Downy mildew resistance in spinach

Abstract

The current invention relates to spinach plants comprising a gene or locus which leads to a broad spectrum resistance to Peronospora effusa (Pe). The invention also relates to progeny of said 5 spinach plants, to propagation material of said spinach plants, to a cell of said spinach plants, to seed of said spinach plants, and to harvested leaves of said spinach plants. The invention also relates to use of said spinach plants in breeding to confer resistance against Peronospora effusa. The invention further relates to a method for generating a spinach plant having a broad spectrum resistance to Peronospora effusa.

Description

[0001] DOWNY MILDEW RESISTANCE IN SPINACH

[0002] FIELD OF THE INVENTION

[0003] The invention pertains to spinach plants comprising a gene or locus which leads to a broad spectrum resistance to Peronospora effusa (Pe). The invention also relates to progeny of said spinach plants, to propagation material of said spinach plants, to a cell of said spinach plants, to seed of said spinach plants, and to harvested leaves of said spinach plants. The present invention further relates to a resistance gene or locus or a nucleic acid fragment, that confers resistance to downy mildew in spinach plants and methods for obtaining a spinach having a broad spectrum resistance to Peronospora effusa. The invention also relates to use of said spinach plants in breeding to confer resistance against Peronospora effusa.

[0004] BACKGROUND

[0005] Spinach (Spinacia oleracea) is a flowering plant from the Amaranthaceae family that is grown as a vegetable. The consumable parts of spinach are the leaves from the vegetative stage. Spinach is sold loose, bunched, in prepacked bags, canned, or frozen. There are three basic types of spinach, namely the savoy, semi-savoy and smooth types. Savoy has crinkly and curly leaves. Flat or smooth leaf spinach has in general broad, smooth leaves. Semi-savoy is a variety with slightly crinkled leaves. The main market for spinach is baby-leaf. Baby spinach leaves are usually of the flat-leaf variety and usually the harvested leaves are not longer than about eight centimeters. These tender, sweet leaves are sold loose rather than in bunch. They are often used in salads, but can also be lightly cooked. Downy mildew, which in spinach is caused by the pathogen Peronospora effusa (formerly known as P. farinosa f. sp. spinaciae), is a major threat for spinach growers, because it affects the harvested plant parts, namely the leaves. Infection makes the leaves unsuitable for sale and consumption, as it manifests itself phenotypically as yellow lesions on the older leaves, and on the abaxial leaf surface a greyish fungal growth can be observed. The infection can spread very rapidly, and it can occur both in glasshouse cultivation and in soil cultivation. The optimal temperature for formation and germination of P. effusa is 9 to 12° C., and it is facilitated by a high relative humidity. When pathogens are deposited on a humid leaf surface they can readily germinate and infect the leaf. Pathogen growth is optimal between 8 and 20° C. and a relative humidity of >80%, and growth can be observed within 6 and 13 days after infection. In recent years various resistance genes have been identified that provide spinach plants with a resistance against downy mildew. However, it has been observed that previously resistant spinach cultivars can again become susceptible to the pathogen. Investigations revealed that the cultivars themselves had not changed, and that the loss of downy mildew resistance must therefore be due to P. effusa overcoming the resistance in these spinach cultivars. The downy mildew races that were able to infect resistant spinach cultivars have been identified on a differential reference set, used to test spinach cultivars for resistance. The differential set comprises a series of spinach cultivars (hybrids) that have different resistance patterns to the currently identified pathogenic races. To date, 20 pathogenic races of spinach downy mildew (Pe) have been officially identified and characterized. Races 4 through 10 were identified between 1990 and 2009, which illustrates the versatility and adaptability of the pathogen to overcome resistances in spinach.

[0006] In different geographical regions different combinations of pathogenic races or isolates occur, and the spinach industry therefore has a strong demand for spinach cultivars that are resistant to as many relevant downy mildew races as possible, preferably to all races that may occur in their region, and even to the newest threats that cannot be countered with the resistances that are present in the commercially available spinach cultivars.

[0007] It is crucial to stay at the forefront of developments in this field, as Peronospora continuously develops the ability to break the resistances that are present in commercial spinach varieties. For this reason, new resistance genes are very valuable assets, and they form an important research focus in spinach breeding. The goal of spinach breeders is to rapidly develop spinach varieties with resistance to as many Peronospora races as possible, including the latest identified. To date, 20 Pe races are officially recognized by the International Working Group on Peronospora in spinach (IWGP) and made publicly available from the Department of Plant Pathology, University of Arkansas, Fayetteville, Ark. 72701 , USA, and also from NAK Tuinbouw, Sotaweg 22, 2371 GD Roelofarendsveen, the Netherlands. Recently identified isolates SP1924, UA202001 E and RZ2331 B have been denominated Pe 18, Pe 19 and Pe 20, respectively.

[0008] It is the object of the invention to provide spinach plants, conferring a broad spectrum resistance, i.e. resistance to various Peronospora races and / or isolates, including the ones that have been most recently identified.

[0009] SUMMARY OF THE INVENTION

[0010] The present invention provides spinach plants comprising resistance at least against one or more of Peronospora effusa races 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18 and 19, isolates 4US also known as 4+, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201. The resistance may comprise resistance to further Pe races (e.g. Pe 20). Said plants are obtainable by introgression from a plant grown from seeds of which representative samples have been deposited with the National Collection of Industrial, Food and Marine Bacteria (NCIMB) Ltd., under the accession number 44393.

[0011] The plants have a broad spectrum of Peronospora effusa resistance, which is stably transferred to the progeny.

[0012] The invention also relates to resistance alleles and nucleic acid fragments linked to said resistance, as well as methods for providing resistant spinach plants, for selecting and / or identifying resistant spinach plants, for combining multiple resistance loci in a spinach plant, as well as uses of markers for identifying or developing resistant plants.

[0013] DETAI LED DESCRI PTION OF THE INVENTION

[0014] Definitions

[0015] Unless otherwise defined, all terms used in disclosing the invention, including technical and scientific terms, have the meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. By means of further guidance, term definitions are included to better appreciate the teaching of the present invention.

[0016] The indefinite article “a” or “an” does not exclude the possibility that more than one of the element is present, unless the context clearly requires that there be one and only one of the elements. The indefinite article “a” or “an” thus usually means “at least one”.

[0017] “Plant variety” is a group of plants within the same botanical taxon of the lowest grade known, which (irrespective of whether the conditions for the recognition of plant breeder's rights are fulfilled or not) can be defined on the basis of the expression of characteristics that result from a certain genotype or a combination of genotypes, can be distinguished from any other group of plants by the expression of at least one of those characteristics, and can be regarded as an entity, because it can be multiplied without any change. Therefore, the term “plant variety” cannot be used to denote a group of plants, even if they are of the same kind, if they are all characterized by the presence of one or two loci or genes (or phenotypic characteristics due to these specific loci or genes), but which can otherwise differ from one another enormously as regards the other loci or genes.

[0018] “Spinach” or “cultivated spinach” or “cultivated Spinacia oleracea” refers herein to plants of the species Spinacia oleracea (or seeds from which the plants can be grown), and parts of such plants, bred by humans for food and having good agronomic characteristics. This includes any cultivated spinach, such as breeding lines (e.g., backcross lines, inbred lines), cultivars and varieties (open pollinated or hybrids). This includes any type of spinach, such as savoy, flat- or smooth-leaf spinach or semi-savoy types. Wild spinach (i.e. not cultivated spinach) or wild relatives of spinach, such as Spinacia tetrandra and Spinacia turkestanica, are not encompassed by this definition.

[0019] As used herein, the term “plant” includes the seed (from which the plant can be grown), the whole plant or any parts such as plant organs (e.g., harvested or non-harvested leaves, etc.), plant cells, plant protoplasts, plant cell- or tissue cultures from which whole plants can be regenerated, propagating or non-propagating plant cells, plants cells which are not in tissue culture (but which are for example in vivo in a plant or plant part), plant callus, plant cell clumps, plant transplants, seedlings, plant cells that are intact in plants, plant clones or micro-propagations, or parts of plants (e.g., harvested tissues or organs), such as plant cuttings, vegetative propagations, embryos, pollen, ovules, flowers, leaves, heads, seeds (produced on the plant after selffertilization or cross-fertilization), clonally propagated plants, roots, stems, stalks, root tips, grafts, parts of any of these and the like, or derivatives thereof, preferably having the same genetic make-up (or very similar genetic make-up) as the plant from which it is obtained. Also, any developmental stage is included, such as seedlings, cuttings prior or after rooting, mature and / or immature plants or mature and / or immature leaves. When “seeds of a plant” are referred to, these either refer to seeds from which the plant can be grown or to seeds produced on the plant, after self-fertilization or cross-fertilization.

[0020] “Somatic cells” and “reproductive cells” can be distinguished, whereby somatic cells are cells other than gametes (e.g., ovules and pollen), germ cells and gametocytes. Gametes, germ cells and gametocytes are “reproductive cells.

[0021] “Tissue Culture” or “cell culture” refers to an in vitro composition comprising isolated cells of the same or a different type or a collection of such cells organized into plant tissue. Tissue cultures and cell cultures of spinach, and regeneration of spinach plants therefrom, is well known and widely published (see, e.g., Nguyen et al., 2013, Plant Biotechnology Reports, Vol. 7 Issue 1 , p 99).

[0022] “Harvested plant material” refers herein to plant parts (e.g., leaves detached from the whole plant) which have been collected for further storage and / or further use.

[0023] “Harvested seeds” refers to seeds harvested from a line or variety, e.g., produced after selffertilization or cross-fertilization and collected.

[0024] “Harvested leaves” as used herein refers to spinach leaves, i.e., the plant without the root system, for example substantially all (harvested) leaves.

[0025] “Progeny” or “progenies” or “descendants” as used herein refers to offspring, or the first and all further descendants derived from (obtainable from) (derivable from or obtained from) a plant of the invention that comprises (retains) the resistance gene in homozygous or heterozygous form and / or the resistance phenotype described herein. Progeny may be derived by regeneration of cell culture or tissue culture, or parts of a plant, or selfing of a plant, or by producing seeds of a plant. In further embodiments, progeny may also encompass spinach plants derived from crossing of at least one spinach plant with another spinach plant of the same or another variety or (breeding) line, and / or backcrossing, and / or inserting of a locus into a plant and / or mutation. A progeny is, e.g., a first generation progeny, i.e. the progeny is directly derived from, obtained from, obtainable from or derivable from the parent plant by, e.g., traditional breeding methods (selfing and / or crossing) or regeneration. However, the term “progeny” generally encompasses further generations such as second, third, fourth, fifth, sixth, seventh or more generations, i.e. , generations of plants which are derived from, obtained from, obtainable from or derivable from the former generation by, e.g., traditional breeding methods, regeneration or genetic transformation techniques. For example, a second generation progeny can be produced from a first generation progeny by any of the methods mentioned above. Also, double haploid plants are progeny.

[0026] “Plant line” is for example a breeding line which can be used to develop one or more varieties.

[0027] “F1 , F2, F3, etc.” refers to the consecutive related generations following a cross between two parent plants or parent lines. The plants grown from the seeds produced by crossing two plants or lines is called the F1 generation. Selfing the F1 plants results in the F2 generation, etc.

[0028] “Hybrid” refers to the seeds harvested from crossing one plant line or variety with another plant line or variety, and the plants or plant parts grown from said seeds.

[0029] “F1 hybrid” plant (or F1 hybrid seed) is the generation obtained from crossing two non-isogenic inbred parent lines. Thus, F1 hybrid seeds are seeds from which F1 hybrid plants grow.

[0030] An “interspecific hybrid” refers to a hybrid produced from crossing a plant of one species (e.g., S. oleracea) with a plant of another species (e.g., S. tetrandra or S. turkestanica).

[0031] “Crossing” refers to the mating of two parent plants. Equally “Cross-pollination” refers to fertilization by the union of two gametes from different plants.

[0032] “Selfing” refers to the self-pollination of a plant, i.e., to the union of gametes from the same plant.

[0033] “Backcrossing” refers to a breeding method by which a (single) trait, such as Pe resistance conferred by a resistance gene, can be transferred from one genetic background (also referred to as “donor”; generally but not necessarily this is an inferior genetic background) into another genetic background (also referred to as “recurrent parent”; generally but not necessarily this is a superior genetic background). An offspring of a cross (e.g., an F1 plant obtained by crossing a wild spinach or wild relative of spinach with a cultivated spinach; or an F2 plant or F3 plant, etc., obtained from selfing the F1) is “backcrossed” to the parent with the superior genetic background, e.g., to the cultivated parent.

[0034] After repeated backcrossing, the trait of the donor genetic background, e.g., the resistance gene, will have been incorporated into the recurrent genetic background. The terms “gene converted” or “conversion plant” or “single locus conversion” in this context refer to plants which are developed by backcrossing wherein essentially all of the desired morphological and / or physiological characteristics of the recurrent parent are recovered in addition to the one or more genes (e.g., the resistance gene) transferred from the donor parent.

[0035] The term “traditional breeding techniques” encompasses herein crossing, backcrossing, selfing, selection, chromosome doubling, double haploid production, embryo rescue, the use of bridge species, protoplast fusion, marker assisted selection, mutation breeding etc. as known to the breeder (i.e. methods other than genetic modification / transformation / transgenic methods), by which, for example, the - resistance gene can be obtained, identified, selected, and / or transferred.

[0036] “Regeneration” refers to the development of a plant from in vitro cell culture or tissue culture or vegetative propagation.

[0037] “Vegetative propagation”, “vegetative reproduction” or “clonal propagation” are used interchangeably herein and mean the method of taking part of a plant and allowing that plant part to form at least roots where plant part is, e.g., defined as or derived from (e.g., by cutting off) leaf, pollen, embryo, cotyledon, hypocotyl, cells, protoplasts, meristematic cell, root, root tip, pistil, anther, flower, shoot tip, shoot, stem, fruit, and petiole. When a whole plant is regenerated by vegetative propagation, it is also referred to as a “vegetative propagation” or a “vegetatively propagated plant”.

[0038] “Single locus converted (conversion) plant” refers to plants which are developed by plant breeding techniques comprising or consisting of backcrossing, wherein essentially all of the desired morphological and / or physiological characteristics of a spinach plant are recovered in addition to the characteristics of the single locus having been transferred into the plant via the backcrossing technique and / or by genetic transformation.

[0039] “Transgene” or “chimeric gene” refers to a genetic locus comprising a DNA sequence which has been introduced into the genome of a spinach plant by transformation. A plant comprising a transgene stably integrated into its genome is referred to as “transgenic plant”.

[0040] “Transgene” or “chimeric gene” refers to a genetic locus comprising a DNA sequence which has been introduced into the genome of a spinach plant by transformation. A plant comprising a transgene stably integrated into its genome is referred to as “transgenic plant”.

[0041] “Pe” or “Peronospora effusa" or “downy mildew” refers to races of the pathogen Peronospora effusa. Pe 1-20 refer to the officially recognized races, which can be differentiated on the differential hosts of spinach, and which can be obtained from the Naktuinbouw, P.O. Box 40, 2370 AA Roelofarendsveen, The Netherlands, or via references provided by the ISF

[0042] (International Seed Federation).

[0043] “Differential hosts” or “differentials” refers to the differential hosts of spinach for distinguishing Pe 1-20, which can be obtained from the Naktuinbouw, P.O. Box 40, 2370 AA Roelofarendsveen, The Netherlands, or via references provided by the ISF (International Seed Federation).

[0044] A “Pe resistant plant” or “downy mildew resistant plant” or a plant having “Pe resistance” or a “Pe resistant phenotype” refers to a spinach plant which is resistant against one or more pathogenic races and / or pathogenic isolates of Pe, as determined in a qualitative resistance assay under controlled environmental conditions. In such a resistance assay a plurality of plants (e.g., at least 2 replicates of at least 10 plants) of a genotype, are inoculated with a sporangia suspension of the race or isolate and incubated under suitable conditions. After a suitable incubation period (e.g., 7, 8, 9, 10, 11 or more days after inoculation) the plants are evaluated for symptoms. Susceptible controls should show sporulation at the time of symptom evaluation. Any plant showing sporulation on the cotyledons (and / or on the true leaf / leaves) is considered “susceptible”, while any plant not showing any sporulation on the cotyledons (and / or on the true leaf / leaves) is considered “resistant”. Additionally, any plants showing sparse sporulation on the tips of cotyledons (and / or on the true leaf / leaves), indicative of a reduced level of infection, is considered “intermediate resistant.” A plant genotype with 95-100% of the inoculated plants being classified as “resistant” plants is considered to be resistant against the race or isolate. In the test greater than >95% of inoculated plants (preferably 100% of plants) of the susceptible control plant, such as cultivar ‘Viroflay’, should show sporulation. Suitable tests are described in Irish et al. 2007 (Plant Disease Vol. 91 No. 11 , in Materials and Methods on page 1392-1394), or in Correll et al. 2010 (“Guidelines for Spinach Downy Mildew: Peronospora farinosa f sp. spinaciae (Ps)” found on the website of the International Seed Federation).

[0045] The term “locus” (loci plural) means a specific place or places or a site on a chromosome where, for example, a gene or genetic marker is found.

[0046] The term “nucleic acid fragment” means a nucleotide polymer, where for example, a gene or genetic marker is found. The “nucleic acid fragment” may be isolated or endogenously present in Spinacia Oleracea plants or plant parts according to the invention.

[0047] The term “allele(s)” means any of one or more alternative forms of a gene at a particular locus, all of which alleles relate to one trait or characteristic at a specific locus. In a diploid cell of an organism, alleles of a given gene are located at a specific location, or locus (loci plural) on a chromosome. One allele is present on each chromosome of the pair of homologous chromosomes. A diploid plant species may comprise a large number of different alleles at a particular locus. These may be identical alleles of the gene (homozygous) or two different alleles (heterozygous).

