Constitutive promoter and use thereof

By using a constitutive promoter from the cotton Ubiquitin gene, the problem of efficient expression of heterologous nucleotide sequences in plant tissues in existing technologies has been solved. This enables efficient expression of heterologous nucleotide sequences in plant tissues and precise gene editing, and is suitable for the expression of proteins encoding herbicide resistance and insect resistance.

WO2026020355A1PCT designated stage Publication Date: 2026-01-29BEIJING DABEINONG BIOTECHNOLOGY CO LTD
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2024/107213
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2024-07-24
Publication Date
2026-01-29

AI Technical Summary

Technical Problem

Existing technologies lack constitutive promoters that can efficiently express heterologous nucleotide sequences in plant tissues, making it difficult to meet the expression needs of multiple genes in different tissues and growth and development stages.

Method used

A constitutive promoter from the cotton Ubiquitin gene is provided, the nucleotide sequence of which includes SEQ ID NO:6 and is selected from a portion of SEQ ID NO:1. By operatively linking it with a heteronucleotide sequence, a recombinant DNA construct and expression cassette are constructed to achieve efficient expression of the heteronucleotide sequence in plant tissues.

Benefits of technology

This constitutive promoter is active in most plant tissues and many cell types, driving constitutive expression of exogenous genes, improving the efficiency and accuracy of gene editing, and is suitable for the expression of proteins encoding herbicide tolerance and insect resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2024107213_29012026_PF_FP_ABST
    Figure CN2024107213_29012026_PF_FP_ABST
Patent Text Reader

Abstract

Provided are a constitutive promoter and use thereof. The nucleotide sequence of the constitutive promoter comprises SEQ ID NO: 6, and the constitutive promoter is derived from SEQ ID NO: 1. The constitutive promoter shows activity in almost most tissues of plants and many types of cells, especially in roots, stems, leaves, flowers, pods, and fruits of plants. The constitutive promoter holds great promise for applications in plants.
Need to check novelty before this filing date? Find Prior Art

Description

Constitutive promoter and use thereof TECHNICAL FIELD

[0001] The present invention relates to a constitutive promoter and use thereof, in particular, to a constitutive promoter from cotton Ubiquitin gene and use thereof. BACKGROUND

[0002] One of the goals of plant genetic engineering is to produce plants with desirable characteristics or traits for agriculture, and the desirable traits usually include improving nutritional quality, increasing yield, conferring disease and pest resistance, improving drought and stress tolerance, improving horticultural quality, and conferring herbicide resistance, etc. Current technical progress has enabled researchers to obtain exogenous polynucleotide molecules (e.g. heterologous or naturally derived genes), and integrate the polynucleotide molecules into the plant genome, and the gene is expressed in plant cells to exhibit the corresponding traits. It is important that appropriate regulatory signals must exist in a suitable structure to obtain the expression of the coding sequence of the newly inserted gene in plant cells. These regulatory signals typically include the promoter region, the 5' untranslated leader sequence, and the 3' transcription terminator / polyadenylation sequence.

[0003] Some promoters are capable of directing RNA synthesis at a certain level of expression in most or all tissues and / or growth and development stages of plants, and these promoters are referred to as "constitutive promoters". Constitutive promoters can be divided into strong, medium and weak promoters according to their effect on directing RNA synthesis. Since in many cases it is necessary to express the target gene in different tissues of plants at the same time to obtain the desired gene function, constitutive promoters are particularly advantageous in the above-mentioned cases.

[0004] Some constitutive promoters that function in plant cells have been described in the prior art, including the promoter of soybean cell elongation factor gene Gm17gTsf1, the nopaline synthase (nos) promoter carried on the tumor-inducing plasmid of Agrobacterium tumefaciens, the octopine synthase (ocs) promoter, and the cauliflower mosaic virus (caulimovirus) promoters, such as the cauliflower mosaic virus (CaMV) 19S or 35S promoter, the CaMV 35S promoter with repeated enhancers, and the figwort mosaic virus (FMV) 35S promoter, which have been applied in plant constructs for transgenic expression. Although some constitutive promoters have been obtained at present, there is still great interest in isolating more novel constitutive promoters that can control the expression of recombinant DNA constructs (or genes) at different levels, and be applied in gene stacking for the expression of multiple genes in the same transgenic plants.

[0005] SUMMARY

[0006] The present application aims to provide a new constitutive promoter and use thereof, which can enable efficient expression of a heterologous nucleotide sequence in plant tissues.

[0007] To achieve the above-mentioned object, the present application provides a constitutive promoter, the nucleotide sequence of which comprises SEQ ID NO: 6, and the constitutive promoter is derived from SEQ ID NO: 1.

[0008] Further, the present application provides a constitutive promoter, the nucleotide sequence of which comprises SEQ ID NO: 56 and is selected from at least a part of SEQ ID NO: 1.

[0009] Further, the present application provides a constitutive promoter, the nucleotide sequence of which is shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 6.

[0010] To achieve the above-mentioned object, the present application further provides a recombinant DNA construct comprising the constitutive promoter operably linked to a heterologous nucleotide sequence of interest.

[0011] Further, the heterologous nucleotide sequence of interest encodes a protein of interest.

[0012] To achieve the above-mentioned object, the present application further provides an expression cassette comprising the recombinant DNA construct.

[0013] To achieve the above-mentioned object, the present application further provides a recombinant vector comprising the expression cassette.

[0014] To achieve the above-mentioned object, the present application further provides a method for expressing a heterologous nucleotide sequence of interest in a plant, comprising: stably integrating the heterologous nucleotide sequence of interest operably linked to the constitutive promoter into a plant cell.

[0015] Further, the plant is Arabidopsis thaliana, Brassica napus, tobacco, soybean, cotton, pepper, sugar beet, pumpkin, eggplant, Chinese cabbage, carrot, tomato, pea, spinach, potato or peanut.

[0016] Preferably, the heterologous nucleotide sequence of interest is expressed constitutively in plant tissues.

[0017] Further, the heterologous nucleotide sequence of interest encodes a protein of interest.

[0018] Preferably, the heterologous nucleotide sequence of interest encodes a herbicide-tolerance protein.

[0019] The heterologous nucleotide sequence of interest encodes an insect-resistance protein.

[0020] To achieve the above object, the present application further provides a plant or part comprising the above constitutive promoter.

[0021] To achieve the above object, the present application further provides a method for obtaining processed agricultural products, comprising processing the harvest of the above plant or part to obtain processed agricultural products.

[0022] To achieve the above object, the present application further provides a use of the above constitutive promoter for constitutive expression of a heterologous nucleotide sequence of interest in plant tissues.

[0023] Preferably, the plant is Arabidopsis thaliana, Brassica, tobacco, soybean, cotton, pepper, sugar beet, pumpkin, eggplant, Chinese cabbage, carrot, tomato, pea, spinach, potato or peanut.

[0024] Further, the heterologous nucleotide sequence of interest encodes a protein of interest.

[0025] In the present application, the term "comprising" or "including" means "including but not limited to".

[0026] In the present application, the term "promoter" means a DNA regulatory region, usually containing a TATA box capable of directing RNA polymerase II to initiate RNA synthesis at an appropriate transcription initiation site of a particular coding sequence. In the present application, the term "gene" means any DNA fragment containing a region of DNA ("transcribed DNA region") that is transcribed into an RNA molecule (e.g., mRNA) in a cell under the control of appropriate regulatory regions (e.g., a plant expressible promoter region). Thus, a gene can contain several operably linked DNA fragments, such as a promoter, a 5' untranslated leader sequence, a coding region, and a 3' untranslated region containing a polyadenylation site. An endogenous plant gene is a gene naturally found in a plant species. A recombinant DNA construct is any gene that is not normally found in a plant species, or any gene whose promoter is not associated in nature with some or all of the transcribed DNA region or with at least another regulatory region of the gene.

[0027] The term "constitutive promoter" in the present invention refers to a special class of gene regulatory sequences. Under the control of this class of promoters, a certain degree of gene expression is exhibited by most or all tissues and / or growth and development stages of an organism. Constitutive promoters are used to express operably linked genes, heterologous nucleotide sequences of interest, or gene editing system guide RNAs (gRNAs) in most cells of an organism, with a certain degree of persistence in the initiated expression. It is understood that for the term "constitutive promoter", there can be some variation in the absolute level of expression or activity between different tissues and developmental stages of an organism. The tissues are structural units in a plant body, which are collections of one or more types of cells of the same origin and performing the same function, such as protective tissue, transport tissue, nutritive tissue, mechanical tissue, meristematic tissue, several different tissues organically cooperate and closely contact to form different organs, and different organs cooperate with each other to more effectively complete the entire life activity process of the organism. The growth and development stages can be divided into embryonic stage, seedling stage, mature stage, and senescence stage according to the differences in plant morphology and function.

[0028] The term "constitutive expression" in the present invention refers to the relatively stable and persistent expression of a gene or heterologous nucleotide sequence of interest in most or all tissues and / or growth and development stages of a plant, for example, the cauliflower mosaic virus CaMV 35S promoter, which can initiate high-intensity expression of foreign genes in most organs and different development periods in plants; constitutive promoters can also ensure the widespread expression of gRNAs in host cells, improving the efficiency and accuracy of gene editing.

[0029] Isolated sequences having promoter activity and hybridizing to a promoter sequence of the present invention or a fragment thereof under stringent conditions are included in the present invention. These sequences are at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homologous to the sequences of the present invention. That is, the range of sequence identity is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity.

