Biomarker HLA-DOA for sepsis-related diseases and use thereof
By using HLA-DOA as a biomarker, the challenge of early diagnosis of sepsis has been solved, enabling early warning and timely treatment, and improving the survival rate of sepsis patients.
Patent Information
- Application Number
- PCT/CN2025/109248
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-07-19
- Filing Date
- 2025-07-18
- Publication Date
- 2026-01-22
AI Technical Summary
The lack of sepsis-specific molecular markers in current technologies makes it difficult to make early diagnosis and intervention before organ dysfunction occurs, and delayed treatment significantly reduces patient survival rates.
Using HLA-DOA or its active fragments as biomarkers, the detection of HLA-DOA levels in samples can be used for early diagnosis, risk assessment, immune status assessment, prognosis prediction, and treatment selection of sepsis-related diseases.
HLA-DOA has high diagnostic efficacy, and can differentiate between infection and sepsis when the SOFA score is below 2, providing early warning, improving the timeliness of treatment, and improving patient survival.
Smart Images

Figure PCTCN2025109248-FTAPPB-I100001 
Figure PCTCN2025109248-FTAPPB-I100002 
Figure PCTCN2025109248-FTAPPB-I100003
Abstract
Description
Sepsis-related disease biomarker HLA-DOA and uses thereof
[0001] Cross-reference to Related Applications
[0002] This application claims the benefit of Chinese Patent Application No. CN202410977780.9, filed on July 19, 2024; the entire contents of which are incorporated herein by reference. TECHNICAL FIELD
[0003] The present invention belongs to the field of molecular diagnostics and specifically relates to the use of HLA-DOA as a sepsis-related disease biomarker for the manufacture of a product for the early diagnosis, risk assessment, immune status assessment, prognosis prediction and / or treatment regimen selection of a sepsis-related disease. BACKGROUND
[0004] Currently, the diagnosis of sepsis mainly relies on clinical indicators, and the diagnostic criteria is "infection + SOFA≥2". SOFA score is a scoring system for evaluating the severity of disease and prognosis of critically ill patients based on clinical blood biochemical tests and clinical indicators. The higher the score, the more severe the disease. The serum marker currently used in clinical practice to assist in the diagnosis of sepsis is procalcitonin (PCT). However, the increase of PCT only indicates infection, and it is difficult to distinguish between ordinary infection and sepsis. In summary, due to the lack of specific molecular markers for sepsis, clinicians have difficulty in early diagnosis and discrimination before the occurrence of organ dysfunction (SOFA≥2). Early intervention is a general principle of sepsis treatment and management. Each delay of 1 hour for treatment, the survival rate of patients will decrease by about 7.6% (Ferrer, R., et al. Effectiveness of treatments for severe sepsis: a prospective, multicenter, observational study. American journal of respiratory and critical care medicine 180, 861-866 (2009).; Kumar, A., et al. Duration of hypotension before initiation of effective antimicrobial therapy is the critical determinant of survival in human septic shock. Critical care medicine 34, 1589-1596 (2006).). If a new molecular marker for sepsis can be found, early warning and diagnosis of the occurrence of sepsis before the occurrence of organ dysfunction can be made through its detection results, which can advance the time window for intervention of sepsis and enable patients to receive more timely treatment. SUMMARY
[0005] The object of the present application is to provide biomarkers of sepsis-related diseases and their use in the preparation of products for the early diagnosis, risk assessment, immune status assessment, prognosis prediction and / or treatment regimen selection of sepsis-related diseases in a subject.
[0006] Another object of the present application is to provide products and systems for the early diagnosis, risk assessment, immune status assessment, prognosis prediction and / or treatment regimen selection of sepsis-related diseases in a subject.
[0007] To solve the above technical problems, achieve the above purposes, the present application provides the following technical solutions:
[0008] In the first aspect, the present application provides the use of HLA-DOA or an active fragment, a functional fragment thereof as a biomarker in the preparation of a product for early diagnosis, risk assessment, immune status assessment, prognosis prediction and / or treatment regimen selection of a subject with a sepsis-related disease.