[0048] The term “gene” means a (genomic) DNA sequence comprising a region (transcribed region), which is transcribed into a messenger RNA molecule (mRNA) in a cell, and an operably linked to regulatory region (e.g., a promoter). Different alleles of a gene are thus different alternative forms of the gene, which may be in the form of e.g., differences in one or more nucleotides of the genomic DNA sequence (e.g., in the promoter sequence, the exon sequences, intron sequences, etc.), mRNA and / or amino acid sequence of the encoded protein.

[0049] “Allelism test” refers to a genetic test whereby it can be tested whether a phenotype, such as Pe resistance, seen in two plants, is determined by the same gene or by different genes. For example, the plants to be tested are crossed with each other, the F1 is selfed and the segregation of the phenotypes amongst the F2 progeny is determined. Other segregating populations can equally be made (e.g., backcross populations). The ratio of segregation of the phenotype indicates if the genes are allelic (alleles of the same gene) or non-allelic (different, independent genes).

[0050] “Introgression fragment” or “introgression segment” or “introgression region” refers to a chromosome fragment (or chromosome part or region) which has been introduced into another plant of the same or related species by crossing or traditional breeding techniques, such as backcrossing, i.e. the introgressed fragment is the result of breeding methods referred to by the verb “to introgress” (such as backcrossing). In spinach, wild spinach or wild relatives of spinach are often used to introgress fragments of the wild genome into the genome of cultivated spinach. Such a spinach plant thus has a “genome of Spinacia oleracea”, but comprises in the genome a fragment of a wild spinach or spinach relative. It is understood that the term “introgression fragment” never includes a whole chromosome, but only a part of a chromosome. The introgression fragment can be large, e.g., even half of a chromosome, but is preferably smaller, such as about 15 Mb or less, such as about 10 Mb or less, about 9 Mb or less, about 8 Mb or less, about 7 Mb or less, about 6 Mb or less, about 5 Mb or less, about 4 Mb or less, about 3 Mb or less, about 2 Mb or less, about 1 Mb (equals 1 ,000,000 base pairs) or less, or about 0.5 Mb (equals 500,000 base pairs) or less, such as about 200,000 bp (equals 200 kilo base pairs) or less, about 100,000 bp (100 kb) or less, about 50,000 bp (50 kb) or less, about 25,000 bp (25 kb) or less.

[0051] “Physical distance” between loci (e.g., between molecular markers and / or between phenotypic markers) on the same chromosome is the actual physical distance expressed in base pairs (bp), kilobase pairs (kb) or megabase pairs (Mb). “Genetic distance” between loci (e.g., between molecular markers and / or between phenotypic markers) on the same chromosome is measured by frequency of crossing-over, or recombination frequency (RF) and is indicated in centimorgans (cM). One cM corresponds to a recombination frequency of 1 %. If no recombinants can be found, the RF is zero and the loci are either extremely close together physically or they are identical. The further apart two loci are, the higher the RF.

[0052] A genetic element, a locus, an introgression fragment or a gene or a nucleic acid fragment or allele conferring a trait (such as resistance against Pe) is said to be “obtainable from” or can be “obtained from” or “derivable from” or can be “derived from” or “as present in” or “as found in” a plant or seed if it can be transferred from the plant or seed in which it is present into another plant or seed in which it is not present (such as a line or variety) using traditional breeding techniques without resulting in a phenotypic change of the recipient plant apart from the addition of the trait conferred by the genetic element, locus, introgression fragment, gene or allele. The terms are used interchangeably and the genetic element, locus, introgression fragment, gene or allele can thus be transferred into any other genetic background lacking the trait. Not only seeds deposited and comprising the genetic element, locus, introgression fragment, gene or allele can be used, but also progeny / descendants from such seeds which have been selected to retain the genetic element, locus, introgression fragment, gene or allele, can be used and are encompassed herein, such as commercial varieties developed from the deposited seeds or from descendants thereof. Whether a plant comprises the same genetic element, locus, introgression fragment, gene or allele as obtainable from the deposited seeds can be determined by the skilled person using one or more techniques known in the art, such as phenotypic assays, whole genome sequencing, molecular marker analysis, trait mapping, chromosome painting, allelism tests and the like.

[0053] The term “traditional breeding techniques” encompasses herein crossing, backcrossing, selfing, selection, chromosome doubling, double haploid production, embryo rescue, the use of bridge species, protoplast fusion, marker assisted selection, mutation breeding etc. as known to the breeder (i.e. methods other than genetic modification / transformation / transgenic methods), by which, for example, the resistance according to the current invention can be obtained, identified, selected, and / or transferred.

[0054] A “molecular marker”, “genetic marker”, or simply “marker” as used herein, refers to a nucleotide sequence that contains, surrounds or associates with variation (polymorphism) at a given genomic locus, and can be used to identify plants having a particular allele. Molecular markers can be developed based on polymorphisms that include, but are not limited to, single nucleotide polymorphism (SNP), insertion / deletion (InDei), simple sequence repeat (SSR), presence / absence variation (PAV), and copy number variation (CNV). Methods and techniques of developing, identifying and genotyping molecular markers are well known in the art. A “single nucleotide variant” or “SNV” refers to a type of variant where one nucleotide base is replaced by another nucleotide base. SNV is similar in context with the more commonly used term “single nucleotide polymorphism (SNP)” but is a preferred term over SNP when no implications of frequency in a population are involved. For the purpose of this application, the terms SNV and SNP are used interchangeably.

[0055] As used herein, a “genetic determinant” refers to the genetic information in the genome of a plant that causes or associates with a trait of interest. Genetic determinants include, but are not limited to, nucleic acid fragments, genes, alleles, genetic markers, and quantitative trait loci (QTL).

[0056] “Mutagenesis” or “random mutagenesis” refers to a technique, by which modifications or mutations are introduced into a nucleic acid sequence in a random or non- site-specific way. For example, mutations can be induced by certain chemicals such as EMS (ethyl methanesulfonate) or ENU (N-ethyl-N-nitrosourea) or physically, e.g. by irradiation with UV or gamma rays.

[0057] “Site-specific modifications” or “site-specific genome editing”, on the other hand, rely on the action of site-specific effectors such as nucleases, nickases, recombinases, transposases, base editors. These tools recognize a certain target sequence and allow to introduce a modification at a specific location within the target sequence.

[0058] “TILLING” (Targeting Induced Local Lesions in Genomes) is a process, which allows to identify mutations in a specific gene after an (unspecific) mutagenesis has been performed. Mutagenesis may e.g. be performed using a chemical mutagen such as EMS. Then, a sensitive DNA screening technique is used to identify single base mutations. Methods for performing TILLING are known to the skilled person.

[0059] As used herein, the term “screening” refers to a process of evaluating or identifying plant material for a property of interest. The property of interest can be a phenotypic property (e.g., disease resistance), or a genotypic property (e.g., presence of a certain allele).

[0060] Description

[0061] The present invention relates to spinach plants comprising a broad spectrum resistance against at least Pe races, including at least one or more, combinations of, or each of, the Pe races 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19 and preferably also Pe 20, isolates 4US, 21 A (UA2016-21A or 2016-21 A), PV2144, Pe22-53, PV2240 and PV2201.

[0062] More specifically the plant is obtainable by (or obtained by, or derivable from, or derived from) introgression from a plant grown from seeds of which a representative sample has been deposited with NCIMB under the accession number 44393, or any plant derived therefrom. In other words, the resistance can be introduced into any other spinach plant by introgression from a plant grown from seeds of which a representative sample was deposited under the NCIMB accession number 44393, or any spinach plant derived therefrom and comprising the gene or locus / loci associated with the resistance. The deposited seeds are therefore a source of the resistance of the invention, as are spinach plants not directly obtained from the deposit, but for example indirectly obtained e.g., later released commercial varieties) and which contain the resistance gene or locus / loci of the invention.

[0063] Hence, according to an aspect, the present invention relates to a spinach plant comprising resistance at least against one or more Peronospora effusa (Pe) races 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 16, 17, 18 and 19, preferably at least Pe races 7, 8, 9, 10, 11 , 12, 13, 16, 17, 18 and 19, and / or more preferably also against Pe race 20, against one or more Pe isolates 4US also known as 4+, 21 A (UA2016-21A or 2016-21 A), PV2144, Pe22-53, PV2240 and PV2201 , wherein said resistance is conferred by a resistance gene / locus / loci, which is / are present in seeds or is / are obtainable from seeds, deposited under an accession number NCIMB 44393. The resistance trait may be inherited by a single gene, preferably a dominant gene. In another embodiment, said resistance is conferred by two or more genes, or a multilocus.

[0064] According to a preferred embodiment, the present invention relates to the spinach plant, wherein the resistance conferring gene / locus / loci comprise(s) at least one nucleotide sequence selected from the group consisting of SEQ ID NOs:1 -23, preferably from the group consisting of SEQ ID NOs:1 , 4-23, or at least one nucleotide sequence having at least 90%, at least 98%, or at least 99% sequence identity with one or more of the above sequences, respectively. Preferably, the present invention relates to the spinach plant, wherein the resistance conferring gene / locus / loci comprised) one or more nucleotide sequences having at least 90% identity, at least 95% identity, at least 98% identity and more preferably at least 99% identity to any of the SEQ ID NOs:1 -23, preferably to any of the SEQ ID NOs:1 , 4-23, said nucleotide sequences preferably comprising the SNP(s) associated with resistance. According to a further preferred embodiment, the present invention relates to the spinach plant, wherein the resistance conferring gene / locus comprises at least one nucleotide sequence selected from the group consisting of SEQ ID NOs:1 , SEQ ID 4 and SEQ 5, or at least one nucleotide sequence having at least 90%, at least 98%, or at least 99% sequence identity with one or more of the SEQ ID NOs:1 , SEQ ID 4 and SEQ 5, said nucleotide sequences comprising the SNP (s) associated with resistance.

[0065] The spinach plants disclosed herein may, or may not, have been obtained exclusively by means of an essentially biological process, as will be discussed further below.

[0066] According to a preferred embodiment, the present invention relates to the spinach plant, wherein the plant is heterozygous or homozygous for the resistance gene / locus / loci. Preferably, the resistance gene / locus / loci is / are homozygously present in the genome of the plant. According to a preferred embodiment, the present invention relates to the spinach plant comprising resistance against at least one or more, a combination, or all of the Pe races 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 16, 17, 18 and 19, preferably at least Pe races 7, 8, 9, 10, 1 1 , 12, 13, 16, 17, 18 and 19 , isolates 4US also known as 4+, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201 and preferably also Pe race 20, wherein said spinach plant comprises in its genome alleles identifiable / identified by one or more, preferably by at least two of the SEQ ID Nos: 1 to 23, preferably by one or more of the SEQ ID Nos: 1 , 4-23. Preferably, the present invention relates to a spinach plant comprising resistance against at least one or more, a combination, or all of the Pe races 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 16, 17, 18 and 19, preferably at least Pe races 7, 8, 9, 10, 11 , 12, 13, 16, 17, 18 and 19 , isolates 4US also known as 4+, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201 and preferably also Pe race 20, wherein said spinach plant comprises in its genome a resistance locus / loci on chromosome 2, comprising or associated with at least one of the sequences SEQ ID No: 1 to 23, or with sequences having at least 95%, at least 98%, or at least 99% sequence identity with one or more of the SEQ ID No: 1 to 23. Preferably, the present invention relates to a spinach plant comprising resistance against at least one or more, a combination, or all of the Pe races 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 16, 17, 18 and 19, preferably at least Pe races 7, 8, 9, 10, 11 , 12, 13, 16, 17, 18 and 19, isolates 4US also known as 4+, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201 and preferably also Pe race 20, wherein said spinach plant comprises in its genome a resistance locus / loci on chromosome 2, comprising or associated with at least one of the sequences SEQ ID No: 1 , 4-23, preferably with at least one of the sequences SEQ ID No: 1 , 4 and 5 or with sequences having at least 95%, at least 98%, or at least 99% sequence identity with one or more of the above SEQ ID Nos.

[0067] According to a preferred embodiment, the present invention relates to a seed from which any of the spinach plants of the present invention can be grown. The present invention also relates to a part of the spinach plant of the present invention, or a part of a progeny plant of the present invention, wherein the part is selected from the group consisting of: stems, cuttings, petioles, cotyledons, flowers, anthers, pollen, ovaries, roots, root tips, protoplasts, callus, microspores, stalks, ovules, shoots, seeds, embryos, embryo sacs, cells, meristems, buds, leaves.

[0068] The resistance locus or loci (and the Pe resistance phenotype conferred thereby), can be transferred from the seeds deposited under the NCIMB accession number provided above, or from progeny of said seeds, into any spinach line or variety by traditional breeding techniques and can confer resistance against one or more of Pe races 1-19, isolates 4US also known as 4+, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201 (and optionally resistance against new pathogenic isolates, e.g. Pe race 20) onto another spinach plant. Thus, for example, a spinach plant of the invention can be used as male or female parent in a cross with another spinach plant, and progeny, such as F1 , F2, F3, or further generations of selfing and / or backcross progeny (e.g., BC1 , BC2, BC1 S1 , BC2S1 , BC1 S2, etc.) can be identified and selected, whereby the progeny comprise the same Pe resistance phenotype as the initial plant ofthe invention. Selection of progeny forthe presence ofthe resistance can, therefore, be carried out using a disease resistance assay as described herein, whereby resistance against one or more (or all) of the Pe races is tested in the progeny.

[0069] According to another aspect, the present invention relates to a resistance locus or loci, wherein the locus (or loci) comprises one or more nucleic acid sequences of SEQ ID NO 1 to 23, or comprises one or more nucleotide sequences having at least 90% identity, at least 95% identity, at least 98% identity and more preferably at least 99% identity to any of the SEQ ID NOs:1 -23, said nucleotide sequences comprising the SNP(s) associated with resistance. Preferably, the present invention relates to a resistance locus, wherein the locus comprises one or more nucleic acid sequences of SEQ ID NO 1 , 4-23, preferably one or more of SEQ ID NO 1 , 4 and 5 or sequences having at least 95%, at least 98%, or at least 99% sequence identity with any of the above SEQ ID Nos, comprising the SNP(s) associated with resistance.

[0070] According to an aspect, the present invention relates to a nucleic acid fragment, associated with a broad spectrum resistance to Peronospora effusa (Pe), wherein said fragment derives from the seeds deposited under the NCIMB accession number 44393, and is located on the chromosomal interval flanked by marker allele SEQ ID No 1 and any of the marker alleles SEQ IDs No 4-23, or by sequences having at least 95%, at least 98%, or at least 99% sequence identity with one or more of the SEQ ID No: 1 , 4-23, respectively, comprising the SNP(s) associated with resistance. Preferably, the nucleic acid fragment of the present invention derives from the seeds deposited under the NCIMB accession number 44393 and is located on the chromosomal interval flanked by SEQ ID No 1 and any of the SEQ ID No 4-5, or by sequences having at least 95%, at least 98%, or at least 99% sequence identity with one or more of the SEQ ID No: 1 , 4-5, comprising the SNP(s) associated with resistance. According to another aspect, the nucleic acid fragment according to the invention and as described herein, derives from progeny of plants grown from seeds deposited under the NCIMB accession number 44393, whereby the progeny retains the Pe resistance phenotype, and preferably and the nucleic acid fragment associated with the resistance.

[0071] According to a further aspect, the nucleic acid fragment of the present invention derives from Spinacia tetrandra and is located on an interval of chromosome 2 flanked by marker allele SEQ ID No 1 and any of the marker alleles SEQ IDs No 4-23, preferably flanked by SEQ ID No 1 and any of the SEQ ID No 4-5, or by sequences having at least 95%, at least 98%, or at least 99% sequence identity with one or more of the above sequences, respectively, , comprising the SNP(s) associated with resistance. In one embodiment, the invention relates to the use of the nucleic acid fragment according to the invention as defined above, for the identification of a spinach plant having a broad spectrum resistance to Peronospora effusa (Pe).

[0072] In another embodiment, the invention relates to the use of the nucleic acid fragment according to the invention and as defined above, for transforming a plant or plant part, preferably a plant cell or a plant tissue. Preferably, the nucleic acid fragment of the present invention or a nucleic acid construct thereof, is used for the stable incorporation into the genome of a spinach cell. A seed deposited under the NCIMB accession number 44393, or a plant grown from said seed or a progeny of said plant, comprising the resistance nucleic acid fragment, is a suitable source of the nucleic acid fragment.

[0073] According to an aspect, said nucleic acid fragment or construct is fused into a plant transformation vector suitable for the stable incorporation of the nucleic acid fragment or construct into the genome of a plant cell. Typically, the stably transformed plant cell will be regenerated into a transformed plant that comprises in its genome the nucleic acid fragment or construct. Such a stably transformed plant is capable of transmitting the nucleic acid fragment or construct to progeny plants in subsequent generations via sexual and / or asexual reproduction. Plant transformation vectors, methods for stably transforming plants with an introduced nucleic acid fragment or construct and methods for plant regeneration from transformed plant cells and tissues are generally known in the art. For spinach, specific protocols have been developed for stable transformation. For example, efficient Agrobacterium-mediated transformation protocols have been developed for spinach (Zhang and Zeevaart, 1999, Plant Cell Rep 18: 640-645; Chin et al, 2009, Plant Biotechnol 26: 243-248; Naderi et al, 2012, Adv Biosci Biotechnol 3: 876-880). Any available plant transformation vector can be used in the context of this invention.

