenyl and modified phenyl groups such as aminophcnol or 2,4,6-trimcthoxy benzene, modified cytosines that act as G-clamp nucleotides, 8-substituted adenines and guanines, 5- substituted uracils and thymines, azapyrimidines, carboxyhydroxyalkyl nucleotides, carboxyalkylaminoalkyl nucleotides, and alkylcarbonylalkylated nucleotides. Modified nucleotides also include those nucleotides that are modified with respect to the sugar moiety, as well as nucleotides having sugars or analogs thereof that are not ribosyl. For example, the sugar moieties may be, or be based on, mannoses, arabinoses, glucopyranoses, galactopyranoscs, 4'-thioribosc, and other sugars, heterocycles, or carbocyclcs.

[0055] The term “nucleotide” is also meant to include what are known in the art as universal bases. By way of example, universal bases include but are not limited to 3-nitropyrrole, 5- nitroindole, or nebularine. The term “nucleotide” is also meant to include the N3’ to P5’ phosphoramidate, resulting from the substitution of a ribosyl 3 ’ oxygen with an amine group. Further, the term nucleotide also includes those species that have a detectable label, such as for example a radioactive or fluorescent moiety, or mass label attached to the nucleotide. The terms “oligonucleotide”, “nucleic acid” and “nucleic acid molecule” are used interchangeably herein to refer to polymers of up to 100 nucleotides, and include but are not limited to single- and double-stranded DNA and RNA, DNA / RNA hybrids including oligonucleotide chains of regularly and / or irregularly alternating deoxyribosyl moieties and ribosyl moieties, and modifications of these kinds of polynucleotides, wherein the attachment of various entities or moieties to the nucleotide units at any position are included.

[0056] The term “pharmaceutical composition” or “pharmaceutical formulation” refers to a preparation which is in such form as to permit the biological activity of the active ingredient(s) to be effective, and which contains no additional components which are unacceptably toxic to a subject to which the composition or formulation would be administered. Such formulations arc sterile. “Pharmaceutically acceptable” carriers and excipients (vehicles, additives) are those which can reasonably be administered to a subject mammal to provide an effective dose of the active ingredient employed.

[0057] The terms “treating”, “treatment” and the like include relieving, reducing, alleviating, ameliorating or otherwise inhibiting the effects of the disease for at least a period of time. It is also to be understood that terms “treating”, “treatment” and the like do not imply that the disease, or a symptom thereof, is permanently relieved, reduced, alleviated, ameliorated or otherwise inhibited and therefore also encompasses the temporary relief, reduction, alleviation, amelioration or otherwise inhibition of the disease, or of a symptom thereof.

[0058] As used herein a “therapeutically effective amount” or “effective amount” is an amount that is non-toxic to the subject and sufficient to effect desired outcomes in a subject (i.e., achieve therapeutic efficacy). For purposes of this disclosure, a therapeutically effective amount of a compound, conjugate or composition is an amount that is sufficient to palliate, ameliorate, stabilise, reverse, prevent, slow or delay the progression of a disease state. A therapeutically effective amount can be administered in one or more administrations.

[0059] The term “combination therapy” as used herein refers to the administration of two or more therapeutic agents to a subject, in the same or separate pharmaceutical formulations, and at the same time or at different times. If the therapeutic agents are administered at different times, they are preferably administered sufficiently close in time (such as within about 12-24 hours of each other, more preferably within about 6-12 hours of each other) to provide for a potentiating or synergistic response. In some instances, it may be desirable to extend the time period for treatment significantly, however, where several days (e.g., 2, 3, 4, 5, 6 or 7) to several weeks (e.g., 1, 2, 3, 4, 5, 6, 7 or 8) lapse between the respective administrations. In other instances, it might be desirable to reduce the time between administration, administering both therapeutic agents within seconds or minutes to hours, preferably within about 6 hours from each other, more preferably within about 1-3 hours.

[0060] The terms “subject”, “patient” or “host”, used interchangeably herein, refer to any subject, particularly a vertebrate subject, and even more particularly a mammalian subject, for whom therapy or prophylaxis is desired. Suitable vertebrate animals that fall within the scope of the invention include, but are not restricted to, any member of the subphylum Chordata including primates (e.g., humans, monkeys and apes, and includes species of monkeys such from the genus Macaca (e.g., cynomologus monkeys such as Macaco, fascicularis, and / or rhesus monkeys (Macaca mulatto)) and baboon (Papio ursinus), as well as marmosets (species from the genus Callithrix), squirrel monkeys (species from the genus Saimiri) and tamarins (species from the genus Saguinus), as well as species of apes such as chimpanzees (Pan troglodytes)), rodents (e.g., mice rats, guinea pigs), lagomorphs (e.g., rabbits, hares), bovines (e.g., cattle), ovines (e.g., sheep), caprines (e.g., goats), porcines (e.g., pigs), equines (e.g., horses), canines (e.g., dogs), felines (e.g., cats), avians (e.g., chickens, turkeys, ducks, geese, companion birds such as canaries, budgerigars etc.), marine mammals (e.g., dolphins, whales), reptiles (snakes, frogs, lizards etc.), and fish.

[0061] As used herein, “and / or” refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations when interpreted in the alternative (or).

[0062] As used in this application, the singular form “a,” “an,” and “the” include plural references unless the context clearly dictates otherwise. For example, the term “an agent” includes a plurality of agents, including mixtures thereof.

[0063] Throughout this specification and the claims which follow, unless the context requires otherwise, the word “comprise”, and variations such as “comprises” and “comprising”, will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps. Throughout this specification and the claims which follow, unless the context requires otherwise, the phrase “consisting essentially of’, and variations such as “consists essentially of’ will be understood to indicate that the recited element(s) is / are essential i.e. necessary elements of the invention. The phrase allows for the presence of other non-recited elements which do not materially affect the characteristics of the invention but excludes additional unspecified elements which would affect the basic and novel characteristics of the method defined.

[0064] Linkage group

[0065] The present disclosure provides linkage groups and methods for preparing oligonucleotide conjugates using the linkage groups.

[0066] Disclosed herein is a compound of Formula (Ta), or a salt, solvate or stereoisomer thereof: wherein Ri and R2are independently selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted silyl, optionally substituted acyl, and optionally substituted phosphoramidityl;

[0067] Rs and R4 are independently selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted silyl, and optionally substituted acyl;

[0068] X is a carbon atom or a heteroatom;

[0069] Li is an optionally substituted linker having a chain length of 0 to 50 atoms;

[0070] Rs is selected from H, cyano, halo, oxo, thio, azido, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted acyl, optionally substituted oxyacyl, optionally substituted acyloxy, optionally substituted amino, optionally substituted aryl, and optionally substituted hctcroaryl; and wherein at least one of Ri and R2is optionally substituted phosphoramidityl. In some embodiments, X is a C, O, S, or N atom.

[0071] Disclosed herein is a compound of Formula (I), or a salt, solvate or stereoisomer thereof: wherein Ri and R2are independently selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted silyl, optionally substituted acyl, and optionally substituted phosphoramidityl;

[0072] Rs and R4 arc independently selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted silyl, and optionally substituted acyl; Li is an optionally substituted linker having a chain length of 0 to 50 atoms;

[0073] R5 is selected from H, cyano, halo, oxo, thio, azido, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted acyl, optionally substituted oxyacyl, optionally substituted acyloxy, optionally substituted amino, optionally substituted aryl, and optionally substituted hctcroaryl; and wherein at least one of Ri and R2is optionally substituted phosphoramidityl.

[0074] The phosphoramidityl moiety in the compound allows incorporation of an oligonucleotide through conventional phosphoramidite-based chemistry. The phosphoramidityl moiety also allows the formation of dimeric or multimeric structures through multiple linkage groups, leading to a multi-ligand-conjugated oligonucleotide. In other words, multiple ligands (whether the same ligand or different ligands) may be conjugated to a single oligonucleotide. The ribose-like structure of the linkage group and the absence of nucleobase-like moieties enhance biocompatibility and minimize interference with the intended activity of the oligonucleotide conjugate.

[0075] In some embodiments, the compound is a compound of Formula (I-i), (I-ii), (I-iii), (I-iv), (I- v) or (I-vi), or a salt or solvate or stereoisomer thereof: wherein Ri and R2 are independently selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted silyl, optionally substituted acyl, and optionally substituted phosphoramidityl;

[0076] Rs and R4 arc independently selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted silyl, and optionally substituted acyl,; Li is an optionally substituted linker having a chain length of 0 to 50 atoms;

[0077] Rs is selected from H, cyano, halo, oxo, thio, azido, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted acyl, optionally substituted oxyacyl, optionally substituted acyloxy, optionally substituted amino, optionally substituted aryl, and optionally substituted heteroaryl; and wherein at least one of Ri and R2 is optionally substituted phosphoramidityl.

[0078] In some embodiments, the compound is a compound of Formula (I-iii) or (I-iv), or a salt or solvate or stereoisomer thereof. In some embodiments, the compound is a compound of Formula (I-v) or (I-vi), or a salt or solvate or stereoisomer thereof.

[0079] In some embodiments, Ri is optionally substituted phosphoramidityl, and R2 is selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted silyl, and optionally substituted acyl.

[0080] In some embodiments, R2 is optionally substituted phosphoramidityl, and Ri is selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted silyl, and optionally substituted acyl.

[0081] In some embodiments, the phosphoramidityl i wherein R7is selected from H, optionally substituted alkyl, and optionally substituted alkenyl; and

[0082] Rs and Rg are independently selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted heterocyclyl, optionally substituted aryl, and optionally substituted heteroaryl.

[0083] In some embodiments, R7 is cyano or cyano-substituted alkyl or heteroalkyl.

[0084] In one embodiment,

[0085] In some embodiments, Rs and / or Rg are isopropyl. In one embodiment, Rs and Rg are both isopropyl.

[0086] In one embodiment, R7 is cyano or alkyl substituted with cyano, and Rs and Rg are isopropyl.

[0087] In some embodiments, the phosphoramidityl is

[0088] In one embodiment, the phosphoramidityl is Ri and / or R2 may be a hydroxyl protecting group.

[0089] By way of non-limiting example, hydroxyl protecting groups include methyl, methoxylmethyl (MOM), methylthiomethyl (MTM), t-butylthiomethyl, (phenyldimethylsilyl)methoxymethyl (SMOM), benzyloxymethyl (BOM), p- methoxybenzyloxymethyl (PMBM), (4-methoxyphenoxy)methyl (p-AOM), guaiacolmethyl (GUM), t-butoxymethyl, 4-pentenyloxymethyl (POM), siloxymethyl, 2- methoxyethoxymethyl (MEM), 2,2,2-trichloroethoxymethyl, bis(2-chloroethoxy)methyl, 2- (trimethylsilyl)ethoxymethyl (SEMOR), tetrahydropyranyl (THP), 3- bromotetrahydropyranyl, tetrahydrothiopyranyl, 1 -methoxycyclohexyl, 4- mcthoxytctrahydropyranyl (MTHP), 4-mcthoxytctrahydrothiopyranyl, 4- methoxytetrahydrothiopyranyl S,S-dioxide, 1 -[(2-chloro-4-methyl)phenyl]-4- methoxypiperidin-4-yl (CTMP), l,4-dioxan-2-yl, tetrahydrofuranyl, tetrahydrothiofuranyl, 2,3,3a,4,5,6,7,7a-octahydro-7,8,8-trimethyl-4,7-methanobenzofuran-2-yl, 1 -ethoxyethyl, 1- (2-chloroethoxy )ethyl, 1 -methyl- 1 -methoxyethyl, 1 -methyl- 1 -benzyloxyethyl, 1 -methyl- 1 - benzyloxy-2-fluoroethyl, 2,2,2-trichloroethyl, 2-trimethylsilylethyl, 2-(phenylselenyl)ethyl, t-butyl, allyl, p-chlorophenyl, p-methoxyphenyl, 2,4-dinitrophenyl, benzyl, p- mcthoxybcnzyl, 3,4-dimcthoxybcnzyl, o-nitrobcnzyl, p-nitrobcnzyl, p-halobcnzyl, 2,6- dichlorobenzyl, p-cyanobenzyl, p-phenylbenzyl, 2-picolyl, 4-picolyl, 3-methyl-2-picolyl N- oxido, diphenylmethyl, p,p'-dinitrobenzhydryl, 5-dibenzosuberyl, triphenylmethyl, a- naphthyldiphenylmethyl, p-methoxyphenyldiphenylmethyl, di(p- methoxyphenyl)phenylmethyl, tri(p-methoxyphenyl)methyl, 4-(4'- bromophenacy loxypheny l)diphenylmethyl, 4 ,4 ' ,4 " -tris(4 ,5 - dichlorophthalimidophenyl)methyl, 4,4',4"-tris(levulinoyloxyphenyl)methyl, 4, 4', 4''- tris(bcnzoyloxyphcnyl)mcthyl, 3-(imidazol-l-yl)bis(4',4"-dimcthoxyphcnyl)mcthyl, 1,1- bis(4-methoxyphenyl)- 1 '-pyrenylmethyl, 9-anthryl, 9-(9-phenyl)xanthenyl, 9-(9-phenyl- 10- oxo)anthryl, l,3-benzodithiolan-2-yl, benzisothiazolyl S,S-dioxido, trimethylsilyl (TMS), triethylsilyl (TES), triisopropylsilyl (TTPS), dimethylisopropylsilyl (TPDMS), diethylisopropylsilyl (DEIPS), dimethylthexylsilyl, t-butyldimethylsilyl (TBDMS), t- butyldiphenylsilyl (TBDPS), tribenzylsilyl, tri-p-xylylsilyl, triphenylsilyl, diphenylmethylsilyl (DPMS), t-butylmethoxyphenylsilyl (TBMPS), formate, benzoylformate, acetate, chloroacctatc, dichloroacctatc, trichloroacctatc, trifluoroacctatc, methoxyacetate, triphenylmethoxyacetate, phenoxyacetate, p-chlorophenoxyacetate, 3- phenylpropionate, 4-oxopentanoate (levulinate), 4,4-(ethylenedithio)pentanoate (levulinoyldithioacetal), pivaloate, adaniantoate, crotonate, 4-methoxycrotonate, benzoate, p-phenylbenzoate, 2,4,6-trimethylbenzoate (mesitoate), alkyl methyl carbonate, 9- fluorenylmethyl carbonate (Fmoc), alkyl ethyl carbonate, alkyl 2,2,2-trichloroethyl carbonate (Troc), 2-(trimethylsilyl)ethyl carbonate (TMSEC), 2-(phenylsulfonyl) ethyl carbonate (Psec), 2-(triphenylphosphonio) ethyl carbonate (Peoc), alkyl isobutyl carbonate, alkyl vinyl carbonate alkyl allyl carbonate, alkyl p-nitrophenyl carbonate, alkyl benzyl carbonate, alkyl p-methoxybenzyl carbonate, alkyl 3,4-dimethoxybenzyl carbonate, alkyl o- nitrobenzyl carbonate, alkyl p-nitrobenzyl carbonate, alkyl S-benzyl thiocarbonate, 4- ethoxy-1 -naphthyl carbonate, methyl dithiocarbonate, 2-iodobenzoate, 4-azidobutyrate, 4- nitro-4-methylpentanoate, o-(dibromomethyl)benzoate, 2 -formylbenzenesulfonate, 2- (mcthylthiomcthoxy)cthyl, 4-(mcthylthiomcthoxy)butyratc, 2-

[0090] (methylthiomethoxymethyl)benzoate, 2,6-dichloro-4-methylphenoxyacetate, 2,6-dichloro- 4-( 1 , 1 ,3,3-tetramethylbutyl)phenoxyacetate, 2, 4 -bis( 1 , l-dimethylpropyl)phenoxy acetate, chlorodiphenylacetate, isobutyrate, monosuccinate, (E)-2-methyl-2-butenoate, o- (methoxycarbonyl)benzoate, a-naphthoate, nitrate, alkyl N,N,N',N'- tetramethylphosphorodiamidate, alkyl N-phenylcarbamate, borate, dimethylphosphinothioyl, alkyl 2,4-dinitrophenylsulfenate, sulfate, methanesulfonate (mesylate), bcnzylsulfonatc, and tosylatc (Ts).