[0030] The present application provides a constitutive promoter whose nucleotide sequence comprises SEQ ID NO: 6 and is selected from at least a portion of SEQ ID NO: 1. SEQ ID NO: 6 is a fragment of SEQ ID NO: 1. With reference to SEQ ID NO: 1, the constitutive promoter of the present application can be extended to the 5' end or the 3' end of SEQ ID NO: 6 alone or to both the 5' end and the 3' end of SEQ ID NO: 6, but the length of the nucleotide sequence extended to both ends cannot exceed the 5' end or the 3' end of SEQ ID NO: 1 itself. In other words, the constitutive promoter whose nucleotide sequence is shown as SEQ ID NO: 6, or with reference to SEQ ID NO: 1, the constitutive promoter obtained by extending either end of SEQ ID NO: 6 arbitrarily and the length of the extension does not exceed the 5' end or the 3' end of SEQ ID NO: 1 itself are within the scope of the present application. Moreover, for such a constitutive promoter (with reference to SEQ ID NO: 1, the constitutive promoter obtained by extending either end of SEQ ID NO: 6 arbitrarily and the length of the extension does not exceed the 5' end or the 3' end of SEQ ID NO: 1 itself), the other nucleotide sequence included in the constitutive promoter other than SEQ ID NO: 6 does not affect the activity of the sequence of SEQ ID NO: 6 itself. The second embodiment of the present application also demonstrates that the prGhUbi10-06 promoter (SEQ ID NO: 6) has activity, and the prGhUbi10-01 promoter (SEQ ID NO: 1), the prGhUbi10-02 promoter (SEQ ID NO: 2), the prGhUbi10-03 promoter (SEQ ID NO: 3), and the prGhUbi10-05 promoter (SEQ ID NO: 5) all have activity. Those skilled in the art can reasonably predict, based on the content described in the present application, that the constitutive promoter whose nucleotide sequence comprises SEQ ID NO: 6 and is selected from at least a portion of SEQ ID NO: 1 all have the same or similar activity as SEQ ID NO: 6.

[0031] The promoter sequences and fragments thereof of the present application, when assembled into a DNA construct to operably link the promoter sequence to a heterologous nucleotide sequence of interest, are used to genetically manipulate any plant. By "operably linked" is meant that the promoter sequence of the present application is functionally connected to a second sequence in which the promoter sequence initiates and modulates transcription of the DNA sequence corresponding to the second sequence. Generally, operably linked means that the nucleic acid sequences being linked are contiguous and, where necessary to join two protein coding regions, are in the same reading frame. In this manner, the promoter nucleotide sequence and the heterologous nucleotide sequence of interest are provided together in an expression cassette to be expressed in a plant of interest. The expression cassette provides a number of restriction sites for insertion of the heterologous nucleotide sequence of interest which will be subject to transcriptional regulation by the regulatory regions comprising the promoter sequence of the present application. The expression cassette can additionally contain at least one additional gene to be co-transformed into the organism. Alternatively, the additional gene can be provided on a plurality of expression cassettes.

[0032] The expression cassette can additionally contain a selectable marker gene. Generally, the expression cassette will contain a selectable marker gene for selection of transformed cells. The selectable marker gene is used to select transformed cells or tissues. The selectable marker genes include, but are not limited to, genes encoding antibiotic resistance such as neomycin phosphotransferase II (NPT) and hygromycin phosphotransferase (HPT), and genes conferring herbicide resistance such as phosphinothricin, bromoxynil, imidazolinones, and 2,4-dichlorophenoxyacetate (2,4-D).

[0033] The expression cassette includes the promoter sequence of the present application, a translation initiation region, a heterologous nucleotide sequence of interest, and a transcriptional and translational termination region functional in plants, transcribed in the 5'-3' direction. The heterologous nucleotide sequence of interest can be native or foreign or heterologous to the plant host. Alternatively, the heterologous nucleotide sequence of interest can be a native sequence or a selectively synthesized sequence. By "foreign" is meant that the introduced transcriptional initiation region does not exist naturally in the plant into which the transcriptional initiation region is introduced. For example, a recombinant DNA construct comprises a promoter sequence of the present application operably linked to a coding sequence that is different from the promoter sequence of the present application.

[0034] The termination region can be derived from the promoter sequence of the present application, from the operably linked heterologous nucleotide sequence of interest, or from another source. Conventional termination regions can be obtained from the Ti plasmid of Agrobacterium tumefaciens, such as the octopine synthase and nopaline synthase (NOS) termination regions.

[0035] In making the expression cassette, the various DNA fragments can be manipulated to provide the DNA sequences in the proper orientation and, in appropriate combinations, to provide the desired reading frame. In doing so, it can be necessary to employ linkers, adapters, restriction-site engineered sites, or other art-accepted techniques to generate the desired codon combinations, to provide for the proper termination signals, or to add desired restriction sites. For these purposes, in vitro mutagenesis, primer repair, restriction, annealing, resubstitutions, such as transitions and transversions, can be involved.

[0036] Where appropriate, the heterologous nucleotide sequence of interest can be optimized to increase the amount of expression in the transformed plant. That is, the gene can be synthesized using plant-preferred codons to improve expression.

[0037] It is known in the art that additional sequence modifications can be made to the gene to increase its expression in a cellular host. These include but are not limited to removal of sequences encoding pseudoprolation signals, exon-intron splice site signals, transposon repeats, and other sequences that can be characterized as potentially deleterious to gene expression. The G-C content of the sequences can be adjusted to be at or near the average level known to be found in the genes of the host cell in question, calculated from the known genes expressed in the host cell. The sequences can be modified to avoid predicted hairpin mRNA secondary structures.

[0038] In the expression cassette or recombinant vector, the expression cassette can additionally contain a 5' leader sequence. The leader sequence can serve to improve the efficiency of transcription. Leader sequences are known in the art and include, but are not limited to, picornavirus leader sequences, such as the EMCV leader (the 5' noncoding region of the encephalomyocarditis 5' noncoding region); potyvirus leaders, such as the TEV leader, MDMV leader, and human immunoglobulin heavy chain binding protein (BiP); the untranslated leader of AMV RNA 4 (from the mRNA of the coat protein of alfalfa mosaic virus); the tobacco mosaic virus (TMV) leader; and the maize chlorotic mottle virus (MCMV) leader. Other known elements that improve transcription efficiency, such as introns, can also be used.

[0039] The promoter sequence of the present application can be used to initiate transcription of an antisense construct that is at least partially complementary to the messenger RNA (mRNA) of the heterologous nucleotide sequence of interest. Antisense nucleotide sequences are constructed to hybridize with the corresponding mRNA. The antisense sequence can be modified as long as it is long enough to hybridize with the corresponding mRNA and interfere with its expression. In this manner, an antisense construct having 80%, preferably 90%, more preferably 95% sequence identity with the corresponding antisense sequence can be used. In addition, a portion of the antisense nucleotide sequence can be used to disrupt the expression of the target gene. Generally, a sequence of at least 50 nucleotides, 100 nucleotides, 200 nucleotides, or more can be used.

[0040] The promoter sequence of this invention is used for the constitutive expression of a target heteronucleotide sequence. A "heteronucleotide sequence" refers to a sequence that is not naturally present with the promoter sequence. Although the nucleotide sequence is heterologous to the promoter sequence, it may be homologous, natural, heterologous, or exogenous to the plant host. A heteronucleotide sequence operatively linked to the promoter of this invention can encode a target protein. Examples of such heteronucleotide sequences include, but are not limited to, nucleotide sequences encoding resistant polypeptides to abiotic stresses such as drought, temperature, salinity, ozone, and herbicides, or biotic stresses such as pathogen invasion, including insects, viruses, bacteria, fungi, and nematodes, and preventing the development of diseases associated with these organisms.

[0041] In this invention, herbicide resistance proteins can express resistance and / or tolerance to herbicides. These genes include, but are not limited to, hydroxyphenylpyruvate dioxygenase (HPPD) gene, protoporphyrinogen oxidase (PPO) gene, acetyllactate synthase (ALS) gene, 5-enolpyruvate shikimyl-3-phosphate synthase (EPSPS) gene, glyphosate acetyltransferase (PAT) gene, glyphosate oxidoreductase (GOX) gene, and GAT gene.

[0042] In this invention, "insect resistance" refers to a plant's avoidance of symptoms and damage caused by plant-insect interactions. This means preventing insect-induced plant damage, crop damage, plant deformity, and plant diseases, or optionally, minimizing or mitigating insect-induced plant damage, crop damage, plant deformity, and plant diseases. The insects may belong to Lepidoptera (e.g., corn borer), Hemiptera (e.g., stink bug), Coleoptera (e.g., beetles), Orthoptera (e.g., locusts), Homoptera (e.g., aphids), Diptera (e.g., flies), etc. Commonly known in the art, target insect resistance proteins include, but are not limited to, Bacillus toxicity proteins; lectins, including snowdrop lectin, pea lectin, canavalia pea lectin, malt lectin, potato lectin, peanut lectin, etc.; lipoxygenases, including pea lipoxygenase 1 or soybean lipoxygenase; and insect chitosanase, etc.

[0043] Different pests transmit viruses from infected plants to healthy plants in different ways. These viruses include, but are not limited to, rice Dongorubicin virus, tobacco mosaic virus, sweet potato dwarf virus, and sweet potato feather spot virus. Therefore, heterologous nucleotide sequences that constitutively express antipathogenic activity or minimize the impact of viral pathogens in plant tissues can be selected.

[0044] The promoter sequence and method of this invention can be used to regulate the expression of any desired heteronucleotide sequence in a plant host to alter the plant phenotype. Various desired phenotypic alterations include, but are not limited to, changes in the plant's fatty acid composition, changes in the plant's amino acid content, and changes in plant pathogen defense mechanisms. These alterations can be achieved by providing the expression of a heterologous product or increasing the expression of an endogenous product in the plant. Alternatively, these alterations can be achieved by reducing the expression of one or more endogenous products in the plant, particularly enzymes or cofactors. These alterations will result in phenotypic changes in the transformed plant.

[0045] Transformation protocols and protocols for introducing nucleotide sequences into plants vary depending on the type of plant or plant cell being transformed, i.e., monocots or dicots. Suitable methods for introducing nucleotide sequences into plant cells and subsequently inserting them into the plant genome include, but are not limited to, Agrobacterium-mediated transformation, microemission bombardment, direct DNA uptake into protoplasts, electroporation, or whisker-based DNA introduction.

[0046] The transformed cells can be grown into plants in a conventional manner. These plants are cultured and pollinated with the same or different transformants to produce hybrids that express the desired identified phenotypic traits. Two or more generations can be cultured to ensure the stable maintenance and inheritance of the desired phenotypic trait, and then seeds that guarantee the expression of the desired phenotypic trait are harvested.

[0047] The term "plant" refers to the whole plant, including all plants and plant populations, such as desired and unwanted wild plants or crop plants (including naturally occurring crop plants). Crop plants can be plants obtained through conventional breeding and optimization methods or through biotechnology and recombination methods, or a combination of these methods, including transgenic plants.

[0048] The term "plant part" includes plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which plants can regenerate, plant callus, plant clumps, and intact plant cells in a plant or plant part. Examples of plant parts include embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, stems, roots, root tips, anthers, etc. It should be understood that parts of transgenic plants within the scope of this invention include, but are not limited to, plant cells, protoplasts, tissues, callus, embryos, and flowers, stems, fruits, leaves, and roots derived from transgenic plants or their progeny that have been previously transformed with the DNA molecules of this invention and are therefore at least partially composed of transgenic cells.