[0074] As discussed above, the nucleic acid fragment of the present invention, to be incorporated into the genome of the plant cell as described above, derives from Spinacia tetrandra and is located on an interval of chromosome 2 flanked by marker allele SEQ ID No 1 and any of the marker alleles SEQ IDs No 4-23, preferably flanked by SEQ ID No 1 and any of the SEQ ID No 4-5, or by sequences having at least 95%, at least 98%, or at least 99% sequence identity with one or more of theSEQ ID No: 1 , 4-23, respectively, comprising the SNP associated with resistance.

[0075] In one embodiment, the nucleic acid fragment according to invention and as defined herein is stably integrated into the genome of a susceptible Spinacia oleracea plant at the same location or a location that is genetically linked with the endogenous locus. This is, for example, immediately adjacent to the endogenous locus, or within 1 cM distance, which implies that the recombination frequency between the endogenous locus and the integrated nucleic acid fragment or construct is maximally one percent. The invention also relates to a vector comprising the nucleic acid fragment as defined above, and to a spinach plant comprising said vector.

[0076] According to an aspect, the resistance locus / nucleic acid fragment of the present invention, is introduced or provided by genome editing techniques (e.g CRISPR Cas), or transformation. Thus, according to a preferred embodiment, the spinach plant of the present invention is obtained by transformation, site-specific genome editing techniques such as CRISPR Cas, or random mutagenesis techniques, preferably by introduction of the nucleic acid fragment / resistance locus as defined herein, which is identifiable by one or more of SEQ ID NO:1 -23, preferably by one or more of SEQ ID No 1 , 4 -23.

[0077] Said nucleic acid fragment / resistance locus preferably derives from Spinacia tetrandra and is located on an interval of chromosome 2 flanked by marker allele SEQ ID No 1 and any of the marker alleles SEQ IDs No 4-23, preferably flanked by SEQ ID No 1 and any of the SEQ ID No 4-5, or by sequences having at least 95%, at least 98%, or at least 99% sequence identity with one or more of the SEQ ID No: 1 , 4-23, respectively, comprising the SNP(s) associated with resistance.

[0078] Hence, according to a preferred aspect, the spinach plant of the present invention is not exclusively obtained by means of an essentially biological process.

[0079] Plants obtainable or obtained by any of the above methods, or progeny thereof, are embodiments of the invention. The plants according to the invention may be any cultivated spinach, e.g., savoy, semi-savoy, flat- or smooth leaved spinach. They may be inbred lines, F1 hybrids, double haploids, transgenic plants, mutant plants, etc.

[0080] The present invention also relates to a nucleic acid fragment comprising a resistance allele from Spinacia tetrandra which confers broad-spectrum resistance to at least one or more Peronospora effusa (Pe) races 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 16, 17, 18, 19, preferably at least Pe races 7, 8, 9, 10, 11 , 12, 13, 16, 17, 18, 19, against one or more isolates 4US also known as 4+, 21 A, PV2144, PE22-53, PV2240, PV2201 and more preferably also against Pe race 20 in Spinacia oleracea.

[0081] Said resistance allele co-segregates with one or more marker sequences selected from SEQ ID NO:1 to SEQ ID NO:23, and / or any S. tetrandra genome-specific marker located in the chromosomal region flanked by SEQ ID NO:1 and SEQ ID NO:23. Preferably, said resistance allele co-segregates with one or more marker sequences selected the group consisting of SEQ ID NO:1 and SEQ ID NO: 4 to SEQ ID NO:23, preferably consisting of SEQ ID NOs: 1 , 4, and 5, and / or any S. tetrandra genome-specific marker located in the chromosomal region flanked by SEQ ID NO:1 and SEQ ID NO:23, preferably flanked by SEQ ID NO: 1 and SEQ ID NO: 5. Preferably, said resistance allele is located on chromosome 2.

[0082] Preferably said resistance allele is present in a Spinacia oleracea plant grown from seeds of which a representative sample was deposited under NCIMB accession number 44393.

[0083] In an embodiment, said resistance allele of the nucleic acid fragment is located on chromosome 2 between positions 2,942,500 bp and 6,004,293 bp, preferably between positions 2,942,500 and 3,127,853 bp.

[0084] Whether a spinach plant genotype (i.e. , a spinach line or variety) comprises resistance against one or more Pe races or isolates can be tested using qualitative disease resistance assays under controlled environment conditions. Different protocols of such assays exist and can be used by the person skilled in the art. In short, seedlings of a plurality of plants of the plant genotype to be tested (e.g., at Ieast 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, or more) are inoculated with inoculum of the Pe race and the seedlings are incubated under conditions which are favorable to the pathogen. Several days after incubation, the plants are assessed for infection symptoms, especially sporulation on the cotyledons and / or leaves (e.g., first true leaf), and each plant is categorized as “resistant” (showing no signs of sporulation) or “susceptible” (showing sporulation). If a certain percentage of all plants of a genotype are classified as “resistant”, e.g., more than about 95%, 98%, 99% (or even 100%), then the spinach plant genotype is resistant to the race tested. Obviously, also one or more control plants (e.g., a susceptible line or variety, a resistant line or variety) should be included in the assay using the same treatment(s) and environmental conditions, to ensure that the assay works as expected.

[0085] Alternatively, or in addition to the phenotypic assay, selection or identification or detection of a spinach plant (e.g., a progeny plant) comprising the resistance gene or locus / loci of the invention may be achieved by detecting one or more of the resistance alleles. This aspect will be described elsewhere herein.

[0086] In one embodiment of the invention, the spinach plant is an inbred line, especially an inbred line which can be used as a parent for F1 hybrid seed production. In another embodiment of the invention, the spinach plant is a hybrid, especially an F1 hybrid. An F1 hybrid may be generated by crossing a first inbred parent line which comprises the resistance gene or locus / loci, preferably in homozygous form, with a second inbred parent line. The first inbred parent line may be a line developed from using seeds deposited under the NCIMB accession number 44393 or from progeny of plants grown from these seeds, whereby the progeny retains the Pe resistance phenotype (and the resistance gene or locus / loci).

[0087] The second inbred parent line may be any spinach line, i.e. it may completely lack Pe resistance, or it may comprise a different Pe resistance gene (and different resistance phenotype) or it may also comprise the resistance gene or locus / loci according to the current invention. As mentioned, the spinach plant according to the invention may be any type of spinach. For example, the spinach plant may be a savoy type, a semi-savoy type or flat- or smooth leaved spinach.

[0088] The resistance of the current invention was identified in wild material from a genebank and was introduced through backcrossing into S. oleracea. In one aspect, therefore, a spinach plant is provided comprising resistance against one or more isolates of Pe 1 -19, isolates 4US also known as 4+, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201 and possibly new pathogenic isolates (e.g. Pe race 20) , wherein said resistance against Peronospora effusa is conferred by an introgression fragment from wild spinach or from a wild relative of spinach. In a preferred aspect, a spinach plant is provided comprising resistance against at least Pe races 7, 8, 9, 10, 11 , 12, 13, 16, 17, 18 and 19 and possibly new pathogenic isolates (e.g. Pe race 20) isolates 4US also known as 4+, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201.

[0089] In one embodiment, the introgression fragment is the fragment as found in (and as obtainable from; or obtained from; or derivable from; or derived from) spinach seeds, a representative sample of seeds having been deposited with the NCIMB under the accession number 44393. The fragment can be identified by various methods, such as chromosome painting or sequencing the spinach genome and identifying chromosome parts which are introgressions from wild spinach or wild relatives of spinach. The fragment can also be identified by one or more molecular markers (e.g., SNP markers, AFLP markers, RFLP markers, etc.), especially molecular markers which are polymorphic between cultivated spinach and the wild introgression fragment.

[0090] In another embodiment, the introgression fragment is derived from the fragment as found in spinach seeds, a representative sample of seeds having been deposited with the NCIMB under the accession number 44393, whereby the introgression fragment is shorter but retains the resistance gene or locus / loci (and the Pe resistance phenotype conferred by the gene). Spinach plants comprising such shorter introgression fragments can be generated by crossing a plant of the invention with another spinach plant and selecting recombinant progeny which retain the resistance phenotype conferred by the resistance gene or locus / loci, but which contain a shorter introgression fragment.

[0091] In one aspect of the invention, a method is provided for generating a spinach plant comprising a broad spectrum resistance against Pe races or isolates, said method comprising growing a plant from a seed selected from the group consisting of seeds with accession number NCIMB 44393; or a progeny thereof, wherein said spinach plant comprises a resistance gene / locus / loci, which confer(s) a broad spectrum resistance against Pe races. According to an aspect, the present invention relates to the use of one or more seeds as deposited with NCIMB under the accession number NCIMB 44393 or a progeny thereof, for generating a spinach plant comprising resistance against at least one or more Pe races 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 16, 17, 18 and 19, preferably at least Pe races7, 8, 9, 10, 11 , 12, 13, 16, 17, 18 and 19, more preferably also against one or more isolates 4US also known as 4+, 21 A (UA2016-21A or 2016-21 A), PV2144, PE22- 53, PV2240 and PV2201 , and even more preferably also against Pe race 20.

[0092] According to a preferred embodiment, a method is provided for generating a spinach plant comprising resistance at least against one or more, a combination of, or all of the Pe races or isolates known in the state of art. Preferably, a method is provided for generating a spinach plant comprising resistance at least against one or more of Pe races 1 -19, preferably against the Pe races 7, 8, 9, 10, 11 , 12, 13, 16, 17, 18 and 19, isolates 4US also known as 4+, 21A (UA2016- 21 A or 2016-21 A), PV2144, Pe22-53, PV2240 and PV2201 , and more preferably also against Pe race 20. The method comprises the steps of: a) Providing a first spinach plant comprising resistance against one or more of the above Pe races; b) Crossing said first spinach plant with a second spinach plant to produce F1 seeds; c) Optionally, selfing the plants grown from F1 seeds one or more times to produce F2, F3 or further generation selfing progeny; d) Identifying (or selecting) spinach plants grown from F1 seeds resulting from step b), or here plants grown from F1 seeds were selfed as in step c) F2 or F3 seeds resulting from step c) or further generation selfing progeny as in step c) which have resistance against said one or more Pe races; e) Optionally, crossing said identified (or selected) F1 progeny or selfing progeny to any spinach plant, to produce a backcross progeny; f) Optionally, selecting backcross progeny comprising resistance against said one or more Pe races (e.g., preferably at least Pe races 7, 8, 9, 10, 11 , 12, 13, 16, 17, 18 and 19, isolates 4US also known as 4+, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201).

[0093] In the above embodiment, the term “any spinach plant” encompasses the first spinach plant of step a), the second spinach plant of step b), or any other spinach plant.

[0094] In another embodiment a method is provided for generating a spinach plant comprising resistance at least against one or more of Pe races or isolates known in the state of art. Preferably, a method is provided for generating a spinach plant comprising resistance at least against one or more of Pe races 1 -19, preferably against the Pe races 7, 8, 9, 10, 11 , 12, 13, 16, 17, 18 and 19, isolates 4US also known as 4+, 21 A (UA2016-21 A or 2016-21 A), PV2144, Pe22- 53, PV2240 and PV2201 , and more preferably also against Pe race 20. The method comprises the steps of: a) Providing a spinach plant comprising an introgression fragment obtainable from (or as in) accession NCIMB 44393, said introgression fragment conferring resistance against at least one or more of Pe races 1 -19, preferably at least against Pe races 7, 8, 9, 10, 11 , 12, 13, 16, 17, 18 and 19, isolates 4US also known as 4+, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201 and more preferably also against Pe 20; b) Crossing said spinach plant with a second spinach plant, for example with a spinach plant which is susceptible against one or more of the Pe races and isolates as mentioned in step (a), to produce F1 seeds; c) Optionally selfing the plants grown from F1 seeds one or more times to produce F2, F3 or further generation selfing progeny; d) Identifying (or selecting) spinach plants grown from F1 seeds resulting from step b), or where plants grown from F1 seeds were selfed as in step c) F2 or F3 seeds, or further generation selfing progeny as in step c) which have resistance at least against one or more of Pe races 1-19, preferably at least against Pe races 7, 8, 9, 10, 11 , 12, 13, 16, 17, 18 and 19, isolates 4US also known as 4+, 21 A (UA2016-21 A or 2016-21 A), PV2144, Pe22-53, PV2240 and PV2201 , and more preferably also against Pe race 20, and / or which comprise the introgression fragment or a resistance-conferring part of the introgression fragment; e) Optionally, crossing said identified (or selected) F1 progeny of step (d) or selfing progeny to any spinach plant , to produce a backcross progeny; f) Optionally, selecting backcross progeny which comprises resistance against the one or more Pe races, preferably against one or more of the Pe races 1-19 (e.g., preferably at least Pe races 7, 8, 9, 10, 1 1 , 12, 13, 16, 17, ), isolates 4US also known as 4+, 21A (UA2016-21 A or 2016-21 A), PV2144, Pe22-53, PV2240, PV2201 , and more preferably also against Pe race 20, and / or which comprise the introgression fragment or a resistance-conferring part of the introgression fragment.

[0095] Regarding both methods, the following is encompassed herein.

[0096] In one aspect, the plant of a) comprises the resistance trait as found in seeds deposited under a NCIMB accession number NCIMB 44393. The spinach plant may be the plant grown from the seeds of the deposit or any spinach plant made using, or having used, the seed deposit and which retains the Pe resistance phenotype (and the gene or locus / loci conferring it). This includes commercial spinach varieties which were made using the seed deposit. Thus, the spinach plant of a) comprises the resistance gene / locus / loci according to the invention, e.g., as found in (or as obtainable from; obtained from; derivable from; derived from) NCIMB 44393. The plant in a) may therefore be a plant grown from seeds, a representative sample of which has been deposited under the NCIMB accession number 44393. Selections (or identification) in step d) and / or f) may be made based on the phenotype ( / .e., using a Pe resistance assay) and / or based on molecular methods, such as detection of molecular markers linked to the resistance gene or locus / loci, or other methods such as sequencing. Preferably, selection (or identification) in step d) and / or f) occurs by identifying the presence of one or more alternative allele in said plants / progeny, i.e. one or more of the SEQ ID No: 1 to 23, or one or more of nucleotide sequence having at least 95%, at least 98%, at least 99% sequence identity with one or more of the SEQ ID No: 1 to 23. More preferably, selection (or identification) in step d) and / or f) occurs by identifying the presence of one or more alternative allele in said plants / progeny, i.e. one or more of the SEQ ID No: 1 , 4-23, preferably of one or more of the SEQ ID No: 1 , 4-5, or one or more of nucleotide sequence having at least 95%, at least 98%, at least 99% sequence identity with one or more of the above sequences, respectively, , comprising the SNP(s) associated with resistance.

[0097] In another aspect, the present invention relates to a method for generating a spinach plant comprising resistance at least against one or more of Pe races known in the state of art. Preferably, a method is provided for generating a spinach plant comprising resistance at least against one or more of Pe races 1 -19, preferably against the Pe races 7, 8, 9, 10, 11 , 12, 13, 16, 17, 18 and 19, isolates 4US also known as 4+, 21 A (UA2016-21 A or 2016-21 A), PV2144, Pe22- 53, PV2240 and PV2201 , and more preferably also against Pe race 20, wherein the method comprises the steps of introducing or providing of a resistance locus or loci in the genome of a susceptible spinach plant thereby providing the downy mildew resistant plant, wherein the resistance locus or loci comprise(s) a nucleic acid sequence having at least 95%, at least 98%, at least 99%, or preferably 100% sequence identity with one or more of the SEQ ID NO: 1 to 23, preferably with one or more of the SEQ ID NO: 1 , 4-23.

[0098] According to a preferred aspect, the method comprises the steps of introducing or providing of a resistance locus or loci in Chromosome 2 of the genome of a susceptible Spinacia Oleracea plant thereby providing the downy mildew resistant plant, wherein the resistance locus comprise(s) a nucleic acid sequence having at least 95%, at least 98%, at least 99%, or preferably 100% sequence identity with one or more of the SEQ ID NO: 1 , 4 and 5, comprising the SNP associated with resistance.

[0099] According to another aspect, a method is provided for generating a spinach plant comprising resistance at least against one or more of Pe races 1 -19, preferably against the Pe races 7, 8, 9, 10, 1 1 , 12, 13, 16, 17, 18 and 19, isolates 4US also known as 4+, 21A (UA2016-21A or 2016- 21 A), PV2144, Pe22-53, PV2240 and PV2201 , and more preferably also against Pe race 20, wherein the method comprises the steps of introducing or providing of a resistance locus or loci in the genome of a susceptible spinach plant thereby providing the downy mildew resistant plant, wherein the resistance locus or loci is identifiable / identified by one or more of the SEQ ID NO: 1 to 23, comprising the SNP associated with resistance. Preferably, the resistance locus or loci is identifiable / identified by one or more of the SEQ ID NO: 1 , 4-23, preferably by one or more of the SEQ ID NO: 1 , 4 and 5 or a nucleic acid sequence having at least 95%, at least 98%, at least 99% sequence identity, with one or more of the above nucleic acid sequences, respectively, comprising the SNP (s) associated with resistance.

[0100] According to an aspect, the present invention relates to a method for providing a spinach plant that is resistant to downy mildew, wherein the method comprises the steps of introducing or providing of a resistance locus or loci in chromosome 2 of a susceptible Spinacia Oleracea plant thereby providing the downy mildew resistant plant, wherein the resistance locus or loci comprises a nucleic acid sequence having at least at least 95%, at least 98%, at least 99% , or preferably 100% sequence identity with one or more of the SEQ ID NO: 1 to 23, preferably with one more of the SEQ ID No 1 , 4-23, more preferably with one or more of the SEQ ID No 1 , 4-5.

[0101] According to an aspect, the present invention relates to a method for providing / generating a spinach plant that is resistant to downy mildew, said method not being an essentially biological process. Alternatively, said method does refer to or includes an essentially biological process.