[0009] In some embodiments, the early diagnosis, risk assessment, immune status assessment, prognosis prediction and / or treatment regimen selection of the subject with a sepsis-related disease comprises: determining the level of HLA-DOA in a sample from the subject, comparing the level of HLA-DOA in the sample with a reference value to diagnose, assess the risk, assess the immune status, predict the prognosis and / or select the treatment regimen for the subject.
[0010] In the second aspect, the present application provides a product for early diagnosis, risk assessment, immune status assessment, prognosis prediction and / or treatment regimen selection of a subject with a sepsis-related disease, characterized in that the product comprises a reagent, a kit and / or a detection device for detecting the level of HLA-DOA in a sample from a subject.
[0011] In some embodiments, the sepsis-related disease comprises sepsis, severe sepsis or septic shock; the early stage of the sepsis-related disease is SOFA<2; and / or the subject is diagnosed with infection or suspected infection.
[0012] In some embodiments, the HLA-DOA is selected from at least one of HLA-DOA gene, HLA-DOA mRNA, cDNA of HLA-DOA mRNA or HLA-DOA protein.
[0013] In some embodiments, the sample is from a body fluid, cells, tissues, metabolites and / or excreta of the subject.
[0014] In some preferred embodiments, the sample is from a body fluid of the subject, and the body fluid is selected from at least one of blood, plasma, extracellular fluid, tissue fluid, lymph or cerebrospinal fluid.
[0015] In some more preferred embodiments, the sample is from blood, preferably peripheral blood, of the subject.
[0016] In some embodiments, the kit comprises:
[0017] (i) a detection-effective amount of a reagent for detecting HLA-DOA in a sample of a subject;
[0018] (ii) optionally, at least one substance selected from the group consisting of a container or package, an adjuvant, a solution, a buffer, a negative control, a positive control, or an instruction manual.
[0019] In some embodiments, the reagent comprises at least one of a primer, a probe, an antibody, a biochip, or a small molecule compound that specifically detects HLA-DOA.
[0020] In some embodiments, the reagent is directly or indirectly labeled with a detectable label selected from at least one of a radioisotope, a fluorescent group, a chemiluminescent moiety, an enzyme, an enzyme substrate, an enzyme cofactor, an enzyme inhibitor, a dye, a metal ion, or a ligand.
[0021] In some embodiments, the kit comprises at least one of a Western blotting kit, an enzyme-linked immunosorbent assay kit, a radioimmunoassay kit, a radioimmunodiffusion kit, a two-dimensional double immunodiffusion kit, a rocket immunoelectrophoresis kit, an immunohistochemical staining kit, an immunoprecipitation assay kit, a complement fixation assay kit, a fluorescence-activated cell sorting kit, an aptamer chip kit, a microarray kit, a protein chip kit, a qPCR kit, or a flow cytometry analysis kit.
[0022] In some embodiments, the detection device is selected from at least one of:
[0023] a detection device for real-time quantitative reverse transcription PCR, a biochip detection method, a Southern blotting method, a Northern blotting method, an in situ hybridization method, an immunofluorescence method, or an immunohistochemical method.
[0024] In a third aspect, the present application provides a system for early diagnosis, risk assessment, immune status assessment, prognosis prediction, and / or treatment regimen selection of a sepsis-related disease in a subject, characterized in that the system comprises:
[0025] (1) a first device for collecting and / or receiving data on the level of HLA-DOA in a sample from a subject;
[0026] (2) a second device for analyzing the data to perform early diagnosis, risk assessment, immune status assessment, prognosis prediction, and / or treatment regimen selection of a sepsis-related disease in the subject.
[0027] In some embodiments, the first device comprises the product of the second aspect;
[0028] In some embodiments, the analysis comprises comparing the level of HLA-DOA in the sample to a reference value.
[0029] In a fourth aspect, the present application provides a method for early diagnosis, risk assessment, immune status assessment, prognosis prediction and / or treatment regimen selection of a sepsis-related disease in a subject, said method comprising:
[0030] 1) collecting and / or processing a sample from the subject to bring the HLA-DOA level to a detectable state;
[0031] 2) detecting the HLA-DOA level in the subject using any of the aforementioned products or systems;
[0032] 3) comparing the HLA-DOA level in the subject to a reference value, thereby early diagnosing, risk assessing, immune status assessing, prognosis predicting and / or treatment regimen selecting the subject.