[0049] On the one hand, plant parts are plant cells. On the other hand, plant parts are either non-regenerative or regenerative cells. Furthermore, plant cells are somatic cells.

[0050] Non-regenerative cells are cells that cannot be regenerated into a whole plant through in vitro culture. Non-regenerative cells can be found in the plant or plant part (e.g., leaf) of this invention. Non-regenerative cells can be cells in a seed or the seed coat of said seed. Mature plant organs (including mature leaves, mature stems, or mature roots) contain at least one non-regenerative cell.

[0051] On the other hand, plant cells are reproductive cells, such as ovules or cells that are part of pollen. In another aspect, pollen cells are vegetative (non-reproductive) cells, or sperm cells.

[0052] This invention provides processing of harvested plants or portions containing the constitutive promoters described herein to obtain processed agricultural products. The term "processed agricultural product" refers to any composition or product composed of materials derived from plants, seeds, plant cells, or plant portions containing the constitutive promoters described herein. Specifically, the term "processed agricultural product" includes, but is not limited to, protein concentrates, protein isolates, starch, flour, biomass, and seed oils.

[0053] This invention provides a constitutive promoter and its application, which has the following advantages:

[0054] 1. This invention discloses for the first time a constitutive promoter from the cotton Ubiquitin gene, the nucleotide sequence of which includes SEQ ID NO:6 and is derived from SEQ ID NO:1.

[0055] 2. The constitutive promoters of this invention exhibit activity in almost all plant tissues and many cell types, particularly in plant roots, stems, leaves, flowers, pods, and fruits.

[0056] 3. The constitutive promoter of this invention can drive the constitutive expression of exogenous genes in plant tissues.

[0057] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Attached Figure Description

[0058] Figure 1 is a schematic diagram of the structure of the vector DBNBC-Dual_LUC containing LUC and REN reporter genes of the present invention.

[0059] Figure 2 is a schematic diagram of the recombinant expression vector DBN11-B containing the prGhUbi10-01 promoter sequence of the present invention.

[0060] Figure 3 is a schematic diagram of the structure of the vector DBNBC-HTG containing the herbicide-resistant gene HTG of the present invention.

[0061] Figure 4 is a schematic diagram of the structure of the recombinant expression vector DBN21-B of the present invention. Detailed Implementation

[0062] The technical solution of the constitutive promoter of the present invention and its application is further illustrated below through specific embodiments.

[0063] First embodiment: Obtaining the constitutive promoter of the present invention

[0064] 1. Obtain the prGhUbi10-01 promoter sequence

[0065] By querying the Cotton Functional Genomic Database (https: / / cottonfgd.org), genes highly expressed in roots, stems, leaves, and flowers can be retrieved. The 2151 bp sequence upstream of the gene Gh_A13G160300 was selected and named the promoter prGhUbi10-01. Using the genomic DNA sequence of cotton variety JM14 as a template for PCR amplification, primers 1 and 2 were designed for PCR amplification.

[0066] Primer 1: 5'-atcttacaaaatttcaacgggtc-3', as shown in SEQ ID NO:8 in the sequence listing;

[0067] Primer 2: 5'-ctattttgaataaaaatagaaca-3', as shown in SEQ ID NO:9 in the sequence listing.

[0068] The PCR reaction system is as follows:

[0069] The primers consist of 2.5 μL of each primer at a concentration of 10 μM, and the reaction buffer is New England Concentrate. The reaction buffer from the company's High-Fidelity DNA Polymerase kit was added to the above PCR reaction system with nuclease-free water to a final volume of 50 μL. Specific operating procedures were followed according to the New England Journal of Medicine guidelines. Company PCR Using Follow the instructions in the High-Fidelity DNA Polymerase (M0491) kit manual.

[0070] The PCR reaction conditions are as follows:

[0071] The PCR amplification product was ligated into a blunt-ended Blunt vector (TransGen cloning vector, Beijing). The procedure was performed according to the TransGen Blunt vector product instructions. The ligation product was then sequenced (Sanger sequencing) to confirm the prGhUbi10-01 promoter sequence, as shown in SEQ ID NO:1 in the sequence listing.

[0072] 2. Obtain the promoter sequences prGhUbi10-02, prGhUbi10-03, prGhUbi10-04, prGhUbi10-05, prGhUbi10-06, and prGhUbi10-07.

[0073] Using the prGhUbi10-01 gene sequence as a PCR amplification template, the following primer pairs were designed: primer 2 (SEQ ID NO:9) and primer 3 (SEQ ID NO:10), primer 2 (SEQ ID NO:9) and primer 4 (SEQ ID NO:11), primer 2 (SEQ ID NO:9) and primer 5 (SEQ ID NO:12), primer 2 (SEQ ID NO:9) and primer 6 (SEQ ID NO:13), primer 2 (SEQ ID NO:9) and primer 7 (SEQ ID NO:14), and primer 2 (SEQ ID NO:9) and primer 8 (SEQ ID NO:15). Following the method described above for obtaining the prGhUbi10-01 promoter sequence, PCR amplification reactions were performed using the aforementioned primer pairs to sequentially obtain the prGhUbi10-02 promoter sequence (SEQ ID NO:2) and the prGhUbi10-03 promoter sequence (SEQ ID NO:15). NO:3), prGhUbi10-04 promoter sequence (SEQ ID NO:4), prGhUbi10-05 promoter sequence (SEQ ID NO:5), prGhUbi10-06 promoter sequence (SEQ ID NO:6) and prGhUbi10-07 promoter sequence (SEQ ID NO:7).

[0074] 3. Synthesize the above-mentioned promoter sequences prGhUbi10-01 to prGhUbi10-07.

[0075] Connect the 5' and 3' ends of the above-mentioned prGhUbi10-01, prGhUbi10-02, prGhUbi10-03, prGhUbi10-04, prGhUbi10-05, prGhUbi10-06, and prGhUbi10-07 promoter sequences, as well as the prGm17gTsf1 control promoter sequence (SEQ ID NO:16), pr35S control promoter sequence (SEQ ID NO:17), and prAtH4A748:lTEV chimeric control promoter sequence (SEQ ID NO:18), to universal adapter primer 1, respectively.

[0076] 5' universal adapter primer 1: 5'-ctaaaaccaaaatccagtggactagt-3', as shown in SEQ ID NO:19 in the sequence listing;

[0077] The 3' universal adapter primer 1: 5'-atgtttttggcgtcttccat-3', as shown in SEQ ID NO:20 in the sequence listing.

[0078] Second embodiment: Verification of the effect of promoter elements driving LUC reporter gene expression in transgenic tobacco.

[0079] 1. A dual-luciferase reporter system was introduced, and recombinant expression vectors containing the prGhUbi10-01 promoter sequence, the prGhUbi10-02 promoter sequence, the prGhUbi10-03 promoter sequence, the prGhUbi10-04 promoter sequence, the prGhUbi10-05 promoter sequence, the prGhUbi10-06 promoter sequence, and the prGhUbi10-07 promoter sequence were constructed respectively.

[0080] Constructing vectors using conventional enzyme digestion methods is well known to those skilled in the art. Figure 1 shows a schematic diagram of the structure of the vector DBNBC-Dual_LUC (vector backbone: modified pCAMBIA2301 with resistance tag, available from CAMBIA) containing the LUC and REN reporter genes (Spec: spectinomycin gene; RB: right border; prAtAct2: Arabidopsis Act2 gene promoter (SEQ ID NO:21); REN: Renidae luciferase gene (SEQ ID NO:22); t35s: cauliflower virus 35s terminator (SEQ ID NO:23); SpeI: restriction endonuclease SpeI recognition site; LUC: firefly luciferase gene (SEQ ID NO:24); tPsE9: pea RbcS gene terminator (SEQ ID NO:25); prAtUbi10: Arabidopsis ubiquitin 10 gene promoter (SEQ ID NO:26); spAtCTP2: Arabidopsis chloroplast transport peptide (SEQ ID NO:26). NO:27); cEPSPS: 5-enolpyruvate-shikimate-3-phosphate synthase gene (SEQ ID NO:28); tNos: terminator of carmine synthase gene (SEQ ID NO:29); LB: left boundary).

[0081] The vector DBNBC-Dual_LUC was linearized by digesting it with the restriction endonuclease SpeI. The digestion product was purified to obtain the linearized DBNBC-Dual_LUC expression vector. The prGhUbi10-01 promoter sequence ligated to the universal adapter primer 1 was then used to perform a recombination reaction with the linearized DBNBC-Dual_LUC expression vector. The operation was performed according to the instructions of the Takara In-Fusion Snap Assembly Master Mix kit (Clontech, CA, JPN, CAT: 638949) to construct the recombinant expression vector DBN11-B, the structural schematic of which is shown in Figure 2.

[0082] The recombinant expression vector DBN11-B was transformed into *E. coli* DH5α competent cells using a heat shock method. The heat shock conditions were as follows: 100 μL of *E. coli* DH5α competent cells and 20 μL of recombinant plasmid DNA (recombinant expression vector DBN11-B) were gently mixed and then heat-shocked in a 42°C water bath for 30 s, followed immediately by placing on ice for 2 min. Then, 250 μL of antibiotic-free LB broth (10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, pH adjusted to 7.5 with NaOH) was added, and the cells were cultured at 37°C with shaking (200 rpm / min) for 1 h. The cells were then incubated upside down on LB agar plates containing 50 mg / L spectinomycin at 37°C for 12 h. Positive colonies were picked and cultured overnight in LB broth containing 50 mg / L spectinomycin at 37°C with shaking (200 rpm / min). Plasmid extraction was performed using the alkaline lysis method: The bacterial culture was centrifuged at 12,000 rpm for 1 min, the supernatant was discarded, and the precipitated bacterial cells were resuspended in 100 μL of ice-cold solution I (25 mM Tris-HCl, 10 mM EDTA (ethylenediaminetetraacetic acid), 50 mM glucose, pH = 8.0); 200 μL of freshly prepared solution II (0.2 M... Add NaOH and 1% SDS (sodium dodecyl sulfate), invert the tube four times to mix, and place on ice for 3-5 min; add 150 μL of ice-cold Solution III (3M potassium acetate, 5M acetic acid), mix thoroughly immediately, and place on ice for 5-10 min; centrifuge at 4℃ and 12000 rpm for 5 min, transfer the supernatant to a new 2 mL centrifuge tube, add 2 volumes of anhydrous ethanol, mix well, and place at room temperature for 5 min; centrifuge at 4℃ and 12000 rpm for 5 min, discard the supernatant, wash the precipitate with 70% ethanol (V / V) and air dry; add 30 μL of TE (10 mM Tris-HCl, 1 mM EDTA, pH = 8.0) containing RNase (20 μg / mL) to dissolve the precipitate; digest RNA in a water bath at 37℃ for 30 min; store at -20℃ for later use. The extracted plasmid was sequenced and identified, and the results showed that the recombinant expression vector DBN11-B contained the nucleotide sequence shown in SEQ ID NO:1 in the sequence listing, which is the prGhUbi10-01 promoter sequence.