[0102] According to an aspect, the resistance locus or loci of the present invention or the introgression fragment, is introduced or provided by site-specific genome editing techniques (e.g. CRISPR Cas), or other mutagenesis techniques (e.g. EMS (ethyl methanesulfonate) or ENU (N-ethyl-N- nitrosourea) or irradiation with UV or gamma rays) or transformation. Thus, according to a preferred embodiment, the spinach plant of the present invention is obtained by site-specific genome editing techniques such as CRISPR Cas, or random mutagenesis techniques, or transformation, preferably by introduction of one or more resistance alleles identifiable by one or more of SEQ ID NO:1-23, preferably by one or more of SEQ ID NO: 1 , or 4-23, even more preferably by SEQ ID NO: 1 , 4, or 5. Hence, according to a preferred aspect, the spinach plant of the present invention is not exclusively obtained by means of an essentially biological process. According to another aspect, the introduction of one or more resistance alleles identifiable by one or more of SEQ ID NO:1-23, preferably by one or more of SEQ ID NO: 1 , or 4-23, even more preferably by SEQ ID NO: 1 , 4, or 5 is done by a Agrobacterium infiltration-mediated transient expression system, based on methods known in the art.

[0103] Plants obtainable or obtained by any of the above methods, or progeny thereof, are embodiments of the invention. The plants according to the invention may be any cultivated spinach, e.g., savoy, semi-savoy, flat- or smooth leaved spinach. They may be inbred lines, F1 hybrids, double haploids, transgenic plants, mutant plants, etc.

[0104] According to an aspect, the present invention relates to a method for providing a spinach plant that is resistant to downy mildew, wherein the method comprises the steps of introducing or providing of a resistance locus / loci in chromosome 2, wherein the introducing or providing is not exclusively achieved by means of an essentially biological process. The resistance locus / loci, comprised) a nucleic acid fragment as described above.

[0105] In particular, said nucleic acid fragment comprises a resistance allele from Spinacia tetrandra which confers broad-spectrum resistance to at least one or more Peronospora effusa (Pe) races 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 16, 17, 18, 19, preferably at least Pe races 7, 8, 9, 10, 1 1 , 12, 13, 16, 17, 18, 19, against one or more isolates 4US also known as 4+, 21A, PV2144, PE22- 53, PV2240, PV2201 and more preferably also against Pe race 20 in Spinacia oleracea.

[0106] Said resistance allele co-segregates with one or more marker sequences selected from SEQ ID NO:1 to SEQ ID NO:23, and / or any S. tetrandra genome-specific marker located in the chromosomal region flanked by SEQ ID NO:1 and SEQ ID NO:23.

[0107] Preferably, said resistance allele co-segregates with one or more marker sequences selected the group consisting of SEQ ID NO:1 and SEQ ID NO: 4 to SEQ ID NO:23, preferably consisting of SEQ ID NOs: 1 , 4, and 5, and / or any S. tetrandra genome-specific marker located in the chromosomal region flanked by SEQ ID NO:1 and SEQ ID NO:23, preferably flanked by SEQ ID NO:1 and SEQ ID Nos 4 or 5 most preferably flanked by SEQ ID NO: 1 and SEQ ID NO: 5.

[0108] Preferably, said resistance allele is located on chromosome 2.

[0109] Preferably said resistance allele is present in a Spinacia oleracea plant grown from seeds of which a representative sample was deposited under NCIMB accession number 44393.

[0110] In an embodiment, said resistance allele of the nucleic acid fragment is located on chromosome 2 between positions 2,942,500 bp and 6,004,293 bp, preferably between positions 2,942,500 and 3,127,853 bp.

[0111] According to an aspect of the present invention, spinach plants according to the current invention comprise alleles identifiable / identified by one or more of SEQ ID NOs:1-23, preferably by at least two, at least three, at least four, at least five, at least six, at least ten, or more preferably by all of the SEQ ID NOs:1-23. Preferably, the plants of the present invention comprise nucleic acid sequences comprising one or more of the SEQ ID NOs:1-23. Preferably, the plants of the present invention comprise alleles identifiable / identified by one or more of SEQ ID No 1 , 4-23, more preferably by one or more of the SEQ ID No 1 , 4 and 5. Preferably, the plants of the present invention comprise nucleic acid sequences comprising one or more of the SEQ ID NOs: 1 , 4-23.

[0112] According to an aspect of the invention, the broad range resistance against the Pe races / isolates, is linked to the alleles identifiable / identified by one or more of SEQ ID NOs:1 -23, preferably by one or more of SEQ ID NOs:1 , 4-23, or to the sequences comprising one or more of the SEQ ID NOs: 1-23, preferably one or more of the SEQ ID No 1 , 4-23, or more preferably one or more of the SEQ ID No 1 , 4-5, comprising the SNPs associated with resistance. According to another embodiment, the different S. tetrandra introgression fragments are identifiable by generating specific haplotypes through the screening of KASP (Kompetitive Allele Specific PCR) markers designed on SEQ ID NOs:1-23, preferably on any of the SEQ ID No 1 , 4- 23 and more preferably on SEQ ID No 1 , 4 and 5.

[0113] Preferably, said plants according to the current invention are identifiable via use of primers directed to one or more of SEQ ID NOs:1-23, preferably to one or more of SEQ ID No 1 , 4-23 and more preferably to any of the SEQ ID No 1 , 4 and 5, whereby the presence of at least one or more of the above sequences, preferably at least SEQ ID No 4, is a prerequisite for a plant according to the current invention. In another embodiment, selection of plants or progeny according to the current invention occurs on the basis of the presence of at least one sequence selected from the group of SEQ ID NOs:1-23 or as discussed above, preferably in said plants or progeny. In step b) the first spinach plant is, in one aspect, crossed with a spinach plant which is susceptible against at least one of the Pe races against which the plant of a) is resistant. If the second parent in b), is a spinach plant which is susceptible against at least one of the Pe races against which the plant of a) is resistant, then the selection in step d) and / or f) may be based on selecting plants which now have resistance against that race. Steps e) and f) may be repeated one or more times and preferably on the basis of the sequences given in one or more of SEQ ID NOs:1-23, preferably in one or more of SEQ ID NOs:1 , 4-23, or in one or more of SEQ ID Nos 1 , 4, and 5.

[0114] In the above methods, also plants can be selected and / or identified which retain the Pe resistance phenotype according to the current invention, but which have a smaller introgression fragment. This can have advantages, as negative traits coupled to the wild introgression fragment can thereby be removed. Initial introgression fragments from wild sources can be quite large, e.g., 20 Mb or 30 Mb. It is therefore preferred to reduce the size of the introgression fragment by recombination and to select plants comprising smaller introgression fragments, but which retain the resistance-conferring part. So, spinach with all sizes of introgression fragments originating from (or derived from; or derivable from; or obtained from; or obtainable from) seeds deposited with NCIMB, under the accession number NCIMB 44393 as provided above are included herein, as long as the Pe resistance conferring part is retained in the spinach plant. As mentioned, the presence can be tested and selected phenotypically and / or using molecular methods known in the art. By preference, selection occurs on the basis of the sequence as given in one or more of SEQ ID NOs:1 -23, preferably in one or more of SEQ ID NOs:1 , 4-23.

[0115] According to an embodiment, the present invention relates to the use of one or more markers or marker sequences for selecting / identifying / detecting a spinach plant that is resistant to downy mildew, wherein said marker is designed to detect any one of the resistance alleles identifiable / identified by any of SEQ IDs No: 1 to 23, preferably by any of the SEQ IDs No: 1 , 4 to 23, preferably designed on any of the SEQ IDs No: 1 to 23, preferably on any of the SEQ IDs No: 1 , 4-23, and more preferably designed to detect any SNP associated with the resistance, within any of the SEQ ID No: 1 to 23, preferably within any SEQ ID No: 1 , 4-23 or within any nucleotide sequence having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with one or more of the above sequences, respectively, comprising the SNPs associated with the resistance.

[0116] Hence, the present invention also relates to a method for the detection of a spinach plant that is resistant to downy mildew, said method comprising the step of identifying any one, preferably one or more of the resistance alleles from the group consisting of SEQ ID No: 1 to 23, preferably one or more of the group consisting of SEQ ID No: 1 , 4-23, or identifying one or more nucleotide sequences having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with any of the SEQ ID No: 1 to 23, said nucleotide sequence(s) comprising the SNP(s) associated with resistance, or identifying one or more nucleotide sequences having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with any of the SEQ ID No: 1 , 4- 23, said nucleotide sequence(s) comprising the SNP(s) associated with resistance, or identifying one or more nucleotide sequences having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with any of the SEQ ID No: 1 , 4 and 5, said nucleotide sequence(s) comprising the SNP(s) associated with resistance.

[0117] Plants of the invention can be used to generate progeny, which have or retain the Pe resistance phenotype as obtainable from (as present in; as derivable from; as obtained or derived from) seeds deposited with NCIMB under the accession number 44393. To generate progeny, a spinach plant according to the invention can be selfed and / or crossed one or more times with another spinach plant and seeds can be collected.

[0118] The presence of resistance according to the current invention or the gene / locus / loci responsible therefore in the progeny plants can be determined by the Pe resistance phenotype and / or molecular methods, such as molecular markers (e.g., SNP markers) closely linked to the gene or locus / loci.

[0119] Also seeds from which the plants of the invention can be grown are provided. In one embodiment, the use of a spinach plant, of which representative seeds have been deposited with NCIMB under the accession number NCIMB 44393 as provided above, or progeny thereof (e.g., obtained by selfing) is provided for generating a spinach plant comprising Pe resistance at least against one or more, a combination of, or all of Pe races 1-19, isolates 4US also known as 4+, 21A (UA2016- 21 A or 2016-21 A), PV2144, Pe22-53, PV2240 and PV2201 , and preferably also against Pe race 20. Preferably the spinach plant comprises resistance against at least Pe races 7, 8, 9, 10, 1 1 , 12, 13, 16, 17, 18 and 19, isolates 4US also known as 4+, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201. In another embodiment, methods of use of a spinach plant comprising resistance against at least one or more of Pe races 1 -19, preferably Pe races 7, 8, 9, 10, 11 , 12, 13, 16, 17, 18 and 19, isolates 4US also known as 4+, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201), and preferably also against Pe race 20, conferred by an introgression fragment obtainable from (or as present in; as derivable from; as obtained or derived from) seeds deposited with NCIMB under the accession number 44393, or from progeny thereof (e.g., obtained by selfing), are provided for generating a spinach plant comprising resistance against one or more of the above Pe races and isolates.

[0120] It is noted that also allelism tests can be used to determine whether the resistance gene in a spinach plant is the same gene / locus / loci or a different gene / locus / loci as the resistance gene / locus / loci as present in the NCIMB accession number 44393 (or in progeny thereof). For instance, NCIMB 44393 (or progeny) can be crossed with another spinach plant comprising the same resistance phenotype and in progeny of such a cross one can determine in which ratios the phenotype segregates. So, in one aspect, a spinach plant is provided comprising resistance against one or more of Pe races 7, 8, 9, 10, 11 , 12, 13, 16, 17, 18 and 19, isolates 4US also known as 4+, 21 A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201 , and preferably also against Pe race 20, wherein said resistance gene / locus / loci conferring said resistance phenotype is the gene / locus / loci as present in NCIMB 44393 (or progeny thereof), as determinable in an allelism test. Allelism tests for dominant genes are known in the art (see, e.g., Hibberd et al., 1987, Phytopathology 77:1304-1307).

[0121] Also seeds from which any of the plants of the invention can be grown are provided, as are containers or packages containing or comprising such seeds. Seeds can be distinguished from other seeds due to the presence of the resistance gene / locus / loci, either phenotypically (based on plants having the resistance phenotype according to the current invention) and / or using molecular methods. Hence, the present invention also relates to a method for the detection of a spinach seed from which any of the plants of the invention can be grown, said method comprising the step of identifying any one, preferably one or more of the resistance alleles from the group consisting of SEQ ID No: 1 to 23, more preferably one or more of the resistance alleles from the group consisting of SEQ ID No: 1 , 4-5 or identifying one or more nucleotide sequences having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with any of the SEQ ID No: 1 to 23, said nucleotide sequence(s) preferably comprising the SNP(s) associated with resistance, or any of the nucleotide sequences as described above throughout the disclosure.

[0122] In one aspect, seeds are packaged into small and / or large containers (e.g., bags, cartons, cans, etc.). The seeds may be pelleted prior to packing (to form pills or pellets) and / or treated with various compounds, such as seed coatings. Pelleting creates round or rounded shapes, which are easily sown with modern sowing machines. A pelleting mixture typically contains seeds and at least glue and filler material. The latter could be, for example, clay, mica, chalk or cellulose. In addition, certain additives can be included to improve particular properties of the pellet, e.g., a seed treatment formulation comprising at least one insecticidal, acaricidal, nematocidal or fungicidal compound can be added directly into the pelleting mixture or in separate layers. A seed treatment formulation can include one of these types of compounds only, a mixture of two or more of the same type of compounds or a mixture of one or more of the same type of compounds with at least one other insecticide, acaricide, nematicide or fungicide.

[0123] Formulations especially suitable for the application as a seed treatment can be added to the seed in the form of a film coating also including the possibility of using the coating in or on a pellet, as well as including the seed treatment formulation directly into the pellet mixture. Characteristically, a film coating is a uniform, dust-free, water permeable film, evenly covering the surface of all individual seeds.

[0124] Besides the formulation, the coating mixture generally also contains other ingredients such as water, glue (typically a polymer), filler materials, pigments and certain additives to improve particular properties of the coating. Several coatings can be combined on a single seed.

[0125] In addition, several combinations with film coating are possible: the film coating can be added on the outside of the pellet, in between two layers of pelleting material, and directly on the seed before the pelleting material is added. Also, more than 1 film coating layer can be incorporated in a single pellet. A special type of pelleting is encrusting. This technique uses less filler material, and the result is a “mini-pellet”.

[0126] Seeds may also be primed. Spinach is often primed. Priming is a water-based process that is performed on seeds to increase uniformity of germination and emergence from the soil, and thus enhance vegetable stand establishment. Priming decreases the time span between the emergence of the first and the last seedlings. Methods how to prime spinach seeds are well known in the art.

[0127] In an aspect, plant parts obtained from (obtainable from) a plant of the invention are provided herein, and containers or packages comprising said plant parts. In a preferred embodiment, the plant parts are leaves of spinach plants of the invention, preferably harvested leaves, or parts of these. Leaves may be loose, bunched, fresh (e.g., in bags), frozen, blanched or boiled. Leaves may be fresh or processed, they may be part of food or feed products, such as salads, etc. Other plant parts, of plants of the invention, include stems, cuttings, petioles, cotyledons, flowers, anthers, pollen, ovaries, roots, root tips, protoplasts, callus, microspores, stalks, ovules, shoots, seeds, embryos, embryo sacs, cells, meristems, buds etc. 1

[0128] Seeds include for example seeds produced on the plant of the invention after self-pollination or seed produced after cross-pollination, e.g., pollination of a plant of the invention with pollen from another spinach plant or pollination of another spinach plant with pollen of a plant of the invention.

[0129] In an aspect, the plant part is a plant cell. In still a further aspect, the plant part is a non- regenerable cell or a regenerable cell.

[0130] In another aspect the plant cell is a somatic cell. A non-regenerable cell is a cell which cannot be regenerated into a whole plant through in vitro culture, but the non-regenerable cell may be in a plant or plant part (e.g., leaves) of the invention.

[0131] Moreover, there is provided an in vitro cell culture or tissue culture of spinach plants of the invention in which the cell- or tissue culture is derived from the plant parts described above, such as, for example and without limitation, a stem, a cutting, a petiole, a cotyledon, a hypocotyl, a flower, a seed, an anther, a pollen, an ovary, a root, a root tip, a protoplast, a callus, a microspore, a stalk, an ovule, a shoot, a seed, an embryo, an embryo sac, a cell, a meristem, a bud or a leaf, somatic cells, reproductive cells.

[0132] Also provided are spinach plants regenerated from the above-described plant parts, or regenerated from the above-described cell or tissue cultures, said regenerated plant having a Pe resistance phenotype, i.e., retains the resistance gene / locus / loci (or the introgression fragment comprising the resistance gene / locus / loci) of the invention. These plants can also be referred to as vegetative propagations of plants of the invention.

[0133] Also provided are harvested leaves of plants of the invention and packages comprising a plurality of leaves of plants of the invention. These leaves thus comprise the resistance of the invention, detectable by e.g., linked molecular markers or phenotypically (for the originally used whole plant and / or regenerated plant).

[0134] A food product may be produced suitable for edible use in humans, comprising or consisting of a plant or plant part of the plant of the invention, a progeny thereof and parts of the aforementioned plants. Preferably, said plant part is a leaf or a plurality thereof.

[0135] A feed composition or a product may also be produced, comprising or consisting of a plant or a plant part of the plant of the invention, or a plant or plant part from a progeny thereof.

[0136] The food or feed product may be fresh, raw, or processed, e.g. comminuted or chopped, thermally processed (for example, steamed, boiled, fried, blanched), encased (e.g., canned, packaged) and / or frozen etc. Examples of food products are salad or salad mixtures, or frozen vegetable mixtures comprising leaves or parts of leaves of plants of the invention. Containers such as cans, boxes, crates, bags, cartons, Modified Atmosphere Packaging, films (e.g., biodegradable films), etc. comprising plant parts of plants (fresh and / or processed) of the invention may also be provided.

[0137] A spinach plant of the invention or a progeny thereof retaining the Pe resistance phenotype conferred by the gene / locus / loci and / or retaining the introgression fragment comprising the gene / locus / loci, as present in the NCIMB accession number NCIMB 44393, and parts of the afore-mentioned plants, can be suitably packed for, e.g., transport, and / or sold fresh. Such parts encompass any cells, tissues and organs obtainable from the seedlings or plants, such as but not limited to: leaves, cuttings, pollen, parts of leaves, and the like.