[0033] In some embodiments, the early stage of the sepsis-related disease is SOFA < 2.
[0034] In some embodiments, the subject is diagnosed with an infection or suspected to be infected.
[0035] In some embodiments, the sepsis-related disease comprises sepsis, severe sepsis or septic shock.
[0036] In some embodiments, the sample is from a body fluid, a cell, a tissue, a metabolite and / or an excretion of the subject.
[0037] In some preferred embodiments, the sample is from a body fluid of the subject, selected from at least one of:
[0038] blood, plasma, extracellular fluid, interstitial fluid, lymph or cerebrospinal fluid.
[0039] In some more preferred embodiments, the sample is from blood, preferably peripheral blood, of the subject.
[0040] In some embodiments, the HLA-DOA level comprises HLA-DOA mRNA molecule level, HLA-DOA mRNA cDNA molecule level and / or HLA-DOA protein molecule level.
[0041] The present application identifies that two molecules of HLA-DOA have obvious expression changes in the early stage of sepsis by using various sequencing analysis means, clinical infection patient blood sample detection and tracking of the clinical outcomes of these infected patients, which can distinguish between infected and non-infected patients, and between ordinary infection and patients who eventually progress to sepsis, and is expected to be used as a sepsis immune marker for early diagnosis, immune status evaluation and prognosis of sepsis. HLA-DOA has better diagnostic performance, and ROC analysis shows that the AUC value for distinguishing between ordinary infection and sepsis is 0.8954, which exceeds the diagnostic performance of the commonly used clinical indicator PCT. Therefore, the sepsis biomarker provided by the present application is of great significance for early clinical sepsis diagnosis, and has good application in the in vitro diagnostic reagent industry. BRIEF DESCRIPTION OF DRAWINGS
[0042] Fig. 1 shows the level of HLA-DOA mRNA in peripheral blood immune cells of healthy volunteers (normal control), ordinary infection patients and sepsis patients detected by digital PCR.
[0043] Fig. 2 shows the ROC curve analysis results of HLA-DOA mRNA levels in the ordinary infection group and the sepsis group.
[0044] Fig. 3 shows the ROC curve analysis results of the HLA-DOA expression and clinical outcome information of 176 sepsis patients in the sequencing data set E-MTAB-7581 of the Biostudies database.
[0045] Fig. 4 shows the Kaplan-Meier survival curve analysis results of the HLA-DOA expression and clinical outcome information of 479 sepsis patients in the sequencing data set GSE65682 of the GEO database.
[0046] Fig. 5 shows the HLA-DOA protein expression in peripheral blood immune cells of control group and sepsis group mice by flow cytometry analysis. DETAILED DESCRIPTION
[0047] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The following definitions are applied to the descriptions and claims herein and, unless otherwise specified, take precedence over any contradictory definitions in external documents, such as application data sheets or patent specifications.
[0048] Unless the context clearly indicates otherwise, as used herein, the singular forms "a" and "an" include plural referents. For example, a reference to "a cell" includes a plurality of such cells, as well as equivalents thereof known to those skilled in the art, and so forth.
[0049] As used herein, the term "about" means a ±20% range of the numerical value that follows. In some embodiments, the term "about" means a ±10% range of the numerical value that follows. In some embodiments, the term "about" means a ±5% range of the numerical value that follows.
[0050] Numerical ranges as used herein are intended to include all numbers and ranges within the range. For example, a range of 1 to 20 is intended to include any number, combination or sub-range from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.
[0051] As used herein, the terms "comprises" or "comprising" means "including, but not limited to". This term is intended to be open-ended, to specify the presence of any stated features, elements, integers, steps, or components, but does not preclude the presence or addition of one or more other features, elements, integers, steps, components, or groups thereof.
[0052] As used herein, the terms "optional", "any", "any of" or "any one of" mean that the subsequently described event or circumstance can or can not occur, and the description includes instances where the event or circumstance occurs and instances where it does not.
[0053] As used herein, the term "and / or" is to be taken as a specific term meaning either one of the items, or any combination of the items, that the term logically includes.
