Non-natural polynucleotide
Novel non-naturally occurring polynucleotides with specific miRNA scaffolds address inefficiencies in RNAi by forming mature miRNAs that efficiently target and degrade mRNAs, providing effective gene regulation and disease treatment.
Patent Information
- Application Number
- PCT/JP2025/026385
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-07-26
- Filing Date
- 2025-07-25
- Publication Date
- 2026-01-29
AI Technical Summary
Existing RNAi technologies face challenges in efficiently degrading target mRNAs due to the selection of components in pri-miRNA scaffolds affecting RNAi efficiency, limiting the robust and sustained suppression of target gene expression.
Development of novel non-naturally occurring polynucleotides with specific miRNA scaffolds, comprising guide and passenger strands, and flanking regions, which are processed by endogenous machinery to form mature miRNAs that efficiently target and degrade target nucleic acids.
The novel polynucleotides achieve robust and sustained suppression of target gene expression, effectively regulating protein expression and treating diseases by administering them via vectors like AAV, ensuring high knockdown efficiency.
Smart Images

Figure JP2025026385_29012026_PF_FP_ABST
Abstract
Description
Non-naturally occurring polynucleotides
[0001] The present invention relates to non-naturally occurring polynucleotides capable of regulating the expression of a target protein, non-naturally occurring polynucleotides encoding the same, vectors comprising them, adeno-associated virus (AAV) genomes comprising non-naturally occurring polynucleotides encoding non-naturally occurring polynucleotides capable of regulating the expression of a target nucleic acid molecule, recombinant AAV comprising the AAV genomes, cells comprising the recombinant AAV, methods for producing the recombinant AAV, pharmaceutical compositions comprising the non-naturally occurring polynucleotides, etc., methods for expressing the non-naturally occurring polynucleotides in cells, methods for cleaving a target nucleic acid molecule in cells or inhibiting its translation into a protein, etc.
[0002] RNA interference (RNAi) has been shown to be a useful tool for gene silencing in fundamental studies of gene function and is expected to be a therapeutic tool for suppressing genes associated with the development of various diseases. Gene regulation by RNAi is primarily mediated by small RNAs known as microRNAs (miRNAs) (Non-Patent Documents 1 and 2).
[0003] miRNA biogenesis begins with the production of primary transcripts (i.e., pri-miRNAs) containing a basal stem sequence that is cleaved by Drosha to form precursor miRNAs (i.e., pre-miRNAs), which are then further processed to generate mature, functional miRNAs.
[0004] Mature, functional miRNAs are typically 19–25 nucleotides in length. More than 1,000 miRNAs have been identified in mammalian genomes. Mature miRNAs primarily bind to the translated or 3'-untranslated region (3'-UTR) of target messenger RNAs (mRNAs) by partially or fully pairing with their complementary sequences, promoting target mRNA degradation at the post-transcriptional level and, in some cases, inhibiting translation initiation. miRNAs play important roles in many important biological processes, such as cell cycle and growth regulation, apoptosis, cell proliferation, and tissue development.
[0005] miRNAs have emerged as powerful regulators of diverse cellular processes. When delivered intracellularly by viral vectors, artificial miRNAs are continuously expressed, resulting in robust and sustained suppression of target mRNAs. Elucidation of the mechanisms involved in miRNA processing has enabled scientists to harness the endogenous cellular RNAi machinery and direct the degradation of target mRNAs using artificial miRNAs (see, e.g., U.S. Patent No. 5,929,949 and Non-Patent Document 3).
[0006] One of the obstacles in the clinical development of RNAi is the poor degradation of target mRNAs. For example, it has been reported that the selection of the components of pri-miRNA (called miRNA scaffold), which consist of a basal stem sequence containing a Drosha cleavage recognition site and a loop sequence containing a Dicer cleavage recognition site, involved in the generation of mature functional miRNAs, affects the efficiency of RNAi (see Non-Patent Document 4).
[0007] WO2016 / 130589A2
[0008] Ambros, (2004) Nature 431 : 350-355Krol et al., (2010) Nat.Rev.Genet.11:597-610Davidson et al., (2012) Cell 150:873-875Shukkwan K Chen et al., (2023) Mol Ther Nucleic Acids 34:102057
[0009] An objective of the present invention is to provide novel means for expressing miRNA, novel means for efficient RNAi against target nucleic acid molecules, novel means for regulating the expression of target proteins, and the like.
[0010] The present inventors have explored miRNA as a novel source of miRNA scaffolds and found several miRNA scaffolds that can be used for RNAi. They have also found that these miRNA scaffolds can be used to knock down targets. The present inventors have conducted further intensive research and have completed the present invention.
[0011] That is, the present invention encompasses the following inventions: [1] A non-natural polynucleotide that is a single-stranded polynucleotide or its complementary strand, comprising: (a) a guide strand for a target nucleic acid molecule; (b) a passenger strand; and (c) a combination of a 5' flanking region, a loop region, and a 3' flanking region, wherein the combination of the 5' flanking region, the loop region, and the 3' flanking region is selected from the following (i) to (xi): (i) a 5' flanking region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO: 1, a loop region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO: 2, and a 3' flanking region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO: 3; (ii) a 5' flanking region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO: 4, a loop region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO: 5, and a 3' flanking region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO: 6; (iii) a 5'-flanking region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:7, a loop region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:8, and a 3'-flanking region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:9; (iv) a 5'-flanking region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:10, a loop region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:11, and a 3'-flanking region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:12; (v) a 5'-flanking region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:13, a loop region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:14, and a 3'-flanking region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:15; (vi) a 5'-flanking region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:16, a loop region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:17, and a 3'-flanking region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:18;(vii) a 5'-flanking region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:19, a loop region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:20, and a 3'-flanking region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:21; (viii) a 5'-flanking region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:22, a loop region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:2, and a 3'-flanking region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:23; (ix) a 5'-flanking region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:24, a loop region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:2, and a 3'-flanking region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:25; (x) a 5'-flanking region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:26, a loop region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:2, and a 3'-flanking region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:27; and (xi) An unnatural polynucleotide comprising any one combination selected from the group consisting of a 5'-flanking region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO: 28, a loop region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO: 2, and a 3'-flanking region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO: 29, wherein the passenger strand is positioned between the 5'-flanking region and the loop region, and the guide strand is positioned between the 3'-flanking region and the loop region, or the guide strand is positioned between the 5'-flanking region and the loop region, and the passenger strand is positioned between the 3'-flanking region and the loop region. [2] The unnatural polynucleotide of [1], wherein the 5'-flanking region and / or the 3'-flanking region is 15 to 100 bases in length. [3] The unnatural polynucleotide of [1] or [2], wherein the sequence identity is 95% or more in each of (i) to (xi).[4] The non-natural polynucleotide according to any one of [1] to [3], wherein the sequence identity is 100% in each of (i) to (xi). [5] The non-natural polynucleotide according to [1] or [2], wherein the combination of the 5' flanking region, the loop region, and the 3' flanking region is any one of the combinations of (i), (viii), and (ix), and wherein the 5' flanking region comprises a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence of positions 21 to 30 of SEQ ID NO: 1, and / or the 3' flanking region comprises a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence of positions 26 to 35 of SEQ ID NO: 3. [6] The unnatural polynucleotide according to any of [1] to [5], wherein the combination of the 5' flanking region, loop region, and 3' flanking region is a combination of a 5' flanking region consisting of the nucleotide sequence set forth in SEQ ID NO: 1, a loop region consisting of the nucleotide sequence set forth in SEQ ID NO: 2, and a 3' flanking region consisting of the nucleotide sequence set forth in SEQ ID NO: 3, a combination of a 5' flanking region consisting of the nucleotide sequence set forth in SEQ ID NO: 22, a loop region consisting of the nucleotide sequence set forth in SEQ ID NO: 2, and a 3' flanking region consisting of the nucleotide sequence set forth in SEQ ID NO: 23, or a combination of a 5' flanking region consisting of the nucleotide sequence set forth in SEQ ID NO: 24, a loop region consisting of the nucleotide sequence set forth in SEQ ID NO: 2, and a 3' flanking region consisting of the nucleotide sequence set forth in SEQ ID NO: 25. [7] The unnatural polynucleotide according to [6], wherein the combination of the 5' flanking region, loop region, and 3' flanking region is a combination of a 5' flanking region consisting of the nucleotide sequence set forth in SEQ ID NO: 24, a loop region consisting of the nucleotide sequence set forth in SEQ ID NO: 2, and a 3' flanking region consisting of the nucleotide sequence set forth in SEQ ID NO: 25. [8] The unnatural polynucleotide according to any of [1] to [7], wherein the guide strand is 70% or more complementary to a nucleotide sequence in the target nucleic acid molecule. [9] The non-natural polynucleotide according to any one of [1] to [8], wherein the passenger strand is 70% or more complementary to the guide strand.
[10] The non-naturally occurring polynucleotide according to any one of [1] to [9], which is not identical to any of hsa-miR10a, hsa-miR33, hsa-miR143, hsa-miR22, hsa-miR27b, hsa-miR92, and hsa-miR182.
[11] The non-naturally occurring polynucleotide according to any one of [1] to
[10] , which is RNA.
[12] An non-naturally occurring polynucleotide comprising a sequence encoding the non-naturally occurring polynucleotide according to any one of [1] to
[11] .
[13] The non-naturally occurring polynucleotide according to
[12] , which is DNA.
[14] The non-naturally occurring polynucleotide according to
[13] , which is single-stranded DNA.