[0083] Following the method described above for constructing the recombinant expression vector DBN11-B containing the prGhUbi10-01 promoter sequence, the following sequences are connected to the universal adapter primer 1: the prGhUbi10-02 promoter sequence, the prGhUbi10-03 promoter sequence, the prGhUbi10-04 promoter sequence, the prGhUbi10-05 promoter sequence, and the prGhUbi10-06 promoter sequence. The prGhUbi10-07 promoter sequence, the prGm17gTsf1 control promoter sequence connected to the universal adapter primer 1, the pr35S control promoter sequence connected to the universal adapter primer 1, and the prAtH4A748:lTEV chimeric control promoter sequence connected to the universal adapter primer 1 were respectively recombined with the linearized DBNBC-Dual_LUC expression vector to obtain recombinant expression vectors DBN12-B to DBN20-B. Sequencing verified that the above nucleotide sequences were correctly inserted into the recombinant expression vectors DBN12-B to DBN20-B.

[0084] 2. Transformation of Agrobacterium with recombinant expression vector

[0085] The correctly constructed recombinant expression vectors DBN11-B to DBN20-B were transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA; Cat. No: 18313-015) using liquid nitrogen. The transformation conditions were as follows: 100 μL Agrobacterium LBA4404, 3 μL plasmid DNA (recombinant expression vector); incubation in liquid nitrogen for 10 min, followed by a 37°C water bath for 10 min; the transformed Agrobacterium LBA4404 was inoculated into LB tubes and cultured at 28°C and 200 rpm for 2 h; then plated onto LB agar plates containing 50 mg / L rifampicin and 50 mg / L spectinomycin until positive single colonies grew. Single colonies were picked, cultured, and their plasmids were extracted. The extracted plasmids were sequenced and identified, and the results showed that the recombinant expression vectors DBN11-B to DBN20-B had completely correct structures.

[0086] 3. Instantaneous transformation of tobacco leaves

[0087] Tobacco leaves are efficient bioreactors for protein expression. Exogenous genes were introduced into tobacco leaves for expression using the Agrobacterium injection permeation method, and the effectiveness of the constitutive promoter of this invention was verified by high-throughput protein expression.

[0088] The methods for converting tobacco leaves are as follows:

[0089] Step 1: Plant tobacco. Cultivate the tobacco under conditions of 14h light / 10h darkness, 25℃ temperature, and 70% relative humidity for 4-5 weeks, and then harvest the tobacco leaves.

[0090] Step 2: Select the following Agrobacterium strains transformed with recombinant expression vectors DBN11-B, DBN12-B, DBN13-B, DBN14-B, DBN15-B, DBN16-B, DBN17-B, DBN18-B, DBN19-B, and DBN20-B respectively from Example 2, and clone them into 1 mL of LB liquid medium containing antibiotics (tryptone 10 g / L, yeast extract 10 g / L, NaCl). In a solution of 5 g / L rifampicin (50 mg / mL), spectinomycin (50 mg / mL), and tetracycline (10 mg / mL), cultured at 28°C with shaking (200 rpm) until the logarithmic growth phase of Agrobacterium (OD200). 600 =0.5-0.6), take 1 mL of Agrobacterium tumefaciens in the logarithmic phase and transfer it to 20 mL of LB liquid medium containing antibiotics (tryptone 10 g / L, yeast extract 10 g / L, NaCl 5 g / L, rifampicin 50 mg / mL, spectinomycin 50 mg / mL, tetracycline 10 mg / mL), and incubate at 28°C with shaking (200 rpm) until the Agrobacterium tumefaciens reaches the logarithmic phase (OD). 600 =0.5-0.6), centrifuged at 5000 rpm for 10 min at room temperature, collected the bacterial cells, and resuspended the Agrobacterium cells in a staining buffer (containing 10 mM MgCl2, 10 mM MES, 150 μM acetylsylgenone, pH = 5.6) to OD. 600 =0.8, stand at room temperature for 2-3 hours to obtain Agrobacterium bacterial suspensions transformed with recombinant expression vectors DBN11-B to DBN20-B for injection;

[0091] Step 3: Using a 1mL needle, gently make a small incision on the back of the tobacco leaf obtained in Step 1 of this embodiment (be careful not to puncture). Then, using a syringe without the needle, draw up the Agrobacterium tumefaciens solution transformed with recombinant expression vectors DBN11-B to DBN20-B in Step 2 of this embodiment and inject it into the tobacco leaf through the small incision. This will allow the T-DNA (including the prAtAct2 promoter sequence, REN gene sequence, t35s terminator sequence, and sequences selected from the prGhUbi10-01, prGhUbi10-02, and prGhUbi10-03 promoter sequences) in the recombinant expression vectors DBN11-B to DBN20-B to be expressed. The following promoter sequences were transferred into tobacco leaves: prGhUbi10-04 promoter sequence, prGhUbi10-05 promoter sequence, prGhUbi10-06 promoter sequence, prGhUbi10-07 promoter sequence, prGm17gTsf1 control promoter sequence, pr35S control promoter sequence, and prAtH4A748:lTEV chimeric control promoter sequence; LUC gene sequence; tPsE9 terminator sequence; prAtUbi10 promoter sequence; spAtCTP2 nucleotide sequence; cEPSPS gene sequence; and tNos terminator sequence. Wild-type tobacco leaves (CK1) were used as a control. Water-stained areas on the tobacco leaves were marked with a marker.

[0092] Step 4: Place the tobacco leaves injected in Step 3 of this embodiment and wild-type tobacco leaves in the dark for 12 hours, then incubate them in a constant temperature incubator at 21°C for 2 days. Cut off the labeled areas of the tobacco leaves, and take three equal mass portions of leaves with labeled areas from recombinant expression vectors DBN11-B to DBN20-B, as well as wild-type tobacco leaves, as biological replicates. Freeze-mill them in liquid nitrogen, then add 1×Passive lysis buffer (PLB) buffer to each, centrifuge at 12000 rpm for 10 min at 4°C, and collect the supernatant for later use.

[0093] 4. Detection of the effect of the constitutive promoter of the present invention on driving LUC reporter gene expression in tobacco leaves.

[0094] Step 5: Take 100 μL of the supernatant from Step 4 above, add it to an ELISA plate, and set up 3 replicates. Add 100 μL of 1× firefly luciferase reaction solution LAR II (dissolve the lyophilized luciferase assay substrate in luciferase assay buffer II (Promega, Dual-...). The luciferase activity of fireflies was obtained from the Reporter Assay System (E1960) kit and stored at -80°C protected from light. After shaking the plate to mix, the activity was measured using a BioTek-H1MF microplate reader. The measurement was completed within 30 minutes. The unit of the measured luciferase activity value is RLU (relative light unit).

[0095] Step 6: Add 100 μL of 1× Renina luciferase reaction solution Stop&Glo (obtained by dissolving 200 μL of Stop&Glo Substrate (50×) in 10 mL of Stop&Glo buffer and storing at -80℃ protected from light), shake the plate to mix, and use a BioTek-H1MF microplate reader to detect the Renina luciferase activity value. The detection is completed within 30 min, and the unit of the detected Renina luciferase activity value is RLU (relative light units).

[0096] To eliminate inter-group errors caused by factors such as different transformation efficiencies due to Agrobacterium infection in plant tissues, the REN gene was used as an internal reference. The LUC / REN ratio reflects the relative activity intensity of the promoter (LUC / REN ratio = (LUC value of tobacco leaves transformed with different recombinant expression vectors - LUC value of wild-type tobacco leaves) / (REN value of tobacco leaves transformed with different recombinant expression vectors - REN value of wild-type tobacco leaves)). The experimental results of LUC and REN enzyme activity detection in transiently transformed tobacco leaves are shown in Table 1.

[0097] Table 1. Enzyme activity values ​​of LUC and REN and LUC / REN ratio in tobacco leaves after transient conversion.

[0098] The results in Table 1 show that: (1) the promoters prGhUbi10-01, prGhUbi10-02, prGhUbi10-03, prGhUbi10-05 and prGhUbi10-06 of the present invention are generally active and can drive LUC gene expression in tobacco leaves; the LUC / REN values ​​of prGhUbi10-04 and prGhUbi10-07 are 0, indicating that prGhUbi10-04 and prGhUbi10-07 have basically no promoter activity; (2) in tobacco leaves, compared with the control promoters prGm17gTsf1, pr35S and prAtH4A748:lTEV, prGhUbi10-01, prGhUbi10-02, prGhUbi10-03 and prGhUbi10-05 have higher activity in driving LUC gene expression.

[0099] Third embodiment: Verification of the effect of promoter elements driving LUC reporter gene expression in transgenic Arabidopsis thaliana.

[0100] 1. Transformation of Agrobacterium with recombinant expression vector

[0101] The recombinant expression vectors DBN11-B to DBN20-B, which were correctly constructed in Example 1 above, were transformed into Agrobacterium GV3101 using liquid nitrogen. The transformation conditions were as follows: 100 μL Agrobacterium GV3101, 3 μL plasmid DNA (recombinant expression vector); placed in liquid nitrogen for 10 min, then in a 37°C water bath for 10 min; the transformed Agrobacterium GV3101 was inoculated into LB tubes and cultured at 28°C and 200 rpm for 2 h; then plated onto LB agar plates containing 50 mg / L rifampicin and 50 mg / L spectinomycin until positive single clones grew. Single clones were picked, cultured, and their plasmids were extracted. The extracted plasmids were sequenced and identified, and the results showed that the recombinant expression vectors DBN11-B to DBN20-B had completely correct structures.