[0054] As used herein, the terms "first", "second", are used only for the purpose of description, to distinguish different described objects, and cannot be understood as indicating or implying relative importance or implicitly indicating the number of the indicated technical features, nor can it be understood as representing an order or connection relationship, etc.
[0055] As used herein, the term "sepsis-related disease" means a class of life-threatening organ dysfunction caused by a dysregulated host response to infection, including, but not limited to: sepsis, septic shock, severe sepsis. In some preferred embodiments, the sepsis-related disease is sepsis. Specific definitions of sepsis and diagnostic criteria can be found in Singer M, Deutschman CS, Seymour CW, et al. The Third International Consensus Definitions for Sepsis and Septic Shock (Sepsis-3). JAMA. 2016;315(8):801-810. doi:10.1001 / jama.2016.0287.
[0056] As used herein, the term "subject" refers to an animal, preferably a mammal, and more typically a human. The subject investigated by the methods of the present application is preferably a subject with a suspected infection. The term "subject with a suspected infection" as used herein means that the subject exhibits clinical parameters, signs and / or symptoms of an infection. Thus, the subject according to the present application is typically a subject with an infection or a suspected infection, more typically a subject visiting an emergency department.
[0057] As used herein, the term "infection" refers to a pathological process caused by the invasion of normally sterile tissue or fluid by a pathogenic or potentially pathogenic organism / pathogen, biological and / or microbial, and preferably involves an infection with bacteria, viruses, fungi and / or parasites. Thus, the infection can be a bacterial infection, a viral infection and / or a fungal infection. The infection can be a local or a systemic infection. For the purposes of the present application, a viral infection can be considered an infection with a microorganism.
[0058] As used herein, unless otherwise stated or clear from context, the term "HLA-DOA" can include the HLA-DOA gene, HLA-DOA mRNA, cDNA of HLA-DOA mRNA and / or HLA-DOA protein. HLA-DOA belongs to the HLA class II molecule alpha chain family member, which binds to the beta chain encoded by the HLA-DOB gene to form the HLA-DO heterodimer, which plays a role in the antigen presentation process of B cells, modulating the function of HLA-DM molecules, thereby affecting the stability of peptide-MHC class II molecule complex and the efficiency of antigen presentation. HLA-DOA is expressed in various tissues, particularly at a higher level in secondary lymphoid organs such as lymph nodes and spleen.
[0059] As used herein, the term "reference value" refers to a standard value used for comparison with the level (content or activity) of a biomarker in a sample, which can be calculated according to the average level of the biomarker determined in samples isolated from a plurality of healthy individuals or individuals with sepsis. Generally, a range of reference values is given as the reference value. Therefore, the terms "reference value" and "range of reference values" used herein are defined to have the same meaning.
[0060] The reference value can be a negative reference value established from healthy people or common infected individuals, for example, a decrease in the level of HLA-DOA relative to the negative reference value generally indicates that the individual is suffering from a sepsis-related disease, or is at risk of developing a sepsis-related disease, or is at risk of immunosuppression, or is at risk of poor prognosis. The reference value can also be a positive reference value established from patients with sepsis, and can also be a series of positive reference values established from patients with different degrees of sepsis, and the HLA-DOA level comparable to the positive reference value generally indicates the corresponding degree of sepsis progression, immune status or prognosis.
[0061] As used herein, the term "decrease" can mean that the detected level (e.g., expression or activity) of a biomarker is reduced by 5%, 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more compared to the reference value.
[0062] As used herein, the terms "reagent", "detection reagent" or "reagent for detecting the level of HLA-DOA" are used interchangeably and all refer to a substance that is specific to HLA-DOA molecules and can be used to directly or indirectly detect the presence and / or content of HLA-DOA genes, mRNA, cDNA and proteins. Based on the sequence of HLA-DOA molecules, a person of ordinary skill in the art can prepare or obtain commercially available reagents specific to HLA-DOA molecules based on conventional means. For example, the detection reagents useful in the present application include, but are not limited to, antibodies (preferably monoclonal antibodies), probes, gene chips, PCR primers, gRNAs, etc. that have detection specificity for HLA-DOA molecules. Moreover, for ease of detection, the detection reagents of the present disclosure can also be provided with a detectable label, including but not limited to, radioisotopes, fluorophores, chemiluminescent moieties, enzymes, enzyme substrates, enzyme cofactors, enzyme inhibitors, dyes, metal ions, ligands (e.g., biotin or haptens), etc. The detection reagents of the present disclosure can exist in solution, immobilized on a support (e.g., a substrate, an adsorbent) or in other conventional ways in the art, as long as the existing form is suitable for detection of HLA-DOA in a biological sample. For example, when the detection reagent of the present application is a nucleotide probe, it can exist in the form of a biochip (or "microarray").