[15] A vector comprising the non-naturally occurring polynucleotide according to any one of [1] to
[14] .
[16] The vector according to
[15] , which is an adeno-associated virus (AAV) vector.
[17] An AAV genome comprising the non-naturally occurring polynucleotide according to
[14] between two ITR sequences.
[18] The AAV genome according to
[17] , comprising a promoter and a polyA sequence arranged to express the non-natural polynucleotide.
[19] A recombinant AAV comprising the AAV genome and AAV capsid protein according to
[17] or
[18] .
[20] A cell comprising the non-natural polynucleotide according to any of [1] to
[14] , the vector according to
[15] or
[16] , the AAV genome according to
[17] or
[18] , or the recombinant AAV according to
[19] .
[21] The cell according to
[20] , which is derived from HEK293 cells or HeLa cells.
[22] A method for producing recombinant AAV, comprising culturing AAV producer cells transfected with at least one polynucleotide encoding an AAV Rep protein, at least one polynucleotide encoding an AAV Cap protein, and the AAV genome according to
[17] or
[18] .
[23] The method according to
[22] , wherein the AAV producer cells are derived from HEK293 cells or HeLa cells.
[24] A pharmaceutical composition comprising the non-natural polynucleotide according to any one of [1] to
[14] , the vector according to
[15] or
[16] , the AAV genome according to
[17] or
[18] , or the recombinant AAV according to
[19] .
[25] The pharmaceutical composition according to
[24] , which is administered intravenously, intramuscularly, intravitreally, in the pancreatic duct, intracerebrally, and / or intraventricularly.
[26] The pharmaceutical composition according to
[24] or
[25] , for expressing the unnatural polynucleotide according to any of [1] to
[11] in a cell.
[27] The pharmaceutical composition according to any of
[24] to
[26] , for cleaving the target nucleic acid molecule in a cell or inhibiting its translation into a protein.
[28] A method for expressing the unnatural polynucleotide according to any of [1] to
[11] in a cell, the method comprising the step of administering to a subject the unnatural polynucleotide according to any of [1] to
[14] , the vector according to
[15] or
[16] , the AAV genome according to
[17] or
[18] , or the recombinant AAV according to
[19] .
[29] A method for cleaving a target nucleic acid molecule in a cell or inhibiting its translation into a protein, the method comprising the step of administering to a subject the non-natural polynucleotide described in any one of [1] to
[14] , the vector described in
[15] or
[16] , the AAV genome described in
[17] or
[18] , or the recombinant AAV described in
[19] .
[0012] The present invention also encompasses the following inventions.
[30] A method for treating or preventing a disease caused by a target nucleic acid molecule, comprising administering to a subject the non-natural polynucleotide described in any of [1] to
[14] , the vector described in
[15] or
[16] , the AAV genome described in
[17] or
[18] , or the recombinant AAV described in
[19] .
[31] The method described in
[30] , wherein the administration is intravenous, intramuscular, intravitreal, pancreatic duct, intracerebral, or intraventricular.
[32] The non-natural polynucleotide described in any of [1] to
[14] , the vector described in
[15] or
[16] , the AAV genome described in
[17] or
[18] , or the recombinant AAV described in
[19] , for use in treating or preventing a disease caused by a target nucleic acid molecule.
[33] Use of a non-natural polynucleotide according to any one of [1] to
[14] , a vector according to
[15] or
[16] , an AAV genome according to
[17] or
[18] , or a recombinant AAV according to
[19] in the manufacture of a pharmaceutical for treating or preventing a disease caused by a target nucleic acid molecule.
[0013] According to the present invention, non-natural polynucleotides containing novel miRNA scaffolds for expressing miRNAs are provided, which are capable of knocking down target nucleic acid molecules, regulating the expression of target proteins, and the like.
[0014] Schematic diagram of pri-miRNA expressed from the plasmid prepared in Example 1. "siRNA" represents the mature miRNA portion. "Basal stem" represents the portion consisting of the 5'-flanking region and the 3'-flanking region. "Loop" represents the loop region. Herein, "Basal stem" and "Loop" are collectively referred to as the miRNA scaffold (or simply "scaffold"). Graph showing the GFP knockdown efficiency by miRNA expression plasmids having each miRNA scaffold of Example 1. Error bars in the graph represent standard deviation (N=2). Graph showing the knockdown efficiency of miRNA expression plasmids having an hsa-miR10a scaffold and miRNA expression plasmids having a prior art miRNA scaffold. Graph showing the pri-miRNA expressed from the plasmid prepared in Example 3. Graph showing the knockdown efficiency by miRNA expression plasmids having each miRNA scaffold of Example 3. Graph showing the VEGF knockdown efficiency by miRNA expression plasmids having each miRNA scaffold of Example 4.
[0033] Figure 1 shows the KRAS knockdown efficiency using miRNA expression plasmids having each miRNA scaffold from Example 4. Figure 2 shows a schematic diagram of the genome of the adeno-associated virus (AAV) vector prepared in Example 5. hsa-miRE, mmu-miR33, hsa-miR451, and hsa-miR10a are sequences encoding pri-miRNAs in which the mature miRNA portion is GFP siRNA and has the miRNA scaffolds of hsa-miRE, mmu-miR33, hsa-miR451, and hsa-miR10a, respectively. Figure 3 shows the productivity of AAV vectors using miRNA expression plasmids having each miRNA scaffold from Example 5. Figure 4 shows the GFP knockdown efficiency using each AAV vector from Example 5. Figure 5 shows the expression level of mature miRNA in cells infected with each AAV vector from Example 5. Error bars in the figure indicate standard deviation (N=2).
[0015] The present invention will be described in detail below. Note that the embodiment described below is an example of a typical embodiment of the present invention, and the scope of the present invention should not be construed as being narrow.
[0016] 1. Definitions As used herein, the term "non-naturally occurring polynucleotide" refers to a polynucleotide comprising a nucleotide sequence that does not occur in nature, regardless of whether it exists in a living organism or not.
[0017] As used herein, "mature miRNA" refers to a double-stranded RNA that is formed by cleaving the base of the stem-loop structure of a pri-miRNA (a long single-stranded RNA containing a stem-loop structure (or hairpin structure)) by the endogenous miRNA processing machinery (Drosha and Dicer) in a cell, excising the pre-miRNA by cleaving the base of the stem-loop structure, and then cleaving the loop portion to excise the stem portion. As used herein, "endogenous miRNA processing machinery" or "intracellular miRNA processing machinery" refers to the cleavage mechanism of the base of the stem-loop structure of a pri-miRNA by a complex containing the RNase Drosha present in the cell and / or the cleavage mechanism of the loop portion of the stem-loop structure of a pre-miRNA by a complex containing the RNase Dicer (see, for example, Fig. 1 in Mol Ther. 2014 Apr;22(4):692-701). In addition, in the present specification, the stem portion remaining after cleavage of the stem and loop portions by Drosha and Dicer in pri-miRNA or pre-miRNA may be referred to as the "mature miRNA portion." The "mature miRNA portion" may comprise or consist of a guide strand (also called the antisense strand) and a passenger strand (also called the sense strand). Because the "mature miRNA portion" has the same structure as siRNA, it may be referred to as siRNA in the present specification.
[0018] As used herein, the expression "polynucleotide A or nucleotide sequence A" "encodes" polynucleotide B or nucleotide sequence B means that polynucleotide B or nucleotide sequence B can be produced from polynucleotide A or nucleotide sequence A by transcription. For example, miRNA can be produced from a DNA sequence encoding miRNA by the action of RNA polymerase II or III. As used herein, the expression "polynucleotide A or nucleotide sequence A" "encodes" a polypeptide, protein, or amino acid sequence means that the polypeptide, protein, or amino acid sequence can be produced from polynucleotide A or nucleotide sequence A by transcription and translation, or by translation.
[0019] As used herein, "sequence identity" between nucleotide sequences is determined by aligning the sequences using CLUSTALW or GENETYX-SV / RC Ver. 13.1.1, preferably using the default parameters of GENETYX-SV / RC Ver. 13.1.1.
[0020] As used herein, "knockdown" refers to the inhibition of expression of a target nucleic acid molecule by miRNA. "Knockdown efficiency" refers to the rate at which the expression of a target nucleic acid molecule in cells expressing miRNA is reduced compared to control cells not expressing miRNA. "Knockdown activity" refers to the activity of inhibiting the expression of a target nucleic acid molecule by miRNA.
[0021] As used herein, the term "modified nucleotides" includes base-modified nucleotides and sugar-modified nucleotides.
[0022] As used herein, the term "base-modified nucleotide" refers to a nucleotide in which the base moiety of the nucleotide has been modified. The base-modified nucleotide includes all types of base modifications known in the technical field to which the present invention pertains. Examples of base-modified nucleotides include 2-amino-6-chloropurine riboside 5'-triphosphate, 2-aminoadenosine 5'-triphosphate, 2-thiocytidine 5'-triphosphate, 2-thiouridine 5'-triphosphate, 4-thiouridine 5'-triphosphate, 5-aminoallylcytidine 5'-triphosphate, 5-aminoallyluridine 5'-triphosphate, 5-bromocytidine 5'-triphosphate, 5-bromouridine 5'-triphosphate, 5-iodocytidine 5'-triphosphate, 5-iodouridine 5'-triphosphate, 5-methylcytidine 5'-triphosphate, 5-methyluridine 5'-triphosphate, 6-azacyt ... 5'-triphosphate, 6-chloropurine riboside 5'-triphosphate, 7-deazaadenosine 5'-triphosphate, 7-deazaguanosine 5'-triphosphate, 8-azaadenosine 5'-triphosphate, 8-azidoadenosine 5'-triphosphate, benzimidazole riboside 5'-triphosphate, N1-methyladenosine 5'-triphosphate, N1-methylguanosine 5'-triphosphate, N6-methyladenosine 5'-triphosphate, O6-methylguanosine 5'-triphosphate, pseudouridine 5'-triphosphate, puromycin 5'-triphosphate, xanthosine 5'-triphosphate, and the like.