[0091] In some embodiments, Ri is H or a hydroxyl protecting group, and R2 is optionally substituted phosphoramidityl. Tn some embodiments, Ri is optionally substituted phosphoramidityl and R2 is H or a hydroxyl protecting group. The hydroxyl protecting group may be optionally substituted triphenylmethyl.

[0092] In some embodiments, Ri is H or dimcthoxytrityl (DMTr), and R2 is optionally substituted phosphoramidityl. In some embodiments, Ri is optionally substituted phosphoramidityl, and R2 is H or dimethoxytrityl (DMTr).

[0093] R3 and R4 may be protecting groups for a 1,2 diol.

[0094] For protecting 1,2- or 1,3-diols, the protecting groups include methylene acetal, ethylidene acetal, 1-t-butylcthylidcnc ketal, 1-phcnylcthylidcnc ketal, (4-mcthoxyphcnyl)cthylidcnc acetal, 2,2,2-trichloroethylidene acetal, acetonide, cyclopentylidene ketal, cyclohexylidene ketal, cycloheptylidene ketal, benzylidene acetal, p-methoxybenzylidene acetal, 2,4- dimethoxybenzylidene ketal, 3,4-diniethoxybenzylidene acetal, 2-nitrobenzylidene acetal, methoxymethylene acetal, ethoxymethylene acetal, dimethoxymethylene ortho ester, 1- methoxyethylidene ortho ester, 1 -ethoxy ethylidine ortho ester, 1,2-dimethoxyethylidene ortho ester, cc-methoxybenzylidene ortho ester, l-(N,N-dimethylamino)ethylidene derivative, a-(N,N'-dimethylamino)benzylidene derivative, 2 -oxacyclopentylidene ortho ester, di-t-butylsilylene group (DTBS), l,3-(l,l,3,3-tetraisopropyldisiloxanylidene) derivative (T1PDS), tetra-t-butoxydisiloxane- 1,3 -diylidene derivative (TBDS), cyclic carbonates, cyclic boronates, ethyl boronate, and phenyl boronate. Amino-protecting groups include methyl carbamate, ethyl carbamate, 9-fluorenylmethyl carbamate (Fmoc), 9-(2- sulfo)fluorenylmethyl carbamate, 9-(2,7-dibromo)fluoroenylmethyl carbamate, 2,7-di-t- butyl-[9-(10,10-dioxo-10,10,10,10-tctrahydrothioxanthyl)]mcthyl carbamate (DBD-Tmoc), 4-methoxyphenacyl carbamate (Phenoc), 2,2,2-trichloroethyl carbamate (Troc), 2- trimethylsilylethyl carbamate (Teoc), 2-phenylethyl carbamate (hZ), l-(l-adamantyl)-!- methylethyl carbamate (Adpoc), l ,l -dimethyl-2-haloethyl carbamate, 1 ,1 -dimethyl-2,2- dibromoethyl carbamate (DB-t-BOC), l,l-dimethyl-2,2,2-trichloroethyl carbamate (TCBOC), 1 -methyl- l-(4-biphenylyl)ethyl carbamate (Bpoc), l-(3,5-di-t-butylphenyl)-l- methylethyl carbamate (t-Bumeoc), 2-(2'- and 4'-pyridyl)ethyl carbamate (Pyoc), 2-(N,N- dicyclohcxylcarboxamido)cthyl carbamate, t-butyl carbamate (BOC), 1-adamantyl carbamate (Adoc), vinyl carbamate (Voc), allyl carbamate (Alloc), 1 -isopropylallyl carbamate (Ipaoc), cinnamyl carbamate (Coc), 4-nitrocinnamyl carbamate (Noc), 8-quinolyl carbamate, N-hydroxypiperidinyl carbamate, alkyldithio carbamate, benzyl carbamate (Cbz), p-rnethoxybenzyl carbamate (Moz), p-nitobenzyl carbamate, p-bromobenzyl carbamate, p-chlorobenzyl carbamate, 2,4-dichlorobenzyl carbamate, 4- methylsulfinylbenzyl carbamate (Msz), 9-anthrylmethyl carbamate, diphenylmethyl carbamate, 2-mcthylthiocthyl carbamate, 2-mcthylsulfonylcthyl carbamate, 2-(p- toluenesulfonyl)ethyl carbamate, [2-(l,3-dithianyl)]methyl carbamate (Dmoc), 4- methylthiophenyl carbamate (Mtpc), 2,4-dimethylthiophenyl carbamate (Bmpc), 2- phosphonioethyl carbamate (Peoc), 2-triphenylphosphonioisopropyl carbamate (Ppoc), 1 ,1 - dimethyl-2-cyanoethyl carbamate, m-chloro-p-acyloxybenzyl carbamate, p- (dihydroxyboryl)benzyl carbamate, 5-benzisoxazolylmethyl carbamate, 2-(trifluoromethyl)- 6-chromonylmethyl carbamate (Tcroc), m-nitrophenyl carbamate, 3,5-dimethoxybenzyl carbamate, o-nitrobcnzyl carbamate, 3,4-dimcthoxy-6-nitrobcnzyl carbamate, phcnyl(o- nitrophenyl)methyl carbamate, phenothiazinyl-(10)-carbonyl derivative, N'-p- toluene sulfonylaminocarbonyl derivative, N'-phenylaminothiocarbonyl derivative, t-amyl carbamate, S-benzyl thiocarbamate, p-cyanobenzyl carbamate, cyclobutyl carbamate, cyclohexyl carbamate, cyclopentyl carbamate, cyclopropylmethyl carbamate, p- decyloxybenzyl carbamate, 2,2-dimethoxycarbonylvinyl carbamate, o-(N,N- dimethylcarboxamido)benzyl carbamate, l,l-dimethyl-3-(N,N- dimethylcarboxamido)propyl carbamate, 1,1-dimethylpropynyl carbamate, di(2- pyridyl)methyl carbamate, 2-furanylmethyl carbamate, 2-iodoethyl carbamate, isoborynl carbamate, isobutyl carbamate, isonicotinyl carbamate, p-(p '-methoxyphenylazo )benzyl carbamate, 1 -methylcyclobutyl carbamate, 1 -methylcyclohexyl carbamate, 1 -methyl- 1- cyclopropylmethyl carbamate, l-methyl-l-(3,5-dimethoxyphenyl)ethyl carbamate, 1- methyl-l-(p-phenylazophenyl)ethyl carbamate, 1 -methyl- 1 -phenylethyl carbamate, 1- mcthyl-l-(4-pyridyl)cthyl carbamate, phenyl carbamate, p-(phcnylazo)bcnzyl carbamate, 2,4,6-tri-t-butylphenyl carbamate, 4-(trimethylammonium)benzyl carbamate, 2,4,6- trimethylbenzyl carbamate, formamide, acetamide, chloroacetamide, trichloroacetamide, trifluoroacetamide, phenylacetamide, 3-phenylpropanamide, picolinamide, 3- pyridylcarboxamide, N-benzoylphenylalanyl derivative, benzamide, p-phenylbenzamide, o- nitophenylacetamide, o-nitrophenoxyacetamide, acetoacetamide, (N'- dithiobenzyloxycarbonylamino)acetamide, 3-(p-hydroxyphenyl)propanamide, 3-(o- nitrophcnyl)propanamidc, 2-mcthyl-2-(o-nitrophcnoxy)propanamidc, 2-mcthyl-2-(o- phenylazophenoxy)propanamide, 4-chlorobutanamide, 3-methyl-3-nitrobutanamide, o- nitrocinnamide, N-acetylmethionine derivative, o-nitrobenzamide, o- (benzoyloxymethyl)benzamide, 4,5-diphenyl-3-oxazolin-2-one, N-phthalimide, N- dithiasuccinimide (Dts), N-2,3-diphenylmaleimide, N-2,5-dimethylpyrrole, N-1,1,4,4- tetramethyldisilylazacyclopentane adduct (STABASE), 5-substituted l,3-dimethyl-l,3,5- triazacyclohexan-2-one, 5-substituted 1, 3 -dibenzyl- 1,3, 5-triazacyclohexan-2-one, 1- substitutcd 3,5-dinitro-4-pyridonc, N-mcthylaminc, N-allylaminc, N-[2- (trimethylsilyl)ethoxy]methylamine (SEM), N-3-acetoxypropylamine, N-(l-isopropyl-4- nitro-2-oxo-3-pyroolin-3-yl)amine, quaternary ammonium salts, N-benzylamine, N-di(4- methoxyphenyl)methylamine, N-5-dibenzosuberylamine, N-triphenylmethylamine (Tr), N- [(4-methoxyphenyl)diphenylmethyl]amine (MMTr), N-9-phenylfluorenylamine (PhF), N- 2,7-dichloro-9-fluorenylmethyleneamine, N-ferrocenylmethylamino (Fem), N-2- picolylamino N'-oxide, N-l,l-dimethylthiomethyleneamine, N-benzylideneamine, N-p- mcthoxybcnzylidcncaminc, N-diphcnylmcthylcncaminc, N-[(2- pyridyl)mesityl]methyleneamine, N — (N',N'-dimethylaminomethylene)amine, N,N'- isopropylidenediamine, N-p-nitrobenzylideneamine, N-salicylideneamine, N-5- chloro salicylideneamine, N-(5-chloro-2-hydroxyphenyl)phenylmethyleneamine, N- cyclohexylideneamine, N-(5,5-dimethyl-3-oxo-l-cyclohexenyl)amine, N-borane derivative, N-diphenylborinic acid derivative, N-[phenyl(pentacarbonylchromium- or tungsten)carbonyl]amine, N-copper chelate, N-zinc chelate, N-nitroamine, N-nitrosoamine, amine N-oxide, diphenylphosphinamide (Dpp), dimethylthiophosphinamide (Mpt), diphenylthiophosphinamide (Ppt), dialkyl phosphoramidates, dibenzyl phosphoramidate, diphenyl phosphoramidate, benzenesulf enamide, o-nitrobenzenesulfenamide (Nps), 2,4- dinitrobenzenesulfenamide, pentachlorobenzenesulfenamide, 2-nitro-4- methoxybenzenesulfenamide, triphenylmethylsulfenamide, 3 -nitropyridine sulfenamide (Npys), p-toluenesulfonamide (Ts), benzenesulfonamide, 2,3,6,-trimethyl-4- mcthoxybcnzcncsulfonamidc (Mtr), 2,4,6-trimcthoxybcnzcncsulfonamidc (Mtb), 2,6- dimethyl-4-methoxybenzenesulfonamide (Pme), 2,3,5,6-tetramethyl-4- methoxybenzenesulfonamide (Mte), 4-methoxybenzenesulfonamide (Mbs), 2,4,6- trimethylbenzenesulfonamide (Mts), 2,6-dimethoxy-4-methylbenzenesulfonamide (iMds), 2,2,5,7,8-pentamethylchroman-6-sulfonamide (Pmc), methanesulfonamide (Ms), P- trimethylsilylethanesulfonamide (SES), 9-anthracenesulfonamide, 4-(4',8'- dimethoxynaphthylmethyl)benzenesulfonamide (DNMBS), benzylsulfonamide, trifluoromcthylsulfonamidc, and phcnacylsulfonamidc.

[0095] In some embodiments, Rs and / or R4 is methyl. In some embodiments, Rs and R4 are both methyl.

[0096] Exemplary protecting groups are detailed herein, however, it will be appreciated that the present disclosure is not intended to be limited to these protecting groups; rather, a variety of additional equivalent protecting groups can be readily identified using the above criteria and utilized in the method of the present invention. Additionally, a variety of protecting groups are described in Greene's Protective Groups in Organic Synthesis, P. G. M. Wuts, 5th edition, John Wiley & Sons, 2014, the entirety of which is incorporated herein by reference.

[0097] Li may be an optionally substituted lineal- or branched (i.e., multi-aimed) linker. Each chain of the linker may have a chain length of 0 to 50 atoms, such as 0 to 45 atoms, 0 to 40 atoms, 0 to 35 atoms, 0 to 30 atoms, 0 to 25 atoms, 0 to 20 atoms, 0 to 15 atoms, 0 to 10 atoms, 0 to 8 atoms, 0 to 6 atoms, 0 to 5 atoms, or 0 to 3 atoms. Branched linkers may have 2 to 50 arms.