[0063] As used herein, the terms "product" or "detection product" are used interchangeably, and mean a combination or a use of a substance, reagent, etc. specific for HLA-DOA, an apparatus used in conjunction therewith, etc. Depending on the detection method used, an appropriate HLA-DOA detection substance can be selected and manufactured into a product, such as a kit, suitable for the detection method used. Those of ordinary skill in the art can adjust and change the detection method and the reagents contained in the product according to actual conditions and needs. The product of the present disclosure can further contain other reagents clinically used for early diagnosis, risk assessment, immune status assessment, prognosis prediction (or assessment, judgment), and / or treatment regimen selection of sepsis-related diseases in subjects, to assist or verify the results obtained by detecting HLA-DOA. Those of ordinary skill in the art can make routine selections according to specific needs.
[0064] To make the objects, technical solutions, and advantages of the present application clearer, the present application is further described in detail below in conjunction with examples. When no specific conditions are specified in the examples, the routine conditions or the conditions recommended by the manufacturer are used. When no manufacturer of all reagents or instruments is specified, all reagents or instruments are commercially available routine products. In order to better illustrate the present application, numerous specific details are given in the following specific embodiments. The specific embodiments described herein are only used to explain the present application and do not constitute any limitation on the present application. In addition, in the following description, the description of well-known structures and techniques is omitted to avoid unnecessary confusion of the concept of the present application. Such structures and techniques are also described in many publications, such as "Molecular Cloning: A Laboratory Manual (Fourth Edition)" (Cold Spring Harbor Laboratory Press), Ausubel, F. M. et al., Current Protocols in Molecular Biology, published by Greene Publishing Assoc. and Wiley-lnterscience.
[0065] Example 1. Verification of the clinical diagnostic efficiency of HLA-DOA for distinguishing between common infections and sepsis
[0066] (1) Extraction of total RNA
[0067] Forty patients with common infections, 11 patients with sepsis, and 20 healthy controls were recruited from West China Hospital of Sichuan University. Peripheral blood was collected in K3EDTA anticoagulant tubes. The blood was lysed overnight (-80℃) or on ice for 30 minutes with an appropriate volume of Trizol under enzyme-free conditions. The lysed blood was thawed at room temperature, inverted to mix, and allowed to stand at room temperature for 10 minutes. One-fifth of the sample volume (approximately 200 μL) of chloroform was added, vortexed for 30 seconds, and allowed to stand for 5 minutes. A pink layer was observed at the bottom, and the top layer was colorless. The sample was centrifuged at 12000g for 20 minutes at 4℃. After centrifugation, the sample was clearly separated into three layers: a pinkish layer of contaminating proteins at the bottom, a middle layer of white DNA, and an uppermost colorless aqueous layer containing RNA. The RNA was carefully transferred to a new enzyme-free tube; an equal volume of isopropanol was added, and the mixture was transferred together to -20℃ to allow RNA precipitation (approximately 1-2 hours). After centrifugation at 12000g for 10 minutes at 4°C, a white, lumpy RNA precipitate was observed settling at the bottom of the tube. The supernatant was removed, and the RNA was resuspended in a prepared DEPC solution (ethanol:DEPC = 3:1). The mixture was then centrifuged at 12000g for 5 minutes at 4°C, repeated twice. After removing the supernatant, the RNA was air-dried in a fume hood until the precipitate became colorless and transparent. Then, 30 μL of enzyme-free water was added, and the mixture was thoroughly mixed. The RNA concentration was then measured using a Thermo Scientific Nanodrop.
[0068] (2) Reverse transcription
[0069] Genomic DNA removal: Add 1 μg of qualified RNA to the following reaction system, gently mix with a pipette, and then transfer the prepared reaction mixture to a metal bath and react at 42°C for 2 minutes.