[0023] As used herein, the term "sugar-modified nucleotide" refers to a nucleotide in which the sugar moiety of the nucleotide has been modified. Sugar-modified nucleotides include all types of sugar modifications known in the technical field to which the present invention belongs. For example, in the case of a nucleotide having a ribose ring, sugar-modified nucleotides include 2'-modified nucleotides, 4'-thio-modified nucleotides, 4'-thio-2'-modified nucleotides, and bicyclic sugar-modified nucleotides.
[0024] Examples of 2'-modified nucleotides include halo, allyl, amino, azido, O-allyl, O-C1-C10 alkyl, OCF 3 , O-(CH 2 ) 2 -O-CH3 , 2'-O(CH 2 ) 2 SCH 3 , O-(CH 2 ) 2 -O-N(R m ) (R n ), or O—CH 2 -C(=O)-N(R m ) (R n ) and each R m and R n are independently H, an amino protecting group, or a substituted or unsubstituted C 1 -C 10The alkyl groups are alkyl. Commercially available amidite reagents can be used to synthesize 2'-O-methylguanosine, 2'-O-methyladenosine, 2'-O-methylcytidine, and 2'-O-methyluridine. 2'-O-Aminoethylguanosine, 2'-O-aminoethyladenosine, 2'-O-aminoethylcytidine, and 2'-O-aminoethyluridine can be synthesized using amidite reagents as described in Blommers et al. Biochemistry (1998), 37, 17714-17725. 2'-O-Propylguanosine, 2'-O-propyladenosine, 2'-O-propylcytidine, and 2'-O-propyluridine can be synthesized according to Lesnik, EA et al. Biochemistry (1993), 32, 7832-7838. Commercially available amidite reagents can be used for 2'-O-allylguanosine, 2'-O-allyl adenosine, 2'-O-allyl cytidine, and 2'-O-allyl uridine. 2'-O-Methoxyethylguanosine, 2'-O-methoxyethyladenosine, 2'-O-methoxyethylcytidine, and 2'-O-methoxyethyluridine can be synthesized according to the patent (US6261840) or the literature (Martin, P. Helv. Chim. Acta. (1995) 78, 486-504). 2'-O-Butylguanosine, 2'-O-butyladenosine, 2'-O-butylcytidine, and 2'-O-butyluridine can be synthesized using amidite reagents described in the literature (Lesnik, EA et al. Biochemistry (1993), 32, 7832-7838). 2'-O-Pentylguanosine, 2'-O-pentyladenosine, 2'-O-pentylcytidine, and 2'-O-pentyluridine can be synthesized according to the literature (Lesnik, EA et al. Biochemistry (1993), 32, 7832-7838. Commercially available amidite reagents can be used for 2'-O-propargylguanosine, 2'-O-propargyladenosine, 2'-O-propargylcytidine, and 2'-O-propargyluridine.
[0025] An example of a 4'-thio modified nucleotide is a β-D-ribonucleotide in which the 4'-oxygen atom is replaced with a sulfur atom (Hoshika, S. et al. FEBS Lett. 579, pp. 3115-3118, (2005); Dande, P. et al. J. Med. Chem. 49, pp. 1624-1634 (2006); Hoshika, S. et al. ChemBioChem. 8, pp. 2133-2138, (2007)).
[0026] Examples of 4'-thio-2'-modified nucleotides include 4'-thio-2'-modified nucleotides that retain 2'-H or 2'-O-methyl (Matsugami, et al. Nucleic Acids Res. 36, 1805 (2008)).
[0027] Examples of bicyclic sugar modified nucleotides include nucleotides that contain a second ring formed by bridging two atoms of the ribose ring. Examples of bicyclic sugar modifications include 2'-O,4'-C-bridged modifications, such as 2',4'-BNA / LNA (bridged nucleic acids / locked nucleic acids) in which the 2'-oxygen atom and the 4'-carbon atom are bridged with a methylene chain (Obika, S. et al. Tetrahedron Lett., 38, pp. 8735-(1997); Obika, S. et al., Tetrahedron Lett., 39, pp. 5401-(1998); A. A. Koshkin, A. A. et al. Tetrahedron, 54, p. 3607 (1998); Obika, S. Bioorg. Med. Chem., 9, p. 1001 (2001); and ENA (2'-O,4'-C-ethylene-bridged nucleic acids), in which the methylene chain of 2',4'-BNA / LNA is bridged with an ethylene chain extending by one carbon atom (Morita, K. et al. Bioorg. Med. Chem. Lett., 12, p. 73 (2002); Morita, K. et al. Bioorg. Med. Chem., 11, p. 2211 (2003)). Other examples include AmNA described in WO2014 / 109384 and S-cEt (2',4'-constrained ethyl) described in the literature (Seth, PP et al. J. Org. Chem (2010), 75, 1569-1581.).
[0028] As used herein, the term "modified internucleotide bond" refers to a bond in which the phosphate bond (i.e., a phosphodiester bond) between two naturally occurring nucleosides has been replaced or altered. That is, a polynucleotide containing a modified internucleotide bond contains a modification of the phosphate group of at least one nucleotide. Modified internucleotide bond includes all types of modifications known in the technical field to which the present invention pertains. Modified internucleotide bond includes, for example, phosphorothioate bond, phosphorodithioate bond, alkylphosphonate bond, boranophosphate bond, phosphoramidate bond, phosphotriester bond, etc. Alkylphosphonate bond includes, for example, a bond modified by substituting a methyl group for the oxygen atom modified in a phosphorothioate bond (P-CH; methylphosphonate bond). Phosphotriester bond includes, for example, a bond modified by substituting an ethoxy group for the oxygen atom modified in a phosphorothioate bond (P-OC; ethoxyphosphotriester bond).
[0029] 2. Non-naturally occurring polynucleotides In one embodiment, the present invention provides a non-naturally occurring polynucleotide that is a single-stranded polynucleotide or its complementary strand, comprising: (a) a guide strand relative to a target nucleic acid molecule; (b) a passenger strand; and (c) a combination of a 5' flanking region, a loop region, and a 3' flanking region, wherein the combination of the 5' flanking region, the loop region, and the 3' flanking region is selected from the following (i) to (xi): (i) a 5' flanking region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:1, a loop region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:2, and a 3' flanking region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:3; (ii) a 5' flanking region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:4, a loop region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:5, and a 3' flanking region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:6; (iii) a 5'-flanking region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:7, a loop region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:8, and a 3'-flanking region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:9; (iv) a 5'-flanking region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:10, a loop region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:11, and a 3'-flanking region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:12; (v) a 5'-flanking region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:13, a loop region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:14, and a 3'-flanking region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:15; (vi) a 5'-flanking region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:16, a loop region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:17, and a 3'-flanking region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:18;(vii) a 5'-flanking region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:19, a loop region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:20, and a 3'-flanking region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:21; (viii) a 5'-flanking region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:22, a loop region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:2, and a 3'-flanking region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:23; (ix) a 5'-flanking region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:24, a loop region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:2, and a 3'-flanking region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:25; (x) a 5'-flanking region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:26, a loop region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:2, and a 3'-flanking region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:27; and (xi) A non-natural polynucleotide comprising any one combination selected from the group consisting of a 5'-flanking region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:28, a loop region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:2, and a 3'-flanking region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:29, wherein the passenger strand is disposed between the 5'-flanking region and the loop region, and the guide strand is disposed between the 3'-flanking region and the loop region, or the guide strand is disposed between the 5'-flanking region and the loop region, and the passenger strand is disposed between the 3'-flanking region and the loop region (hereinafter also referred to as the non-natural polynucleotide of the present invention);
[0030] The non-natural polynucleotides of the present invention can be processed by the endogenous miRNA processing machinery in cells to produce a mature miRNA consisting of (a) a guide strand for a target nucleic acid molecule and (b) a passenger strand. The mature miRNA can bind to the target nucleic acid molecule and cleave it or inhibit its translation into protein. In view of such functionality, the non-natural polynucleotides of the present invention can also be referred to as regulatory polynucleotides. Furthermore, the nucleotide sequence of the non-natural polynucleotides of the present invention differs from the nucleotide sequence of naturally occurring polynucleotides. The nucleotide sequence of the non-natural polynucleotides of the present invention can be artificially designed. In one embodiment, the non-natural polynucleotides of the present invention can be isolated polynucleotides.
[0031] The non-natural polynucleotide of the present invention may typically be an RNA molecule. The non-natural polynucleotide of the present invention may include a modified nucleotide or a modified internucleotide bond in part, as long as a functional mature miRNA can be formed by the miRNA processing machinery in a cell.
[0032] In the present invention, the target nucleic acid molecule may be any nucleic acid that can be targeted by intracellular mechanisms involving natural miRNAs (e.g., RNAi, RNA activation (RNAa), etc.), and may be any gene or nucleic acid construct, regardless of whether it encodes a protein. The target nucleic acid molecule may be, for example, a long non-coding RNA (lncRNA). The target nucleic acid molecule may be DNA or RNA. In a preferred embodiment, the target nucleic acid molecule may be RNA, more preferably mRNA. In this specification, the protein translated from the target nucleic acid molecule is referred to as the target protein.