[0102] 2. Obtaining transgenic Arabidopsis plants

[0103] Wild-type Arabidopsis seeds were suspended in a 0.1% (w / v) agarose solution. The suspended seeds were stored at 4°C for 2 days to complete the necessary dormancy to ensure synchronous germination. A mixture of vermiculite and horse manure was irrigated from the bottom with water until moist, and the soil mixture was drained for 24 hours. The pretreated seeds were then sown on the soil mixture and covered with a moisture-retaining cover for 7 days. Germination was then carried out under constant temperature (22°C), constant humidity (40-50%), and light intensity of 120-150 μmol / m². 2 s -1 Plants were cultivated in a greenhouse under long-day conditions (16 hours of light / 8 hours of darkness). Initially, the plants were irrigated with Hogland's nutrient solution, followed by deionized water, keeping the soil moist but not saturated.

[0104] Arabidopsis thaliana was transformed using the flower immersion method. Selected Agrobacterium colonies were inoculated with one or more 15-30 mL aliquots of LB medium containing spectinomycin (50 mg / L) and rifampin (10 mg / L) (tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, pH adjusted to 7.5 with NaOH). The pre-cultures were incubated overnight at 28°C with constant shaking at 220 rpm. Each pre-culture was used to inoculate two 500 mL aliquots of the aforementioned LB medium containing spectinomycin (50 mg / L) and rifampin (10 mg / L), and the cultures were incubated overnight at 28°C with continuous shaking. Cells were pelleted by centrifugation at approximately 4000 rpm for 20 min at room temperature, and the supernatant was discarded. The cell pellet was gently resuspended in 500 mL of osmotic medium containing 1 / 2 × MS salt / vitamin B5, 10% (w / v) sucrose, 0.044 μM benzylaminopurine (10 μL / L (stock solution in 1 mg / mL DMSO)), and 300 μL / L Silwet L-77. Approximately one-month-old Arabidopsis plants were immersed in the resuspended cell medium for 5 min, ensuring the newest inflorescences were submerged. The plants were then laid sideways and covered, kept in the dark for 24 h, and cultured normally at 22°C with a 16 h light / 8 h dark photoperiod. Seeds were harvested after approximately 4 weeks.

[0105] Newly harvested T1 seeds (prGhUbi10-01 promoter sequence, prGhUbi10-02 promoter sequence, prGhUbi10-03 promoter sequence, prGhUbi10-04 promoter sequence, prGhUbi10-05 promoter sequence, prGhUbi10-06 promoter sequence, prGhUbi10-07 promoter sequence, prGm17gTsf1 control promoter sequence, pr35S control promoter sequence, prAtH4A748:lTEV chimeric control promoter sequence) were dried at room temperature for 7 days. The seeds were then sown in 26.5cm × 51cm germination trays, with each tray receiving 200mg of T1 seeds (approximately 10,000 seeds). These seeds had been pre-suspended in distilled water and stored at 4°C for 2 days to complete the necessary dormancy and ensure synchronous germination.

[0106] Mix vermiculite with horse manure and irrigate the bottom of the soil with water until moist, then drain by gravity. Using a pipette, evenly sow the pretreated seeds onto the soil mixture and cover with a moisture-retaining cover for 4-5 days. Remove the cover one day before initial transformant selection using a glyphosate spray (selecting the co-transformed EPSPS gene) after germination.

[0107] Seven days after planting (DAP) and again at 11 DAP, T1 plants (cotyledon stage and 2-4 leaf stage, respectively) were sprayed with a 0.5% solution of Roundup herbicide (356 g ae / L glyphosate) at a spray volume of 10 mL / tray (703 L / ha) using a DeVilbiss compressed air nozzle, providing an effective dose of 420 g ae / ha of glyphosate per application. Surviving plants (actively growing plants) were identified 4-7 days after the final spray and transplanted into 7 cm × 7 cm square pots (2-4 plants per pot) prepared with horse manure and vermiculite. The transplanted plants were covered with a moisture-retaining cover for 3-4 days and placed in a 22°C incubator as before or directly transferred to a greenhouse. Then, remove the cover and plant the plants in a greenhouse (temperature 22±5℃, 50±30% RH, 14h light: 10h dark, minimum 500 μE / m²) for at least one day before testing the effect of promoter element driving the LUC reporter gene. 2 s -1 (Natural + supplemental light).

[0108] 3. Detection of the effect of the constitutive promoter of the present invention on driving LUC reporter gene expression in various tissues of Arabidopsis thaliana.

[0109] The T1 transformant was selected from a background of untransformed seeds using a glyphosate selection scheme. Arabidopsis T1 plants transformed with the prGhUbi10-01 promoter sequence, Arabidopsis T1 plants transformed with the prGhUbi10-02 promoter sequence, and Arabidopsis T1 plants transformed with the prGhUbi10-03 promoter sequence were obtained as described in Example 2. Arabidopsis T1 plants were divided into four groups: plants with the prGhUbi10-04 promoter sequence, plants with the prGhUbi10-05 promoter sequence, plants with the prGhUbi10-06 promoter sequence, plants with the prGhUbi10-07 promoter sequence, plants with the prGm17gTsf1 control promoter sequence, plants with the pr35S control promoter sequence, and plants with the prAtH4A748:lTEV chimeric control promoter sequence. Samples were taken from different parts of the above-mentioned Arabidopsis T1 plants at different time points as test samples.

[0110] Samples were taken from three parts during the rosette stage as test samples: roots, stems, and leaves;

[0111] Samples were taken from four parts during the bolting stage as test samples: roots, stems, leaves, and flowers;

[0112] Samples were taken from four parts during the maturity stage as test samples: roots, stems, leaves, and pods.

[0113] Wild-type Arabidopsis thaliana (CK2) samples from the same part of the plant at the same growth stage were used as negative control samples.

[0114] Three identical samples were taken from different parts of the plant at different time points and transformed into recombinant expression vectors DBN11-B to DBN20-B, respectively, and negative control samples from the same part of the wild-type Arabidopsis thaliana plant at the same time point were used as biological replicates. The samples were cryogenically ground in liquid nitrogen, and then 1×PLB buffer was added to each sample. The samples were centrifuged at 12,000 rpm for 10 min at 4 °C, and the supernatant was collected for later use.

[0115] The activity of dual-luciferase inhibitors (LCIs) in the test samples and negative control samples was detected according to steps 5 and 6 in Example 4 of the second embodiment. The REN gene was used as an internal control. The LUC / REN ratio reflected the relative activity intensity of the promoter (LCI / REN ratio = (LCI value of test samples transformed into different recombinant expression vectors at different times and locations - LUC value of wild-type plants at the same time and location) / (REN value of test samples transformed into different recombinant expression vectors at different times and locations - REN value of wild-type plants at the same time and location)). The LUC / REN ratios of stably transformed Arabidopsis thaliana at different times and locations are shown in Table 2.

[0116] Table 2. Ratio of LUC / REN in different parts of Arabidopsis thaliana at different stages of stable transformation.

[0117] The results in Table 2 show that: (1) the promoters prGhUbi10-01, prGhUbi10-02, prGhUbi10-03, prGhUbi10-05 and prGhUbi10-06 of the present invention are generally active and are expressed in the roots, stems, leaves, flowers and pods of Arabidopsis plants, indicating that the promoters prGhUbi10-01, prGhUbi10-02, prGhUbi10-03, prGhUbi10-05 and prGhUbi10-06 can drive the constitutive expression of the target heterologous gene in the plant; the LUC / REN ratios of prGhUbi10-04 and prGhUbi10-07 are very low, indicating that prGhUbi10-04 and prGhUbi10-07 have basically no promoter activity.

[0118] (2) In Arabidopsis thaliana plant leaves, compared with the control promoters prGm17gTsf1, pr35S and prAtH4A748:lTEV, prGhUbi10-01, prGhUbi10-02 and prGhUbi10-03 showed higher activity in driving LUC gene expression during the rosette, bolting and maturity stages.

[0119] (3) In the roots of Arabidopsis plants, compared with the prAtH4A748:lTEV control promoter, prGhUbi10-01, prGhUbi10-02, prGhUbi10-03, prGhUbi10-05 and prGhUbi10-06 had higher activity in driving LUC gene expression.

[0120] (4) In the flowers of Arabidopsis plants, prGhUbi10-01, prGhUbi10-02 and prGhUbi10-03 had higher activity in driving LUC gene expression compared with the control promoters pr35S and prAtH4A748:lTEV.

[0121] (5) In the pods of Arabidopsis plants, prGhUbi10-01, prGhUbi10-02, prGhUbi10-03 and prGhUbi10-05 had higher activity in driving LUC gene expression compared with the control promoters pr35S and prAtH4A748:lTEV.

[0122] Fourth Example: Validation of the effect of promoter elements driving LUC reporter gene expression in transgenic soybeans

[0123] 1. Transformation of Agrobacterium with recombinant expression vector

[0124] The correctly constructed recombinant expression vectors DBN11-B, DBN18-B, DBN19-B, and DBN20-B were transformed into Agrobacterium EHA101 using the liquid nitrogen method. The transformation conditions were as follows: 100 μL Agrobacterium EHA101, 3 μL plasmid DNA (recombinant expression vector); incubation in liquid nitrogen for 10 min, followed by a 37°C water bath for 10 min; the transformed Agrobacterium EHA101 was inoculated into LB tubes and cultured at 28°C and 200 rpm for 2 h; then plated onto LB agar plates containing 50 mg / L rifampicin and 50 mg / L spectinomycin until positive single colonies grew. Single colonies were picked, cultured, and their plasmids were extracted. The extracted plasmids were sequenced and identified. The results showed that the recombinant expression vectors DBN11-B, DBN18-B, DBN19-B, and DBN20-B had completely correct structures.

[0125] 2. Obtaining transgenic soybean plants

[0126] Following the conventional Agrobacterium infection method, cotyledonary node tissues of aseptically cultured soybean variety SY2043C were co-cultured with the Agrobacterium described in Example 1 to infect the T-DNA (including the prAtAct2 promoter sequence, REN gene sequence, t35S terminator sequence, and sequences selected from the prGhUbi10-01 promoter sequence, prGm17gTsf1 control promoter sequence, pr35S control promoter sequence, and prAtH4A748:l) in the recombinant expression vectors DBN11-B, DBN18-B, DBN19-B, and DBN20-B. One of the TEV chimeric control promoter sequences, the LUC gene sequence, the tPsE9 terminator sequence, the prAtUbi10 promoter sequence, the spAtCTP2 nucleotide sequence, the cEPSPS gene sequence, and the tNos terminator sequence were transferred into the soybean chromosome, resulting in soybean plants with the prGhUbi10-01 promoter sequence, soybean plants with the prGm17gTsf1 control promoter sequence, soybean plants with the pr35S control promoter sequence, and soybean plants with the prAtH4A748:lTEV chimeric control promoter sequence.