[0138] Leaves may be harvested immature, as baby-leaf or baby spinach, or mature. A plant, plants or parts thereof may be packed in a container (e.g. , bags, cartons, cans, etc.) alone or together with other plants or materials. Parts can be stored and / or processed further. A container may comprise one or more spinach plants of the present invention, in a growth substrate for harvest of plant parts, preferably leaves from said plants.

[0139] In another embodiment, plants and parts of spinach plants of the invention, and progeny of spinach plants of the invention are provided, e.g., grown from seeds, produced by sexual or vegetative reproduction, regenerated from the above-described plant parts, or regenerated from cell or tissue culture, in which the reproduced (seed propagated or vegetatively propagated) plant comprises resistance at least against one or more of Pe races 1-19, preferably at least Pe races 7, 8, 9, 10, 11 , 12, 13, 16, 17, 18 and 19, isolates 4US also known as 4+, 21A (UA2016-21A or 2016-21 A), PV2144, Pe22-53, PV2240 and PV2201 , and more preferably also against Pe race 20.

[0140] As mentioned before, whether or not a plant, progeny or vegetative propagation comprises the Pe resistance phenotype as conferred by the current invention can be tested phenotypically using e.g., the Pe disease resistance assays as described above; and / or using molecular techniques such as molecular marker analysis, DNA sequencing (e.g. , whole genome sequencing to identify the wild introgression), chromosome painting, etc.

[0141] In one embodiment, the resistance gene / locus / loci obtainable from (obtained from; as found in) plants deposited with NCIMB under the accession number NCIMB 44393, or progeny thereof, can be combined with other Peronospora effusa resistance genes or resistance loci or with other traits, such resistance against bacteria (e.g., Pseudomonas syringae pv. spinacea; Erwinia carotovora), fungi (e.g., Colletotrichum dematium fsp. spinaciae; Stemphylium beticola (formerly known as Stemphylium botryosum f sp. spinaciae), Stemphylium vesicarium, Stemphylium drummondi viruses (e.g., viruses causing curly top disease), oomycetes (e.g. Albugo occidentalis), or nematodes. This can be done by traditional breeding techniques, e.g., by backcrossing in order to introduce one or more traits into a plant of the invention or in order to introduce the gene / locus / loci of a plant of the invention into another spinach plant comprising such one or more additional traits. Thus, in one aspect a plant of the invention is used as a donor of the resistance according to the current invention, while in another aspect a plant of the invention is used as recipient of one or more other traits.

[0142] Furthermore, the invention provides for progeny comprising or retaining the Pe resistance phenotype, against at least one or more Pe races 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 16, 17, 18 and 19, preferably at least Pe races 7, 8, 9, 10, 1 1 , 12, 13, 16, 17, 18, and 19, against one or more isolates 4US also known as 4+, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201 , and more preferably also against Pe race 20. Such progeny is obtained by, e.g., selfing one or more times and / or cross-pollinating a plant of the invention with another spinach plant of a different variety or breeding line, or with a spinach plant of the invention one or more times. In particular, the invention provides for progeny that retains the resistance gene / locus / loci (conferring the Pe resistance phenotype) of (as found in) the NCIMB accession number NCIMB 44393. According to a preferred embodiment, a progeny plant is provided, identifiable by one or more of SEQ ID NO 1 -23, preferably by one or more of SEQ ID NO 1 , 4- 23, more preferably by SEQ ID No 1 , 4, or 5, preferably by SEQ ID No 4, or comprising in its genome one or more nucleotide sequences having at least 90% identity, at least 95% identity, at least 98% identity and more preferably at least 99% identity to any of the SEQ ID NOs:1-23, respectively, said nucleotide sequences comprising the SNP(s) associated with resistance.

[0143] Such a progeny plant may be produced from a spinach plant comprising the resistance according to the current invention by one or more methods selected from the group consisting of: selfing, crossing, mutation, double haploid production or transformation.

[0144] Mutation may be spontaneous mutations or human induced mutations or somaclonal mutations. In one embodiment, plants or seeds of the invention may also be mutated by random mutagenesis (by e.g., irradiation, chemical mutagenesis, heat treatment, TILLING, etc.) and / or mutated seeds or plants may be selected (e.g., natural variants, somaclonal variants, etc.) in order to change one or more characteristics of the plants.

[0145] In some embodiments, the resistance alleles can be modified or mutated using mutagenesis techniques, site-specific gene editing techniques, or other methods known in the art to obtain the plants of the current disclosure. In some embodiments, the site-specific gene editing technique is selected from the group of transcription activator-like effector nuclease (TALEN) gene editing techniques, clustered Regularly Interspaced Short Palindromic Repeat (CRISPR / Cas9) gene editing techniques, or zinc- finger nuclease (ZFN) gene editing techniques. In some embodiments, the mutation is introduced using one or more vectors including gene editing components selected from the group of a CRISPR / Cas9 system, a TALEN, a zinc finger, and a meganuclease designed to target a nucleic acid sequence encoding a resistance gene.

[0146] Similarly, plants of the invention may be transformed and regenerated, whereby one or more chimeric genes are introduced into the plants. Transformation can be carried out using standard methods, such as Agrobacterium tumefaciens mediated transformation or biolistics, followed by selection of the transformed cells and regeneration into plants.

[0147] A desired trait (e.g., genes conferring pest or disease resistance, herbicide, fungicide or insecticide tolerance, etc.) can be introduced into the plants, or progeny thereof, by transforming a plant of the invention or progeny thereof with a transgene that confers the desired trait, wherein the transformed plant retains the resistance according to the current invention and the Pe resistance phenotype conferred by it and contains the desired trait.

[0148] The resistance nucleic acid fragment or locus / loci may be transferred to progeny by further breeding. In one aspect progeny are F1 progeny obtained by crossing a plant of the invention with another plant or S1 progeny obtained by selfing a plant of the invention. Also encompassed are F2 progeny obtained by selfing the F1 plants, or further generation progeny. “Further breeding” encompasses traditional breeding techniques (e.g., selfing, crossing, backcrossing), marker-assisted breeding, and / or mutation breeding. In one embodiment, the progeny has the Pe resistance phenotype of a plant derivable from a seed deposited with NCIMB under the accession number NCIMB 44393 as provided above.

[0149] The current invention also relates to a method for producing spinach seed, comprising crossing a plant of the invention with itself or a different spinach plant and harvesting the resulting seed. In an embodiment, the invention relates to seed produced according to this method and / or a spinach plant produced by growing such seed. Thus, a plant of the invention may be used as male and / or female parent, in the production of spinach seeds, whereby the plants grown from said seeds comprise resistance at least against one or more of Pe races 1-19, preferably Pe races 7, 8, 9, 10, 11 , 12, 13, 16, 17, 18 and 19, isolates 4US also known as 4+, 21A (UA2016- 21 A or 2016-21 A), PV2144, Pe22-53, PV2240 and PV2201 and more preferably also against Pe race 20.

[0150] Thus, in one aspect, progeny of a spinach plant of the invention is provided, wherein the progeny plant is produced by selfing, crossing, mutation, or transformation and wherein the progeny retain the resistance gene / locus / loci (and phenotype conferred by it) described herein, i.e. obtainable by crossing a spinach plant, grown from seeds deposited under the NCIMB accession number provided above, with another spinach plant. In other words, the resistance gene or locus (or introgression fragment comprising the gene or locus) present in or as derivable from seed deposited with NCIMB under the accession number provided above, is retained in the progeny plants.

[0151] Molecular markers may also be used to aid in the identification of the plants (or plant parts or nucleic acids obtained therefrom) containing the resistance gene or locus or allele(s). For example, one can develop one or more suitable molecular markers which are closely genetically (and preferably also physically) linked to the resistance gene, locus or allele. This can be done by crossing a resistant spinach plant with a susceptible spinach plant and developing a segregating population (e.g., F2 or backcross population) from that cross. The segregating population can then be phenotyped for Pe resistance and genotyped using e.g., molecular markers such as SNPs (Single Nucleotide Polymorphisms), AFLPs (Amplified Fragment Length Polymorphisms; see, e.g., EP 534 858), or others, and by software analysis molecular markers which co-segregate with the Pe resistance trait in the segregating population can be identified and their order and genetic distance (centimorgan distance, cM) to the resistance gene or locus can be identified. Molecular markers which are closely linked to resistance locus or loci, e.g., markers at a 5 cM distance or less, can then be used in detecting and / or selecting plants (e.g., plants of the invention or progeny of a plant of the invention) or plant parts comprising or retaining the introgression fragment comprising the resistance gene or locus. Such closely linked molecular markers can replace phenotypic selection (or be used in addition to phenotypic selection) in breeding programs, i.e. in Marker Assisted Selection (MAS). Preferably flanking markers are used in MAS, i.e. one marker on either side of the resistance gene or locus / loci.

[0152] Any other type of molecular marker and / or other assay that is able to identify the relative presence or absence of a trait of interest in a plant or plant part can also be useful for breeding purposes.

[0153] Said progeny plants according to the current invention comprise alleles identifiable by one or more of SEQ ID NOs:1-23, preferably by one or more of SEQ ID NOs:1 , 4-23. Preferably, said progeny plants comprise alleles identifiable by two or more of SEQ ID NOs:1 -23. Preferably, said progeny plants comprise alleles identifiable by one or more of SEQ ID NOs:1 , 4-23, i.e. at least one, or at least two of any of the SEQ ID NOs:1 , 4-23.. According to another aspect, the progeny plants of the present invention comprise alleles or sequences comprising one or more of the SEQ ID NOs:1-23, preferably comprising at least one, or at least two or at least three or at least four of the SEQ ID NOs:1 , 4-23, or at least one, or at least two of the SEQ ID NOs:1 , 4 and 5. According to another embodiment, the introgression fragments, preferably comprising one or more of SEQ ID NOs:1 -23, preferably one or more of SEQ ID NOs:1 , 4-23, are derived from S. tetrandra. Preferably, the different S. tetrandra introgression fragments and / or SEQ ID NOs:1- 23, are identifiable by generating specific haplotypes through the screening of KASP (Kompetitive Allele Specific PCR) markers designed on SEQ ID NOs:1-23, preferably designed on SEQ ID NOs:1 , 4-23, more preferably designed on SEQ ID NOs:1 , 4- 5. According to an aspect of this invention, the progeny plants according to the current invention are identifiable via use of primers directed to one or more of SEQ ID NOs:1-23, preferably to one or more of SEQ ID NOs:1 , 4-23, more preferably to one or more of SEQ 1 , 4 and 5, whereby the presence of at least one or more of the above sequences, is a prerequisite for a plant according to the current invention. In some embodiments, selection of plants according to the current invention occurs on the basis of the presence of at least one sequence selected from SEQ ID NOs:1-23, preferably on the basis of the presence of at least one sequence selected from SEQ ID NOs:1 , 4-23.

[0154] In another aspect, the invention relates to the use of one or more marker sequences selected from SEQ ID NO:1 to SEQ ID NO:23, and / or any Spinacia tetrandra genome-specific marker located in between SEQ ID NO:1 and SEQ ID NO:23, for identifying or developing Peronospora effusa resistant Spinacia oleracea plants.

[0155] In an embodiment, the marker sequences are selected from SEQ ID NO:1 and SEQ ID NO:4 to SEQ ID NO:23, preferably the marker sequences are selected from SEQ ID NO:1 , SEQ ID NO:4, and SEQ ID NO:5.

[0156] In another or further embodiment, the marker sequences are selected from Spinacia tetrandra genome-specific marker located in between SEQ ID NO:1 and SEQ ID NO:5.

[0157] According to an aspect, the present invention relates to a method for identifying a spinach plant that is resistant to downy mildew caused by any of the abovementioned Pe races / isolates, the method comprising the steps of:

[0158] - isolating or providing plant material of the spinach plant;

[0159] - detecting in the plant material one or more of the sequences from the group consisting of SEQ ID NO 1 to 23, preferably from the group consisting of SEQ ID NO 1 , 4-23 or

[0160] - detecting in the plant material at least one sequence having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with any of the SEQ ID NO: 1 to 23, preferably with any of the SEQ ID NO 1 , 4-23, comprising a SNP associated with the resistance, as herein disclosed.

[0161] Preferably, at least one of SEQ ID NO: 1 , 4, or 5 are detected, or sequences having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with any of said sequences, comprising the SNP(s) associated with the resistance.

[0162] At present, all previously known Peronospora effusa resistance in spinach originate from (a combination of) resistant alleles present on chromosome 3 and 1 in spinach. The plant of the present invention comprises at least a resistance locus / loci on chromosome 2. Thus, the advantage is provided to combine or stack multiple resistance genes present in different chromosomes, into one sole spinach plant.

[0163] The present invention thus also relates to a method for introducing or providing of a combination of resistance loci conferring resistance or tolerance to downy mildew, in the genome of a susceptible spinach plant, said method comprising the steps of:

[0164] - introducing or providing of a resistance locus or loci in chromosome 2, wherein the resistance locus (or loci) comprise(s) a nucleic acid sequence having at least 85%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity with one or more of the SEQ ID NO: 1 to 23, preferably with one or more of the SEQ ID NO: 1 , 4 to 23, as flanking regions, having the SNP(s) associated with resistance;

[0165] - introducing or providing of a resistance locus or loci in chromosome 3, wherein the resistance locus (or loci) in chromosome 3 comprise(s) one or more of the SEQ ID NOs 1-15 as defined in PCT / EP2023 / 071866, the latter sequences which have been renumbered in the present application to refer to SEQ ID NO: 24 to 38 respectively; and / or

[0166] - introducing or providing of a resistance locus (or loci) in chromosome 4, wherein the resistance locus or loci comprise(s) any of the SEQ ID No: 241 to 251 , preferably any of the SEQ ID No 247 to SEQ ID No 251 as defined in WQ2023012342, the latter sequences which have been renumbered in the present application to refer to SEQ ID NO: 39 to 49 respectively, preferably SEQ ID NO: 45 to 49.

[0167] As such, the method for introducing or providing of a combination of resistance loci conferring resistance or tolerance to downy mildew, in the genome of a susceptible spinach plant, comprises the steps of:

[0168] - introducing or providing of a resistance locus or loci in chromosome 2, wherein the resistance locus (or loci) comprise(s) a nucleic acid sequence having at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with one or more of the SEQ ID NO: 1 to 23, preferably with one or more of the SEQ ID NO: 1 , 4 to 23;

[0169] - introducing or providing of a resistance locus (or loci) in chromosome 3, wherein the resistance locus or loci in chromosome 3 comprised) one or more of the SEQ ID NO: 24 to 38; and / or

[0170] - introducing or providing of a resistance locus (or loci) in chromosome 4, wherein the resistance locus or loci comprise(s) any of the SEQ ID NO: 39 to 49, preferably SEQ ID NO: 45 to 49.

[0171] Preferably, the steps of introducing or providing of the resistance locus or loci, in chromosome 2 and chromosome 3 and / or chromosome 4, comprise means of site-specific genome editing or random mutagenesis, or transformation, as described above in any one of the embodiments and / or using methods as generally known in the art.

[0172] SEQ ID NOs 1 -23 are as described above, and preferably are related to chromosome 2.

[0173] SEQ ID NOs 24-38 preferably are related to chromosome 3. Said sequences preferably are introgression fragments obtainable from S. tetrandra, preferably identifiable through the screening of KASP (Kompetitive Allele Specific PCR) markers designed on SEQ ID NOs:24-38.

[0174] One or more of said resistance loci may be introduced or provided in chromosome 3, such as 1 , 2, 3, 4, 5, 6; 7, 8, 9, 10, or even more loci. Spinach plants into which said locus or loci have been introduced or provided may comprise alleles identifiable by one or more of the SEQ ID NOs: 24- 38.

[0175] Spinach plants to which said locus or loci have been introduced may be identifiable via use of primers directed to one or more of SEQ ID NOs:24-38, whereby the presence of at least one or more of the above sequences, preferably at least 6 or more of the above sequences is preferred.

[0176] Also, selection of progeny plants of said plants preferably occurs on the basis of the presence of at least one sequence, preferably of at least two of the sequences selected from SEQ ID NOs:24- 38 in said plants or progeny.

[0177] Also plants can be selected, obtained and / or identified which retain the Pe resistance phenotype, but which have a smaller introgression fragment. This can have advantages, as negative traits coupled to the wild introgression fragment can thereby be removed. Initial introgression fragments from wild sources can be quite large, e.g., 20 Mb or 30 Mb. It is therefore preferred to reduce the size of the introgression fragment by recombination and to select plants comprising smaller introgression fragments, but which retain the resistance-conferring part. So, spinach with all sizes of introgression fragments originating from said SEQ ID NOs 24-38, as long as the Pe resistance conferring part is retained in the spinach plant. As mentioned, the presence can be tested and selected phenotypically and / or using molecular methods known in the art. By preference, selection / identification occurs on the basis of the sequence as given in one or more of SEQ ID NOs:24-38.

[0178] Said providing or introducing of a resistance locus or loci in chromosome 3, wherein the resistance locus or loci in chromosome 3 comprise(s) one or more of the SEQ ID NO: 24 to 38, may be obtained by site specific genome editing techniques such as CRISPR Cas, or random mutagenesis techniques, preferably by introduction of one or more resistance alleles identifiable by one or more of SEQ ID NO:24-38. In addition, also SEQ ID NOs 39-49 are preferably related to chromosome 4. They are preferably identified through the screening of KASP (Kompetitive Allele Specific PCR) markers designed on SEQ ID NOs:39-49.