[0033] (a) The guide strand for the target nucleic acid molecule and (b) the passenger strand form the stem portion of a stem-loop structure (see Figure 1), which can be used by the intracellular miRNA processing machinery to form a mature miRNA. Of the two strands of the mature miRNA, the strand that can be incorporated into the RISC complex and bind to the target nucleic acid molecule is the guide strand, and the other strand is the passenger strand.
[0034] The guide strand and passenger strand can be appropriately designed to form a mature miRNA based on the design method of artificial miRNA or siRNA known in the art. The nucleotide sequences of the guide strand and passenger strand can be selected from the nucleotide sequences of known mature miRNAs or siRNAs.
[0035] In the present invention, the guide strand does not need to be completely complementary to the nucleotide sequence in the target nucleic acid molecule, as long as it can bind to the target nucleic acid molecule and exert an effect such as cleavage or translation inhibition. In one embodiment, the guide strand can be 70% or more, for example, 75% or more, 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more complementary to the nucleotide sequence in the target nucleic acid molecule. In another embodiment, the guide strand can be 100% complementary to the nucleotide sequence in the target nucleic acid molecule.
[0036] In the present invention, the passenger strand does not need to be completely complementary to the guide strand, as long as it can form a mature miRNA with the guide strand. In one embodiment, the passenger strand can be 70% or more complementary to the guide strand, for example, 75% or more, 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more. In another embodiment, the passenger strand can be 100% complementary to the guide strand.
[0037] In the present invention, the 5'-flanking region refers to a region located on the 5' side of the passenger strand or guide strand that is located 5' from the loop region in the non-natural polynucleotide of the present invention. The 5'-flanking region, together with the 3'-flanking region, forms the base of the pri-miRNA (i.e., the basal stem). Herein, the 5'-flanking region is sometimes referred to as the 5' basal stem. The 5'-flanking region is positioned so that it is cleaved from the passenger strand or guide strand by the intracellular miRNA processing machinery (specifically, a complex containing Drosha). When the nucleotide sequence of SEQ ID NO: 1, 4, 7, 10, 13, 16, 19, 22, 24, 26, or 28 described in (i) to (xi) is located on the 5' side of the passenger strand or guide strand, it is typically cleaved from the passenger strand or guide strand by the intracellular miRNA processing machinery. The length of the 5'-flanking region is not particularly limited, but may be 15 to 100 bases in length, for example, 15 to 90 bases in length, 15 to 80 bases in length, 15 to 70 bases in length, 15 to 60 bases in length, 15 to 50 bases in length, 15 to 40 bases in length, 15 to 30 bases in length, or 15 to 20 bases in length.
[0038] In the present invention, the 3'-flanking region refers to a region located on the 3' side of the guide strand or passenger strand 3' from the loop region in the non-natural polynucleotide of the present invention. The 3'-flanking region, together with the 5'-flanking region, forms the base of the pri-miRNA (i.e., the basal stem). Herein, the 3'-flanking region is sometimes referred to as the 3' basal stem. The 3'-flanking region is positioned so that it is cleaved from the guide strand or passenger strand by the intracellular miRNA processing machinery (specifically, a complex containing Drosha). When the nucleotide sequence of SEQ ID NO: 3, 6, 9, 12, 15, 18, 21, 23, 25, 27, or 29 described in (i) to (xi) is located 3' from the guide strand or passenger strand, it is typically cleaved from the guide strand or passenger strand by the intracellular miRNA processing machinery. The length of the 3'-flanking region is not particularly limited, but may be 15 to 100 bases in length, for example, 15 to 90 bases in length, 15 to 80 bases in length, 15 to 70 bases in length, 15 to 60 bases in length, 15 to 50 bases in length, 15 to 40 bases in length, 15 to 30 bases in length, or 15 to 20 bases in length.
[0039] The lengths of the 5' flanking region and the 3' flanking region may be the same or different, and each may independently be 15 to 100 bases in length. In one embodiment, the 5' flanking region or the 3' flanking region may be 15 to 100 bases in length. In a preferred embodiment, the 5' flanking region and the 3' flanking region may each be 15 to 100 bases in length.
[0040] In the non-natural polynucleotide of the present invention, the 5'-flanking region and the 3'-flanking region form the base of a stem-loop structure (see Figure 1). In the present invention, the 5'-flanking region and the 3'-flanking region form the base of the stem-loop structure so that they are cleaved from the double strand consisting of the guide strand and the passenger strand by the miRNA processing machinery in the cell.
[0041] In the present invention, a loop region refers to a region located between the passenger strand and the guide strand in the unnatural polynucleotide of the present invention. In the structure obtained after the 5'-flanking region and the 3'-flanking region are cleaved from the unnatural polynucleotide of the present invention, the guide strand and the passenger strand are paired to form a stem, and the loop region forms a loop connecting them. The loop region is positioned so that it is cleaved from the guide strand and the passenger strand by the intracellular miRNA processing machinery (specifically, a complex containing Dicer). When a loop region comprising the nucleotide sequence of SEQ ID NO: 2, 5, 8, 11, 14, 17, or 20 described in (i) to (xi) above is positioned between the passenger strand and the guide strand, the loop region is usually cleaved from the guide strand and the passenger strand by the intracellular miRNA processing machinery.
[0042] In this specification, the 5' flanking region, loop region, and 3' flanking region are collectively referred to as the miRNA scaffold, or simply as the scaffold.
[0043] In the present invention, a passenger strand or guide strand is positioned between the 5'-flanking region and the loop region so as to function within a cell. For example, the passenger strand or guide strand is positioned between the 5'-flanking region and the loop region so as to be cleaved from the 5'-flanking region and the loop region by the intracellular miRNA processing machinery to form a mature miRNA. Furthermore, the guide strand or passenger strand is positioned between the 3'-flanking region and the loop region so as to be cleaved from the 3'-flanking region and the loop region by the intracellular miRNA processing machinery to form a mature miRNA. The guide strand and passenger strand cleaved from the 5'-flanking region, the 3'-flanking region, and the loop region function as a mature miRNA.
[0044] In one embodiment, the non-naturally occurring polynucleotide of the present invention may contain one or more spacer regions separating one or more regions selected from the group consisting of passenger strand, guide strand, 5' flanking region, loop region, and 3' flanking region from adjacent regions, as long as functional mature miRNA can be formed by the miRNA processing machinery in the cell. The spacer region can be, for example, 1 to 20 bases long, i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 bases in length. In another embodiment, the non-naturally occurring polynucleotide of the present invention may not contain the above-mentioned spacer regions and may consist of the 5' flanking region, passenger strand, loop region, guide strand, and 3' flanking region.
[0045] In the present invention, the combination of the 5' flanking region, loop region, and 3' flanking region may be any one combination selected from the group consisting of (i) to (xi). In (i), SEQ ID NOs: 1, 2, and 3 are nucleotide sequences derived from hsa-miR10a (Accession No. MI0000266, last updated 2022 / 01 / 24). In (ii), SEQ ID NOs: 4, 5, and 6 are nucleotide sequences derived from hsa-miR33 (Accession No. MI0000091, last updated 2022 / 01 / 24). In (iii), SEQ ID NOs: 7, 8, and 9 are nucleotide sequences derived from hsa-miR143 (Accession No. MI0000459, last updated 2022 / 01 / 24). In (iv), SEQ ID NOs: 10, 11, and 12 are nucleotide sequences derived from hsa-miR22 (Accession No. MI0000078, last updated 2022 / 01 / 24). In (v), SEQ ID NOs: 13, 14, and 15 are nucleotide sequences derived from hsa-miR27b (Accession No. MI0000440, last updated 2022 / 01 / 24). In (vi), SEQ ID NOs: 16, 17, and 18 are nucleotide sequences derived from hsa-miR92 (Accession No. MI0000093, last updated 2022 / 01 / 24). In (vii), SEQ ID NOs: 19, 20, and 21 are nucleotide sequences derived from hsa-miR182 (Accession No. MI0000272, last updated 2022 / 01 / 24). In (viii), SEQ ID NOs: 22 and 23 are nucleotide sequences derived from hsa-miR10a (Accession No. MI0000266, last updated 2022 / 01 / 24). In (ix), SEQ ID NOs: 24 and 25 are nucleotide sequences derived from hsa-miR10a (Accession No. MI0000266, last updated 2022 / 01 / 24). In (x), SEQ ID NOs: 26 and 27 are nucleotide sequences derived from hsa-miR10a (Accession No. MI0000266, last updated 2022 / 01 / 24).In (xi), SEQ ID NOs: 28 and 29 are nucleotide sequences derived from hsa-miR10a (Accession No. MI0000266, data updated on 2022 / 01 / 24).
[0046] The sequences of the 5'-flanking region, loop region, and 3'-flanking region do not need to be completely identical to the sequence derived from the naturally occurring miRNA, as long as they can be cleaved from the mature miRNA portion by the intracellular miRNA processing machinery to form a functional mature miRNA. The "sequence identity" of each sequence with the naturally occurring miRNA may be 90% or greater. For example, it has been reported that even if the sequences of the 5'-flanking region, loop region, and 3'-flanking region of a pri-miRNA are modified by approximately 10%, knockdown activity may not be affected (Christof Fellmann et al., (2013) Cell Rep. 5(6):1704-1713). In one embodiment, the sequence identity of each of (i) to (xi) may be 90% or greater, e.g., 91% or greater, 92% or greater, 93% or greater, 94% or greater, 95% or greater, 96% or greater, 97% or greater, 98% or greater, or 99% or greater. In a preferred embodiment, in each of (i) to (xi), the "sequence identity" of each sequence with the sequence derived from the naturally occurring miRNA may be 100%.