[0098] In some embodiments, Li is a linear chain with a chain length of 1 to 50 atoms. Li may be a linear chain with a chain length of 1 to 45 atoms, 1 to 40 atoms, 1 to 35 atoms, 1 to 30 atoms, 1 to 25 atoms, 1 to 20 atoms, 1 to 15 atoms, 1 to 10 atoms, 1 to 8 atoms, 1 to 6 atoms, 1 to 5 atoms, or 1 to 3 atoms.

[0099] In some embodiments, Li is a branched linker with 2 to 50 branch chains, with each branch chain having a chain length of 1 to 50 atoms. In some embodiments, Li is a branched linker with 2 to 8 branch chains, with each branch chain having a chain length of 1 to 50 atoms. In some embodiments, Li is a branched linker with 2 to 50 branch chains, with each branch chain having a chain length of 1 to 10 atoms. In some embodiments, Li is a branched linker with 2 to 8 branch chains, with each branch chain having a chain length of 1 to 10 atoms.

[0100] In some embodiments, Li is an optionally substituted alkyl or heteroalkyl with a chain length of 1 to 50 atoms.

[0101] In some embodiments, Rs is a conjugating group. The term “conjugating group” refers to a chemical group capable of coupling with the functional group of another compound to form a covalent bond.

[0102] In some embodiments, the conjugating group is a click functional group capable of coupling with another click functional group via a click reaction to form a click adduct. The click reaction may be, for example, an SN2 reaction, a Diels-Alder reaction, a conjugate addition reaction, or a cycloaddition reaction (which may or may not utilise a Cu(I) catalyst). Examples of click functional groups include but are not limited to alkyne groups (such as a linear alkynyl, cyclooctynyl, and dibenzocyclooctynyl), alkene groups (such as transcyclooctenyl and norbomyl), diene groups (such as tetrazinyl and tetrazolyl), azide, maleimide, thiol, 1,3-nitrone, aldehyde, ketone, hydrazine, and hydroxylamine.

[0103] The table below exemplifies different pairs of click conjugates that will react with each other to form a covalent bond.

[0104] In some embodiments, R5 is optionally substituted alkynyl.

[0105] In one embodiment, R5 is , wherein Re is selected from H, optionally substituted alkyl, and optionally substituted alkoxy; and n is an integer selected from 1 to 50.

[0106] In one embodiment, the linkage group is a compound of Formula (II), or a salt, solvate or stereoisomer thereof: wherein Ri and R2 are independently selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted hctcrocyclyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted silyl, optionally substituted acyl, and optionally substituted phosphoramidityl;

[0107] R3 and R4 are independently selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted silyl, and optionally substituted acyl; R& is selected from H, optionally substituted alkyl, and optionally substituted alkoxy; n is an integer selected from 1 to 50; and wherein at least one of Ri and R2 is optionally substituted phosphoramidityl.

[0108] In some embodiments, the linkage group is a compound of Formula (Il-i), (Il-ii), (II-iii), (II- iv), (II-v) or (II- vi), or a salt or solvate or stereoisomer thereof: wherein Ri and R2 are independently selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted hctcrocyclyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted silyl, optionally substituted acyl, and optionally substituted phosphoramidityl;

[0109] Rs and R4 are independently selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted silyl, and optionally substituted acyl; R > is selected from H, optionally substituted alkyl, and optionally substituted alkoxy; n is an integer selected from 1 to 50; and wherein at least one of Ri and R2 is optionally substituted phosphoramidityl.

[0110] In some embodiments, the compound is a compound of Formula (II-iii) or (IT-iv), or a salt or solvate or stereoisomer thereof. In some embodiments, the compound is a compound of Formula (11-v) or (II- vi), or a salt or solvate or stereoisomer thereof. In one embodiment, the compound is a compound of Formula (111), or a salt, solvate or stereoisomer thereof: wherein R2 is selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted hctcrocyclyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted silyl, and optionally substituted acyl,;

[0111] Rs and R4 are independently selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted silyl, and optionally substituted acyl; R6is selected from H, optionally substituted alkyl, and optionally substituted alkoxy;

[0112] R7is selected from H, optionally substituted alkyl, optionally substituted alkenyl;

[0113] Rs and R9arc independently selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl; and n is an integer selected from 1 to 50.

[0114] In some embodiments, the compound is a compound of Formula (Ill-i) , (111-ii), (111-iii), (III- iv), (III-v) or (III- vi), or a salt or solvate or stereoisomer thereof:

[0115] wherein R2 is selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted hctcroaryl, optionally substituted silyl, and optionally substituted acyl, ;

[0116] Rs and R4 are independently selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted silyl, and optionally substituted acyl; Rg is selected from H, optionally substituted alkyl, and optionally substituted alkoxy;

[0117] Ry is selected from H, optionally substituted alkyl, optionally substituted alkenyl;

[0118] Rs and Rg are independently selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted hcleroaryl; and n is an integer selected from 1 to 50.

[0119] In some embodiments, the compound is a compound of Formula (III-iii) or (Ill-iv), or a salt or solvate or stereoisomer thereof. In some embodiments, the compound is a compound of Formula (IIl-v) or (Ill-vi), or a salt or solvate or stereoisomer thereof. Compounds of Formula (1-iii), (1-iv), (1-v), (1-vi), (11-iii), (11-iv), (11-v), (11-vi), (111-iii), (111- iv), (III-v), and (ITI-vi) have the advantage that the stereochemistry at the 3’-C and 5’-C of the ribose-like backbone does not sterically hinder the installation of a phosphoramidite and the subsequent conjugation of an oligonucleotide to the 3’-OH of the ribose-like backbone.

[0120] The alkynyl group allows conjugation of a ligand or linker containing a complementary click functional group (e.g., an azide group) through a click reaction.

[0121] In some embodiments, R2 is H or a hydroxyl protecting group. In one embodiment, R2 is dimethoxytrityl (DMTr).

[0122] In some embodiments, Rs and R4 arc protecting groups for a 1,2 diol. In some embodiments, Rs and R4 are both methyl.

[0123] In one embodiment, Re is H.

[0124] In some embodiments, n is 1 to 50. In some embodiments, n is 1 to 40, 1 to 30, 1 to 20, or 1 to 10. In one embodiment, n is 1.

[0125] In one embodiment, the compound salt or solvate or stereoisomer thereof, wherein Ri is H or phosphoramidityl;

[0126] R2 is H or a hydroxyl protecting group, such as dimethoxy trityl (DMTr); and n is an integer from 1 to 50.

[0127] In some embodiments, the compound is selected

[0128] A “ligand” herein encompasses chemical moieties which are capable of altering the distribution, targeting or lifetime of an oligonucleotide to which it is conjugated. Ligands also include therapeutic modifiers, e.g., for enhancing cellular uptake; diagnostic compounds or reporter groups e.g., for monitoring distribution; and nuclease resistance-conferring moieties. The ligand may be a monovalent or multivalent ligand.

[0129] In some embodiments, the ligand provides an enhanced affinity for a selected target, e.g., a molecule, cell or cell type, cellular compartment, tissue, organ or region of the body, as compared to an oligonucleotide absent of such a ligand.

[0130] In some embodiments, the ligand is capable of binding to a cell surface antigen or receptor. In some embodiments, the ligand is capable of binding to an asialoglycoprotein receptor (ASGPR). Preferred ligands do not interfere with hybridization or functionality of the oligonucleotide.

[0131] In some embodiments, the ligand comprises a peptide, polypeptide, monosaccharide, disaccharide, polysaccharide, glycan, lipid, polymer, metabolite, fatty acid, hormone, vitamin, or a combination thereof. The ligand may be a naturally-occurring molecule or a recombinant or synthetic molecule, such as a synthetic derivative of a naturally-occurring molecule. In some embodiments, the ligand is selected from acetylcholine, N- acetylgalactosamine (GalNAc), N-acetylglucosamine (GlcNAc), acetyl-glyceryl-ether- phosphorylcholine (AGEPC), N-acetylserotonin, adenosine, adrenaline, agmatine, gamma- aminobutyric acid (GAMA), anandamide, anisamide, N-arachidonoyl dopamine (NADA), 2-arachidonoylglycerol, biotin (vitamin B7), calcitonin, carbachol, chenodeoxycholic acid, cholesterol, cholic acid, deoxycholic acid, dopamine, epigallocatechin-3 -gallate (EGCG), estrone, fatty acid, folic acid, glutamic acid, glycocholic acid, histamine, 6- hydroxymelatonin, lithocholic acid, melatonin, N-methyltyramine (NMT), niacin (vitamin B3), norepinephrine, meto-octopamine, para-octopamine, oxytocin, phenylethanolamine, prostacyclin, prostaglandin, putrescine, riboflavin (vitamin B2), serotonin, squalene, taurocholic acid, thiamin (vitamin Bl), thromboxane, tocopherol, vasopressin, virodhamine, and derivatives thereof.

[0132] In some embodiments, the ligand is a monosaccharide.

[0133] In some embodiments, the ligand comprises galactose or a galactose derivative. In some embodiments, the ligand comprises N-acetyl-galactosamine (GalNAc) or a GalNAc derivative, such as an O-acetylated or O-methylated derivative of GalNAc. In one embodiment, the ligand is GalNAc or a derivative thereof.

[0134] The ligand may be attached to the linkage group via an intervening linker. For example, the ligand may be attached to the linker via a first conjugation reaction, and the linker subsequently attached to the linkage group via a second conjugation reaction.

[0135] Linkers

[0136] Linkers herein (e.g., Li, L2 and L3) may be conjugated to a linkage group and / or a ligand via a conjugation moiety at one or more ends of the linker. Such a moiety may include, but is not limited to, esters, carbonates, carbamates, imines phosphate esters, oximes, hydrazones, acetals, orthoesters, amides, thioethers, succinimides, triazoles, isoxazolines, pyridazines, and peptide linkages. For example, the linker may comprise a click functional group (such as an azide moiety) at one of its ends, for coupling to an alkynyl moiety on the linkage group or on a ligand via a click cycloaddition reaction. Functional groups for conjugation (e.g., click functional groups) can be incorporated into the ligand, linkage group or linker by methods known in the art.

[0137] The linker can be hydrolytically stable, i.e., the linker is substantially stable in water and does not react with water at useful pH values, including but not limited to, under physiological conditions for an extended period of time. The linker can be hydrolytically unstable, i.e., the linker is degradable in water or in aqueous solutions, including for example, blood. Linkers can be susceptible to cleavage (cleavable linker), such as, acid- induced cleavage, photo-induced cleavage, peptidase-induced cleavage, esterase-induced cleavage, and disulfide bond cleavage, at conditions under which the compound or the antibody remains active. In this regard, the linker can be a pro-charged linker (linker which will become charged after cell processing), a hydrophilic linker, or a dicarboxylic acid-based linker. Alternatively, linkers can be substantially resistant to cleavage (e.g., stable linker or non-cleavable linker).

[0138] Non-cleavable linkers are any chemical moiety capable of forming a stable, covalent linkage and does not fall off under the categories listed above for cleavable linkers. Thus, non- cleavable linkers are substantially resistant to acid-induced cleavage, photo-induced cleavage, peptidase-induced cleavage, esterase-induced cleavage and disulfide bond cleavage. Furthermore, non-cleavable refers to the ability of the chemical bond in the linker or adjoining the linker to withstand cleavage induced by an acid, photolabile-cleaving agent, a peptidase, an esterase, or a chemical or physiological compound that cleaves a disulphide bond, at conditions under which the ligand does not lose its activity.

[0139] Acid-labile linkers are linkers cleavable at acidic pH. For example, certain intracellular compartments, such as endosomes and lysosomes, have an acidic pH (pH 4-5), and provide conditions suitable to cleave acid-labile linkers.

[0140] Photo-labile linkers arc linkers that arc useful at the body surface and in many body cavities that are accessible to light. Furthermore, infrared light can penetrate tissue.

[0141] Some linkers can be cleaved by peptidases, i.e., peptidase cleavable linkers. Furthermore, peptides are composed of a-amino acids and peptide bonds, which chemically are amide bonds between the carboxylate of one amino acid and the amino group of a second amino acid. Other amide bonds, such as the bond between a carboxylate and the s-amino group of lysine, are understood not to be peptide bonds and are considered non-cleavable.

[0142] Some linkers can be cleaved by esterases, i.e., esterase cleavable linkers. Esters are formed by the condensation of a carboxylic acid and an alcohol. Simple esters are esters produced with simple alcohols, such as aliphatic alcohols, and small cyclic and small aromatic alcohols.

[0143] Pro-charged linkers are derived from charged cross-linking reagents that retain their charge after incorporation into an antibody drug conjugate.

[0144] The linker can be enzymatically unstable or degradable by one or more enzymes. By way of example only, polyethylene glycol (PEG) and related polymers may include degradable linkages in the polymer backbone or in the linker group between the polymer backbone and one or more of the terminal functional groups of the polymer molecule. Such degradable linkages include, but are not limited to, ester linkages formed by the reaction of PEG carboxylic acids or activated PEG carboxylic acids with alcohol groups on a biologically active agent, wherein such ester groups generally hydrolyze under physiological conditions to release the biologically active agent. Other hydrolytically degradable linkages include but are not limited to carbonate linkages; imine linkages resulting from reaction of an amine and an aldehyde; phosphate ester linkages formed by reacting an alcohol with a phosphate group; hydrazone linkages which are a reaction product of a hydrazide and an aldehyde; acetal linkages that are the reaction product of an aldehyde and an alcohol; orthoester linkages that are the reaction product of a formate and an alcohol; peptide linkages formed by an amine group, including but not limited to, at an end of a polymer such as PEG, and a carboxyl group of a peptide; and oligonucleotide linkages formed by a phosphoramiditc group, including but not limited to, at the end of a polymer, and a 5’ hydroxyl group of an oligonucleotide.

[0145] In some embodiments, the linker is selected from the group consisting of a cleavable linker, a non-cleavable linker, a hydrophilic linker, a pro-charged linker and a dicarboxylic acidbased linker. A linker herein may be a linear or branched (i.e., multi-armed) linker. In preferred embodiments, each chain in a linear or branched linker has a chain length of 1 to 50 atoms. Branched linkers may have 2-50 anus.