[0179] SEQ ID NO 39-49 relate to markers, (i.e., including marker loci and nucleic acids corresponding to (or derived from) these marker loci, such as probes and amplification products) useful for genotyping plants, correlated with a susceptibility (S) gene in spinach, for example Spov3_chr4_93275081 , Spov3_chr4_105049870, Spov3_chr4_107241402,

[0180] Spov3_chr4_109546568, Spov3_chr4_109698808, Spov3_chr4_1 12008390,

[0181] Spov3_chr4_112574123, Spov3_chr4_1 17783935, Spov3_chr4_118191085,

[0182] Spov3_chr4_118788268, and Spov3_chr4_121142541 , each located on chromosome 4, as described below. Such molecular markers are useful for selecting spinach plants that are resistant to downy mildew. Accordingly, these markers are useful for marker assisted selection (MAS) and breeding of downy mildew resistant lines and identification of resistant lines. The markers of the invention are also used to identify and define chromosome intervals corresponding to an S-gene. An S-gene can be isolated by positional cloning, e.g. of the genetic interval defined by a pair of markers described herein or subsequences of an interval defined by and including such markers. In addition, an S-gene isolated from one organism, e.g. spinach, can, in turn, serve to isolate homologues of an S-gene in other organisms, including a variety of commercially important crops.

[0183] Table 1 :

[0184] The chromosome 4 interval may encompass any of the markers identified herein as being associated with the downy mildew resistance trait including a ‘T at Spov3_chr4_93275081 (position 101 of reference sequence SEQ ID NO: 39), an “A” at Spov3_chr4_105049870 (position 101 of reference sequence SEQ ID NO: 40), an “A” at Spov3_chr4_107241402 (position 101 of reference sequence SEQ ID NO: 41), an “A” at Spov3_chr4_109546568 (position 101 of reference sequence SEQ ID NO: 42), an “A” at Spov3_chr4_109698808 (position 101 of reference sequence SEQ ID NO: 43), an “A” at Spov3_chr4_1 12008390 (position 101 of reference sequence SEQ ID NO: 44), a “T” at Spov3_chr4_112574123 (position 101 of reference sequence SEQ ID NO: 45), a “T” at Spov3_chr4_117783935 (position 101 of reference sequence SEQ ID NO: 46), an “A” at Spov3_chr4_118191085 (position 101 of reference sequence SEQ ID NO: 47), an “A” at Spov3_chr4_118788268 (position 101 of reference sequence SEQ ID NO: 48), and an “A” at Spov3_chr4_121142541 (position 101 of reference sequence SEQ ID NO: 49).

[0185] Most preferred markers relate to SEQ ID NO: 45-49, comprising respectively a “T” at

[0186] Spov3_chr4_112574123 (position 101 of reference sequence SEQ ID NO: 45), a “T” at

[0187] Spov3_chr4_117783935 (position 101 of reference sequence SEQ ID NO: 46), an “A” at

[0188] Spov3_chr4_118191085 (position 101 of reference sequence SEQ ID NO: 47), an “A” at

[0189] Spov3_chr4_118788268 (position 101 of reference sequence SEQ ID NO: 48), and an “A” at Spov3_chr4_121142541 (position 101 of reference sequence SEQ ID NO: 49).

[0190] Any marker located within these intervals related to SEQ ID NO 39 to 49 can find use as a marker for downy mildew resistance and can be used in the context of the methods presented herein to identify and / or select plants that have resistance to downy mildew, whether it is newly conferred or enhanced compared to a control plant.

[0191] This thus provides the means to identify disease resistant spinach plants that comprise altered expression of an S-gene by identifying plants having a specified allele, e.g., at one or more of markers Spov3_chr4_93275081 , Spov3_chr4_105049870, Spov3_chr4_107241402,

[0192] Spov3_chr4_109546568, Spov3_chr4_109698808, Spov3_chr4_112008390,

[0193] Spov3_chr4_112574123, Spov3_chr4_1 17783935, Spov3_chr4_118191085,

[0194] Spov3_chr4_118788268, and Spov3_chr4_121142541 , preferably as shown in table 1 shown above. Similarly, by identifying plants lacking the desired allele, plants without the disease resistance can be identified and, e.g., eliminated from subsequent crosses.

[0195] Preferably, a method of identifying a spinach plant with increased resistance to downy mildew, may comprise a) detecting in a spinach plant an allele associated with increased resistance to downy mildew, wherein the resistant allele comprises a “T” at Spov3_chr4_93275081 , an “A” at Spov3_chr4_105049870, an “A” at Spov3_chr4_107241402, an “A” at Spov3_chr4_109546568, an “A” at Spov3_chr4_109698808, an “A” at Spov3_chr4_112008390, a “T” at Spov3_chr4_112574123, a “T” at Spov3_chr4_117783935, an “A” at Spov3_chr4_118191085, an “A” at Spov3_chr4_118788268, or an “A” at Spov3_chr4_121142541 ; and b) identifying a spinach plant comprising the resistant gene allele as having increased resistance to downy mildew. Thus, a method of identifying and / or selecting a spinach plant having increased resistance to downy mildew, may comprise: a) screening a population with a marker located within an interval on chromosome 4 comprising and flanked by SEQ ID NO: 39 and SEQ ID NO: 49 to determine if one or more plants from the population comprise a resistant allele; and b) selecting from said population at least one plant comprising the resistant allele. Said method may further comprise: c) crossing the plant of b) to a second plant; and d) obtaining a progeny plant that has the resistant allele. Most preferably, the resistant allele comprises a “T” at Spov3_chr4_93275081 , an “A” at Spov3_chr4_105049870, an “A” at Spov3_chr4_107241402, an “A” at Spov3_chr4_109546568, an “A” at Spov3_chr4_109698808, an “A” at Spov3_chr4_112008390, a “T” at Spov3_chr4_112574123, a “T” at Spov3_chr4_1 17783935, an “A” at Spov3_chr4_118191085, an “A” at Spov3_chr4_118788268, or an “A” at Spov3_chr4_121 142541.

[0196] Hence, according to a preferred embodiment, the present invention relates to a plant comprising a combination of: i) a genomic fragment located on chromosome 2, said genomic fragment conferring resistance to at least one or more Pe races selected from the group of Pe races 1 to 19 and preferably also Pe race 20, comprising at least one nucleic acid sequence having at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity, preferably 100% with one or more of the SEQ ID NO: 1 to 23; and ii) a genomic fragment located on chromosome 3, said genomic fragment conferring resistance to a broad range of Pe races, comprising at least one nucleic acid sequence having at least 85%, at least 90%, at least 95%, at least 98%, or at least 99%, preferably 100% sequence identity with the SEQ ID NO: 24 to 38; and / or iii) a genomic fragment located on chromosome 4, said genomic fragment conferring resistance to a broad range of Pe, comprising at least one nucleic acid sequence having at least 85%, at least 90%, at least 95%, at least 98%, or at least 99%, preferably 100 sequence identity with SEQ ID NO: 39 to 49, preferably SEQ ID NO: 45 to 49.

[0197] Preferably, such plant comprises at least one or more genomic fragments as in i), and further comprises one or more genomic fragments as in ii), iii), or a combination thereof. Preferably, such plants are not exclusively obtained by means of an essentially biological process.

[0198] Preferably, and unless explicitly indicated otherwise, any reference to a nucleic acid sequence having at least 85%, at least 90%, at least 95%, at least 98%, or at least 99%, and preferably 100%, sequence identity with a sequence identified by a specific SEQ ID NO, is intended to also expressly discloses nucleic acid sequences having any intermediate identity value falling between the explicitly mentioned thresholds, including, at least 85.0%, at least 85.1 %, at least

[0199] 85.2%, at least 85.3%, at least 85.4%, at least 85.5%, at least 85.6% , at least 85.7%, at least

[0200] 85.8%, at least 85.9%, at least 86.0%, at least 86.1 %, at least 86.2%, at least 86.3%, at least 86.4%, at least 86.5%, at least 86.6%, at least 86.7%, at least 86.8%, at least 86.9%, at least

[0201] 87.0%, at least 87.1 %, at least 87.2%, at least 87.3%, at least 87.4%, at least 87.5%, at least

[0202] 87.6%, at least 87.7%, at least 87.8%, at least 87.9%, at least 88.0%, at least 88.1%, at least

[0203] 88.2%, at least 88.3%, at least 88.4%, at least 88.5%, at least 88.6%, at least 88.7%, at least

[0204] 88.8%, at least 88.9%, at least 89.0%, at least 89.1 %, at least 89.2%, at least 89.3%, at least

[0205] 89.4%, at least 89.5%, at least 89.6%, at least 89.7%, at least 89.8%, at least 89.9%, at least

[0206] 90.0%, at least 90.1 %, at least 90.2%, at least 90.3%, at least 90.4%, at least 90.5%, at least

[0207] 90.6%, at least 90.7%, at least 90.8%, at least 90.9%, at least 91.0%, at least 91.1%, at least

[0208] 91.2%, at least 91.3%, at least 91.4%, at least 91 .5%, at least 91.6%, at least 91.7%, at least

[0209] 91.8%, at least 91.9%, at least 92.0%, at least 92.1 %, at least 92.2%, at least 92.3%, at least

[0210] 92.4%, at least 92.5%, at least 92.6%, at least 92.7%, at least 92.8%, at least 92.9%, at least

[0211] 93.0%, at least 93.1 %, at least 93.2%, at least 93.3%, at least 93.4%, at least 93.5%, at least

[0212] 93.6%, at least 93.7%, at least 93.8%, at least 93.9%, at least 94.0%, at least 94.1%, at least

[0213] 94.2%, at least 94.3%, at least 94.4%, at least 94.5%, at least 94.6%, at least 94.7%, at least

[0214] 94.8%, at least 94.9%, at least 95.0%, at least 95.1 %, at least 95.2%, at least 95.3%, at least

[0215] 95.4%, at least 95.5%, at least 95.6%, at least 95.7%, at least 95.8%, at least 95.9%, at least

[0216] 96.0%, at least 96.1 %, at least 96.2%, at least 96.3%, at least 96.4%, at least 96.5%, at least

[0217] 96.6%, at least 96.7%, at least 96.8%, at least 96.9%, at least 97.0%, at least 97.1%, at least

[0218] 97.2%, at least 97.3%, at least 97.4%, at least 97.5%, at least 97.6%, at least 97.7%, at least

[0219] 97.8%, at least 97.9%, at least 98.0%, at least 98.1 %, at least 98.2%, at least 98.3%, at least

[0220] 98.4%, at least 98.5%, at least 98.6%, at least 98.7%, at least 98.8%, at least 98.9%, at least

[0221] 99.0%, at least 99.1 %, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least

[0222] 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, or at least 100.0% sequence identity with the referenced sequence. All such identity levels are hereby expressly disclosed and encompassed within the scope of this application.

[0223] DEPOSIT INFORMATION

[0224] Seeds of spinach line X21-018-08, also referred to as line X21 -018-8, were deposited with NCMB under the accession number NCIMB 44393 by KWS Vegetables B.V. on 10 / 06 / 2024, at the NCIMB Ltd. Wellheads Place, Aberdeen, Dyce, AB21 7GB Scotland (NCIMB). Subject to 37 C.F.R. § 1 .808(b), all restrictions imposed by the depositor on the availability to the public of the deposited material will be irrevocably removed upon the granting of the patent. The deposit will be maintained for a period of 30 years, or 5 years after the most recent request or for the enforceable life of the patent whichever is longer, and will be replaced if it ever becomes nonviable during that period. Applicant does not waive any rights granted under this patent on this application or under the Plant Variety Protection Act (7 USC 2321 et seq.). The biological material shall be made available as provided for under Rule 13bis.6 PCT and Rule 32(1) EPC only by the issuance of a sample to an Expert. EXAMPLES

[0225] The present disclosure will be more fully understood by reference to the following examples. It should not, however, be construed as limiting the scope of the present disclosure. It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims.

[0226] Example 1 : Downy Mildew-Resistant Spinach Family X21-018-8, corresponding to NCIMB accession number 44393.

[0227] Origin of Breeding:

[0228] The ‘X21-018 progeny’ spinach lines were developed by first crossing a plant of variety ‘Viroflay’ (S. oleracea) with 19 accessions of Spinacia tetrandra (see crossing scheme below, scheme 1).

[0229] Scheme 1 :

[0230] Year 1

[0231] V ccessions

[0232] Year 2 Fl

[0233] Year 3 W03-324-4-6-3 / 5 BC1

[0234] Year 4 X21-018

[0235] Bio-assay mix

[0236] Year 5 X21-018-X BC2S1

[0237] Bio-assays and genotyping

[0238] Year s X21-018-X-X BC2S2 Bio-assays and genotyping

[0239] Year 7 Bio-assays and genotyping Step 1 : crossing between cultivar ‘Viroflay’ (S. oleracea) and with 19 accessions of Spinacia tetrandra (Table II); TABLE II. Spinacia tetrandra accessions used in Step 1 of the outlined crossing scheme. CGN number is the collection number of the Dutch Center of Genetic Resources. PI numbers have been retrieved from USDA Plant Introduction stations.

[0240] Step 2: crossing of F1 progeny plants from step 1 with a S. oleracea cultivar with internal reference ‘B11-509-7-41-2’;

[0241] Step 3: crossing of F1 progeny plants from step 2 with a S. oleracea cultivar with an elite line with internal reference ‘W03-324-4-6-3 / 5’ leading to the (BC2) X21-018 progeny; Step 4: thousands of seedlings of the X21-018 progeny were inoculated with a mixture of Peronospora effusa (Pe) Pe 16, Pe 19 and isolate 4US also known as 4+.

[0242] Step 5: Survivors ( / .e. resistant) plants of the inoculations from step 4 were selfed leading to the (BC2S1 ) X21 -018-X families; Step 6: 74 inbred families from step 5 were retested with Pe 16, Pe 19 Pe isolates 4US also known as 4+.and 21A (UA2016-21A or 2016-21A). A set of 80 SNP markers were used to genotype the inbred families;

[0243] Step 7: 1 inbred family (X21-018-8) from step 6 was segregating for the resistance to Pe-isolates 4US also known as 4+, Pe 16, Pe 19 and non-denominated isolate 21A (UA2016-21A or 2016- 21A);

[0244] Marker analyses were performed, which indicated that the segregation resistance observed in family X21-018-8 did not correlated with known resistance genes from Chromosome 3 that provide resistance to Pe-isolates 4US also known as 4+, Pe 16, Pe 19 and non-denominated isolate 21 A (UA2016-21A or 2016-21 A). Seventeen plants were selfed leading to (BC2S2) X21- 018-8-X families. These seventeen X21-018-8-X families were screened in a bioassay with Pe 16. A Bulk Segregant Analysis was performed on family X21 -018-8-4, which showed a clear segregation of resistance towards Pe 16. A Resistant (R, 20 plants) and a Susceptible (S, 19 plants) pool, was sequenced with I lluminia and analyzed. The analyses indicate that resistance in X21 -018-8-4 is determined by a previously unknown locus from S. tetrandra on chrom 2.

[0245] Seeds from the family X21-018-8 were deposited with the NCIMB under number 44393.

[0246] Example 2: Fine-mapping of the novel resistance locus from S. tetrandra on Chromosome 2

[0247] Eleven hundred and seventy plants from X21-018-8-X families were screened by 21 markers on Chromosome 2 designed to differentiate between S. tetrandra and S. oleracea. Sixteen plants with a recombination in resistance region were selected and selfed (X21 -018-8-X). All 16 inbred families were subjected to a bioassay with Pe 16 and an additional marker screening, resulting in further fine-mapping of the resistance locus to rSPOVchr2:2942500 - rSPOVchr2:6004293 (WUR; Viroflay 104-b)

[0248] Example 3: Validation fine-mapping of the novel resistance locus from S. tetrandra on Chromosome 2

[0249] Thirty-nine plants from X21 -018-8-X may be selfed and the offspring may be genotyped using markers designed on Seq ID:1-23 to differentiate between S. tetrandra and S. oleracea. Moreover, the plants may be subjected to a bioassay with Pe 16 to confirm the location of resistance locus, or potentially further narrow down the region.

[0250] Table 3 with Seq IDs:

[0251] Example 4: Resistance spectrum of the novel resistance locus from S. tetrandra on Chrom 2

[0252] Genotypes of plants from X21 -018-8-X-X families may be identified using one or more of the flanking markers identified as SEQ ID NO: 1 to SEQ ID NO: 23. Identified plants may be selected for the presence of the novel Chrom 2 resistance locus and the absence of other known resistance loci, such as Chrom 3. Such identified plants may be subjected to bioassays for all denominated and non-denominated Pe isolates to confirm that the novel Chrom 2 resistance locus provides resistance to all downy mildew (Pe) isolates, including Pe 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20 4+, 21 A, and non-denominated isolates.

[0253] Example 5: Further fine mapping.

[0254] Preliminary fine-mapping data suggest that certain SEQ ID NOs, in particular SEQ ID NOs: 1 and 4-23, and more specifically SEQ ID NOs: 1 , 4, and 5, may be especially informative or strongly associated with the resistance phenotype, as well as regions flanked by SEQ ID NO 1 and 4, or SEQ ID NO 1 and 5. Nonetheless, based on the currently available data, all SEQ ID NOs: 1-23 are considered to be linked to, indicative of, or co-seg regating with the resistance trait, and are therefore included within the scope of the invention.

[0255] Example 6: Stable transformation of susceptible spinach with resistance locus

[0256] A nucleic acid fragment derived from Spinacia tetrandra and comprising resistance-associated SNPs located within SEQ ID NOs:1 , 4 and 5, is cloned into a plant transformation vector under control of a spinach-compatible promoter. The construct is introduced into susceptible Spinacia oleracea via Agrobacterium-mediated transformation, using protocols as described in Chin et al., 2009 and Naderi et al., 2012, adapted for spinach. Edited plants are identified by sequencing and evaluated for resistance to Peronospora effusa. The edited genotype displays full resistance across multiple Pe races, comparable to that of the resistant donor genotype NCIMB 44393.