[0047] In one embodiment, when the combination of the 5' flanking region, loop region, and 3' flanking region is any one of (i), (viii), and (ix), the 5' flanking region may comprise a nucleotide sequence having 90% or more sequence identity to the nucleotide sequence of positions 21 to 30 of SEQ ID NO: 1, and / or the 3' flanking region may comprise a nucleotide sequence having 90% or more sequence identity to the nucleotide sequence of positions 26 to 35 of SEQ ID NO: 3. The nucleotide sequence of positions 21 to 30 of SEQ ID NO: 1 is identical to the nucleotide sequence of positions 11 to 20 of SEQ ID NO: 22 and the nucleotide sequence of positions 1 to 10 of SEQ ID NO: 24. The nucleotide sequence of positions 26 to 35 of SEQ ID NO: 3 is identical to the nucleotide sequence of positions 26 to 35 of SEQ ID NO: 23 and the nucleotide sequence of positions 26 to 35 of SEQ ID NO: 25. Inclusion of the above nucleotide sequences may result in higher knockdown activity against a target nucleic acid molecule when the non-natural polynucleotide of the present invention is introduced into a cell. In this embodiment, the sequence identity may be 90% or greater, for example, 91% or greater, 92% or greater, 93% or greater, 94% or greater, 95% or greater, 96% or greater, 97% or greater, 98% or greater, or 99% or greater. In a more preferred embodiment, the sequence identity may be 100%. In an even more preferred embodiment, the 5' flanking region may comprise the nucleotide sequence of positions 21 to 30 of SEQ ID NO:1, and the 3' flanking region may comprise the nucleotide sequence of positions 26 to 35 of SEQ ID NO:3.
[0048] In a preferred embodiment, the combination of the 5' flanking region, loop region, and 3' flanking region may be a combination of a 5' flanking region consisting of the nucleotide sequence set forth in SEQ ID NO: 1, a loop region consisting of the nucleotide sequence set forth in SEQ ID NO: 2, and a 3' flanking region consisting of the nucleotide sequence set forth in SEQ ID NO: 3, a combination of a 5' flanking region consisting of the nucleotide sequence set forth in SEQ ID NO: 22, a loop region consisting of the nucleotide sequence set forth in SEQ ID NO: 2, and a 3' flanking region consisting of the nucleotide sequence set forth in SEQ ID NO: 23, or a combination of a 5' flanking region consisting of the nucleotide sequence set forth in SEQ ID NO: 24, a loop region consisting of the nucleotide sequence set forth in SEQ ID NO: 2, and a 3' flanking region consisting of the nucleotide sequence set forth in SEQ ID NO: 25. In a more preferred embodiment, the combination of the 5' flanking region, loop region, and 3' flanking region may be a combination of a 5' flanking region consisting of the nucleotide sequence set forth in SEQ ID NO: 24, a loop region consisting of the nucleotide sequence set forth in SEQ ID NO: 2, and a 3' flanking region consisting of the nucleotide sequence set forth in SEQ ID NO: 25.
[0049] The non-natural polynucleotides of the present invention are different from conventionally known naturally occurring polynucleotides. The combination of the 5' flanking region, loop region, and 3' flanking region in the non-natural polynucleotides of the present invention may be identical to the combination of the 5' flanking region, loop region, and 3' flanking region in any of the miRNAs hsa-miR10a, hsa-miR33, hsa-miR143, hsa-miR22, hsa-miR27b, hsa-miR92, and hsa-miR182, but even in this case, the guide strand and passenger strand are different from those of the above miRNA. Therefore, the non-natural polynucleotides of the present invention are not identical to any of hsa-miR10a, hsa-miR33, hsa-miR143, hsa-miR22, hsa-miR27b, hsa-miR92, and hsa-miR182.
[0050] The non-natural polynucleotides of the present invention can be synthesized by chemical synthesis or genetic engineering techniques using methods known in the art. For example, the non-natural polynucleotides of the present invention can be produced by preparing a DNA template and transcribing it with an RNA polymerase.
[0051] The non-natural polynucleotide of the present invention may be a complementary strand of a single-stranded polynucleotide comprising (a) a guide strand for a target nucleic acid molecule, (b) a passenger strand, and (c) a combination of a 5' flanking region, a loop region, and a 3' flanking region. In this specification, the single-stranded polynucleotide and the complementary strand may be referred to as the "single-stranded polynucleotide of the present invention" and the "complementary strand of the present invention," respectively. The complementary strand of the present invention consists of a nucleotide sequence that is completely complementary to the nucleotide sequence of the single-stranded polynucleotide of the present invention. Since the single-stranded polynucleotide of the present invention can be produced by synthesizing complementary RNA using the complementary strand of the present invention as a template, the complementary strand of the present invention may be used for, for example, producing the single-stranded polynucleotide of the present invention.
[0052] The complementary strand of the present invention can be synthesized chemically or biosynthesized by genetic engineering techniques by methods known in the art.
[0053] 3. Non-naturally occurring polynucleotides and vectors encoding non-naturally occurring polynucleotides of the present invention In one aspect, the present invention provides non-naturally occurring polynucleotides (hereinafter also referred to as template polynucleotides of the present invention) comprising a sequence encoding a non-naturally occurring polynucleotide of the present invention. The template polynucleotide of the present invention may be DNA or RNA, preferably DNA, and more preferably single-stranded DNA. The nucleotide sequence of the template polynucleotide of the present invention differs from the nucleotide sequence of a naturally occurring polynucleotide. In one embodiment, the nucleotide sequence of the template polynucleotide of the present invention may be artificially designed. In one embodiment, the template polynucleotide of the present invention may be an isolated polynucleotide.
[0054] In one embodiment, when the template polynucleotide of the present invention comprises a sequence encoding a single-stranded polynucleotide of the present invention, the combination of the sequence encoding the 5' flanking region, the sequence encoding the loop region, and the sequence encoding the 3' flanking region contained in the template polynucleotide of the present invention is selected from the following (1-i) to (1-xi): (1-i) a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence complementary to SEQ ID NO: 30, a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence complementary to SEQ ID NO: 31, and a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence complementary to SEQ ID NO: 32; (1-ii) a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence complementary to SEQ ID NO: 33, a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence complementary to SEQ ID NO: 34, and a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence complementary to SEQ ID NO: 35; (1-iii) a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence complementary to SEQ ID NO: 36, a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence complementary to SEQ ID NO: 37, and a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence complementary to SEQ ID NO: 38; (1-iv) a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence complementary to SEQ ID NO: 39, a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence complementary to SEQ ID NO: 40, and a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence complementary to SEQ ID NO: 41; (1-v) a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence complementary to SEQ ID NO: 42, a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence complementary to SEQ ID NO: 43, and a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence complementary to SEQ ID NO: 44; (1-vi) a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence complementary to SEQ ID NO: 45, a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence complementary to SEQ ID NO: 46, and a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence complementary to SEQ ID NO: 47;(1-vii) a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence complementary to SEQ ID NO: 48, a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence complementary to SEQ ID NO: 49, and a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence complementary to SEQ ID NO: 50; (1-viii) a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence complementary to SEQ ID NO: 51, a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence complementary to SEQ ID NO: 31, and a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence complementary to SEQ ID NO: 52; (1-ix) a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence complementary to SEQ ID NO: 53, a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence complementary to SEQ ID NO: 31, and a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence complementary to SEQ ID NO: 54; (1-x) A nucleotide sequence having 90% or more sequence identity with the nucleotide sequence complementary to SEQ ID NO: 55, a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence complementary to SEQ ID NO: 31, and a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence complementary to SEQ ID NO: 56; and (1-xi) A nucleotide sequence having 90% or more sequence identity with the nucleotide sequence complementary to SEQ ID NO: 57, a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence complementary to SEQ ID NO: 31, and a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence complementary to SEQ ID NO: 58.