[0146] In some embodiments, the linker is a linear chain with a chain length of 1 to 50 atoms. For example, the linker may be a linear chain with a chain length of 1 to 45 atoms, 1 to 40 atoms, 1 to 35 atoms, 1 to 30 atoms, 1 to 25 atoms, 1 to 20 atoms, 1 to 15 atoms, 1 to 10 atoms, 1 to 8 atoms, 1 to 6 atoms, 1 to 5 atoms, or 1 to 3 atoms.

[0147] In some embodiments, the linker is a branched linker with 2 to 50 branch chains, with each branch chain having a chain length of 1 to 50 atoms. In some embodiments, the linker is a branched linker with 2 to 8 branch chains, with each branch chain having a chain length of 1 to 50 atoms. In some embodiments, the linker is a branched linker with 2 to 50 branch chains, with each branch chain having a chain length of 1 to 10 atoms. In some embodiments, the linker is a branched linker with 2 to 8 branch chains, with each branch chain having a chain length of 1 to 10 atoms.

[0148] Exemplary linkers include but are not limited to optionally substituted linear and branched chain alkyls and heteroalkyls with a chain length of 1 to 50 atoms. For example, linkers herein may be linear polyethylene glycol (PEG) or alkyl chains with a chain length of 1 to 50 atoms.

[0149] Ligand-conjugated linkage group

[0150] Disclosed herein is a compound of Formula (TV), or a salt, solvate or stereoisomer thereof: wherein Ri and R2 arc independently selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted silyl, optionally substituted acyl, and optionally substituted phosphoramidityl; Rj and R4 are independently selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted silyl, and optionally substituted acyl; L2 is an optionally substituted linker having a chain length of 1 to 50 atoms;

[0151] Lig is a ligand capable of binding to a cell surface antigen or receptor; and wherein at least one of Ri and R2 is optionally substituted phosphoramidityl.

[0152] In some embodiments, the compound is a compound of Formula (IV-i), (IV-ii), (IV-iii), (IV- iv), (IV-v) or (IV-vi), or a salt or solvate or stereoisomer thereof: wherein Ri and R2 are independently selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted silyl, optionally substituted acyl, and optionally substituted phosphoramidityl;

[0153] R3 and R4 are independently selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted silyl, and optionally substituted acyl; L2 is an optionally substituted linker having a chain length of 1 to 50 atoms;

[0154] Lig is a ligand capable of binding to a cell surface antigen or receptor; and wherein at least one of R1 and R2 is optionally substituted phosphoramidityl. In some embodiments, the compound is a compound of Formula (IV-iii) or (IV-iv), or a salt or solvate or stereoisomer thereof. In some embodiments, the compound is a compound of Formula (IV-v) or (IV-vi), or a salt or solvate or stereoisomer thereof.

[0155] In some embodiments, Ri is H or phosphoramidityl. In one embodiment, the phosphoramidityl

[0156] In some embodiments, R2 is H or a hydroxyl protecting group. In one embodiment, R2 is dimethoxytrityl (DMTr).

[0157] In some embodiments, R3 and R4 are protecting groups for a 1 ,2 diol. In some embodiments, R3 and R4 are both methyl.

[0158] In some embodiments, Re is H.

[0159] L2 may be an optionally substituted linear or branched (i.e., multi-armed) linker. Each chain may have a chain length of 1 to 50 atoms, such as 0 to 45 atoms, 0 to 40 atoms, 0 to 35 atoms, 0 to 30 atoms, 0 to 25 atoms, 0 to 20 atoms, 0 to 15 atoms, 0 to 10 atoms, 0 to 8 atoms, 0 to 6 atoms, 0 to 5 atoms, or 0 to 3 atoms. Branched linkers may have 2 to 50 arms.

[0160] In some embodiments, L2 is a lineal' chain with a chain length of 1 to 50 atoms. L2 may be a linear chain with a chain length of 0 to 45 atoms, 0 to 40 atoms, 0 to 35 atoms, 0 to 30 atoms, 0 to 25 atoms, 0 to 20 atoms, 0 to 15 atoms, 0 to 10 atoms, 0 to 8 atoms, 0 to 6 atoms, 0 to 5 atoms, or 0 to 3 atoms.

[0161] In some embodiments, L2 is a branched linker with 2 to 50 branch chains, with each branch chain having a chain length of 1 to 50 atoms. In some embodiments, L2 is a branched linker with 2 to 8 branch chains, with each branch chain having a chain length of 1 to 50 atoms. In some embodiments, L2 is a branched linker with 2 to 50 branch chains, with each branch chain having a chain length of 1 to 10 atoms. In some embodiments, L2 is a branched linker with 2 to 8 branch chains, with each branch chain having a chain length of 1 to 10 atoms. In some embodiments, L2 is an optionally substituted alkyl or heteroalkyl with a chain length of 1 to 50 atoms.

[0162] In some embodiments, L2 comprises ;wherein Re is selected from H, optionally substituted alkyl, and optionally substituted alkoxy; and n is an integer selected from 1 to 50.

[0163] In some embodiments, the compound is a compound of Formula (V), or a salt, solvate or wherein Ri and R2 are independently selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted silyl, optionally substituted acyl, and optionally substituted phosphoramidityl;

[0164] Rs and R4 are as disclosed herein;

[0165] R& is selected from H, optionally substituted alkyl, and optionally substituted alkoxy; n is an integer selected from 1 to 50; L3is an optionally substituted linker with a chain length from 1 to 50 atoms;

[0166] Lig is a ligand capable of binding to a cell surface antigen or receptor; and wherein at least one of Ri and R2 is optionally substituted phosphoramidityl.

[0167] In some embodiments, the compound is a compound of Formula (V-i), (V-ii), (V-iii), (V- iv), (V-v) or (V-vi), or a salt or solvate or stereoisomer thereof:

[0168] wherein Ri and R2 are independently selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted silyl, optionally substituted acyl, and optionally substituted phosphoramidityl;

[0169] R3 and R4 are as disclosed herein; Rs is selected from H, optionally substituted alkyl, and optionally substituted alkoxy; n is an integer selected from 1 to 50; L3is an optionally substituted linker with a chain length from 1 to 50 atoms;

[0170] Lig is a ligand capable of binding to a cell surface antigen or receptor; and wherein at least one of Ri and R2 is optionally substituted phosphoramidityl.

[0171] In some embodiments, the compound is a compound of Formula (V-iii) or (V-iv), or a salt or solvate or stereoisomer thereof. In some embodiments, the compound is a compound of Formula (V-v) or (V-vi), or a salt or solvate or stereoisomer thereof. Compounds of Formula (IV) and (V) may be formed from reacting a compound of Formula (II) or (III) with a azido-containing compound. L3may be an optionally substituted linear or branched (i.e., multi-armed) linker. Each chain may have a chain length of 1 to 50 atoms, such as 0 to 45 atoms, 0 to 40 atoms, 0 to 35 atoms, 0 to 30 atoms, 0 to 25 atoms, 0 to 20 atoms, 0 to 15 atoms, 0 to 10 atoms, 0 to 8 atoms, 0 to 6 atoms, 0 to 5 atoms, or 0 to 3 atoms. Branched linkers may have 2 to 50 arms.

[0172] In some embodiments, L3is a lineal' chain with a chain length of 1 to 50 atoms. L3may be a linear chain with a chain length of 0 to 45 atoms, 0 to 40 atoms, 0 to 35 atoms, 0 to 30 atoms, 0 to 25 atoms, 0 to 20 atoms, 0 to 15 atoms, 0 to 10 atoms, 0 to 8 atoms, 0 to 6 atoms, 0 to 5 atoms, or 0 to 3 atoms.

[0173] In some embodiments, L3is a branched linker with 2 to 50 branch chains, with each branch chain having a chain length of 1 to 50 atoms. In some embodiments, L3is a branched linker with 2 to 8 branch chains, with each branch chain having a chain length of 1 to 50 atoms. In some embodiments, L3is a branched linker with 2 to 50 branch chains, w'ith each branch chain having a chain length of 1 to 10 atoms. In some embodiments, L2 is a branched linker w'ith 2 to 8 branch chains, w'ith each branch chain having a chain length of 1 to 10 atoms.

[0174] In some embodiments, L3is an optionally substituted alkyl or heteroalkyl w ith a chain length of 1 to 50 atoms. By way of example, L3may be a polyethylene glycol (PEG) chain or an alkyl chain w'ith a chain length of 1 to 50 atoms.

[0175] In some embodiments, the compound is or a salt, solvate or stereoisomer thereof, w'herein Ri is H or phosphoramidityl;

[0176] R2 is H or a hydroxyl protecting group, such as dimethoxytrityl (DMTr); L3is an optionally substituted linker w'ith a chain length from 1 to 50 atoms;

[0177] Lig is a ligand capable of binding to a cell surface antigen or receptor; and n is an integer from 1 to 50.

[0178] In some embodiments, the compound is selected from wherein L3is an optionally substituted linker with a chain length from 1 to 50 atoms; and Lig is a ligand capable of binding to a cell surface antigen or receptor.

[0179] Oligomers with two or more linkage groups

[0180] Disclosed herein is an oligomer comprising two or more compounds as defined herein, wherein the two or more compounds are linked by an internucleoside linkage formed between Ri and R2 of adjacent compounds. The two or more compounds may be a compound of Formula (I), (II), (III), (IV) or (V).

[0181] One or more compounds in the oligomer may comprise a conjugated ligand. In one embodiment, the oligomer comprises at least one compound of Formula (IV) or (V). In one embodiment, all of the compounds in the oligomer are compounds of Formula (IV) or (V). As used herein, “internucleoside linkage” refers to a covalent linkage between adjacent nucleosides.

[0182] Suitable intemucleoside linkages include, but are not limited to, phosphodiesters, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3 ’-alkylene phosphonates, 5’-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3’-amino phosphoramidate and aminoalkylphosphoramidates, phosphorodiamidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, selenophosphates and boranophosphates having normal 3’-5’ linkages, 2’ -5’ linked analogues of these, and those having inverted polarity wherein one or more intemucleoside linkages is a 3 ’-3’, 5 ’-5’ or 2 ’-2’ linkage. Suitable oligonucleotides having inverted polarity comprise a single 3’-3’ linkage at the 3’-most intemucleoside linkage, i.e., a single inverted nucleoside residue which may be a basic (the nucleobase is missing or has a hydroxyl group in place thereof). Various salts (such as, for example, potassium or sodium), mixed salts and free acid forms are also included.

[0183] In some embodiments, the intemucleoside linkage comprises one or more phosphorothioate and / or hctcroatom intemucleoside linkages, in particular -CH2-NH-O-CH2-, - CH2-N(CH3)- O-CH2- (known as a methylene methylimino or MMI backbone), - CH2-O-N(CH3)- CH2-, - CH2-N(CH3)-N(CH3)-CH2- and -O-N(CH3)-CH3- CH2- (wherein the native phosphodiester linkage is represented as -O-P(=O)(OH)-O-CH2-). MMI type intemucleoside linkages are disclosed in the above referenced U.S. Pat. No. 5,489,677. Suitable amide intemucleoside linkages are disclosed in U.S. Pat. No. 5,602,240.

[0184] Also suitable arc intemucleoside linkages having morpholino backbone structures as described in, e.g., U.S. Pat. No. 5,034,506. For example, in some embodiments, the oligonucleotide may comprise a 6-membered morpholino ring in place of a ribose ring. In some of these embodiments, a phosphorodiamidate or other non- phosphodies ter intemucleoside linkage replaces a phosphodiester linkage.

[0185] Suitable modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that arc formed by short chain alkyl or cycloalkyl intemucleoside linkages, mixed heteroatom and alkyl or cycloalkyl intemucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulphide, sulphoxide and sulphone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; riboacetyl backbones; alkene containing backbones; sulphamate backbones; methyleneimino and methylenehydrazino backbones; sulphonate and sulphonamide backbones; amide backbones; and others having mixed N, O, S and CH2component parts.

[0186] Non-limiting examples of internucleoside linkages include: -O-P(O)2-O-, -O-P(O,S)-O-, - O-P(S)2-O-, -S-P(O)2-O-, -S-P(O,S)-O-, -S-P(S)2-O-, -O-P(O)2-S-, -O-P(O,S)- S-, -S-P(O)2- S-, -O-PO(RH)-O-, O-PO(OCH3)-O-, -O-PO(NRH)-O-, -O-PO(OCH2CH2S-R)-O-, -O- PO(BH3)-O-, -O-PO(NHRII)-O-, -O-P(O)2-NRII-, -NRII-P(O)2-O-, -NRII-CO-O-, -NRII-CO- NRH-, -O-CO-O-, -O-CO-NR11-, -NRH-CO-CH2-, -O-CH2-CO-NRH-, -O-CH2-CH2-NR11-, - CO-NRH-CH2-, -CH2-NRH-CO-, -O-CH2-CH2-S-, -S-CH2-CH2-O-, -S-CH2-CH2-S-, -CH2- SO2-CH2-, -CH2-CO-NRH-, -O-CH2- CH2-NRH-CO-, -CH2-NCH3-O-CH2-, where RHis selected from hydrogen and C1-4-alkyl.

[0187] In some embodiments, the oligomer comprises two or more compounds of Formula (I) linked by an intcrnuclcosidc linkage, such as two or more compounds of Formula (I-i), Formula (I-ii), Formula (I-iii), Formula (I-iv), Formula (I-v) or Formula (I-vi).

[0188] In some embodiments, the oligomer comprises two or more compounds of Formula (II) linked by an internucleoside linkage, such as two or more compounds of Formula (Il-i), Formula (Il-ii), Formula (11-iii), Formula (11-iv), Formula (11-v) or Formula (11- vi).

[0189] In some embodiments, the oligomer comprises two or more compounds of Formula (III) linked by an intemucleoside linkage, such as two or more compounds of Formula (Ill-i), Formula (Ill-ii), Formula (III-iii), Formula (Ill-iv), Formula (III- v) or Formula (III- vi).

[0190] In some embodiments, the oligomer comprises two or more compounds of Formula (IV) linked by an intemucleoside linkage, such as two or more compounds of Formula (IV-i), Formula (IV-ii), Formula (IV-iii), Formula (IV-iv), Formula (IV-v) or Formula (IV-vi). In some embodiments, the oligomer comprises two or more compounds of Formula (V) linked by an internucleoside linkage, such as two or more compounds of Formula (V-i), Formula (V-ii), Formula (V-iii), Formula (V-iv), Formula (V-v) or Formula (V-vi).