[0257] While Example 6 refers to specific SEQ ID NOs, it is understood that similar genome editing and / or transformation protocols can be applied to other SEQ ID NOs that are linked to or cosegregate with the resistance trait. These examples are provided for illustrative purposes only and are not intended to limit the scope of the invention.

[0258] Sequence listing

[0259] SEQ ID NO: 1 to 23 are as shown above in Table 3.

[0260] Each of the following sequence variants 1 to 23 (i.e. SEQ ID NO: 50 to 72 below), consist of two variants (i.e. a reference and an alternative allele - not necessarily in this order), as being indicated within the brackets. The alternative alleles associated with the resistance, are provided in Table 3 where the variation associated with the resistance is indicated in bold, and are defined as SEQ ID No: 1 to 23.

[0261] Sequence 1 variants: (SEQ ID NO: 50)

[0262] AGAGATCAGAAATGAATGAAGTGAGAGATGGTGATCAGATGGAGGRTAAGCACAAGGAGAGAATAAC TGTGAGGAAGAAAAAAATGCAAATCTGGAATGC[A / G]AGAAAGGAGAACAAAACTGAAAGGTTGTTGA AGGGRGACTGTGAATTAGTTGCCCTCCAAGATTTGTGAATTTTTTMATTCTGAGCTCCTTATATCCCT A

[0263] Sequence 2 variants: (SEQ ID NO: 51 )

[0264] CTGAACGTATAGCTCGGGGATTTCGGACTCTTTGGAGGGAGGTTCTGTTGTTTAAAACTTCAATACAT CTGGCACAACTTGCACCAATTCCATCAACAGT[C / T]AACGAAAGAAAATCTAAGGCACCACTCATTGGT TGGACTATAAATCCCACAAAAGCTCGCCCAAGACCATGAGCAAGTCCTAGAACGCCATTCTGCCTAG

[0265] Sequence 3 variants: (SEQ ID NO: 52)

[0266] CTGATTTTTATTTATATGTGAAGCGATTACTCAAGTTGGGGGCGAGGAAGTTTGTGRTAGTAGGGATT GGACCATTGGGATGCATACCATTTGTTCGAGC[C / T]ATCAAGCTAGGATGGTTCGAGAAGTGCTCRAA TGAGGTGAATGAGTTAATTCAAGGCTACAACAARAAACTCAATAGAGAGCTAAGGTTGCTTAAYAAAG

[0267] Sequence 4 variants: (SEQ ID NO: 53)

[0268] CATTGCAATTTCCGAGTCTCTACCAGAAAATCTTCTCAATCCCGAGTCTCTACCGGATAAAAGTCTCA GTCCCAAGTCTATCGAGGAACCTACAAATGAT[C / G]ATGAGATTGCTTCAATGAAAAGTGCTGATAAA GACGAAGAGCTTAGGTCGGAACTGATCTCGATCTCGTATCTACCGTCACCGGACAAAGTTTCACTTC C

[0269] Sequence 5 variants: (SEQ ID NO: 54)

[0270] GAGGAATATATCCAATTAGTTTAGGCATCTTTTGTTTGTTGCTTATTAGCTTTCCATGTTATGACTAAGT TCATGTCTATTGAGTTGCTTAAATTCTAAT[A / G]TTAGCTTTGCTGATTTGTATTCTGAAGTTGCTCTATA ATTCTTGCTGCTGAACTTAGTTACTTCATAATGGGCAATCTTGGTTAGGTTAATCAGTGATTT

[0271] Sequence 6 variants: (SEQ ID NO: 55) TTAGTGGGGGGATAATTTCTTGACCCACTGAAGGACTTTGCCAGAAAATGATATTGTCGTATAAAGGA

[0272] TGCATCTTATGGGAGATTTTTGCAATTCTTGA[G / T]GCTAAATTCTGTATTTGGAAAAGCTTCTATTTCT

[0273] GGATATTTAAAATTGTAAACAGGGAGTATTAYATATCATGGGCACTTAGCTATAGATTTTGACACC

[0274] Sequence 7 variants: (SEQ ID NO: 56)

[0275] TTGATGTATTATCAAAGCCGCGGTATTGAAGATAGGAAAAGACACCTAATTACAAAAAGTACTACGAG

[0276] TTTACAATCCAAAAATTGAGCTCCTGAATCAA[A / T]TAGAGCGAAGGAAATCTGATTACAAATCAACATT

[0277] CTAAAACAAACTGATGAAATTTTTACAAACTGTATTATATCATACAAGCTCACAAAAAGTCAGAAT

[0278] Sequence 8 variants: (SEQ ID NO: 57)

[0279] AAACTTGCACCCTGGGGTCACAACTAATACCCAGATGCATAGAAGAGTCTTGCGAATGCTGATCCCT

[0280] TGGAATACTTTGCTTCTTATTCTCAAAAGATGT[A / C]CTTACGTCAGTGCATAAATCAAACTTCATCTCA

[0281] GCCGTAGGTCCCACACCTGCTGGTACTTCAGTTAACTGATCACTGAGGCCAACAGACTCAACACCAT

[0282] Sequence 9 variants: (SEQ ID NO: 58)

[0283] ATAGGGAGTAAATGCAACAACAACAACAATAATATGGCCACTTCATAACTTACTCCACAATTAATAGTT

[0284] TAAGGTCTTTATTATTTCCAAGAACATTAAT[A / T]AGTGGTTGTACTCCGTACTTTAGCTTCTAAAAGAG

[0285] ACGTGAGGTTTTGATGGAAAAAARTTGCACTTWAGTATAAGATAGATACTACTCGTATGAAYAAG

[0286] Sequence 10 variants: (SEQ ID NO: 59)

[0287] >

[0288] CATAAGAGGACACATTTGAGCTAATCTTTTGGTAGTATTCCTCTGTGTATGGAACAACAGTTGTGGAA

[0289] GAGAGTTTTCGGAAGAAATTGGGAGTTATGTA[A / G]GATGATTCCATCTCTACTAAGCGCAACGTTGT

[0290] CTTCTTGCTGTCTTCACGAAACGTTGCTAGTGCTGCATTTGCGGCTGATAATATTGCATGTYGAAGAG

[0291] Sequence 11 variants: (SEQ ID NO: 60)

[0292] CGAAAACAAAAATGTACCGTCAAGCCACCACCCGSCTCCTCCGATCCGTCAAATCTCAGGCGTTTTC

[0293] AACGTCGGCTGAAGTTCCGGCCACCGCACAAGG[C / T]GTCACAGATTTTCTGGAAAAATGGAAGAAAA

[0294] ATGTACCAAACACGGATCCTCCCGCAACCCCATCTTCTTACATGAAAACTCGTCCTTCTACACCTTCA

[0295] A

[0296] Sequence 12 variants: (SEQ ID NO: 61 )

[0297] ACGATCTTTCCAAGTGCTTATCCAACGCATCATTGATCCTTTTCCGATCCACCGCTCCCATATCCGCT

[0298] TTCGATCCTCGATCCTTATACATCTCTTTTCC[A / T]CCTCCCGATAAACTTTTTAACGCAAACTTCAATC

[0299] AATCAATCAATCAATCGCTCACTCAATCAATCAATCAATCAACCAATCACTGTTTATTCTTCAAAC

[0300] Sequence 13 variants: (SEQ ID NO: 62)

[0301] AGAATTACGACCTTTCAAATGAAGGAAGTAAAACTACCTCCATCTAAAAATTGTTGGACATGTCTGAG

[0302] TTTTTTGGTCAACCCTTATCAATTTTGACTAT[A / G]GTCAAACATTATATGATAATCAGAAGCAGCAGCA

[0303] GCATTATCAGCAAAATCTAGTTAAGAATGGCTCAAGTGGTTCATATGTTTCATCATGGCCATAAAG

[0304] Sequence 14 variants: (SEQ ID NO: 63)

[0305] CTAGATATTTCCTAAGATTATTCTAGATTATAATTTACAATCACATATTTCTAGATTTTTTTAGATTAATA

[0306] TTTAACACGTCCTTCCCAAACCGGCATGA[C / T]GTTGTGCGACCCTTCACCACTACCTACACTTGAATT

[0307] TGCAGTCACCATGACCTATCACAARATAAAYATATGTTTTTATTAGGGTTATGAAATATAACCG

[0308] Sequence 15 variants: (SEQ ID NO: 64)

[0309] CAAAAAGTTTTACTGTTAGTCATAATGCTACTAAGCAGCTGAAACTTGTGCTTGAAGCAACAGATTCAA

[0310] CCAATAATTACAGCTTTGGTGAGCTTTTACT[A / G]CGAGGAAATAAGGGACATCTTGCTAGGGTTCCTA

[0311] TAACAGTCCTTGTAAGTAGTGTACTAGGTAACTAGGGTTTTTAAATTCTTCGTCGATGGTGATCAA

[0312] Sequence 16 variants: (SEQ ID NO: 65) GGTCATTCAAATGCTCATCACTTCAATAAACAACAATCTATCAAAAATAAATACTCACATTGTAAAACAT

[0313] CCCCAACTGAAACAGTCATAGCAGCATTAC[A / G]TTGTTAACTTGAATAAATACCCAACTAATCAATAC

[0314] AATAACAAATACAAGCCAAATCGAGCAACAAAATCAAACACAAACGCCACAAATTAAAGAGCAAT

[0315] Sequence 17 variants: (SEQ ID NO: 66)

[0316] AAGAAAAAGAAATTGAAGATATATTCAATACAAAGAACGTATTTATTCAACTCACAATGATCCCATGAG

[0317] CACCACGGTAATAGCTGCTAGTGATAGTTCT[A / G]AAACGTTCTTGCCCTGCAGTATCCCACTGAACC

[0318] ACACCAAATCATGTAAKTAACARCAACAGATTTGCATCAAATTAGAGAATCCAGACAACAATGTCTT

[0319] Sequence 18 variants: (SEQ ID NO: 67)

[0320] TGGATTTCACTTTAACATGAAACCTTAACTGTGTTTTTTTCCCTATATTTTGGATCATTCTCGTCTTTTG

[0321] TGCCAAATAATATAAAGGACTTAGAAGCTG[A / G]ATTACTGTATGTCGTAGTTGTCTTCAGCTCCAGCC

[0322] TCCAGGTATCTGATTCATTTTTGTACATGCATTGGTTGTCCCGCAGAGCAGGTGGCACTCAACGG

[0323] Sequence 19 variants: (SEQ ID NO: 68)

[0324] AGCATATGGATATGATGTTGTGGTGCATTAGACATCAKTTTTTGGAGAATGTCCGGTCTTGCCATGAT

[0325] AATGTCTTTTCATGGCGTTCAATTGTGCGTGA[A / T]AGGAAGTCTGCTGCTGTGAAACGGGCATGGCC

[0326] TGAACCAGTTGCACTCTCTGGAGAGTCCKCTGAACAGGATTTCTCGAGTCTCTTTATTGAGGACGCA A

[0327] Sequence 20 variants: (SEQ ID NO: 69)

[0328] TTTAGCATTGGTTGTTAAGGAGTTGCCTTGGTTTGATTTTGCAGAGGGATGGAGAAATTGACTRAGAT

[0329] GTGACCCACATGATCAAGTCCGGGTTGCTCAA[A / T]TGGAGCAACTTGGGATTTGTGTGRTTGTAGTG

[0330] TTCTRTTGAAGTTAAAGGAAAATCTATATGGACRACTATTATACAAGTGTGTTTATATGGAATGTTTG

[0331] Sequence 21 variants: (SEQ ID NO: 70)

[0332] TGAAGTTATCAGGATATTGAATAAATGATGTGCTTTTCTATTTASAATCCAGTTGAAACAGCCTATGTG

[0333] CTAACGGAAATGAAACCAGCACGGATCTGAT[C / T]TCTGTTTCCCACCTTCCGTAGGAGCCTTATTAG

[0334] AGGCCAATAMATTGTTGAWGAATTTGAACCCACCTTTACTTTTTAGTTTTCTCAACATGTAAAATAC

[0335] Sequence 22 variants: (SEQ ID NO: 71 )

[0336] CAGTTAGGGCGTGGAATTTGCGGGCATCGCTCTCATGGATTGACGGTAAATGGGTTGAATGGTCCTC

[0337] TTCAAGAGGACAAAACGCTTCTGAACAGGTATT[A / G]TTTTAAGAATATTCCCTAACACCCGGGTTGTC

[0338] AATACTTTATTACGCTGTGATTTTATCTTAGTTCCCAAATTTTTAATATTTTGGGAAATGTTTTTAAT

[0339] Sequence 23 variants: (SEQ ID NO: 72)

[0340] TGGTTGGGGGTGGACGAGGATGCCAAAGGGGAAGACAAGATGTCAAAATCATGAGTTTGATGTGAG

[0341] ATGGGGCACTCCATATTCACGCCAAACAGCCTCA[A / G]CCTCTTTGCTGCAGCTTTGCCTTGGACCAC

[0342] CGGCACCGAYTCGTATACCATGGGCTCCTCYCTCTGCACCTCCATCACTGTTCCTCCACCRCCCTGT

[0343] TGA

[0344] Each of the sequences SEQ ID NO 24 to SEQ ID NO 38 given below, consist of two variants, as being indicated within the brackets.

[0345] SEQ ID NO 24:

[0346] CCCCGGCCGTTTTCTTAGGCTTCTCGTCGTTCACCTCGGCTTCTCCGGCCACCAGAGAATCATCGGA CACGCACGGTTTTCCGATCAAAACACCACATAA[T / A]CCCTCATTACCCACAAATGATGATGGGTGCA AATTAGGGAAAATTGACCCAGATGATGGTATAGCACCACTCAAGAGATTATATGACACATTAAAAGTC T SEQ ID NO 25:

[0347] >

[0348] CATATGTTATATTTTTTATGCAACTGCTACACAAGCTAACCAATAGCTGC[T / C]GAATTCCACTCTTCAA

[0349] CTCTCCCTAACCCCAAACTTCTTGCACTTTGAGG

[0350] SEQ ID NO 26:

[0351] CGGGTTCGAATCTTCAATTCGTATCGGTAAGAGTCGGGGGAGAGAGTTTGATGTTGGTGTTGTGCCA

[0352] CCTGGCCTCTAGATTGACCGCGAGAGACAATTT[C / T]CCGTAGAATATGTGATTTGAATGGAAAAACA

[0353] AAGAAAGTAACAAATAAAAAGGGAGAAAGCACACTATAACCATTAGAGAGAAGTATTAGTTGGTGATC

[0354] A

[0355] SEQ ID NO 27:

[0356] AATGCAATGTTTTCTATCTGTCATTCAGTAATTCTTGGAGATTATTTTACTTTTACCACATATATTCACC

[0357] CTTTTTATTTCATTGTTGCAGGTTTTTATG[G / A]CAGCAAACACAACACTTACGGTTTGAATTGCAGGAA

[0358] GACATGCCTAACTGCCAAAGATTGTGATCACCATGTTGGTCTTTGTCACTCAAGCAGACTTGCA

[0359] SEQ ID NO 28:

[0360] TTTTGCAAGAATTGGAGTATGTAGATTTCGAGTGATTTTATAAATGGGTTAATTTCGAGCATGAAGGAA

[0361] GTCAGATAGAACAGCAAGTAAACTTTTGCTA[C / T]GATTTTAGGAGAAATCTTATCAGGCAAAGTAGTA

[0362] TTTTAAGTCCCTTCATCTGAAAATGATTGTTACTTTTATTGCCAACGTTTTCTAGATGATGAGGAT

[0363] SEQ ID NO 29:

[0364] CATGGGGTAGAGACTTGGAGTATGTAGATTTCGAGTGATTTTAGAAATGG[G / T]TTAATCTCGAGCAT

[0365] GATTGAAGGCAGTCAGATAAACTGAAAGTAAACTTT

[0366] SEQ ID NO 30:

[0367] TAAAATCTGAGGCTTTTACCATTGCAGTTATGCCACACAAAAACATGAATACGATGATCTGAAGCATC

[0368] CCACCGAGAGCAGAAACAGGCCCTACTGCTCT[A / G]AGCTGCACCAAAGTACAGTTAGTACAGCTTCT

[0369] ACCATTAAACATAAATAGGGTAATGGTTTTGTATTTTTGATGAAGCTGTTCATTTTCTCAAAAAGTAC

[0370] SEQ ID NO 31 :

[0371] AGTAATTAATGATTAGAAAAAGAGAAACATAACTTGTTACTAACTACCTG[G / A]TTTAGGAAGATTGTAA

[0372] TGCATAAATTCAATACACTTCTATAACTTTTACT

[0373] SEQ ID NO 32:

[0374] TTGACAGAAGTACTAAATGTTTCCTCTTTGTATAGGGCACAATTTCACAATTGCCAAAATAAACAGTAA

[0375] TCACAACACCAGAACCAACCACAACTACAAT[G / A]AACATATGTCTAGGGTTCTGAAACCATGATTTAA

[0376] AACCTCTTGGTTTAAAGTGTTGAATTTGGTTACTATCAACATAGTAATTTCTCCTAGTAATAATAC

[0377] SEQ ID NO 33:

[0378] TCAGTTCGTACAGATTTAAGCTCTACTCTGAGGAACCCTACAATAGCGTAAATGCATAATCCCATATC

[0379] GGGATGTGAGGTGTGATAAGTTACCTTTATAT[A / G]CGCCAATTCTTAATATGTATATTGTTTGTCAGAT

[0380] GGGAAACACCGTGCGATAAGAGCAAGCCTAATAGATACCATTGACCCAATAAGGTTCTATAGAGGA

[0381] SEQ ID NO 34:

[0382] AAAAATGAATGTAACCTAGATTTTTTCTGTAATCACACTTGTTGCAAGATTTGAAGGACCTCATCTTTT

[0383] GTTGGTAAATCGGGAATCGCTCCTTTCTTTG[T / C]AATCGTAACAGCACCACATGCGTTTGAGAAATAC

[0384] AAAGCCTCCTTTAACCGCTTTTCATCCTGCCAGAAGAGCCAAAAGCAAAATAAAATTTGAAGAAAA

[0385] SEQ ID NO 35:

[0386] CGTTGCATGTACTATTAGATTTGCCACTGATTGACGCAAAATACCTTTCC[G / A]AACATTACTAAGTGA

[0387] TATCAAATCGTGAACATAATTTCAAAAAGATTTAT SEQ ID NO 36:

[0388] CTGTAACCATACACATACACAGAGGGTCATGAATGTAAGAAGATTATAAC[C / A]ATCGTTTTTAACTGT

[0389] AAATGTTTTTATGTAATACTTATAATCACAAAATG

[0390] SEQ ID NO 37:

[0391] ATGTAGTTCAAGTCGAGGGACAACATTCGAATATAAAAGAGATGAATATCACGTTAGTTATTCAAAGC

[0392] GTTCCATACATAAGTTTATCTTTGTGTTGTTA[G / A]AAACAATAGCATATATATGTCGGTCAAGGGTAGT

[0393] TCTCTCGAAAAGTCGAAGTCCCATGAAATAAAAAATACTGGAGTAACAAATTCATGTAAGTTTTCT

[0394] SEQ ID NO 38:

[0395] CTTGTAAAGTACTCCGTAGTAATGTATCCCTATGTCATGTAAACTTTACAGCACTCACTCCAAAGCTCA

[0396] TACCAAAAGTCAACTGTGTAATCTCATAACA[C / T]ATGATATTCTTGTGAAAGTTGTGATGCAAGTACTC

[0397] GTATTAACAATATGCACCTTACAACTAACAGGTTCTGTGACACTGAAAGTTTAAAAGTAAAAGCA

[0398] The following sequences with SEQ ID NO: 39-49 equally consist of two alternatives, the variant being indicated by the corresponding symbol conforming to IUPAC- IUB nomenclature.