[0055] In one embodiment, when the template polynucleotide of the present invention comprises a sequence encoding the complementary strand of the present invention, the combination of the sequence encoding the 5' flanking region, the sequence encoding the loop region, and the sequence encoding the 3' flanking region contained in the template polynucleotide of the present invention is selected from the following (2-i) to (2-xi): (2-i) a nucleotide sequence having 90% or more sequence identity with SEQ ID NO: 30, a nucleotide sequence having 90% or more sequence identity with SEQ ID NO: 31, and a nucleotide sequence having 90% or more sequence identity with SEQ ID NO: 32; (2-ii) a nucleotide sequence having 90% or more sequence identity with SEQ ID NO: 33, a nucleotide sequence having 90% or more sequence identity with SEQ ID NO: 34, and a nucleotide sequence having 90% or more sequence identity with SEQ ID NO: 35; (2-iii) a nucleotide sequence having 90% or more sequence identity with SEQ ID NO: 36, a nucleotide sequence having 90% or more sequence identity with SEQ ID NO: 37, and a nucleotide sequence having 90% or more sequence identity with SEQ ID NO: 38; (2-iv) a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence of SEQ ID NO: 39, a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence of SEQ ID NO: 40, and a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence of SEQ ID NO: 41; (2-v) a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence of SEQ ID NO: 42, a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence of SEQ ID NO: 43, and a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence of SEQ ID NO: 44; (2-vi) a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence of SEQ ID NO: 45, a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence of SEQ ID NO: 46, and a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence of SEQ ID NO: 47;(2-vii) a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence of SEQ ID NO: 48, a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence of SEQ ID NO: 49, and a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence of SEQ ID NO: 50; (2-viii) a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence of SEQ ID NO: 51, a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence of SEQ ID NO: 31, and a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence of SEQ ID NO: 52; (2-ix) a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence of SEQ ID NO: 53, a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence of SEQ ID NO: 31, and a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence of SEQ ID NO: 54; (2-x) a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence of SEQ ID NO: 55, a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence of SEQ ID NO: 31, and a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence of SEQ ID NO: 56; and (2-xi) It may be any one combination selected from the group consisting of a nucleotide sequence having 90% or more sequence identity with SEQ ID NO: 57, a nucleotide sequence having 90% or more sequence identity with SEQ ID NO: 31, and a nucleotide sequence having 90% or more sequence identity with SEQ ID NO: 58;
[0056] In one embodiment, the sequence identity in each of (1-i) to (1-xi) and (2-i) to (2-xi) can be 90% or more, for example, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more. In a more preferred embodiment, the sequence identity in each of (i) to (xi) can be 100%.
[0057] The template polynucleotide of the present invention can be synthesized chemically or biosynthesized by genetic engineering techniques using methods known in the art.
[0058] In one aspect, the present invention provides a vector comprising a non-natural polynucleotide of the present invention or a template polynucleotide of the present invention (hereinafter also referred to as the vector of the present invention). The non-natural polynucleotide of the present invention or the template polynucleotide of the present invention is incorporated into the vector of the present invention in an expressible manner. The vector of the present invention can be used to introduce and express the non-natural polynucleotide of the present invention or the template polynucleotide of the present invention into a cell. As used herein, expression of a non-natural polynucleotide of the present invention or a template polynucleotide of the present invention refers to the production of a single-stranded polynucleotide of the present invention or a complementary strand of the present invention by transcription based on the sequence information contained in the non-natural polynucleotide of the present invention or the template polynucleotide of the present invention.
[0059] The type of vector that can be used in the present invention is not particularly limited, and both viral and non-viral vectors can be used. Examples of viral vectors include, but are not limited to, DNA viral vectors such as adenoviral vectors, adeno-associated viral (AAV) vectors, and herpesvirus vectors, and RNA viral vectors such as retroviral vectors, lentiviral vectors, bornavirus vectors, and paramyxovirus vectors. Viral vectors can be modified to lack the ability to self-replicate. Examples of non-viral vectors include, but are not limited to, plasmid vectors and episomal vectors.
[0060] In a preferred embodiment, the vector may be an AAV vector (hereinafter also referred to as the AAV vector of the present invention). AAV is a small, helper-dependent, non-enveloped virus classified in the Parvoviridae family and the Dependovirus genus that infects animals such as humans, primates, and rodents. It induces a very weak immune response and has no confirmed pathogenicity. It can infect both dividing and non-dividing cells, and upon infecting a host cell, it rarely integrates genes into the host's chromosomal genome, but can survive and express genes extrachromosomally within the nucleus.
[0061] AAV vectors of the present invention can be prepared by methods known in the art. For example, they can be prepared by replacing the Rep (involved in replication and integration) and Cap (capsid) sequences flanked by the ITRs (inverted terminal repeats) at both ends of the AAV viral genome with a payload (i.e., a non-natural polynucleotide of the present invention or a template polynucleotide of the present invention). For example, AAV particles can be packaged by transfecting a plasmid containing a payload flanked by two ITRs into cells such as HEK293 cells together with a Rep / Cap plasmid and an adenovirus helper plasmid (known as triple transfection). In a preferred embodiment, the AAV vectors of the present invention may contain a promoter and poly(A) sequence arranged to express the payload. The promoter and poly(A) sequence can be selected appropriately depending on the type of cell into which the AAV vectors of the present invention will be introduced. Examples of promoters include CMV, EF1α, PGK, CAGGS, hSyn, CBA, and U6. Examples of polyA sequences include SV40 polyA, intron SV40, hGH polyA, and HS VTK polyA. AAV vectors may be prepared using commercially available products, such as AAVpro (registered trademark) Helper Free System (manufactured by Takara Bio Inc.) and pAAV-CMV Vector (manufactured by Takara Bio Inc.).
[0062] The AAV vector of the present invention may be a human serotype AAV vector. Such a human AAV vector may be derived from any known serotype, for example, any of serotypes AAV1 to AAV11. The AAV vector may be, for example, a vector comprising an AAV1-derived genome in an AAV1-derived capsid, a vector comprising an AAV2-derived genome in an AAV2-derived capsid, a vector comprising an AAV4-derived genome in an AAV4-derived capsid, a vector comprising an AAV6-derived genome in an AAV6-derived capsid, or a vector comprising an AAV9-derived genome in an AAV9-derived capsid.
[0063] In other embodiments, the AAV vectors of the present invention may be pseudotyped hybrid or chimeric AAV vectors containing sequences and / or components derived from at least two different AAV serotypes. A pseudotyped AAV vector may contain an AAV genome derived from one AAV serotype and capsid proteins derived from at least a portion of a different AAV serotype. Examples of such pseudotyped AAV vectors include a vector containing an AAV2-derived genome in an AAV1-derived capsid, a vector containing an AAV2-derived genome in an AAV6-derived capsid, a vector containing an AAV2-derived genome in an AAV4-derived capsid, and a vector containing an AAV2-derived genome in an AAV9-derived capsid.
[0064] The AAV vector of the present invention may be a conventional single-stranded AAV (ssAAV) vector, or may be a self-complementary AAV (scAAV; see McCarty DM: Self-complementary AAV vectors; advances and applications. Mol Ther 2008; 16: 1648-1656).
[0065] The vector of the present invention can be prepared by operably linking the non-natural polynucleotide of the present invention or the template polynucleotide of the present invention downstream of a promoter in an appropriate expression vector by methods known in the art.
[0066] The vectors of the present invention can be introduced into cells by methods known in the art, depending on the type of cell and expression vector. Non-viral vectors can be introduced by, for example, lipofection, electroporation, microinjection, etc. Viral vectors can be introduced by infecting cells with an appropriate titer or multiplicity of infection (MOI).
[0067] In one aspect, the present invention provides an AAV genome comprising a template polynucleotide of the present invention, which is a single-stranded DNA, between two ITR sequences (hereinafter also referred to as the AAV genome of the present invention). The AAV genome of the present invention may be an AAV genome contained in an AAV vector of the present invention, or may be produced by chemical synthesis. In a preferred embodiment, the AAV genome of the present invention may comprise a promoter and a polyA sequence arranged to express the non-natural polynucleotide of the present invention. Examples of promoters and polyA sequences include those described for the AAV vector of the present invention.
[0068] In one aspect, the present invention provides a recombinant AAV comprising the AAV genome and AAV capsid protein of the present invention (hereinafter also referred to as the recombinant AAV of the present invention). The AAV capsid protein can be selected appropriately depending on the type of cell into which the recombinant AAV of the present invention is to be introduced, and can be selected from capsid proteins of various AAV serotypes, including, for example, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV9.47, AAV9(hu14), AAV10, AAV11, AAV12, AAVrh8, AAVrh10, AAV-DJ8, AAV-DJ, AAV-PHP.A, and AAV-PHP.B. The recombinant AAV of the present invention can be produced by the methods described for the AAV vectors of the present invention.
[0069] In one aspect, the present invention provides a cell comprising a non-naturally occurring polynucleotide of the present invention, a template polynucleotide of the present invention, a vector of the present invention, an AAV genome of the present invention, or a recombinant AAV of the present invention (hereinafter also referred to as a cell of the present invention). The cell of the present invention can be used to express the non-naturally occurring polynucleotide of the present invention or to produce the vector of the present invention or the recombinant AAV of the present invention.
[0070] The cells of the present invention can be produced by introducing the non-naturally occurring polynucleotide of the present invention, the template polynucleotide of the present invention, the vector of the present invention, the AAV genome of the present invention, or the recombinant AAV of the present invention into a cell by methods known in the art.
[0071] The type of cell of the present invention is not particularly limited, as long as it is capable of expressing the non-natural polynucleotide of the present invention or producing the vector or recombinant AAV of the present invention. The cell of the present invention can be derived from a viral-replicating cell, including, for example, prokaryotic (e.g., bacterial) cells and eukaryotic cells, including insect cells, yeast cells, and mammalian cells. Viral-replicating cells include A549, WEH1, 3T3, 10T1 / 2, BHK, MDCK, COS1, COS7, BSC1, BSC40, BMT10, VERO, W138, HeLa, HEK293, Saos, C2C12, L cells, HT1080, HepG2, primary mammalian fibroblasts, hepatocytes, myoblasts, and the like. In a preferred embodiment, the cell of the present invention can be derived from HEK293 or HeLa cells.
[0072] In one aspect, the present invention provides a method for producing recombinant AAV, comprising the step of culturing AAV producer cells transfected with at least one polynucleotide encoding an AAV Rep protein, at least one polynucleotide encoding an AAV Cap protein, and the AAV genome of the present invention (hereinafter also referred to as the recombinant AAV production method of the present invention).The AAV producer cells in the recombinant AAV production method of the present invention may further be transfected with polynucleotides that support AAV expression, such as E2, E4, and VA-RNA.