[0191] In some embodiments, the oligomer comprises two or more compounds independently selected from a compound of Formula (I-i), (Il-i), (Ill-i), (IV-i) and (V-i), wherein the two or more compounds are linked by an internucleoside linkage.

[0192] In some embodiments, the oligomer comprises two or more compounds independently selected from a compound of Formula (1-ii), (Il-ii), (Ill-ii), (IV-ii) and (V-ii), wherein the two or more compounds are linked by an intemucleoside linkage.

[0193] In some embodiments, the oligomer comprises two or more compounds independently selected from a compound of Formula (I-iii), (II-iii), (III-iii), (IV-iii) and (V-iii), wherein the two or more compounds are linked by an internucleoside linkage.

[0194] In some embodiments, the oligomer comprises two or more compounds independently selected from a compound of Formula (I-iv), (Il-iv), (Ill-iv), (IV-iv) and (V-iv), wherein the two or more compounds arc linked by an intemucleoside linkage.

[0195] In some embodiments, the oligomer comprises two or more compounds independently selected from a compound of Formula (I-v), (II-v), (TTI-v), (IV-v) and (V-v), wherein the two or more compounds are linked by an internucleoside linkage.

[0196] In some embodiments, the oligomer comprises two or more compounds independently selected from a compound of Formula (I-vi), (II- vi), (Ill-vi), (IV-vi) and (V-vi), wherein the two or more compounds are linked by an intemucleoside linkage.

[0197] The intemucleoside linkage may comprise a phosphodiester or phosphothioate moiety, or a derivative thereof.

[0198] For example, a dimer comprising two compounds of Formula (III-v) linked by a phosphodicstcr bond may be:

[0199] A dimer comprising two compounds of Formula (V-v) linked by a phosphorothioate bond may be, for example:

[0200] In some embodiments, the oligomer comprises a ligand selected from acetylcholine, N- acetylgalactosamine (GalNAc), N-acetylglucosamine (GlcNAc), acetyl-glyceryl-ether- phosphorylcholine (AGEPC), N-acetylserotonin, adenosine, adrenaline, agmatine, gamma- aminobutyric acid (GAMA), anandamide, anisamide, N-arachidonoyl dopamine (NADA), 2-arachidonoylglyccrol, biotin (vitamin B7), calcitonin, carbachol, chcnodcoxycholic acid, cholesterol, cholic acid, deoxycholic acid, dopamine, epigallocatechin-3 -gallate (EGCG), estrone, fatty acid, folic acid, glutamic acid, glycocholic acid, histamine, 6- hydroxymelatonin, lithocholic acid, melatonin, N-methyltyramine (NMT), niacin (vitamin B3), norepinephrine, meta-octopamine, para-octopamine, oxytocin, phenylethanolamine, prostacyclin, prostaglandin, putrescine, riboflavin (vitamin B2), serotonin, squalene, taurocholic acid, thiamin (vitamin Bl), thromboxane, tocopherol, vasopressin, virodhamine, and derivatives thereof. In one embodiment, the oligomer comprises GalNAc or a derivative thereof.

[0201] Oligonucleotide conjugates

[0202] Disclosed herein is an oligonucleotide conjugate, comprising: a) a compound or an oligomer as defined herein; and b) an oligonucleotide, wherein the compound or oligomer is linked to the oligonucleotide by an intemucleoside linkage formed between Ri or R2 of the compound or oligomer and the oligonucleotide. The compound may be a compound of Formula (I), (11), (111), (IV) or (V).

[0203] Suitable intemucleoside linkages include, but arc not limited to, phosphodicstcrs, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3 ’-alkylene phosphonates, 5’-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3’-amino phosphoramidate and aminoalkylphosphoramidates, phosphorodiamidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, selenophosphates and boranophosphates having normal 3’-5’ linkages, 2’ -5’ linked analogues of these, and those having inverted polarity wherein one or more intemucleoside linkages is a 3 ’-3’, 5 ’-5’ or 2 ’-2’ linkage. Suitable oligonucleotides having inverted polarity comprise a single 3 ’-3’ linkage at the 3 ’-most intemucleoside linkage, i.e., a single inverted nucleoside residue which may be a basic (the nucleobase is missing or has a hydroxyl group in place thereof). Various salts (such as, for example, potassium or sodium), mixed salts and free acid forms are also included.

[0204] In some embodiments, the intemucleoside linkages comprises one or more phosphorothioatc and / or heteroatom intemucleoside linkages, in particular -CH2-NH-O-CH2-, -CH2-N(CH3)- O-CH2- (known as a methylene (methylimino) or MMI backbone), -CH2-O-N(CH3)-CH2-, - CH2-N(CH3)-N(CH3)-CH2- and -O-N(CH3)-CH2-CH2- (wherein the native phosphodiester linkage is represented as -O-P(=O)(OH)-O-CH2-). MMI type intemucleoside linkages axe disclosed in the above referenced U.S. Pat. No. 5,489,677. Suitable amide intemucleoside linkages are disclosed in U.S. Pat. No. 5,602,240. Also suitable are linkages having morpholino backbone structures as described in, e.g., U.S. Pat. No. 5,034,506. For example, in some embodiments, the oligonucleotide may comprise a 6-membered morpholino ring in place of a ribose ring. In some of these embodiments, a phosphorodiamidate or other non-phosphodie ster intemucleoside linkage replaces a phosphodiester linkage.

[0205] Suitable modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl intemucleoside linkages, mixed heteroatom and alkyl or cycloalkyl intemucleoside linkages, or one or more short chain heteroatomic or heterocyclic intemucleoside linkages. These include those having morpholino linkages (formed in pail from the sugar' portion of a nucleoside); siloxane backbones; sulphide, sulphoxide and sulphone backbones; formacctyl and thioformacctyl backbones; methylene formacetyl and thioformacctyl backbones; riboacetyl backbones; alkene containing backbones; sulphamate backbones; methyleneimino and methylenehydrazino backbones; sulphonate and sulphonamide backbones; amide backbones; and others having mixed N, O, S and CH2component parts.

[0206] Non-limiting examples of internucleoside linkages include: -O-P(O)2-O-, -O-P(O,S)-O-, - O-P(S)2-O-, -S-P(O)2-O-, -S-P(O,S)-O-, -S-P(S)2-O-, -O-P(O)2-S-, -O-P(O,S)- S-, -S-P(O)2- S-, -O-PO(RH)-O-, O-PO(OCH3)-O-, -O-PO(NRH)-O-, -O-PO(OCH2CH2S-R)-O-, -O- PO(BHr)-O-, -O-PO(NHRH)-O-, -O-P(O)2-NRH-, -NRH-P(O)2-O-, -NRH-CO-O-, -NRH-CO- NRH-, -O-CO-O-, -O-CO-NR11-, -NRH-CO-CH2-, -O-CH2-CO-NRH-, -O-CH2-CH2-NR11-, - CO-NRH-CH2-, -CH2-NRH-CO-, -O-CH2-CH2-S-, -S-CH2-CH2-O-, -S-CH2-CH2-S-, -CH2- SO2-CH2-, -CH2-CO-NRH-, -O-CH2-CH2-NRH-CO-, -CH2-NCH3-O-CH2-, where RHis selected from hydrogen and Ci-4-alkyl.

[0207] The compound in the conjugate may be a compound of Formula (I-i), (I-ii), (I-iii), (I-iv), (I- v), (I-vi), (Il-i), (Il-ii), (II-iii), (Il-iv), (II-v), (Il-vi), (Ill-i), (Ill-ii), (III-iii), (Ill-iv), (III-v), (TTT-vi), (IV-i), (TV-ii), (TV-iii), (IV-iv), (IV-iv), (IV-iv), (V-i), (V-ii), (V-iii), (V-iv), (V-v) or (V-iv). In some embodiments, the one or more compounds is a compound of Formula (V), such as a compound of Formula (V-i), (V-ii), (V-iii), (V-iv), (V-v) or (V-vi).

[0208] In some embodiments, the oligonucleotide conjugate comprises two or more compounds independently selected from a compound of Formula (I), (II), (III), (IV) and (V). The two or more compounds may be linked to form an oligomer as defined herein. In some embodiments, the two or more compounds are compounds of Formula (V), such as compounds of Formula (V-i), (V-ii), (V-iii), (V-iv), (V-v) or (V-vi).

[0209] In some embodiments, the oligonucleotide conjugate comprises an oligomer that contains at least one compound of Formula (IV) or (V), such as at least one compound of Formula (IV- i), (IV-ii), (IV-iii), (IV-iv), (IV-v), (IV-vi), (V-i), (V-ii), (V-iii), (V-iv), (V-v) or (V-vi). In some embodiments, the oligonucleotide conjugate comprises an oligomer, and all of the compounds in the oligomer are compounds of Formula (IV) or (V), such as compounds of Formula (IV-i), (IV-ii), (IV-iii), (IV-iv), (IV-v), (IV-vi), (V-i), (V-ii), (V-iii), (V-iv), (V-v) or (V-vi).

[0210] In some embodiments, the oligonucleotide conjugate comprises a ligand selected from acetylcholine, N-acetylgalactosamine (GalNAc), N-acetylglucosamine (GlcNAc), acetyl- glyceryl-ether-phosphorylcholine (AGEPC), N-acetylserotonin, adenosine, adrenaline, agmatine, gamma-aminobutyric acid (GAMA), anandamide, anisamide, N-arachidonoyl dopamine (NADA), 2-arachidonoylglycerol, biotin (vitamin B7), calcitonin, carbachol, chenodeoxycholic acid, cholesterol, cholic acid, deoxycholic acid, dopamine, cpigallocatcchin-3-gallatc (EGCG), estrone, fatty acid, folic acid, glutamic acid, glycocholic acid, histamine, 6-hydroxymelatonin, lithocholic acid, melatonin, N-methyltyramine (NMT), niacin (vitamin B3), norepinephrine, meta-octopamine, para-octopamine, oxytocin, phenylethanolamine, prostacyclin, prostaglandin, putrescine, riboflavin (vitamin B2), serotonin, squalene, taurocholic acid, thiamin (vitamin Bl), thromboxane, tocopherol, vasopressin, virodhamine, and derivatives thereof.

[0211] In one embodiment, the oligonucleotide conjugate comprises GalNAc or a derivative thereof.

[0212] In some embodiments, the compound or oligomer is linked to the 5’ or 3’ end of the oligonucleotide. The compound or oligomer may be linked to the 5’ end of the oligonucleotide via the 3 ’-OH of the ribose-like backbone of the compound or oligomer. The compound or oligomer may be linked to the 3’ end of the oligonucleotide via the 6’-OH of the ribose-like backbone of the compound or oligomer. The skilled person will appreciate that conventional phosphoramiditc chemistry may be used to link the compound or oligomer to the oligonucleotide. The oligonucleotide may be a single- or double- stranded nucleic acid, and may comprise ribonucleotides, deoxyribonucleotides, or a combination thereof. In one embodiment, the oligonucleotide is a double- stranded oligonucleotide. The compound or oligomer may be linked to one or both of the 5’ ends of the double- stranded oligonucleotide, or to one or both of the 3’ ends of the double-stranded oligonucleotide. In one embodiment, the oligonucleotide is a single-stranded oligonucleotide. The compound or oligomer may be linked to one or both of the 5’ and 3’ ends of the single-stranded oligonucleotide.

[0213] The oligonucleotide may have a length of 10-100 nucleotides, such as a length of 10-50 nucleotides, 10-40 nucleotides, 10-30 nucleotides, or 10-20 nucleotides.

[0214] In some embodiments, the oligonucleotide is a therapeutic nucleic acid. In some embodiments, the oligonucleotide is a small interfering RNA (siRNA), a short hairpin RNA (shRNA), a microRNA, or an antisense oligonucleotide (ASO). In some embodiments, the oligonucleotide is an antisense oligonucleotide (ASO), and the ASO is a RNascH-activating gapmer or a steric blocking oligonucleotide e.g. a splice-switching oligonucleotide (SSO).

[0215] As used herein, the term “antisense oligonucleotide (ASO)” refers to an oligonucleotide having sufficient sequence complementarity to a target nucleic acid molecule to which it hybridises so as to modulate (i.e., increase or decrease) the level of or expression from the target nucleic acid. ASOs can mediate a range of gene regulatory mechanisms from transcript cleavage and degradation, splice-switching to translational repression or activation. ASOs can be broadly divided into steric block or RNase H-competent.

[0216] Steric block ASOs mask specific sequences within a target nucleic acid, thus interfering with interactions of the nucleic acid with other biomolecules and / or cellular machinery. For example, an ASO may bind to the 5 ’-untranslated region (5’-UTR) of a target mRNA and repress protein synthesis by interfering with the formation of the translation initiation complex. ASOs targeted to the 3’-UTR can bias the selection of polyadenylation sites and alter the length and stability of an mRNA transcript. Masking of splicing factor binding by steric block ASOs leads to splice switching which may include or exclude specific exons from a mature mRNA, retain specific introns in the mRNA, or give rise to alternative usage of splice sites. Gapmer ASOs comprise a central “gap” region of unmodified DNA flanked by modified nucleosides that are typically modified RNAs. Binding of the gap region to target RNA activates RNase H-mediated degradation of the target RNA, resulting in target gene product reduction. The modified nucleosides confer enhanced nuclease resistance and increased hybridisation affinity. Additional stability and base-pairing specificity could be introduced by including locked nucleic acid (LNA) or bridged nucleic acid (BNA) resides at the flanks, both of which are bicyclic residues containing a bridge bond between the 2’ oxygen and the 4’ carbon of the nucleoside ribose. Phosphodiester bonds between nucleosides can be replaced with phosphorothioate (PS) linkages to further increase nuclease resistance.

[0217] As used herein, the term “splice switching oligonucleotide (SSO)” refers to an ASO which disrupts the splicing process by sterically blocking RNA-RNA base-pairing or protein-RNA binding interactions that occur between components of the splicing machinery and the pre- mRNA. Splice switching by SSOs can be used to either rescue or disrupt gene expression. SSOs can be used to correct aberrant splicing and thereby restore normal protein expression, induce alternative splicing, or produce novel splice variants. Unlike siRNA or miRNA that use the endogenous RNA interference pathway to inhibit the expression of a gene, SSOs can induce aberrant splicing to generate premature termination codons in the target mature transcripts that are then degraded via the nonsense mediated decay pathway.