[0127] For Agrobacterium-mediated soybean transformation, mature soybean seeds were germinated in soybean germination medium (3.1 g / L B5 salt, B5 vitamin, 20 g / L sucrose, 8 g / L agar, pH 5.6). Seeds were inoculated onto the germination medium and cultured under the following conditions: temperature 25 ± 1℃; photoperiod (light / dark) 16 / 8 h. One day after germination, a cotyledon and the first true leaf were removed and inoculated onto a pretreated medium containing cytokinins (MS salt 4.3 g / L, vitamin B5, sucrose 20 g / L, agar 8 g / L, 2-morpholinoethanesulfonic acid (MES) 4 g / L, zeatin (ZT) 2 mg / L, 6-benzyladenine (6-BAP) 1 mg / L, acetylsyringone (AS) 40 mg / L, pH = 5.3). Three days after inoculation on the pretreated medium, the cotyledonary node was wounded with the back of a scalpel, and Agrobacterium suspension was applied to the wounded cotyledonary node tissue. Agrobacterium can deliver the prGhUbi10-01 promoter sequence, the prGm17gTsf1 control promoter sequence, the pr35S control promoter sequence, and the prAtH4A748:lTEV chimeric control promoter sequence to the wounded cotyledonary node tissue (Step 1: Infection Step). In this step, the cotyledonary node tissue is preferably immersed in Agrobacterium suspension (OD). 660=0.5-0.8, inoculated in infection medium (MS salt 2.15 g / L, vitamin B5, sucrose 20 g / L, glucose 10 g / L, acetylsuccinone (AS) 40 mg / L, 2-morpholinoethanesulfonic acid (MES) 4 g / L, zeatin (ZT) 2 mg / L, pH 5.3). Cotyledonary tissue is co-cultured with Agrobacterium for a period (3 days) (Step 2: Co-culture step). Preferably, after the infection step, the cotyledonary tissue is cultured on solid medium (MS salt 4.3 g / L, vitamin B5, sucrose 20 g / L, glucose 10 g / L, MES 4 g / L, ZT 2 mg / L, agar 8 g / L, pH 5.6). After this co-culture phase, a selective "recovery" step can be performed. In the "recovery" step, the recovery medium (3.1 g / L B5 salt, B5 vitamin, 1 g / L MES, 30 g / L sucrose, 2 mg / L ZT, 8 g / L agar, 150 mg / L cephalosporin, 100 mg / L glutamate, 100 mg / L aspartic acid, pH 5.6) contains at least one known antibiotic that inhibits the growth of Agrobacterium (cephalosporin 150-250 mg / L), without adding a selector for plant transformants (Step 3: Recovery Step). Preferably, the cotyledonary node regenerated tissue blocks are cultured on a solid medium containing antibiotics but without a selector to eliminate Agrobacterium and provide a recovery period for infected cells. Next, the cotyledonary node regenerated tissue blocks are cultured on a medium containing a selector (glyphosate) and the growing transformed callus is selected (Step 4: Selection Step). Preferably, the cotyledonary regenerated tissue blocks are cultured on a selective solid medium containing a selector (B5 salt 3.1 g / L, B5 vitamin, MES 1 g / L, sucrose 30 g / L, 6-benzyladenine (6-BAP) 1 mg / L, agar 8 g / L, cephalosporin 150 mg / L, glutamate 100 mg / L, aspartic acid 100 mg / L, N-(phosphonocarboxymethyl)glycine 0.25 mol / L, pH 5.6), leading to selective growth of the transformed cells. The transformed cells then regenerate into plants (step 5: regeneration step). Preferably, the cotyledonary regenerated tissue blocks grown on the selective medium are cultured on solid media (B5 differentiation medium and B5 rooting medium) to regenerate plants.

[0128] The selected resistant tissue blocks were transferred to the B5 differentiation medium (B5 salt 3.1 g / L, B5 vitamin, MES 1 g / L, sucrose 30 g / L, ZT 1 mg / L, agar 8 g / L, cephalosporin 150 mg / L, glutamic acid 50 mg / L, aspartic acid 50 mg / L, gibberellin 1 mg / L, auxin 1 mg / L, N-(phosphocarboxymethyl)glycine 0.25 mol / L, pH 5.6) and cultured at 25°C for differentiation. The differentiated seedlings were transferred to the B5 rooting medium (B5 salt 3.1 g / L, B5 vitamin, MES 1 g / L, sucrose 30 g / L, agar 8 g / L, cephalosporin 150 mg / L, indole-3-butyric acid (IBA) 1 mg / L) and cultured at 25°C until approximately 10 cm tall, then transferred to a greenhouse for further cultivation until fruit set. In the greenhouse, the plants were cultured at 26°C for 16 hours each day, followed by 8 hours at 20°C.

[0129] 3. Verify transgenic soybean plants using TaqMan

[0130] Approximately 100 mg of leaves were collected from soybean plants transformed with the prGhUbi10-01 promoter sequence, the prGm17gTsf1 control promoter sequence, the pr35S control promoter sequence, and the prAtH4A748:lTEV chimeric control promoter sequence, respectively. Genomic DNA was extracted using Qiagen's DNeasy Plant Maxi Kit. The copy number of the EPSPS gene was determined by TaqMan probe-based quantitative PCR to identify the copy numbers of the prGhUbi10-01, prGm17gTsf1, pr35S, and prAtH4A748:lTEV genes. Wild-type soybean plants were used as controls, and the analysis was performed according to the methods described below. The experiment was conducted in triplicate, and the average value was used.

[0131] The specific method for detecting the EPSPS gene copy number is as follows:

[0132] Step 6: Take 100 mg of leaves from soybean plants transformed with the prGhUbi10-01 promoter sequence, soybean plants transformed with the prGm17gTsf1 control promoter sequence, soybean plants transformed with the pr35S control promoter sequence, soybean plants transformed with the prAtH4A748:lTEV chimeric control promoter sequence, and wild-type soybean plants, respectively. Grind each sample into a homogenate in a mortar using liquid nitrogen. Take 3 replicates for each sample.

[0133] Step 7: Use Qiagen's DNeasy Plant Mini Kit to extract genomic DNA from the above samples. Refer to the product manual for specific methods.

[0134] Step 8: Determine the genomic DNA concentration of the above samples using NanoDrop 2000 (Thermo Scientific);

[0135] Step 9: Adjust the genomic DNA concentration of the above samples to the same concentration value, wherein the concentration value ranges from 80-100 ng / μL;

[0136] Step 10: The copy number of the samples was identified using TaqMan probe-based quantitative real-time PCR. Samples with known copy numbers were used as standards, and wild-type soybean plant samples were used as controls. Each sample was tested in triplicate, and the average value was taken. The primer and probe sequences for quantitative real-time PCR were as follows:

[0137] The following primers and probes are used to detect the EPSPS gene sequence:

[0138] Primer 1: ggtgtgcaggtgaagtctgaag is shown in SEQ ID NO:30 in the sequence listing;

[0139] Primer 2: gtctttggtccacgcaaggt is shown in SEQ ID NO:31 in the sequence listing;

[0140] Probe 1: cggtgatcgtcttccagt is shown as SEQ ID NO:32 in the sequence listing;

[0141] The PCR reaction system is as follows:

[0142] The 50× primer / probe mixture contains 45 μL of each primer at a concentration of 1 mM, 50 μL of the probe at a concentration of 100 μM, and 860 μL of 1×TE buffer, and is stored in amber tubes at 4°C.

[0143] The PCR reaction conditions are as follows:

[0144] The data was analyzed using SDS2.3 software (Applied Biosystems).

[0145] By analyzing the experimental results of EPSPS gene copy number, it was confirmed that the prGhUbi10-01 promoter sequence, the prGm17gTsf1 control promoter sequence, the pr35S control promoter sequence, and the prAtH4A748:lTEV chimeric control promoter sequence had all been integrated into the chromosome set of the tested soybean plants. Moreover, soybean plants transformed with the prGhUbi10-01 promoter sequence, soybean plants transformed with the prGm17gTsf1 control promoter sequence, soybean plants transformed with the pr35S control promoter sequence, and soybean plants transformed with the prAtH4A748:lTEV chimeric control promoter sequence all obtained single-copy transgenic soybean plants.

[0146] 4. Detection of the effect of the constitutive promoter of the present invention on driving LUC reporter gene expression in various soybean tissues.

[0147] Soybean plants transformed with the prGhUbi10-01 promoter sequence, soybean plants transformed with the prGm17gTsf1 control promoter sequence, soybean plants transformed with the pr35S control promoter sequence, and soybean plants transformed with the prAtH4A748:lTEV chimeric control promoter sequence were obtained in Example 3. Samples were taken from different parts of the above transgenic soybean plants at different stages as test samples.

[0148] Samples were taken from three parts during the vegetative growth stage (V3 stage) as test samples: roots, stems, and leaves;

[0149] Samples were taken from six parts during the reproductive growth period as test samples: roots, stems, leaves, flowers, pods, and fruits;

[0150] Wild-type soybean plants (CK3) at the same growth stage and in the same part were sampled as negative control samples.

[0151] Test samples from different periods and parts of the plant and negative control samples from wild-type soybean plants (CK3) from the same period and part of the plant (three lines were sampled at each period, and three replicates of the same mass were sampled from each part of each line) were cryogenically ground in liquid nitrogen, and then 1×PLB buffer was added to each sample. The samples were centrifuged at 12,000 rpm for 10 min at 4°C, and the supernatant was collected for later use.

[0152] The test samples and negative control samples were subjected to dual-luciferase detection according to steps 5 and 6 in the second embodiment 4, with the REN gene as an internal reference. The LUC / REN ratio reflects the relative activity intensity of the promoter (the definition of the LUC / REN ratio is the same as that in Table 2 of the third embodiment above). The LUC / REN ratios of different parts of soybeans at different stages of stable transformation are shown in Table 3.