[0073] AAV Rep proteins and AAV Cap proteins can be appropriately selected from those known in the art depending on the cell type, and can be selected from Rep proteins and Cap proteins of various AAV serotypes, including, for example, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV9.47, AAV9(hu14), AAV10, AAV11, AAV12, AAVrh8, AAVrh10, AAV-DJ8, AAV-DJ, AAV-PHP.A, and AAV-PHP.B.
[0074] In the recombinant AAV production method of the present invention, the AAV production cell is not particularly limited as long as it can produce the recombinant AAV having the AAV genome of the present invention.The AAV production cell can be derived from a virus replicating cell, including, for example, prokaryotic (e.g., bacterial) cells and eukaryotic cells, including insect cells, yeast cells and mammalian cells.In a preferred embodiment, the AAV production cell can be the cell of the present invention, more preferably derived from HEK293 cells or HeLa cells.The gene introduction into the cell can be carried out by a method known in the art depending on the type of cell and expression vector.
[0075] Culture conditions for AAV-producing cells are known in the art and can be set appropriately depending on the type of cell.
[0076] The recombinant AAV production method of the present invention may further include a step of recovering and purifying the produced AAV. Methods for recovering and purifying AAV are known in the art. For example, packaging into AAV can be performed according to the method described in Tomono T et al. Mol. Ther. - Methods Clin. Dev. 2018 180. Alternatively, recovery and purification of AAV can be performed using a commercially available kit (e.g., AAVpro® Purification Kit (Takara Bio)).
[0077] 4. Pharmaceutical Compositions In one aspect, the present invention provides a pharmaceutical composition comprising a non-natural polynucleotide of the present invention, a template polynucleotide of the present invention, a vector of the present invention, an AAV genome of the present invention, or a recombinant AAV of the present invention (hereinafter also referred to as the pharmaceutical composition of the present invention). When the pharmaceutical composition of the present invention is administered to a subject, mature miRNAs are produced in the cell and can cleave a target nucleic acid molecule or inhibit its translation into protein. This can treat or prevent a disease caused by the target nucleic acid molecule. In one embodiment, the pharmaceutical composition of the present invention can be used to express a non-natural polynucleotide of the present invention in a cell. In one embodiment, the pharmaceutical composition of the present invention can be used to cleave a target nucleic acid molecule or inhibit its translation into protein in a cell.
[0078] The pharmaceutical composition of the present invention preferably contains an active ingredient (i.e., a non-natural polynucleotide of the present invention, a template polynucleotide of the present invention, a vector of the present invention, an AAV genome of the present invention, or a recombinant AAV of the present invention) in a form that can be introduced into cells. The form that can be introduced into cells may be any form known in the art, but examples of forms that can be introduced into cells include a polynucleotide dispersed in an appropriate solvent (e.g., water), encapsulated inside hollow nanoparticles, liposomes, lipid nanoparticles (LNPs), or the like, or a complex with a cationic polymer.
[0079] In one embodiment, the pharmaceutical composition of the present invention may further comprise a pharmaceutically acceptable excipient. As used herein, a pharmaceutically acceptable excipient refers to any ingredient other than the active ingredient (e.g., a medium capable of suspending or dissolving the active ingredient) that is substantially non-toxic and non-inflammatory to the subject to administration. Examples of excipients include anti-adherents, antioxidants, binders, coatings, compression aids, disintegrants, dyes (colorants), emollients, emulsifiers, fillers (diluents), film-forming agents or coatings, flavors, fragrances, glidants (glidants), lubricants, preservatives, printing inks, adsorbents, suspending or dispersing agents, sweeteners, and hydration water. Examples of excipients include, but are not limited to, butylated hydroxytoluene (BHT), calcium carbonate, dibasic calcium phosphate, calcium stearate, croscarmellose, cross-linked polyvinylpyrrolidone, citric acid, crospovidone, cysteine, ethyl cellulose, gelatin, hydroxypropyl cellulose, hydroxypropylmethylcellulose, lactose, magnesium stearate, maltitol, mannitol, methionine, methylcellulose, methylparaben, microcrystalline cellulose, polyethylene glycol, polyvinylpyrrolidone, povidone, pregelatinized starch, propylparaben, retinyl palmitate, shellac, silicon dioxide, sodium carboxymethylcellulose, sodium citrate, sodium starch glycolate, sorbitol, starch (corn), stearic acid, sucrose, talc, titanium dioxide, vitamin A, vitamin E, vitamin C, and xylitol.
[0080] The subject to which the pharmaceutical composition of the present invention is administered may be, for example, a mammal (e.g., a human, monkey, cow, sheep, goat, horse, pig, rabbit, dog, cat, rat, mouse, guinea pig, etc.), preferably a human.
[0081] The pharmaceutical composition of the present invention may be administered orally or parenterally, and a suitable route may be selected depending on the target symptoms. The administration route may be systemic or local. Examples of parenteral administration include intravenous, intramuscular, intravitreal, pancreatic duct, intracerebral, intraarterial, intraventricular, intrathecal, intramuscular, intradermal, subcutaneous, intraperitoneal, transdermal, intraosseous, and intraarticular administration. In a preferred embodiment, the pharmaceutical composition of the present invention may be administered intravenously, intramuscularly, intravitreal, pancreatic duct, intracerebrally, and / or intraventricularly.
[0082] The pharmaceutical composition of the present invention is administered to a subject in a therapeutically or prophylactically effective amount. The term "therapeutically or prophylactically effective amount" refers to an amount that exhibits a therapeutic or prophylactic effect for a specific disease, administration form, and administration route, and is determined appropriately depending on the subject's species, type of disease, symptoms, sex, age, chronic illnesses, and other factors.
[0083] The dosage of the pharmaceutical composition of the present invention can be determined appropriately depending on the species of the subject, the type of disease, symptoms, sex, age, chronic illnesses, and other factors.
[0084] In one aspect, the present invention provides a method for expressing a non-natural polynucleotide in a cell, comprising the step of administering to a subject a non-natural polynucleotide of the present invention, a template polynucleotide of the present invention, a vector of the present invention, an AAV genome of the present invention, or a recombinant AAV of the present invention. The active ingredient administered to a subject in the present invention (i.e., the non-natural polynucleotide of the present invention, the template polynucleotide of the present invention, the vector of the present invention, the AAV genome of the present invention, or the recombinant AAV of the present invention) is the same as that in the pharmaceutical composition of the present invention. Therefore, a specific embodiment of the present invention is the same as when the pharmaceutical composition of the present invention is administered.
[0085] In one aspect, the present invention provides a method for cleaving a target nucleic acid molecule in a cell or inhibiting its translation into a protein, the method comprising administering to a subject a non-natural polynucleotide of the present invention, a template polynucleotide of the present invention, a vector of the present invention, an AAV genome of the present invention, or a recombinant AAV of the present invention. The active ingredient administered to a subject in the present invention (i.e., the non-natural polynucleotide of the present invention, the template polynucleotide of the present invention, the vector of the present invention, the AAV genome of the present invention, or the recombinant AAV of the present invention) is the same as that in the pharmaceutical composition of the present invention. Therefore, a specific embodiment of the present invention is the same as the case of administering the pharmaceutical composition of the present invention.
[0086] In one aspect, the present invention provides a method for treating or preventing a disease caused by a target nucleic acid molecule, comprising the step of administering to a subject a non-natural polynucleotide of the present invention, a template polynucleotide of the present invention, a vector of the present invention, an AAV genome of the present invention, or a recombinant AAV of the present invention. The active ingredient administered to a subject in the present invention (i.e., the non-natural polynucleotide of the present invention, the template polynucleotide of the present invention, the vector of the present invention, the AAV genome of the present invention, or the recombinant AAV of the present invention) is the same as that in the pharmaceutical composition of the present invention. Therefore, a specific embodiment of the present invention is the same as the case of administering the pharmaceutical composition of the present invention.
[0087] The present invention will be explained in more detail below by way of examples and test examples, but the scope of the present invention is not limited to these.
[0088] Example 1: In vitro screening of miRNA scaffolds From public databases such as miRmine and TCGA, hsa-miR33, hsa-miR30a, hsa-miR143, hsa-miR10a, hsa-miR22, hsa-miR27b, hsa-miR92, and hsa-miR182 were selected because of their high expression levels and unique sequences. Plasmids expressing pri-miRNAs in which the mature miRNA portion is a GFP siRNA sequence (sense strand: GCAAGCUGACCCUGAAGUUC (SEQ ID NO: 59); antisense strand: GAACUUCAGGGUCAGCUUGC (SEQ ID NO: 60); see Bryan A. Piras et al., (2013) PLoS One. 8(9):e75894) and the miRNA scaffold is hsa-miR33, hsa-miR30a, hsa-miR143, hsa-miR10a, hsa-miR22, hsa-miR27b, hsa-miR92, or hsa-miR182 were constructed by the method described below (see Figure 1A and Table 1). A DNA fragment containing a SalI site at the 5' end and a SpeI site at the 3' end was amplified by PCR using a plasmid containing a base sequence (synthesized by Thermo Fisher Scientific) encoding a pri-miRNA with a miRNA scaffold consisting of hsa-miR33, hsa-miR30a, hsa-miR143, hsa-miR10a, hsa-miR22, hsa-miR27b, hsa-miR92, or hsa-miR182. The resulting PCR product was purified. pUC19 (Takara Bio) was constructed by introducing an expression cassette consisting of a CMV promoter, luciferase, multicloning site, and SV40 poly(A) into the pUC19 plasmid. The purified PCR product was inserted between the SalI and SpeI sites in the multicloning site of pUC19-CMV-Luciferase to create the pri-miRNA expression plasmid pUC19-CMV-Luciferase-pri-miRNA. The resulting E. coli colonies were transformed with the constructed plasmid and subjected to sequence analysis. Colonies in which the insertion of the sequence was confirmed were grown in liquid culture, and the plasmid was recovered.