[0070] Table 1. Genome Removal Reaction System
[0071] Remove the mixture from the metal bath after the above reaction is complete, and then prepare the mRNA reverse transcription reaction system according to the grouping in the table below. After completion, place the mixture in a PCR instrument for reverse transcription. The reverse transcription program is: 37°C, 15 minutes; 85°C, 2 minutes; 4°C incubation.
[0072] Table 2. Reverse transcription reaction system
[0073] (3) Digital PCR detection
[0074] After reverse transcription is complete, dilute the resulting cDNA to approximately 0.2 ng / μL RNA equivalent to prepare the ddPCR reaction system for the gene to be tested: 1 μL cDNA template, Bio-rad QX200...TM ddPCR TM 10 μL of enzyme premixed reaction solution and 0.8 μL of primers (0.4 μL each of forward and reverse primers) were added to a final volume of 20 μL with water. The primer sequences were: HLA-DOA-F:CATCTGCATCGTGGACAACA (SEQ ID NO:1); HLA-DOA-R:AAATGGTCAGGCTGGGAAT (SEQ ID NO:2).
[0075] The absolute copy number of HLA-DOA mRNA was determined using a Bio-Rad QX200 ddPCR instrument, following its instruction manual. The QX200 ddPCR system primarily utilizes microfluidic technology to partition the sample to be tested into approximately 20,000 nanometer-sized droplets before detection.
[0076] The test results were displayed using a scatter bar chart. Differences between groups were compared using one-way ANOVA, and the Mann-Whitney u test was used to compare the common infection group and the sepsis group separately (p<0.0001). The results showed that compared with the normal control, HLA-DOA expression was significantly reduced in patients with common infection, and the lowest in patients with sepsis (Figure 1). Receiver operating characteristic (ROC) curve analysis was performed on the HLA-DOA mRNA expression levels in the common infection group and the sepsis group. Sensitivity was plotted on the ordinate to represent the true positive rate, and 1-specificity on the x-axis to represent the false positive rate, to create the ROC curve. The area under the curve (AUC) reflects the diagnostic value of the test; the larger the area, the closer it is to 1.0, the better the diagnostic efficacy and the higher the accuracy; the closer it is to 0.5, the lower the diagnostic efficacy; when it equals 0.5, it has no diagnostic value. ROC analysis showed that the AUC of 0.8954 was between the common infection group and the sepsis group, indicating that HLA-DOA mRNA level has high diagnostic efficacy in differentiating between sepsis and common infection (Figure 2).
[0077] Example 2. Receiver operating curves and Kaplan-Meier survival curves to assess the predictive efficacy of HLA-DOA for the prognosis of sepsis patients.
[0078] This invention analyzes the sequencing dataset E-MTAB-7581 (https: / / www.ebi.ac.uk / biostudies / arrayexpress / studies?query=E-MTAB-7581) from the Biostudies database. This dataset contains 176 sepsis patients. HLA-DOA mRNA expression and clinical outcome information were collected, and ROC analysis was performed. The ROC curve was plotted by calculating the sensitivity, specificity, and false positive rate (1-specificity) for all cutoff points. Sensitivity was plotted on the ordinate (true positive rate) and 1-specificity on the x-axis (false positive rate) to create an ROC curve, and the area under the curve (AUC) was calculated. The optimal cutoff point is often selected at the upper left corner of the ROC curve, as it corresponds to relatively optimal sensitivity and specificity. The ROC analysis results showed that the area under the curve (AUC) was 0.76, the sensitivity was 0.817, the specificity was 0.606, the optimal cutoff value was 5.421, and the accuracy was good, indicating clinical application value (Figure 3).
[0079] This invention analyzes the clinical prognostic information of 479 sepsis patients in the GEO database GSE65682 dataset (https: / / www.ncbi.nlm.nih.gov / geo / query / acc.cgi?acc=GSE65682). HLA-DOA mRNA expression and clinical outcome information were collected, and Kaplan-Meier survival curve analysis was performed. Kaplan-Meier survival curves are primarily used to analyze the impact of a single factor on survival, to estimate patient survival rates, and to plot survival curves. The survival curve, plotted with survival time on the horizontal axis and survival rate on the vertical axis, is a continuous step-shaped curve used to illustrate the relationship between survival time and survival rate. In medicine, biology, and other fields, Kaplan-Meier survival curves are commonly used to assess disease prognosis and treatment effectiveness. Kaplan-Meier survival curves were used to analyze the prognostic value of HLA-DOA for sepsis patients in the GSE65682 dataset. The results showed that HLA-DOA expression was associated with the survival rate of sepsis patients (p = 0.074) (Figure 4).