[0153] Table 3. LUC / REN ratios at different stages of stable transformation in different parts of soybean.

[0154] The results in Table 3 show that: (1) the promoter prGhUbi10-01 of this invention is expressed in the roots, stems, leaves, flowers, pods and fruits of soybean plants, indicating that the promoter prGhUbi10-01 can drive the constitutive expression of the target heterologous gene in the plant; (2) during the vegetative growth stage of soybean, compared with the control promoters pr35S and prAtH4A748:lTEV, prGhUbi10-01 has a higher activity in driving the expression of the LUC gene; (3) during the reproductive growth stage of soybean, in the leaves, stems, roots, flowers and fruits, compared with the control promoter prAtH4A748:lTEV, prGhUbi10-01 has a higher activity in driving the expression of the LUC gene.

[0155] Fifth Example: Detection of Herbicide Resistance in Transgenic Arabidopsis Plants

[0156] 1. Construct recombinant expression vectors for the herbicide resistance gene HTG: prGhUbi10-01, prGhUbi10-02, prGhUbi10-03, prGhUbi10-04, prGhUbi10-05, prGhUbi10-06, and prGhUbi10-07.

[0157] The 5' and 3' ends of the prGhUbi10-01, prGhUbi10-02, prGhUbi10-03, prGhUbi10-04, prGhUbi10-05, prGhUbi10-06, and prGhUbi10-07 promoter sequences, as well as the prGm17gTsf1, pr35S, and prAtH4A748:lTEV chimeric control promoter sequences, were ligated to universal adapter primer 2.

[0158] 5' universal adapter primer 2: 5'-cacgtgaccctagtcacttaaagcttggcgcgcc-3', as shown in SEQ ID NO:33 in the sequence listing;

[0159] 3' universal adapter primer 2: 5'-cagtagctggtgttggaggcat-3', as shown in SEQ ID NO:34 in the sequence listing.

[0160] Constructing vectors using conventional enzyme digestion methods is well known to those skilled in the art. Figure 3 shows a schematic diagram of the structure of the vector DBNBC-HTG containing the herbicide resistance gene HTG (vector backbone: pCAMBIA2301 modified with resistance tag (available from CAMBIA)). (Spec: spectinomycin gene; RB: right border; AscI: restriction endonuclease AscI recognition site; HTG: hydroxyphenylpyruvate dioxygenase gene (SEQ ID NO:35); t35s: cauliflower virus 35S terminator (SEQ ID NO:23); prAtUbi10: promoter of Arabidopsis ubiquitin 10 gene (SEQ ID NO:26); spAtCTP2: Arabidopsis chloroplast transport peptide (SEQ ID NO:27); cEPSPS: 5-enolpyruvate shikimate-3-phosphate synthase gene (SEQ ID NO:28); tNos: terminator of carmine synthase gene (SEQ ID NO:29); LB: left border).

[0161] The above-mentioned vector DBNBC-HTG was linearized by digestion with the restriction endonuclease AscI. The digestion product was purified to obtain the linearized DBNBC-HTG expression vector. The prGhUbi10-01 promoter sequence ligated with the universal adapter primer 2 was used to carry out a recombination reaction with the linearized DBNBC-HTG expression vector. The operation procedure was performed according to the instructions of Takara In-Fusion Snap Assembly Master Mix kit (Clontech, CA, JPN, CAT: 638949) to construct the recombinant expression vector DBN21-B, the structural schematic diagram of which is shown in Figure 4.

[0162] The recombinant expression vector DBN21-B was transformed into *E. coli* DH5α competent cells using a heat shock method. The heat shock conditions were as follows: 100 μL of *E. coli* DH5α competent cells and 20 μL of recombinant plasmid DNA (recombinant expression vector DBN21-B) were gently mixed and then heat-shocked in a 42°C water bath for 30 s, followed immediately by placing on ice for 2 min. Then, 250 μL of antibiotic-free LB broth (10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, pH adjusted to 7.5 with NaOH) was added, and the cells were cultured at 37°C with shaking (200 rpm / min) for 1 h. The cells were then incubated upside down on LB agar plates containing 50 mg / L spectinomycin at 37°C for 12 h. Positive colonies were picked and cultured overnight in LB broth containing 50 mg / L spectinomycin at 37°C with shaking (200 rpm / min). Plasmids were extracted using the alkaline lysis method: The bacterial culture was centrifuged at 12000 rpm for 1 min, the supernatant was discarded, and the precipitated bacterial cells were resuspended in 100 μL of ice-cold solution I (25 mM Tris-HCl, 10 mM EDTA (ethylenediaminetetraacetic acid), 50 mM glucose, pH = 8.0); 200 μL of freshly prepared solution II (0.2 M... Add NaOH and 1% SDS (sodium dodecyl sulfate), invert the tube four times to mix, and place on ice for 3-5 min; add 150 μL of ice-cold Solution III (3M potassium acetate, 5M acetic acid), mix thoroughly immediately, and place on ice for 5-10 min; centrifuge at 4℃ and 12000 rpm for 5 min, transfer the supernatant to a new 2 mL centrifuge tube, add 2 volumes of anhydrous ethanol, mix well, and place at room temperature for 5 min; centrifuge at 4℃ and 12000 rpm for 5 min, discard the supernatant, wash the precipitate with 70% ethanol (V / V) and air dry; add 30 μL of TE (10 mM Tris-HCl, 1 mM EDTA, pH = 8.0) containing RNase (20 μg / mL) to dissolve the precipitate; digest RNA in a water bath at 37℃ for 30 min; store at -20℃ for later use. The extracted plasmid was sequenced and identified, and the results showed that the recombinant expression vector DBN21-B contained the nucleotide sequence shown in SEQ ID NO:1 in the sequence listing, which is the prGhUbi10-01 promoter sequence.

[0163] Following the method described above for constructing the recombinant expression vector DBN21-B containing the prGhUbi10-01 promoter sequence, the following sequences are connected: the prGhUbi10-02 promoter sequence linked to the universal adapter primer 2; the prGhUbi10-03 promoter sequence linked to the universal adapter primer 2; the prGhUbi10-04 promoter sequence linked to the universal adapter primer 2; the prGhUbi10-05 promoter sequence linked to the universal adapter primer 2; the prGhUbi10-06 promoter sequence linked to the universal adapter primer 2; and the universal adapter primer... The prGhUbi10-07 promoter sequence of primer 2, the prGm17gTsf1 control promoter sequence connected to the universal adapter primer 2, the pr35S control promoter sequence connected to the universal adapter primer 2, and the prAtH4A748:lTEV chimeric control promoter sequence connected to the universal adapter primer 2 were respectively recombined with the linearized DBNBC-HTG expression vector to obtain recombinant expression vectors DBN22-B to DBN30-B. Sequencing verified that the above nucleotide sequences were correctly inserted in the recombinant expression vectors DBN22-B to DBN30-B.

[0164] 2. Transformation of Agrobacterium with recombinant expression vector

[0165] Following the method for transforming Agrobacterium with recombinant expression vectors in Example 1 of the third embodiment described above, the correctly constructed recombinant expression vectors DBN21-B to DBN30-B were transformed into Agrobacterium GV3101 using liquid nitrogen. Sequencing verification results showed that the structures of the recombinant expression vectors DBN21-B to DBN30-B were completely correct.

[0166] 3. Detection of the herbicide resistance effect of the promoter-driven herbicide-tolerant gene HTG in transgenic Arabidopsis plants.

[0167] Following the method described in Example 2 of the third embodiment above, Arabidopsis inflorescences were immersed in the Agrobacterium bacterial solution described in Example 2 to transfer the T-DNA from the recombinant expression vectors DBN21-B to DBN30-B constructed in Example 2 into the Arabidopsis chromosome, thereby obtaining the corresponding transgenic Arabidopsis plants, namely, Arabidopsis T1 plants transferred with the prGhUbi10-01 promoter sequence, Arabidopsis T1 plants transferred with the prGhUbi10-02 promoter sequence, Arabidopsis T1 plants transferred with the prGhUbi10-03 promoter sequence, and Arabidopsis T1 plants transferred with the prGh... Arabidopsis T1 plants with the Ubi10-04 promoter sequence, Arabidopsis T1 plants with the prGhUbi10-05 promoter sequence, Arabidopsis T1 plants with the prGhUbi10-06 promoter sequence, Arabidopsis T1 plants with the prGhUbi10-07 promoter sequence, Arabidopsis T1 plants with the prGm17gTsf1 control promoter sequence, Arabidopsis T1 plants with the pr35S control promoter sequence, and Arabidopsis T1 plants with the prAtH4A748:lTEV chimeric control promoter sequence.

[0168] T1 transformants were selected from a background of untransformed seeds using a glyphosate selection protocol. Arabidopsis T1 plants transformed with the prGhUbi10-01 promoter sequence, Arabidopsis T1 plants transformed with the prGhUbi10-02 promoter sequence, Arabidopsis T1 plants transformed with the prGhUbi10-03 promoter sequence, Arabidopsis T1 plants transformed with the prGhUbi10-04 promoter sequence, Arabidopsis T1 plants transformed with the prGhUbi10-05 promoter sequence, and Arabidopsis T1 plants transformed with the prGhUbi10-06 promoter sequence... Arabidopsis thaliana T1 plants with the prGhUbi10-07 promoter sequence, Arabidopsis thaliana T1 plants with the prGm17gTsf1 control promoter sequence, Arabidopsis thaliana T1 plants with the pr35S control promoter sequence, Arabidopsis thaliana T1 plants with the prAtH4A748:lTEV chimeric control promoter sequence, and wild-type Arabidopsis thaliana plants (CK4) (18 days after sowing) were sprayed with 4 times the field concentration (100 g ai / ha) of bensulfuron-methyl to test the herbicide tolerance of Arabidopsis thaliana. Seven days after spraying, the degree of damage to each plant from the herbicide was determined based on the proportion of leaf whitening area (leaf whitening area ratio = leaf whitening area / total leaf area × 100%): level 0 was basically no whitening phenotype, level 1 was leaf whitening area ratio less than 50%, level 2 was leaf whitening area ratio greater than 50%, and level 3 was leaf whitening area ratio of 100%.

[0169] The resistance performance of each recombinant expression vector in the transformation event was scored according to the formula X=[Σ(N×S) / (T×M)]×100 (X-phytotoxicity score, N-number of plants with the same level of damage, S-number of phytotoxicity levels, T-total number of plants, M-highest phytotoxicity level). Resistance was evaluated based on the scores: highly resistant plants (0-15 points), moderately resistant plants (16-33 points), low-resistant plants (34-67 points), and non-resistant plants (68-100 points). The experimental results are shown in Table 4.