[0218] The SSO may be a mixmer. The term “mixmer” refers to an oligonucleotide comprising chemical modifications to its sugar moieties, backbone linkages, or both. Examples of chemical modifications include phosphorothioate linkages, 2’-O-methyl RNA modifications, 2’-O-methoxyethyl modifications and locked nucleic acid (LNA) substitutions. Mixmcrs typically contain a combination of unmodified and modified nucleosides, and may contain nucleosides with different chemical modifications (such as a mixture of 2’-O-methyl-modified nucleosides and locked nucleic acids). The chemical modifications may increase the efficacy, selectivity and stability and / or reduce the toxicity of the SSO.

[0219] In some embodiments, the oligonucleotide comprises a nucleic acid sequence having at least 70% sequence identity to a nucleic acid sequence of SEQ ID NO: 1-3. Disclosed herein is a pharmaceutical composition comprising an oligonucleotide conjugate as defined herein and a pharmaceutically acceptable carrier.

[0220] The pharmaceutically acceptable carrier may be a polymer-based carrier system such as a cationic polymer-nucleic acid complex (i.e., polyplex). The carrier may be a cyclodextrin- based carrier system such as a cyclodextrin polymer-nucleic acid complex. The carrier may be a protein-based carrier system such as a cationic peptide-nucleic acid complex. The carrier may be a lipid-based carrier system, including but not limited to micelles, liposomes, cationic lipid-nucleic acid complexes (i.e., lipoplexes), lipid nanoparticles (LNPs), virosomes and extracellular vesicles such as exosomes.

[0221] The composition may additionally comprise a pharmaceutically acceptable excipient. Such an excipient may be any organic or inorganic carrier substance suitable for administration which does not deleteriously react with the oligonucleotide conjugate. Suitable pharmaceutically acceptable excipients include, but are not limited to, water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.

[0222] Nucleic acid sequence of exemplary oligonucleotides

[0223] SS01: AUGACAGGCAUUCUCAUCA (SEQ ID NO: 1)

[0224] SS02: ATGACAGGCAUUCUCATCA (SEQ ID NO: 2)

[0225] SSO3: UTTGUAUGCUCCAGUGUUCUC (SEQ ID NO: 3)

[0226] AVA1: GTCCAGAGCTTTCATTCTGT (SEQ ID NO: 4)

[0227] SS01, SS02 and SS03 are mixmers containing locked nucleic acids (underlined residues) and cither 2’-O-mcthyl or 2’-O-mcthoxycthyl modifications (non-undcrlincd residues).

[0228] Methods of use

[0229] Disclosed herein is an oligonucleotide conjugate or a pharmaceutical composition as defined herein, for use as a medicament. Disclosed herein is the use of an oligonucleotide conjugate or a pharmaceutical composition as defined herein for delivering an oligonucleotide to a cell. The compound or ligand- conjugated linkage group may thus serve as a delivery agent for the oligonucleotide.

[0230] Disclosed herein is a method of delivering an oligonucleotide to a cell, the method comprising contacting the cell with an oligonucleotide conjugate or a pharmaceutical composition as defined herein.

[0231] Disclosed herein is a method of delivering an oligonucleotide to a cell, the method comprising conjugating an oligonucleotide to a compound of Formula (1), (11), (111), (IV) or (V) to form an oligonucleotide conjugate, and contacting the cell with the oligonucleotide conjugate.

[0232] Disclosed herein is a method of modulating protein expression or function in a cell, the method comprising contacting the cell with an oligonucleotide conjugate or a pharmaceutical composition as defined herein.

[0233] The oligonucleotide conjugate preferably comprises a compound with an attached ligand, such as a compound of Formula (IV) or (V). The ligand may be a ligand as described herein.

[0234] In some embodiments, the oligonucleotide conjugate comprises a ligand selected from acetylcholine, N-acetylgalactosamine (GalNAc), N-acetylglucosamine (GlcNAc), acetyl- glyceryl-ether-phosphorylcholine (AGEPC), N-acetylserotonin, adenosine, adrenaline, agmatine, gamma-aminobutyric acid (GAMA), anandamide, anisamide, N-arachidonoyl dopamine (NADA), 2-arachidonoylglycerol, biotin (vitamin B7), calcitonin, carbachol, chcnodcoxycholic acid, cholesterol, cholic acid, dcoxycholic acid, dopamine, epigallocatechin-3-gallate (EGCG), estrone, fatty acid, folic acid, glutamic acid, glycocholic acid, histamine, 6-hydroxymelatonin, lithocholic acid, melatonin, N-methyltyramine (NMT), niacin (vitamin B3), norepinephrine, meta-octopamine, yrara-octopamine, oxytocin, phenylethanolamine, prostacyclin, prostaglandin, putrescine, riboflavin (vitamin B2), serotonin, squalene, taurocholic acid, thiamin (vitamin Bl), thromboxane, tocopherol, vasopressin, virodhamine, and derivatives thereof. In some embodiments, the oligonucleotide conjugate comprises a GalNAc ligand or a derivative thereof. In some embodiments, the method is an in vitro method, i.e., contacting of the cell with the oligonucleotide conjugate, a conjugate comprising a linkage group as disclosed herein or pharmaceutical composition occurs in vitro. In vitro contacting can be conducted in any suitable manner. For example, the cell may be treated in adherent culture, or in suspension culture.

[0235] In some embodiments, the method is an in vivo method, i.e., contacting of the cell with the oligonucleotide conjugate, a conjugate comprising a linkage group as disclosed herein or pharmaceutical composition occurs in vivo. In vivo contacting may be performed by administering the oligonucleotide conjugate or pharmaceutical composition to a subject or tissue containing the cell.

[0236] In one embodiment, modulating protein expression or function comprises reducing or inhibiting protein expression or function. In one embodiment, modulating protein expression or function comprises increasing protein expression or function.

[0237] In some embodiments, the cell is one that expresses a cell surface receptor or antigen that binds to the ligand in the oligonucleotide conjugate. In some embodiments, the cell is one that expresses a cell surface receptor or antigen that binds to GalNAc or a derivative thereof. In some embodiments, the cell is one that expresses the asialoglycoprotein receptor (ASPGR). In some embodiments, the cell is a liver or kidney cell.

[0238] Disclosed herein is a method of treating or preventing a disease or disorder in a subject, the method comprising administering a therapeutically effective amount of an oligonucleotide conjugate or pharmaceutical composition as defined herein to the subject.

[0239] The disease or disorder may be a metabolic, proliferative, neurodegenerative, autoimmune, inflammatory, haematological, cardiovascular, or infectious disease or disorder. The disease or disorder may be a disease or disorder of any cell, tissue, organ or system, such as a disease or disorder of the liver, kidney, pancreas, blood, heart, brain, lungs, bladder, skin, muscle, bones, cartilage, eye, nose, tongue, ear, vascular system, gastrointestinal system, nervous system, endocrine system, reproductive system, or immune system. In some embodiments, the disease or disorder is a liver disease or disorder, non-limiting examples of which include hepatitis (e.g., hepatitis A, hepatitis B, hepatitis, C, hepatitis D or hepatitis E), fatty liver disease, liver cancer (such as hepatocellular carcinoma), and genetic liver diseases or disorders (e,g., hemochromatosis, alpha- 1 antitrypsin deficiency, Wilson disease, Gilbert syndrome, Alagille syndrome, and congenital hepatic fibrosis).

[0240] In some embodiments, the disease or disorder is a kidney disease or disorder, non-limiting examples of which include glomerulonephritis and genetic kidney diseases or disorders (e,g., Alport syndrome, Fabry disease, Gitelman syndrome, Goodpasture syndrome, polycystic kidney disease, thin basement membrane disease, focal segmental glomerulosclerosis, nephronophthisis, cystinosis, and tuberous sclerosis).

[0241] In some embodiments, the disease or disorder is a metabolic disease or disorder. In one embodiment, the metabolic disorder is a citrin deficiency disorder. In one embodiment, the metabolic disease is an ornithine transcarbamylase (OTC) deficiency disorder.

[0242] Disclosed herein is an oligonucleotide conjugate or pharmaceutical composition as defined herein, for use in treating or preventing a disease or disorder in a subject.

[0243] Disclosed herein is the use of an oligonucleotide conjugate or pharmaceutical composition as defined herein in the manufacture of a medicament for treating or preventing a disease or disorder in a subject.

[0244] The reference in this specification to any prior publication (or information derived from it), or to any matter which is known, is not, and should not be taken as an acknowledgment or admission or any form of suggestion that that prior publication (or information derived from it) or known matter forms part of the common general knowledge in the field of endeavour to which this specification relates.

[0245] Those skilled in the ait will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications, which fall within the spirit and scope. The invention also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any two or more of said steps or features.

[0246] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0247] Certain embodiments of the invention will now be described with reference to the following examples which are intended for the purpose of illustration only and are not intended to limit the scope of the generality hereinbefore described.

[0248] EXAMPLES

[0249] Example 1: Synthesis of GalNAc-linker group

[0250] As a popular ligand, the targeting ability of GalNAc arises from its identity as an endogenous ligand for asialoglycoprotein receptors (ASGPRs). Ligand-receptor interactions between GalNAc and ASGPR can help to localize GalNAc-conjugated oligonucleotides to ASGPRs- cxprcssing target cells and facilitate cndocytic uptake. Notably, hepatocytes express these receptors abundantly, making them suitable targets for GalNAc-oligonucleotide conjugates. Given their ability to recognize and attach to ASGPR proteins, specific delivery of therapeutic GalNAc-oligonucleotide conjugates to liver cells can be achieved, while minimizing interactions with non-ASGPR-expressing cells in the liver. This would both increase treatment efficacy and reduce side effects associated with high dosages and nonspecific cellular uptake.

[0251] Besides GalNAc, a complete GalNAc ligand-linker reagent also consists of a linkage group and a linker. The linkage group forms the covalent bond between the conjugate and the oligonucleotide. A flexible functional group known as the linker joins the linkage group to GalNAc and positions GalNAc for interaction with the ASGPRs.

[0252] In each ligand-linker reagent, there can be single or multiple ligand molecules. In general, monovalent and triantennary arc the two categories that have been developed. The triantennary reagent can introduce three GalNAc in a single conjugation, but it usually requires a long synthetic route (Formula A of Figure 1). In contrast, monomeric reagent can be prepared more efficiently, and incorporation of more than one GalNAc can be achieved by serial conjugation, via solid-support synthesis for example. Examples of existing monomeric linkage groups are provided in Formula B and C of Figure 1.

[0253] The- state-of-the-art chemistry used in the conjugation reaction onto oligonucleotide is phosphoramidite paired with DMTr protected hydroxy group (Formula B-D). With these two functional groups, ligand-linker reagents will be compatible with the solid support synthesis of oligos, and multiple GalNAc conjugation is also feasible. Other type of chemistry is also available, such as pentafluorophenyl (PFP) ester (Formula A). In this case the oligos should be modified with an amine-terminated functional group prior to the conjugation, and only single coupling is possible.

[0254] The linkage group positioned opposite to the GalNAc is usually considered unless only 5’ conjugation is pursued. L-hydroxyprolinol has been used as a linkage group as the preexistence of both primary OH and secondary OH can fulfil the requirement of DMTr and phosphoramidite installation, respectively. Furthermore, the defined chirality of the molecule will lead to enantiopure product after the conjugation with oligos (Figure IB). A uridinc-likc skeleton has also been used as a linkage group, which can also meet the above- mentioned requirement (Formula C), but as the nucleoside-mimic reagent share similar structures with its natural counterpart, there would be potential interference with the therapeutic domain.

[0255] Based on the above consideration, a monomeric reagent was synthesised using phosphoramidite chemistry, as this option provides an efficient synthesis and sufficient flexibility. For the linkage group, a ribosc-likc structure was chosen, which has the same advantages as structures with Formula B and C. More importantly, without the presence of any base-like moieties, the chance of interference with therapeutic domain can be avoided (Formula D).

[0256] Synthesis of the linker group is shown in Fig. 2. The synthesis of the ribose-like linker group started with the commercially available 1,2:5, 6-di-O-isopropylidene-a-D-allofuranose 1, the core structure of which shares high resemblance with ribose. The secondary -OH group in 1 was first protected by t-BuPl Si-, which is stable under the acidic condition that would be used for the deprotection of acetonide preinstalled for 5,6-hydroxyl group protection. The 6- OH of 3 was then protected by DMTr, with TEA as the base and DMAP as the catalyst, and undesired reaction on the secondary -OH was not observed under this condition. The alkylation reaction between 4 and propargyl bromide can be greatly accelerated by catalytic amounts of TBAI to afford intermediate 5, which was then refluxed with TBAF in THF to afford 6 bearing a terminal alkynyl for click chemistry and a free secondary -OH for the installation of phosphoramidite.

[0257] The ligand GalNAc was first protected and transformed to oxazoline 9 before it was introduced to one end of the linker 10; the reaction took place in the presence of the Lewis acid TMSOTf and molecular sieves. A click reaction was then performed using C11SO4 and sodium ascorbate (NaAsc) to conjugate 11 to 6, which gave excellent yield and regioselectivity. The last step was installation of phosphoramidite, which was achieved by the reaction of 12 with 2-cyanoethyl N,N-diisopropylchlorophosphoramidite. The final ligand-linker reagent could be purified by precipitation and used in solid-support oligo synthesiser for the conjugation of oligos for both 3’ and 5’ end modification.