[0080] Example 3. Flow cytometry detection to verify differential HLA-DOA protein expression
[0081] (1) Construction of animal models:
[0082] All wild-type C57 mice (SPF grade) used in this invention were purchased from Beijing Huafukang Biotechnology Co., Ltd., with an age range of 7-8 weeks and a weight range of 20g-25g. All purchased mice underwent a one-week acclimatization period at the Experimental Animal Center of the Frontier Medical Research Center, West China Hospital, Sichuan University. The rearing room was well-ventilated, with humidity at 50%-60%, and the room temperature controlled at approximately 26℃. Day and night cycles were alternated, each lasting 12 hours. Mice were fed standard feed and had free access to water. Experiments were conducted after the one-week acclimatization period.
[0083] Establishment of a severe infection (sepsis) model (designated as the Critical group): 6-8 week old C57 mice were selected. Mice were anesthetized with sodium pentobarbital. The abdomen of the mice was prepared with a shaving tool. After disinfection with iodine, the mice were opened under aseptic conditions. A small incision was made 0.5 cm to the left of the midline of the abdomen. The cecum was separated and gently removed with surgical forceps (curved forceps). The cecum was then ligated with sterile No. 4 suture 0.75 cm from the cecum end. Then, an 18-gauge needle was used to puncture the cecum once. The cecum was then returned to the abdominal cavity. The muscle layer and outer skin layer of the mice were sutured. After disinfection with iodine, the mice were returned to their cages for observation.
[0084] The healthy sham surgery group (designated as the Sham group) served as the control: the preoperative operation was the same as that of the sepsis model. After opening the abdomen and finding the cecum, the cecum was not ligated or punctured. The cecum was gently placed back into the abdominal cavity, the muscle layer and the outer skin layer of the mice were sutured, and the mice were disinfected with povidone-iodine and then placed back into the breeding cage for observation.
[0085] Immediately after modeling, all mice were subcutaneously injected with 800 μL of physiological saline for fluid rewarming, and 20 mg / kg of ciprofloxacin was injected intramuscularly into the inner thigh.
[0086] (2) Flow cytometry detection of HLA-DOA expression:
[0087] (a) A sepsis model was established using the animal modeling method described above, with the sham-operated group as a healthy control.
[0088] (b) Collect 50 μL of peripheral blood from mice into a K3EDTA anticoagulant tube and mix by inverting.
[0089] (c) Add flow cytometry antibodies for all genes to be tested according to the instructions (generally 2.5 μL / test): CD45 (brand: BD Pharmaceuticals) TM HLA-DOA antibody (brand: ThermoFisher-Invitrogen, catalog number: AB_2552186).
[0090] (d) Add 450 μL of 1X FACs hemolysin to the counting tube and lyse the red blood cells at room temperature (20°C) in the dark for 15 minutes to fully lyse the red blood cells.
[0091] (e) For flow cytometry analysis, the sample does not need to be washed. Add Dapi to the sample 5 minutes before the flow cytometer analysis to stain for cell viability and death, and then it can be used on the instrument.
[0092] (f) Results Analysis
[0093] The FAC file from the flow cytometer was analyzed using Fiowjo 10.0, and the results are shown in Figure 5. Compared with the healthy control group, the HLA-DOA protein level in peripheral blood immune cells of the sepsis group was significantly reduced, suggesting that detecting the HLA-DOA protein level in peripheral blood immune cells can also be used for the diagnosis of sepsis.
[0094] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, and is not intended to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions made by those skilled in the art to the technical solution of the present invention do not depart from the essence and scope of the technical solution of the present invention.
Claims
1. Use of HLA-DOA or an active fragment, a functional fragment thereof as a biomarker in the manufacture of a product for early diagnosis, risk assessment, immune status assessment, prognosis prediction and / or treatment regimen selection of a subject with a sepsis-related disease.