[0170] Table 4. Results of tolerance experiment of transgenic Arabidopsis thaliana T1 plants to benzyladenine.

[0171] For Arabidopsis, 4 times the field concentration of benzimidone was the effective dose for high-stress treatment. The results in Table 4 showed that: (1) Compared with CK4, Arabidopsis plants transformed with the prGhUbi10-01 promoter sequence, Arabidopsis plants transformed with the prGhUbi10-02 promoter sequence, Arabidopsis plants transformed with the prGhUbi10-03 promoter sequence, Arabidopsis plants transformed with the prGhUbi10-05 promoter sequence, and Arabidopsis plants transformed with the prGhUbi10-06 promoter sequence were all tolerant to benzimidone, while Arabidopsis plants transformed with the prGhUbi10-04 promoter sequence and Arabidopsis plants transformed with the prGhUbi10-07 promoter sequence were not tolerant to benzimidone. Therefore, it can be seen that the constitutive promoters prGhUbi10-01, prGhUbi10-02, prGhUbi10-03, prGhUbi10-05 and prGhUbi10-06 of the present invention can drive the expression of the target heterologous gene in plants. (2) Compared with the control promoters pr35S and prAtH4A748:lTEV, prGhUbi10-01, prGhUbi10-02, prGhUbi10-03 and prGhUbi10-05 have a better effect on driving the herbicide resistance gene HTG in transgenic Arabidopsis plants.

[0172] Sixth Example: Detection of Herbicide Resistance in Transgenic Soybean Plants

[0173] 1. Transformation of Agrobacterium with recombinant expression vector

[0174] Following the method for transforming Agrobacterium with recombinant expression vectors in Example 1 of the fourth embodiment, the correctly constructed recombinant expression vectors DBN21-B to DBN30-B were transformed into Agrobacterium EHA101 using liquid nitrogen. Sequencing verification results showed that the structures of the recombinant expression vectors DBN21-B to DBN30-B were completely correct.

[0175] 2. Obtaining transgenic soybean plants

[0176] Following the method described in Example 2 of the fourth embodiment above, cotyledonary node tissue of aseptically cultured soybean variety SY2043C was co-cultured with Agrobacterium as described in Example 1 to transfer the T-DNA from the recombinant expression vectors DBN21-B to DBN30-B into the soybean chromosome. This resulted in soybean plants with the prGhUbi10-01 promoter sequence, soybean plants with the prGhUbi10-02 promoter sequence, soybean plants with the prGhUbi10-03 promoter sequence, and soybean plants with the prGhUbi10-03 promoter sequence. Soybean plants with the prGhUbi10-04 promoter sequence, soybean plants with the prGhUbi10-05 promoter sequence, soybean plants with the prGhUbi10-06 promoter sequence, soybean plants with the prGhUbi10-07 promoter sequence, soybean plants with the prGm17gTsf1 control promoter sequence, soybean plants with the pr35S control promoter sequence, and soybean plants with the prAtH4A748:lTEV chimeric control promoter sequence.

[0177] 3. Verify transgenic soybean plants using TaqMan

[0178] The copy number of the EPSPS gene in transgenic soybean plants was detected using the method described in Example 3 of the fourth embodiment above. Analysis of the EPSPS gene copy number results confirmed that the promoter sequences prGhUbi10-01, prGhUbi10-02, prGhUbi10-03, prGhUbi10-04, prGhUbi10-05, prGhUbi10-06, prGhUbi10-07, prGm17gTsf1 control promoter, pr35S control promoter, and prAtH4A748:lTEV chimeric control promoter had all been integrated into the chromosome set of the detected soybean plants. Soybean plants with the prGhUbi10-01 promoter sequence, soybean plants with the prGhUbi10-02 promoter sequence, soybean plants with the prGhUbi10-03 promoter sequence, soybean plants with the prGhUbi10-04 promoter sequence, soybean plants with the prGhUbi10-05 promoter sequence, soybean plants with the prGhUbi10-06 promoter sequence, soybean plants with the prGhUbi10-07 promoter sequence, soybean plants with the prGm17gTsf1 control promoter sequence, soybean plants with the pr35S control promoter sequence, and soybean plants with the prAtH4A748:lTEV chimeric control promoter sequence were all single-copy transgenic soybean plants.

[0179] 4. Detection of the herbicide resistance effect of the promoter-driven herbicide-tolerant gene HTG in transgenic soybean plants.

[0180] Soybean plants transformed with the prGhUbi10-01 promoter sequence, soybean plants transformed with the prGhUbi10-02 promoter sequence, soybean plants transformed with the prGhUbi10-03 promoter sequence, soybean plants transformed with the prGhUbi10-04 promoter sequence, soybean plants transformed with the prGhUbi10-05 promoter sequence, soybean plants transformed with the prGhUbi10-06 promoter sequence, soybean plants transformed with the prGhUbi10-07 promoter sequence, soybean plants transformed with the prGm17gTsf1 control promoter sequence, soybean plants transformed with the pr35S control promoter sequence, soybean plants transformed with the prAtH4A748:lTEV chimeric control promoter sequence, and wild-type soybean plants (CK5) (18 days after sowing) were treated with 4 times the field concentration (100g). The herbicide tolerance of transgenic soybean plants was tested by spraying with benzylabufen (ai / ha). Seven days after spraying, resistance was evaluated according to the method described in Example 3 of Section 5 above. The experimental results are shown in Table 5.

[0181] Table 5. Results of experiments on the tolerance of transgenic soybean plants to benzyladenine.

[0182] For soybeans, 4 times the field concentration of benzimidone is the effective dose for high-stress treatment. The results in Table 5 show that: (1) Compared with CK5, soybean plants with prGhUbi10-01 promoter sequence, prGhUbi10-02 promoter sequence, prGhUbi10-03 promoter sequence, prGhUbi10-05 promoter sequence and prGhUbi10-06 promoter sequence were tolerant to benzimidone at 4 times the field concentration, while soybean plants with prGhUbi10-04 promoter sequence and prGhUbi10-07 promoter sequence were not tolerant to benzimidone. Therefore, it can be seen that the constitutive promoters prGhUbi10-01, prGhUbi10-02, prGhUbi10-03, prGhUbi10-05 and prGhUbi10-06 of the present invention can drive the expression of the target heterologous gene in plants. (2) Compared with the control promoters pr35S and prAtH4A748:iTEV, prGhUbi10-01, prGhUbi10-02, prGhUbi10-03 and prGhUbi10-05 have a better effect on driving the herbicide resistance gene HTG in transgenic soybean plants.

[0183] In summary, this invention discloses for the first time a constitutive promoter from the cotton Ubiquitin gene. This constitutive promoter exhibits activity in almost all plant tissues and many cell types, particularly in plant roots, stems, leaves, flowers, pods, and fruits, and has broad application prospects in plants.

[0184] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention.

Claims

1. A constitutive promoter comprising, the nucleotide sequence of which comprises SEQ ID NO: 6, and the constitutive promoter is derived from SEQ ID NO:

1.

2. The constitutive promoter of claim 1, wherein, the nucleotide sequence of which comprises SEQ ID NO: 6, and is selected from at least a portion of SEQ ID NO:

1.

3. The constitutive promoter of claim 1 or 2, wherein, the nucleotide sequence of which is set forth in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 5, or SEQ ID NO:

6.

4. A recombinant DNA construct comprising the constitutive promoter of any one of claims 1-3 operably linked to a heterologous nucleotide sequence of interest.

5. The recombinant DNA construct of claim 4, wherein, the heterologous nucleotide sequence of interest encodes a protein of interest.

6. An expression cassette comprising the recombinant DNA construct of claim 4 or 5.

7. A recombinant vector comprising the expression cassette of claim 6.

8. A method of expressing a heterologous nucleotide sequence of interest in a plant, comprising, comprises: stably integrating into a plant cell a heterologous nucleotide sequence of interest operably linked to the constitutive promoter of any one of claims 1-3.

9. The method for expressing a heterologous nucleotide sequence of interest in a plant according to claim 8, wherein, the plant is Arabidopsis thaliana, Brassica napus, tobacco, soybean, cotton, pepper, sugar beet, pumpkin, eggplant, Chinese cabbage, carrot, tomato, pea, spinach, potato, or peanut.

10. The method for expressing a heterologous nucleotide sequence of interest in a plant according to claim 8, wherein, constitutive expression in plant tissue of the heterologous nucleotide sequence of interest.

11. The method for expressing a heterologous nucleotide sequence of interest in a plant according to claim 8, wherein, the heterologous nucleotide sequence of interest encodes a protein of interest.

12. The method for expressing a heterologous nucleotide sequence of interest in a plant according to claim 11, wherein, the heterologous nucleotide sequence of interest encodes a herbicide tolerance protein.

13. The method for expressing a heterologous nucleotide sequence of interest in a plant according to claim 11, wherein, the heterologous nucleotide sequence of interest encodes an insect resistance protein.

14. A plant or part, characterized in that, the constitutive promoter of any one of claims 1-3.

15. A method of obtaining processed agricultural products, characterized by, comprises:

16. Use of the constitutive promoter of any one of claims 1-3 for constitutive expression in plant tissue of a heterologous nucleotide sequence of interest.

17. Use of the constitutive promoter according to claim 16 for the constitutive expression of a heterologous nucleotide sequence of interest in plant tissue, characterized in that, the plant is Arabidopsis thaliana, Brassica napus, tobacco, soybean, cotton, pepper, sugar beet, pumpkin, eggplant, Chinese cabbage, carrot, tomato, pea, spinach, potato, or peanut.

18. Use of the constitutive promoter according to claim 16 for the constitutive expression of a heterologous nucleotide sequence of interest in plant tissue, characterized in that, the heterologous nucleotide sequence of interest encodes a protein of interest.

Citation Information

Patent Citations

  • Constitutive promoter and application thereof

    CN103725678A

  • Constitutive promoter and application thereof

    CN103725679A

  • Constitutive promoter and application thereof

    CN103740716A

  • InDel molecular marker related to cotton drought resistance and application thereof

    CN112981000A

  • InDel molecular marker for identifying high-temperature resistance character of cotton and application of InDel molecular marker

    CN113151554A