[0258] Synthesis of 4

[0259] To a round-bottom flask (RBF) containing 3 (3.0 g, 6.5 mmol, 1 eq), DMAP (80 mg, 0.6 mmol, 0.1 eq) and distilled CH2CI2 (25 mL) was added with a stirring bar and the RBF was connected to N2 balloon. TEA (1.7 mL, 11.8 mmol, 1.8 eq) was added subsequently. DMTr- C1 (2.4 g, 7.2 mmol, 1.1 eq) was added in portions at 0°C. The reaction flask was then left to stir overnight. The reaction was monitored by using TLC (Hex / EA 5:1, the reaction mixture was dissolved in DCM). Upon completion, the reaction mixture was washed with distilled water, saturated sodium bicarbonate and lastly saturated sodium chloride. Na2.SOi was added to remove water, and filtration was done to remove Na2SO4 before concentrating via rotary evaporator. The crude product was then purified by silica gel column chromatography to afford 4 as white foam (4.67 g, yield: 93%).1H NMR (400 MHz, DMSO- d6): 5 7.65-7.59 (m, 4H), 7.46-7.18 (m, 15H), 6.82-6.76 (m, 4H), 5.37 (d, .1 = 3.75 Hz, 1H), 5.19 (d, J = 4.75 Hz, 1H), 4.15 (dd, J = 8.44, 4.44 Hz, 1H), 4.00 (dd, J = 8.69, 1.44 Hz, 1H), 3.94 (q, J = 5.42 Hz, 1H), 3.70 (s, 3H), 3.70 (s, 3H), 3.59 (t, J = 4.06 Hz, 1H), 3.19 (dd, J = 9.44, 7.32 Hz, 1H), 2.99 (dd, J = 9.38, 5.00 Hz, 1H), 1.39 (s, 3H), 1.00 (s, 3H), 0.89 (s, 9H).

[0260] Synthesis of 5 A RBF containing 4 (4.67 g, 6.1 mmol, 1 eq) and distilled THF (24 mL) was cooled to -10 °C. Next, NaH (306 mg, 7.7 mmol, 1.25 eq) was added in portions. After 2 hours, TBA1 (1.13 g, 3.1 mmol, 0.5 eq) and propargyl bromide (0.557 mL, 1.2 eq) were added at -5 °C. The reaction was completed in 2 h, and the reaction mixture was washed with distilled water, saturated sodium bicarbonate, and saturated sodium chloride. Na2SO4was added to remove water, and filtration was performed to remove Na2SO4before concentrating via rotary evaporator. The crude product was then purified by silica gel column chromatography to afford 5 as a white foam (4.85 g, yield: 99%).1H NMR (400 MHz, DMSO-d6): 5 7.50-7.33 (m, 10H), 7.22-7.14 (m, 5H), 7.04-6.99 (m, 4H), 6.79-6.74 (m, 4H), 5.49 (d, J = 3.75 Hz, 1H), 4.72 (t, J = 4.00 Hz, 1H), 4.24-4.19 (m, 2H), 4.12-3.98 (m, 3H), 3.72 (s, 3H), 3.71 (s, 3H), 3.43 (t, J = 2.38 Hz, 1H), 3.16 (dd, J = 9.26, 7.38 Hz, 1H), 3.02 (dd, J = 9.26, 6.13 Hz, 1H), 1.42 (s, 3H), 1.27 (s, 3H), 0.92 (s, 9H).

[0261] Synthesis of 6

[0262] Distilled THF (80 mL) and TBAF (1 M, 13.8 mL, 2.3 eq) were added to an RBF containing 5 (4.85 g, 6.0 mmol, 1 eq), and the reaction was refluxed for 2 hours. The reaction was monitored using TLC (Hex / EA 4:1). Upon completion, the reaction mixture was dissolved in ethyl acetate and washed with distilled water, saturated sodium bicarbonate, and saturated sodium chloride. Na2SO4was added to remove water, and filtration was performed to remove Na2SO4before concentrating via rotary evaporator. The crude product was then purified by silica gel column chromatography to afford 6 as a white foam (2.3 g, yield: 68%).1H NMR (400 MHz, DMSO-d6): 8 7.42-7.19 (m, 9H), 6.90-6.86 (m, 4H), 5.66 (d, J = 3.75 Hz, 1H), 5.08 (d, J = 4.88 Hz, 1H), 4.64 (t, J = 3.88 Hz, 1H), 4.15 (dd, J = 15.8, 2.44 Hz, 1H), 4.04-3.91 (m, 3H), 3.88-3.83 (m, 1H), 3.73 (s, 6H), 3.33 (t, J = 2.38 Hz, 1H), 3.02 (dd, J = 9.13, 6.63 Hz, 1H), 2.94 (dd, J = 9.26, 5.75 Hz, 1H), 1.43 (s, 3H), 1.26 (s, 3H).

[0263] Synthesis of 11

[0264] To an RBF containing 9 (14.36 g, 43.6 mmol, 1 eq), 10 (9.7 g, 56.7 mmol, 1.3 eq) and distilled DCM (200 mL) was added with activated molecular sieves (20 g). The RBF was allowed to cool down to 0°C and then TMSOTf (4.0 mL, 21.8 mmol, 0.5 eq) was added dropwise, and RBF was left to react overnight. The reaction was monitored using TLC (100% EA, stain with PMA). The molecular sieve was removed with filtration, and the resulting mixture was extracted with water, saturated sodium carbonate, and saturated sodium chloride before it as dried over anhydrous Na2SO4. After filtration, the resulting mixture was concentrated via rotary evaporator. The crude product was subsequently purified by silica gel column chromatography to afford 11 as a yellowish gel (16.6g, yield: 76%). H NMR (400 MHz, DMS0-&): 5 7.82 (d, J = 9.13 Hz, 1H), 5.21 (d, J = 3.38 Hz, 1H), 4.96 (dd, J = 11.19, 3.31 Hz, 1H), 4.48 (d, J = 8.50 Hz, 1H), 4.06-3.98 (m, 3H), 3.86 (dt, J = 11.00, 8.81 Hz, 1H), 3.69 (dt, J = 9.82, 6.16 Hz, 1H), 3.41 (dt, J = 9.84, 6.50 Hz, 1H), 3.30 (t, J = 6.95 Hz, 2H), 2.10 (s, 3H), 1.99 (s, 3H), 1.89 (s, 3H), 1.76 (s, 3H), 1.55- 1.25 (m, 12H).

[0265] Synthesis of 12

[0266] PBS (lx, pH = 7.8, 80 mL) and NaAsc (0.712 g, 3.60 mmol, 1 eq) were added to an RBF containing 6 (6.76 g, 12.1 mmol, 1 eq), 11 (6.64 g, 13.3 mmol, 1.1 eq) and distilled CH2CI2 (160 mL). The RBF was cooled to -10 °C, then CuSCL (386 mg, 2.4 mmol, 0.2 eq) was added in one portion. The reaction was left to react overnight, and was monitored using TLC. Upon completion, the reaction mixture was washed twice with distilled water, and then with saturated sodium bicarbonate. The organic layer was dried over anhydrous Na2SO4. After filtration, the resulting mixture was concentrated via rotary evaporator. The crude product was subsequently purified by silica gel column chromatography to afford 12 as a white foam (11.0 g, yield: 86%). i l NMR (400 MHz, DMSO-d6): 5 7.82 (d, J = 9.13 Hz, 1H), 7.75 (s, 1H), 7.40-7.18 (m, 9H), 6.87-6.84 (m, 4H), 5.65 (d, J = 3.75 Hz, 1H), 5.22 (d, J = 3.50 Hz, 1H), 5.07 (d, J = 4.50 Hz, 1H), 4.96 (dd, J = 11.19, 3.44 Hz, 1H), 4.62 (t, J = 3.88 Hz, 1H), 4.59-4.43 (m, 3H), 4.28 (t, J = 7.13 Hz, 2H), 4.06-3.99 (m, 3H), 3.96-3.81 (m, 4H), 3.73 (s, 3H), 3.73 (s, 3H), 3.69 (dt, J = 9.84, 6.18 Hz, 1H), 3.41 (dt, J = 9.84, 6.50 Hz, 1H), 3.02 (dd, J = 9.38, 7.00 Hz, 1H), 2.93 (dd, J = 9.26, 5.63 Hz, 1H), 2.10 (s, 3H), 1.99 (s, 3H), 1.90 (s, 3H), 1.76 (s, 3H), 1.43 (s, 3H), 1.27-1.23 (m, 15H).

[0267] Synthesis of 13

[0268] DIEA (4.6 mL, 26.4 mmol, 5 eq) was added to an RBF containing 12 (5.6 g, 5.3 mmol, 1 eq) and distilled CH2CI2 (100 mL). The RBF was cooled to 0°C, and 2-cyanoethyl N,N- diisopropylchlorophosphoramidite (2.38 g, 10.0 mmol, 1.9 eq, in 10 mL CH2CI2) was added via syringe. The reaction was left to react for another 3 hours, and monitored using TLC. Upon completion, the reaction mixture was washed twice with distilled water, and then with saturated sodium bicarbonate. The organic layer was dried over anhydrous Na2SO4. After filtration, the resulting mixture was concentrated via rotary evaporator. The crude product was dissolved in CH2CI2 (50 mL), and added dropwise into a large excess of hexane (500 mL). The product was collected after centrifuge and vacuum as a white foam (5.5 g, yield: 82%). H NMR (400 MHz, DMSO-d6): δ 7.81 (d, J = 9.26 Hz, 1H), 7.75 (d, J = 13.00 Hz, 1H), 7.40-7.18 (m, 9H), 6.88-6.82 (m, 4H), 5.63 (dd, J = 33.02, 3.63 Hz, 1H), 5.21 (d, J = 3.38 Hz, 1H), 4.96 (dd, J = 11.19, 3.44 Hz, 1H), 4.68-4.56 (m, 2H), 4.49-4.41 (m, 2H), 4.30- 4.20 (m, 2H), 4.16-3.94 (m, 5H), 3.90-3.77 (m, 2H), 3.73-3.72 (m, 6H), 3.69-3.45 (m, 4H), 3.13-3.06 (m, 2H), 2.70 (t, J = 5.88 Hz, 2H), 2.59-2.51 (m, 2H), 2.09 (s, 3H), 1.99 (s, 3H), 1.89 (s, 3H), 1.75 (s, 3H), 1.47-1.40 (m, 3H), 1.28-1.18 (m, 15H), 1.12-1.04 (m, 12H).31P NMR (162 MHz, DMSO-d6): 8 149.6, 149.2.

[0269] Example 2: Synthesis and biological activity of trivalent GalNAc-oligonucleotide conjugates

[0270] Synthesis of trivalent GalNAc conjugate

[0271] A trivalent GalNAc conjugate, referred to as Gl, was synthesized by sequential conjugation of three monomeric GalNAc chemical moieties via standard phosphoramidite chemistry. Tn this way Gl was linked to specific SSOs, also via standard phosphoramidite chemistry, to facilitate the validation of targeted delivery' to hepatocytes.

[0272] Functional uptake of trivalent GalNAc-SSO conjugates in cell cultures

[0273] Gl was linked to the 5’ ends of SS01 and SS02, which are antisense oligonucleotides developed against the SLC25A13 c.469-2922G>T mutation for citrin deficiency disorders. As a positive control, a validated GalNAc*3 C3 Phosphoramidite ((4- (Trimethoxytrityloxymethyl)- 1-(6-(4-(3, 4, 6-O-triacetyl-2-acetylamino-2-deoxy-P-D- galactopyranosyl)butanamido)hexanoyl)piperidin-4-yl)methyl-O-[(2-cyanoethyl)-(N,N- diisopropyl)] (Glen Research), referred to as GA (formula provided below), was also linked to SSO1 and SSO2. The Gl- and GA-conjugated SSOs were first incubated with hepatoma cells that express the SLC25A13 minigene harbouring the target mutation under a calcium- enriched medium (CEM). It was confirmed that Gl does not interfere with the on-target efficiency of the conjugated SSOs (Figure 3A). Notably, SSOs conjugated with Gl performed equally, and in some cases better than, when conjugated to GA in rescuing the target splicing aberration (Figure 3A). Subsequently, the G1-SSO1 was tested on hepatocytes differentiated from iPS cells derived from patients with the SLC25A13 c.469- 2922G>T mutation. Corroborating the observation from cell lines, G1-SSO1 was functionally taken up by the hepatocytes resulting in higher efficacy when compared to the unconjugated SSO (Figure 3D). Furthermore, it was confirmed that G1 is not toxic (Figure 3E) or immunogenic (Figure 3F) when tested by MTS assay or BJAB assay, respectively.

[0274] In a similar fashion, Gl and GA were conjugated to the 5’ end of SSO3, an antisense oligonucleotide developed against the OTC c.540+265G>A mutation for OTC deficiency disorders. It was confirmed that Gl does not interfere with the on-target efficiency of SSO3 in rescuing the target splicing aberration (Figure 3B) in hepatoma cells expressing the mutant OTC minigene under CEM condition. Again, SSO3 conjugated with Gl performed better than when conjugated to GA. Lastly, Gl was conjugated to AVA1, an antisense oligonucleotide that switches expression of the CALIMERO gene from EGFP to tRFP isoforms, at 5’ or 3’ end. When incubated in Huh7 and ASGR1- overexpressing U87 cells, G1 conjugation at either end enhanced AVA1 efficacy compared to the unconjugated counterpart by free uptake (without CEM) (Figure 3C).

[0275] Functional uptake of trivalent GalNAc-SSO conjugates in mouse livers

[0276] Piggybac -based SLC25A13 c.469-2922G>T minigene plasmid was delivered together with a hyperactive Piggybac transposase-expressing plasmid into the liver of a mouse by hydrodynamic tail vein injection, resulting in the genomic integration and stable expression of the minigene in the liver after 8 weeks post-injection.

[0277] G1-SSO2 was then administered to the mice twice a week for 3 weeks at 25mg / kg or 50mg / kg dose (Figure 4A). At the endpoint, the livers were analysed for in vivo target engagement by G1-SSO2. A distinct increase in abundance of the minigcnc transcripts was detected, which were predisposed to nonsense-mediated decay (NMD). This suggests that SSO2 was functionally delivered to cells and rescuing the aberrant splicing, resulting in the stabilization of the transcripts from NMD degradation (Figure 4B). This was further verified when it was observed that the pseudoexon SLC25A13-PE5, which was caused by the SLC25A13 c.469-2922G>T mutation, was spliced-out in the minigene transcripts only in mice treated with G1-SSO2, but not in the vehicle control aim, confirming that the increase in minigcnc transcript levels was due to a bona fide increase in wild-type transcripts (Figure 4C).