2. Use according to claim 1, characterized in that, The early diagnosis, risk assessment, immune status assessment, prognosis prediction and / or treatment regimen selection of the subject with a sepsis-related disease comprises: determining the level of HLA-DOA in a sample from the subject, comparing the level of HLA-DOA in the sample with a reference value, to make early diagnosis, risk assessment, immune status assessment, prognosis prediction and / or treatment regimen selection of the subject.
3. A product for early diagnosis, risk assessment, immune status assessment, prognosis prediction and / or treatment regimen selection of a sepsis-related disease in a subject, characterized in that, The product comprises reagents, kits and / or detection devices for detecting the level of HLA-DOA in a sample from a subject.
4. Use according to claim 1 or product according to claim 3, characterized in that, The sepsis-related disease comprises sepsis, severe sepsis or septic shock; the early stage of the sepsis-related disease is SOFA < 2; and / or the subject is confirmed to be infected or suspected to be infected.
5. Use according to claim 1 or product according to claim 3, characterized in that, The HLA-DOA is selected from at least one of HLA-DOA gene, HLA-DOA mRNA, cDNA of HLA-DOA mRNA or HLA-DOA protein.
6. The product of claim 3, wherein, The sample is from the body fluid, cells, tissues, metabolites and / or excreta of the subject; Preferably, the sample is from the body fluid of the subject, which is selected from at least one of blood, plasma, extracellular fluid, tissue fluid, lymph or cerebrospinal fluid; More preferably, the sample is from the blood of the subject; More preferably, the sample is from the peripheral blood of the subject.
7. The product according to any one of claims 3-6, characterized in that, The kit comprises: (i) a detection-effective amount of reagent for detecting HLA-DOA in a sample from a subject; (ii) optionally, at least one substance selected from the group consisting of a container or package, an adjuvant, a solution, a buffer, a negative control, a positive control or an instruction; And / or, the reagent comprises at least one of the following: primers, probes, antibodies, biochips or small molecule compounds that specifically detect HLA-DOA; Preferably, the reagent is directly or indirectly labeled with a detectable label selected from at least one of the following: a radioisotope, a fluorescent group, a chemiluminescent moiety, an enzyme, an enzyme substrate, an enzyme cofactor, an enzyme inhibitor, a dye, a metal ion or a ligand.
8. The product of claim 7, wherein, The kit comprises at least one of the following: a Western blotting kit, an enzyme-linked immunosorbent assay kit, a radioimmunoassay kit, a radioimmunodiffusion kit, a two-dimensional double immunodiffusion kit, a rocket immunoelectrophoresis kit, an immunohistochemical staining kit, an immunoprecipitation assay kit, a complement fixation assay kit, a fluorescence-activated cell sorting kit, an aptamer chip kit, a microarray kit, a protein chip kit, a qPCR kit or a flow cytometry analysis kit.
9. The product according to any one of claims 3-8, characterized in that, The detection device is selected from at least one of the following: A detection device for real-time quantitative reverse transcription PCR, biochip detection method, Southern blotting method, Northern blotting method, in situ hybridization method, immunofluorescence method or immunohistochemical method.
10. A system for early diagnosis, risk assessment, immune status assessment, prognosis prediction and / or treatment regimen selection of a sepsis-related disease in a subject, characterized in that, The system comprises: (1) a first device for collecting and / or receiving the level of HLA-DOA in a sample from a subject; (2) a second device for analyzing the data to perform early diagnosis, risk assessment, immune status assessment, prognosis prediction and / or treatment regimen selection of a sepsis-related disease for the subject; wherein the first device comprises the product of claims 3-9; and / or, the analysis comprises comparing the level of HLA-DOA in the sample with a reference value.
Citation Information
Patent Citations
Biomarker HLA-DOA for sepsis-related diseases and application of biomarker HLA-DOA
CN118979103A
Apparatus, kits and methods for predicting the development of sepsis
US20230340599A1
A continuous metric to measure endotype and corticosteroid interaction in septic shock
US20240209445A1
Apparatus, kits and methods for predicting the development of sepsis
WO2022064162A1