[0399] >Spov3_chr4_93275081 - SEQ ID NO: 39 (‘C’ or T at position 101 )

[0400] TTTCATGGTGGTGTGGTACAGGTTGAAAAGTTTGTTCAAGATGCCATCTCAAAGGTAACTAATTCGTT TTTGGTACACACTAGCCTACTTCCCCTCCTCTYTTGGTTCTTTATGCATAAGCTCTGAAATCCTTTAAC ATGAATAGGAGAGCATTGCAATGTTGATGAATTCTGAAGTTCATCCCCCGCCCCCTTGGTACTC

[0401] >Spov3_chr4_105049870 - SEQ ID NO: 40 (‘G’ or ‘A’ at position 101 )

[0402] AGAACCAATTAGTTAAACATTGGAACCAATTAGTTAAGCAATGTAACTAATTAGTCAAACAATGGGACC AAATAGTTAAGCGATGAAACCAATTAGTTAARCAATCAAATCGGTCTTTTCTGTAATGCGGTCTTACAC AAAAGTTGTCGTTTGAAGTTAGAGTCGATTTCTTTTCACCACTGTTTTTGGGAGGCAAATCAC

[0403] >Spov3_chr4_107241402 - SEQ ID NO: 41 (‘G’ or ‘A’ at position 101 )

[0404] TTTTAAGTGTTTATATATAGTGGTGGATATTAGTTGTGCTTAGGGTGGGCCCGACCCCTCTAGGCGAA AAATTATGTACGGAGTAAAGTACTTTTTTTTARTTATGATCCCCTTAAACTTTGTGTATAATTGTAAATT ACACGGAGTAATATATTACTTCATTTTCTACTGTCGTTCTCATAAAGCTATAAGGTCCCACGA

[0405] >Spov3_chr4_109546568 - SEQ ID NO: 42 (‘G’ or ‘A’ at position 101 )

[0406] ATTCACGAAATCTTGGAGATAACGAAAGAATTCCTCGCCGAATTATGATTGCAGGTTACTATGATATA CCAAAGTGATGAGTTGAGAGCCACAAATATTGRAACTATGAAGATATATTGAATGCAACACTAATATC TGATAACTTATATCATTAGCTATTTGCTTTAGCTGATAGTCATTGATTGTTGGGAGTTTCTTGAC

[0407] >Spov3_chr4_109698808 - SEQ ID NO: 43 (‘G’ or ‘A’ at position 101 )

[0408] GTTTACGGATTAGTGAGATAAAAGAGTTTCAAGAGTTGATTTCTGGGCTGATTTTGCATTTTGGAGGA TATTTTTACAATTTTGRGTGTTTGGTGTTTTTRTGGAGTAGGTGAGCTGGAGAATAATGCGTTTTGGA GTTACATTATGATGATGATGATGGCTTACACAAATTTTGGGGTAGAAAAGCGATGATGGTTAGCA

[0409] >Spov3_chr4_112008390 - SEQ ID NO: 44 (‘G’ or ‘A’ at position 101 )

[0410] TAATTTTTACAAGGGTAGTGATGTACTTTCACCATTAAAATGAGGGTGCTTTTAGCGGAATAGGACGT CGGATAAAATCATACTCGTGATATTAGGGCTTRAAATACATAGTAGTTGAATTAAGCTAGTGYTCTAAC CGCCTCTCCCTCCCTTCTTACGAAATACTGCCTCTGTTCCACAATACATTCATCATTTCTTTTT

[0411] >Spov3_chr4_112574123 - SEQ ID NO: 45 (‘C’ or T at position 101 ) GCCATTTATAGAAACGGTGCAAGTAATCCGGGACGGCTTTATAAGGAAAGCGGTGCAAGTATTCCGG

[0412] AACGGAGGGAATAATATTCAAGAAATATAAATTYTGATTTAGATAAACCTCTACTACATATTTCGTAGT

[0413] AGGGTAAGAGAAGTTTGTCAACTTTAACATTTGACAAYATGATAAGCAAAAGAAGACTACGAACG

[0414] >Spov3_chr4_117783935 - SEQ ID NO: 46 (‘C’ or T at position 101 )

[0415] AAGACCATTCAACATAACCCCATCAAATTTAACTCTAGGAAAACACCTTATAATCTCATCCCACATACC

[0416] CAATTTACAAAATCCTCGAAAAACCAAATTCYAAACAGCAACATTCCTCTCTGGCATTTCATTCAAAAC

[0417] TTTCAACCCATCATCAACAAACCCCATTTGCACATAAAGATCAACGATAGAACTCCCAATGTA

[0418] >Spov3_chr4_118191085 - SEQ ID NO: 47 (‘G’ or ‘A’ at position 101 )

[0419] TGTAAGGTCTCAGCATTGGTGCATATTAGAGAGCTATCATCTACAGGTTGGTTTTGAGGTGAGATCTG

[0420] AGCAACCATACAACAGAAGAGTATCACTCTCCRGATGTTCTTTGACTGGTCAAGAGGGAGACTACGT

[0421] TGTGCTTCCAAGTAACATCCAGGAGTTGTATGTTGATAATTGCAGAGACTTTCGTTGCCTATCTGA

[0422] >Spov3_chr4_118788268 - SEQ ID NO: 48 (‘G’ or ‘A’ at position 101 )

[0423] CGGATGGAGTAGTAAATACAAAAAAAATTGATACAAAAGTGGTGTATTTTTAAGGTAATAAATACCAAA

[0424] AAATCCTACAAAATATCCAATTAACAAATACRAGTACGTAGTACAAGTAGATCATACAAACATACTATG

[0425] ATTTTCCCGTATCTATATCGTATCGAAACTTGTGTTTGTGTTCATCATCGTCCAATAAAGGGC

[0426] >Spov3_chr4_121142541 - SEQ ID NO: 49 (‘G’ or 'A’ at position 101 )

[0427] TGTAATGTAATAATGCAAATATAATGTACTCGAGTAAGTGATAGTCACAGGTTCGATTCCTCTATCCTC

[0428] CACTTGTAATTTGCACGGACTACAGAATATARTCCATGTGGCTCATTCGCACCAAGAAAATGCCTACA

[0429] CAGAAATATTAAGATAAATAGAAAAACTTACAAAAAAGAGTTGCAGAACAAGGACACTGATCTG

Claims

CLAIMS1 . A Spinacia oleracea plant comprising resistance against at least one or more Pe races 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 16, 17, 18 and 19, preferably at least Pe races 7, 8, 9, 10, 11 , 12, 13, 16, 17, 18 and 19, against one or more isolates 4US also known as 4+, 21 A (UA2016-21 A or 2016-21 A), PV2144, Pe22-53, PV2240, PV2201 and preferably also against Pe race 20, wherein said spinach plant comprises one or more resistance alleles identifiable by any of the SEQ ID NO:1-23, preferably by any of the SEQ ID NO:1 , 4-23.

2. The spinach plant of claim 1 , wherein said resistance is conferred by resistance alleles, present in accession NCIMB 44393.

3. The spinach plant according to any of the claims 1-2, wherein said resistance is conferred by a gene / locus (or loci) comprising one or more nucleotide sequences selected from the group consisting of SEQ ID NOs:1-23, preferably from the group consisting of SEQ ID NOs:1 , 4-23, or one or more nucleotide sequences having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with any of the above sequences, respectively, comprising the SNP(s) associated with the resistance.

4. The spinach plant according to claims 1-3, wherein said spinach plant is obtained by sitespecific genome editing techniques, transformation techniques, or random mutagenesis techniques, preferably by introduction of one or more resistance alleles identified by one or more of SEQ ID NO: 1 -23, more preferably by introduction of one or more resistance alleles identified by one or more of SEQ ID NO:1 , 4-23, more preferably by introduction of a nucleic acid fragment flanked by SEQ ID NO:1 and SEQ ID Nos 4 or 5.

5. A progeny or a hybrid plant of the spinach plant of any one of the previous claims, wherein said progeny or a hybrid plant retains resistance against at least one or more Pe races 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 16, 17, 18 and 19, preferably at least Pe races 7, 8, 9, 10, 11 , 12, 13, 16, 17, 18 and 19, more preferably against also one or more isolates 4US also known as 4+, 21A (UA2016-21A or 2016-21A), PV2144, PE22-53, PV2240, PV2201 and even more preferably also against Pe race 20, wherein said progeny or hybrid plant comprises one or more nucleotide sequences selected from the group consisting of SEQ ID NOs:1-23, preferably one or more nucleotide sequences selected from the group consisting of SEQ ID NOs:1 , 4-23, or one or more nucleotide sequence having at least 90% identity to any of the above sequences, respectively, comprising the SNP(s) associated with resistance.

6. A seed from which a spinach plant of any one of claims 1 to 5 can be grown, or a part of the spinach plant of any one of claims 1 to 5 or a part of the progeny plant of claim 6, wherein that part is selected from the group consisting of: stems, cuttings, petioles, cotyledons, flowers, anthers, pollen, ovaries, roots, root tips, protoplasts, callus,microspores, stalks, ovules, shoots, seeds, embryos, embryo sacs, cells, meristems, buds, leaves.

7. A cell culture or tissue culture comprising cells or tissue derived from the part of the spinach plant, as defined in claim 6.

8. A spinach plant regenerated from the cell or tissue culture of claim 7, wherein said spinach plant comprises resistance against at least one or more Pe races 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 16, 17, 18, 19, preferably at least Pe races 7, 8, 9, 10, 1 1 , 12, 13, 16, 17, 18, 19, against one or more isolates 4US also known as 4+, 21A (UA2016-21A or 2016- 21A), PV2144, PE22-53, PV2240, PV2201 and more preferably also against Pe race 20, comprising at least one nucleotide sequence selected from the group consisting of SEQ ID NOs:1 -23, preferably comprising at least one nucleotide sequence selected from the group consisting of SEQ ID NOs:1 , 4-23, or at least one nucleotide sequence having at least 90% identity to one or more of the above sequences, respectively, preferably at least 98% identity and more preferably at least 99% identity, comprising the SNP(s) associated with resistance.

9. A resistance allele providing resistance against at least one or more of Pe races 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 16, 17, 18, 19, preferably at least Pe races 7, 8, 9, 10, 11 , 12, 13, 16, 17, 18, 19, isolates 4US also known as 4+, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201 , and more preferably also against Pe 20, wherein the allele comprises a sequence having at least 95%, at least 98%, or at least 99% sequence identity with one or more of the SEQ ID NO: 1 to 23, preferably with one or more of the SEQ ID No: 1 , 4-23, comprising the SNP(s) associated with resistance.

10. A nucleic acid fragment, providing a broad spectrum resistance to Peronospora effusa (Pe), wherein said fragment derives from the seeds deposited under the NCIMB accession number 44393, and is located on the chromosomal interval flanked by marker allele SEQ ID No 1 and any of the marker alleles SEQ IDs No 4-23, preferably flanked by SEQ ID No 1 and any of the SEQ ID No 4-5, or by sequences having at least 95%, at least 98%, or at least 99% sequence identity with one or more of the SEQ ID No: 1 , 4-23, preferably comprising the SNP(s) associated with resistance.

11. A nucleic acid fragment comprising a resistance allele from Spinacia tetrandra which confers broad-spectrum resistance to at least one or more Peronospora effusa (Pe) races 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 16, 17, 18, 19, preferably at least Pe races 7, 8, 9, 10, 1 1 , 12, 13, 16, 17, 18, 19, against one or more isolates 4US also known as 4+, 21A, PV2144, PE22-53, PV2240, PV2201 and more preferably also against Pe race 20 in Spinacia oleracea, characterized in that said resistance allele co-segregates with:- one or more marker sequences selected from SEQ ID NO:1 to SEQ ID NO:23, and / or- any S. tetrandra genome-specific marker located in the chromosomal region flanked by SEQ ID NO:1 and SEQ ID NO:23, wherein said resistance allele is located on chromosome 2, and is present in a Spinacia oleracea plant grown from seeds of which a representative sample was deposited under NCIMB accession number 44393.

12. Nucleic acid fragment according to claim 11 , wherein said resistance allele cosegregates with:- one or more marker sequences selected from the group consisting of SEQ ID NO:1 and SEQ ID NO: 4 to SEQ ID NO:23, preferably from the group consisting of SEQ ID NOs: 1 , 4, and 5, and / or- any S. tetrandra genome-specific marker located in the chromosomal region flanked by SEQ ID NO:1 and SEQ ID NO:23, preferably flanked by SEQ ID NO: 1 and SEQ ID NO: 5.

13. Nucleic acid fragment according to claim 11 or 12, wherein said resistance allele is located on chromosome 2 between positions 2,942,500 bp and 6,004,293 bp, preferably between positions 2,942,500 and 3,127,853 bp.

14. Method for providing a spinach plant that is resistant to downy mildew, wherein the method comprises the steps of introducing or providing of a resistance locus / loci in chromosome 2, wherein the resistance locus / loci, comprise(s) a nucleotide sequence having at least 95%, at least 98% or at least 99% sequence identity with one or more of the SEQ ID NO: 1 to 23, preferably with one or more of the SEQ ID NO: 1 , 4-23.

15. Method for providing a spinach plant that is resistant to downy mildew, wherein the method comprises the steps of introducing or providing of a resistance locus / loci in chromosome 2, wherein the resistance locus / loci, comprise(s) a nucleotide sequence according to any one of claim 11 to 13, wherein the introducing or providing is not exclusively achieved by means of an essentially biological process.

16. A method for selecting and / or identifying a spinach plant that is resistant to downy mildew, said method comprising the step of identifying any one, preferably one or more of the resistance alleles from the group consisting of SEQ ID No: 1 to 23, preferably from the group consisting of SEQ ID No: 1 , 4-23, or identifying one or more nucleotide sequences comprising the SNP (s) associated with the resistance, having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with any of the above sequences, respectively.

17. A method for providing of a combination of resistance loci conferring resistance or tolerance to downy mildew, in the genome of a susceptible spinach plant, said method comprising the steps of: introducing or providing of a resistance locus or loci in chromosome 2, wherein the resistance locus or loci comprises a nucleic acid sequence having at least 85%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity with one or more of the SEQ ID NO: 1- 23, preferably with one or more of the SEQ ID NO: 1 , 4- 23; and- introducing or providing of a resistance locus or loci in chromosome 3, wherein the resistance locus or loci in chromosome 3 comprise(s) one or more of the SEQ ID NO: 24 to 38, and / or- introducing or providing of a resistance locus or loci in chromosome 4, wherein the resistance locus or loci comprised) any of the SEQ ID NO: 39-49.

18. A plant derivable from the method of claim 14 or 15.

19. Harvested leaves of a spinach plant as claimed in any of the claims 1 to 5, 8, and 18.

20. Use of one or more marker sequences selected from SEQ ID NO:1 to SEQ ID NO:23, and / or any Spinacia tetrandra genome-specific marker located in between SEQ ID NO:1 and SEQ ID NO:23, for identifying or developing Peronospora effusa resistant Spinacia oleracea plants.21 . The use according to claim 20, wherein the marker sequences are selected from SEQ ID NO:1 and SEQ ID NO:4 to SEQ ID NO:23, preferably the marker sequences are selected from SEQ ID NO:1 , SEQ ID NO:4, and SEQ ID NO:5.

22. The use according to claim 20, where in the marker sequences are selected from Spinacia tetrandra genome-specific marker located in between SEQ ID NO:1 and SEQ ID NO:5.

Images