[0278] No acute toxicity was observed in mice injected with G1 -SSO2, as inferred from the invariant body weights (Figure 4D), plasma alanine transaminase levels (Figure 4E) and plasma aspartate aminotransferase levels (Figure 4F). Furthermore, G1-SSO2 was not immunogenic, as seen by the absence of increase in immune cell markers by qPCR (Figure 4G) or any observable immune infiltrations in histology sections (Figure 4H). There was also no renal toxicity, as plasma creatinine was unchanged (Figure 41) and immune cell markers in the kidney (Figure 4J) and spleen (Figure 4K) were not altered. Interestingly, thrombocytopenia, which is commonly observed upon administration of phosphorothioate- containing antisense oligonucleotide, was not seen in mice injected with G1-SSO2 (Figure 4L) although SSO2 is fully modified with phosphorothioate bonds. In conclusion, G1 results in functional delivery of its payload, and is neither toxic nor immunogenic, suggesting that it is a clinically relevant tool for specific delivery of antisense oligonucleotides to the liver. It will be appreciated that many further modifications and permutations of various aspects of the described embodiments are possible. Accordingly, the described aspects are intended to embrace all such alterations, modifications, and variations that fall within the spirit and scope of the appended claims.

Claims

CLAIMS1. A compound of Formula (la), or a salt, solvate or stereoisomer thereof:wherein Ri and R2 are independently selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted hctcrocyclyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted silyl, optionally substituted acyl, and optionally substituted phosphoramidityl;R3 and R4 are independently selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted silyl, and optionally substituted acyl;X is a C atom or a heteroatom;Li is an optionally substituted linker having a chain length of 0 to 50 atoms;Rs is selected from H, cyano, halo, oxo, thio, azido, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted acyl, optionally substituted oxyacyl, optionally substituted acyloxy, optionally substituted amino, optionally substituted aryl, and optionally substituted heteroaryl; and wherein at least one of Ri and R2 is optionally substituted phosphoramidityl.

2. The compound of claim 1, wherein X is a C, O, S or N atom.

3. A compound of Formula (I), or a salt, solvate or stereoisomer thereof:wherein Ri and R2 are independently selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted heterocyclyl, optionallysubstituted aryl, optionally substituted heteroaryl, optionally substituted silyl, optionally substituted acyl, and optionally substituted phosphoramidityl;Rs and R4 are independently selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted hctcroaryl, optionally substituted silyl, and optionally substituted acyl;Li is an optionally substituted linker having a chain length of 0 to 50 atoms;Rs is selected from H, cyano, halo, oxo, thio, azido, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted acyl, optionally substituted oxyacyl, optionally substituted acyloxy, optionally substituted amino, optionally substituted aryl, and optionally substituted heteroaryl; and wherein at least one of Ri and Rr is optionally substituted phosphoramidityl.

4. The compound of any one of claims 1 to 3, wherein Ri is optionally substituted phosphoramidityl, and R2 is H or dimethoxytrityl (DMTr).

5. The compound of any one of claims 1 to 4, wherein Li has a chain length of 1 to 50 atoms.

6. The compound of any one of claims 1 to 5, wherein the compound is a compound of Formula (I-iii) or (I-iv), or a salt or solvate or stereoisomer thereof:wherein Ri and R2 are independently selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted silyl, optionally substituted acyl, and optionally substituted phosphoramidityl;R3 and R4 are independently selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted silyl, and optionally substituted acyl;Li is an optionally substituted linker having a chain length of 0 to 50 atoms;R5 is selected from H, cyano, halo, oxo, thio, azido, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted acyl, optionally substituted oxyacyl, optionally substituted acyloxy, optionally substituted amino, optionally substituted aryl, and optionally substituted hctcroaryl; and wherein at least one of Ri and R2 is optionally substituted phosphoramidityl.

7. The compound of any one of claims 1 to 6, wherein the compound is a compound of Formula (II), or a salt, solvate or stereoisomer thereof:wherein Ri and R2 arc independently selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted hctcroaryl, optionally substituted silyl, optionally substituted acyl, and optionally substituted phosphoramidityl;R3 and R4 are independently selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted silyl, and optionally substituted acyl;R& is selected from H, optionally substituted alkyl, and optionally substituted alkoxy; n is an integer selected from 1 to 50; and wherein at least one of Ri and R2 is optionally substituted phosphoramidityl.

8. The compound of any one of claims 1 to 7, wherein the compound is a compound ofFormula (II-iii) or (Il-iv), or a salt or solvate or stereoisomer thereof:wherein Ri and R2 are independently selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted heterocyclyl, optionallysubstituted aryl, optionally substituted heteroaryl, optionally substituted silyl, optionally substituted acyl, and optionally substituted phosphoramidityl;Rs and R4 are independently selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted hctcroaryl, optionally substituted silyl, and optionally substituted acyl;Rr> is selected from H, optionally substituted alkyl, and optionally substituted alkoxy; n is an integer selected from 1 to 50; and wherein at least one of Ri and R2 is optionally substituted phosphoramidityl.

9. The compound of any one of claims to 1 to 8, wherein the compound is a compound of Formula (III), or a salt, solvate or stereoisomer thereof:wherein R2 is selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted silyl, and optionally substituted acyl;R3 and R4 are independently selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted silyl, and optionally substituted acyl;Re is selected from H, optionally substituted alkyl, and optionally substituted alkoxy;R? is selected from H, optionally substituted alkyl, optionally substituted alkenyl;Rs and R9 are independently selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl; and n is an integer selected from 1 to 50.

10. The compound of any one of claims 1 to 9, wherein the compound is a compound of Formula (III-iii) or (IH-iv), or a salt or solvate or stereoisomer thereof:iv), wherein R2 is selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted silyl, and optionally substituted acyl;R3 and R4 are independently selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted silyl, and optionally substituted acyl;Re is selected from H, optionally substituted alkyl, and optionally substituted alkoxy;R7 is selected from H, optionally substituted alkyl, optionally substituted alkenyl;Rs and R9 are independently selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted hctcroaryl; and n is an integer selected from 1 to 50.1 1 . The compound of any one of claims 7 to 10, wherein Re is H.

12. The compound of any one of claims 9 to 11, wherein R7 is cyano or alkyl substituted with cyano, and Rs and R9 are isopropyl.

13. A compound of Formula (IV), or a salt, solvate or stereoisomer thereof:wherein Ri and R2 are independently selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted heterocyclyl, optionallysubstituted aryl, optionally substituted heteroaryl, optionally substituted silyl, optionally substituted acyl, and optionally substituted phosphoramidityl;Rs and R4 are independently selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted hctcroaryl, optionally substituted silyl, and optionally substituted acyl;L2 is an optionally substituted linker having a chain length of 1 to 50 atoms;Lig is a ligand capable of binding to a cell surface antigen or receptor; and wherein at least one of Ri and R2 is optionally substituted phosphoramidityl.

14. The compound of claim 13, wherein the compound is a compound of Formula (IV-iii) of (IV-iv), or a salt or solvate or stereoisomer thereof:wherein Ri and R2 are independently selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted silyl, optionally substituted acyl, and optionally substituted phosphoramidityl;R3 and R4 are independently selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted silyl, and optionally substituted acyl;L2 is an optionally substituted linker having a chain length of 1 to 50 atoms;Lig is a ligand capable of binding to a cell surface antigen or receptor; and wherein at least one of Ri and R2 is optionally substituted phosphoramidityl.

15. The compound of claim 13 or 14, wherein L2 compriseswherein Re is selected from H, optionally substituted alkyl, and optionally substituted alkoxy; andn is an integer selected from 1 to 50;16. The compound of any one of claims 13 to 15, wherein the compound is a compound of Formula (V), or a salt, solvate or stereoisomer thereof:wherein Ri and R2 are independently selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted silyl, optionally substituted acyl, and optionally substituted phosphoramidityl;Rs and R4 arc independently selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted silyl, and optionally substituted acyl;Re is selected from H, optionally substituted alkyl, and optionally substituted alkoxy; n is an integer selected from 1 to 50; L3is an optionally substituted linker with a chain length from 1 to 50 atoms;Lig is a ligand capable of binding to a cell surface antigen or receptor; and wherein at least one of Ri and R2 is optionally substituted phosphoramidityl.

17. The compound of any one of claims 13 to 16, wherein the compound is a compound of Formula (V-iii) or (V-iv), or a salt or solvate or stereoisomer thereof:R1 (V-iii),Ri (V-iv), wherein Ri and R2 are independently selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted silyl, optionally substituted acyl, and optionally substituted phosphoramidityl;Rs and R4 are independently selected from H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted silyl, and optionally substituted acyl;Re is selected from H, optionally substituted alkyl, and optionally substituted alkoxy; n is an integer selected from 1 to 50;Ls is an optionally substituted linker with a chain length from 1 to 50 atoms; Lig is a ligand capable of binding to a cell surface antigen or receptor; and wherein at least one of Ri and R2 is optionally substituted phosphoramidityl.

18. The compound of any one of claims 13 to 17, wherein Lig is selected from acetylcholine, N-acctylgalactosaminc (GalNAc), N-acctylglucosaminc (GlcNAc), acetyl-glyceryl-ether-phosphorylcholine (AGEPC), N-acetylserotonin, adenosine, adrenaline, agmatine, gamma-aminobutyric acid (GAMA), anandamide, anisamide, N-arachidonoyl dopamine (NADA), 2-arachidonoylglycerol, biotin (vitamin B7), calcitonin, carbachol, chenodeoxycholic acid, cholesterol, cholic acid, deoxycholic acid, dopamine, epigallocatechin-3-gallate (EGCG), estrone, fatty acid, folic acid, glutamic acid, glycocholic acid, histamine, 6-hydroxymelatonin, lithocholic acid, melatonin, N-mcthyltyraminc (NMT), niacin (vitamin B3), norepinephrine, meta- octopamine, para-octopamine, oxytocin, phenylethanolamine, prostacyclin, prostaglandin, putrescine, riboflavin (vitamin B2), serotonin, squalene, taurocholic acid, thiamin (vitamin B l), thromboxane, tocopherol, vasopressin, virodhamine, and derivatives thereof.

19. The compound of claim 18, wherein Lig is GalNAc or a derivative thereof.

20. An oligomer comprising two or more compounds of any one of claims 1 to 19, wherein the two or more compounds are linked by an intemucleoside linkage formed between Ri and R2 of adjacent compounds.

21. The oligomer of claim 20, wherein the oligomer comprises at least one compound of any one of claims 13 to 19.

22. An oligonucleotide conjugate, comprising:a) a compound of any one of claims 13 to 19 or an oligomer of claim 21 ; and b) an oligonucleotide; wherein the compound or oligomer is linked to the oligonucleotide by an internucleoside linkage formed between Ri or R2 of the compound or oligomer and the oligonucleotide.

23. The oligonucleotide conjugate of claim 22, wherein the compound or oligomer is linked to the 5’ or 3’ end of the oligonucleotide.

24. The oligonucleotide conjugate of claim 22 or 23, wherein the oligonucleotide is a single-stranded oligonucleotide.

25. The oligonucleotide conjugate of claim 24, wherein the oligonucleotide is an antisense oligonucleotide (ASO).

26. The oligonucleotide conjugate of claim 25, wherein the ASO is a gapmer or a spliceswitching oligonucleotide (SSO).

27. The oligonucleotide conjugate of any one of claims 22 to 26, wherein the oligonucleotide conjugate comprises a ligand selected from acetylcholine, N- acetylgalactosamine (GalNAc), N-acetylglucosamine (GlcNAc), acetyl-glyceryl- ether-phosphorylcholine (AGEPC), N-acetylserotonin, adenosine, adrenaline, agmatine, gamma-aminobutyric acid (GAMA), anandamide, anisamide, N- arachidonoyl dopamine (NADA), 2-arachidonoylglycerol, biotin (vitamin B7), calcitonin, carbachol, chenodeoxycholic acid, cholesterol, cholic acid, deoxycholic acid, dopamine, cpigallocatcchin-3-gallatc (EGCG), estrone, fatty acid, folic acid, glutamic acid, glycocholic acid, histamine, 6-hydroxymelatonin, lithocholic acid, melatonin, N-methyltyramine (NMT), niacin (vitamin B3), norepinephrine, meta- octopamine, para-octopamine, oxytocin, phenylethanolamine, prostacyclin, prostaglandin, putrescine, riboflavin (vitamin B2), serotonin, squalene, taurocholic acid, thiamin (vitamin B l), thromboxane, tocopherol, vasopressin, virodhamine, and derivatives thereof.

28. The oligonucleotide conjugate of claim 27, wherein the ligand is GalNAc or a derivative thereof.

29. A pharmaceutical composition comprising an oligonucleotide conjugate of any one of claims 22 to 28 and a pharmaceutically acceptable carrier.

30. An oligonucleotide conjugate of any one of claims 22 to 28 or a pharmaceutical composition of claim 29, for use as a medicament.

31. A method of delivering an oligonucleotide to a cell, the method comprising contacting the cell with an oligonucleotide conjugate of any one of claims 22 to 28 or a pharmaceutical composition of claim 29.

32. A method of modulating protein expression or function in a cell, the method comprising contacting the cell with an oligonucleotide conjugate of any one of claims 22 to 28 or a pharmaceutical composition of claim 29.

33. The method of claim 31 or 32, wherein the oligonucleotide conjugate comprises a GalNAc ligand, or a derivative thereof.

34. The method of any one of claims 31 to 33, wherein the cell is one that expresses the asialoglycoprotein receptor (ASGPR).

35. The method of any one of claims 31 to 34, wherein the cell is a liver or kidney cell.

36. A method of treating or preventing a disease or disorder in a subject, the method comprising administering a therapeutically effective amount of an oligonucleotide conjugate of any one of claims 22 to 28 or a pharmaceutical composition of claim 29 to the subject.

37. An oligonucleotide conjugate of any one of claims 22 to 28 or a pharmaceutical composition of claim 29, for use in treating or preventing a disease or disorder in a subject.

38. Use of an oligonucleotide conjugate of any one of claims 22 to 28 or a pharmaceutical composition of claim 29 in the manufacture of a medicament for treating or preventing a disease or disorder in a subject.

39. The method of claim 36, oligonucleotide conjugate for use of claim 37, or use of claim 38, wherein the disease or disorder is a liver or kidney disease or disorder.

40. The method of claim 36 or 39, oligonucleotide conjugate for use of claim 37 or 39, or use of claim 38 or 39, wherein the oligonucleotide conjugate comprises a GalNAc ligand, or a derivative thereof.

Images