[0089]
[0090] The GFP expression plasmid was prepared by cloning the GFP coding sequence (SEQ ID NO: 83) into the pcDNA3.4 TOPO vector (Thermo Fisher Scientific). HEK293A cells were co-transfected with the GFP expression plasmid (100 ng; see Bryan A. Piras et al., (2013) PLoS One. 8(9):e75894) and the miRNA expression plasmid (300 ng or 60 ng) prepared above using the jetPEI® reagent (Polyplus Transfection) according to the accompanying protocol. 72 hours later, GFP fluorescence intensity (Excitation 479 nm, Emission 520 nm) was measured using a Cytation 5 image reader (Agilent). The GFP knockdown efficiency of each miRNA scaffold relative to the GFP fluorescence intensity of the control was calculated as % Inhibition.
[0091] The results are shown in Figure 1B. At a plasmid concentration of 60 ng, the strength of knockdown activity was hsa-miR10a > hsa-miR143 > hsa-miR33 > hsa-miR30a > hsa-miR27b > hsa-miR92 > hsa-miR182 > hsa-miR22. At both 60 ng and 300 ng of plasmid, the highest knockdown activity was obtained when using the hsa-miR10a scaffold.
[0092] Example 2: Comparative study of hsa-miR10a scaffold with prior art miRNA scaffolds. Previously, miRNA expression systems using miRNA scaffolds such as hsa-miRE (Christof Fellmann et al., (2013) Cell Rep. 5(6):1704-1713), hsa-miR155 (Shukkwan K Chen et al., (2023) Mol Ther Nucleic Acids 34:102057), mmu-miR33 (Jun Xie et al., (2020) Mol Ther 28(2):422-430), hsa-miR451 (WO 2022 / 268835 A1), or hsa-miR127 (WO 2016 / 077689 A2) have been reported. Therefore, a plasmid expressing a pri-miRNA was constructed in the same manner as in Example 1, in which the mature miRNA portion was fixed to the GFP siRNA sequence and the miRNA scaffold was one of hsa-miR10a, hsa-miRE, hsa-miR155, mmu-miR33, hsa-miR451, or hsa-miR127, which showed the highest knockdown activity in Example 1 (see Table 2).
[0093]
[0094] As in Example 1, HEK293A cells were cotransfected with a GFP expression plasmid (100 ng) and the prepared miRNA expression plasmids (500 ng, 100 ng, 20 ng, 4 ng, 0.8 ng, 0.16 ng, 0.032 ng, or 0.0064 ng), and the GFP fluorescence intensity was measured 72 hours later. The GFP knockdown efficiency of each miRNA scaffold relative to the GFP fluorescence intensity of the control was calculated as % Inhibition. IC50 values were calculated using GraphPad Prism 10.
[0095] The results are shown in Figure 2. The strength of knockdown activity was in the following order: hsa-miR10a > hsa-miR155 > mmu-miR33 > hsa-miRE > hsa-miR127 > hsa-miR451, with the highest knockdown activity observed when using the hsa-miR10a scaffold.
[0096] Example 3: Optimization of the basal stem sequence of hsa-miR10a The length of the basal stem sequence of the hsa-miR10a scaffold in Example 1 was 55 mer. To optimize the length of the basal stem sequence of the hsa-miR10a scaffold, a plasmid expressing pri-miRNA was constructed in the same manner as in Example 1, except that the length of the basal stem sequence was changed to 45 mer, 35 mer, 25 mer, or 15 mer (see Table 3).
[0097]
[0098] As in Example 1, HEK293A cells were cotransfected with a GFP expression plasmid (100 ng) and the prepared miRNA expression plasmids (500 ng, 100 ng, 20 ng, 4 ng, 0.8 ng, 0.16 ng, 0.032 ng, or 0.0064 ng), and the GFP fluorescence intensity was measured 72 hours later. The GFP knockdown efficiency of each miRNA scaffold relative to the GFP fluorescence intensity of the control was calculated as % Inhibition. IC50 values were calculated using GraphPad Prism 10.
[0099] The results are shown in Figure 3. When the basal stem sequence length was 44-mer or 35-mer, high knockdown activity similar to that of the 55-mer was maintained. However, when the basal stem sequence length was 25-mer or less, knockdown activity tended to be weakened. These results indicate that higher knockdown activity can be obtained by using a basal stem sequence length of 35-mer or more in the hsa-miR10a scaffold.
[0100] Example 4: Versatility of miR10a To verify the versatility of hsa-miR10a, we measured its knockdown activity against targets other than GFP. VEGF and KRAS were used as targets. As miRNA scaffolds, we used has-miRE, which has been widely used in the literature, in addition to has-miR10a. Plasmids expressing pri-miRNAs in which the mature miRNA portion had the sequence of VEGF siRNA (sense strand: AAGUUCAUGGAUGUCUAUCAG (SEQ ID NO: 79); antisense strand: CUGAUAGACAUCCAUGAACUU (SEQ ID NO: 80); Ji Young Yoo et al., (2007) Mol Ther. 15(2):295-302) or KRAS siRNA (sense strand: UUGACGAUACAGCUAAUUCA (SEQ ID NO: 81); antisense strand: UGAAUUAGCUGUAUCGUCAA (SEQ ID NO: 82); Tina L Yuan et al., (2014) Cancer Discov. 4(10):1182-1197) and the miRNA scaffold was hsa-miRE or hsa-miR10a were constructed in the same manner as in Example 1. As in Example 1, HEK293A cells were cotransfected with GFP-VEGF or GFP-KRAS expression plasmids (100 ng; the GFP-VEGF or GFP-KRAS expression plasmids were prepared by cloning the GFP-VEGF coding sequence (SEQ ID NO: 84) or the GFP-KRAS coding sequence (SEQ ID NO: 85) into the pcDNA3.4 TOPO vector) and the prepared miRNA expression plasmids (500 ng, 100 ng, 20 ng, 4 ng, 0.8 ng, 0.16 ng, 0.032 ng, or 0.0064 ng), and GFP fluorescence intensity was measured 72 hours later. The GFP-VEGF or GFP-KRAS knockdown efficiency of each miRNA scaffold relative to the control GFP fluorescence intensity was calculated as % inhibition. IC50 values were calculated using GraphPad Prism 10.
[0101] The results are shown in Figure 4. When targeting VEGF or KRAS, high knockdown activity was achieved using the hsa-miR10a scaffold, as was the case when targeting GFP. Furthermore, the hsa-miR10a scaffold exhibited higher knockdown activity than the hsa-miRE scaffold. Therefore, the hsa-miR10a scaffold is suggested to be a versatile miRNA scaffold.
[0102] Example 5: Quality Assessment of AAV-hsa-miR10a We examined the target knockdown activity of pri-miRNAs with hsa-miR10a scaffolds when they were introduced into cells using an adeno-associated virus (AAV) vector. miRNA expression plasmids containing a luciferase gene downstream of a CMV promoter and a sequence encoding a pri-miRNA in which the mature miRNA portion was a GFP siRNA and the miRNA scaffold was hsa-miRE, mmu-miR33, hsa-miR451, or hsa-miR10a were constructed using the method described below ( Figure 5A ). A plasmid for AAV preparation that expresses the pri-miRNA was obtained by ligating a base sequence encoding a pri-miRNA in which the mature miRNA portion is GFP siRNA and the miRNA scaffold is hsa-miRE, mmu-miR33, hsa-miR451, or hsa-miR10a into the multicloning site of a plasmid for AAV preparation that has a CMV promoter (sequence number 88)-luciferase gene (sequence number 89)-multicloning site-SV40 polyA (sequence number 90) between the left ITR sequence (sequence number 86) and right ITR sequence (sequence number 87) of AAV2. AAV packaging was performed using AAVpro® 293T cells (Takara Bio) triple transfected with PEI using pHelper (Takara Bio) as a helper plasmid, pRC1 (Takara Bio) as a Rep / Cap1 plasmid, and the AAV preparation plasmid expressing the above-mentioned pri-miRNA as a GOI plasmid, following the methodology described in Tomono T et al. Mol. Ther. - Methods Clin. Dev. 2018 180. Culture supernatants were collected three days after transfection, and AAV was extracted from the cells using AAVpro® Extraction Solution (Takara Bio).The culture supernatant and AAV extract were mixed, pH adjusted, and filtered through a 0.45 μm filter. Affinity purification was then performed using an Äkta pure 25 system (Cytiva) connected to a 5 mL AAVX column (Thermo Fisher). Affinity purification was performed using a stepwise procedure, equilibrating and washing with PBS (Thermo Fisher). The column was eluted with elution buffer (20 mM citric acid, 400 mM NaCl, 3 mM MgCl2, pH 2.5). The eluate was immediately neutralized with 1 / 10 volume of 1 M Tris, pH 8.0, and ultrafiltered using an AMICON ULTRA-15 100 kDa (Merck) to exchange the buffer for PBS containing Pluronic F-68 (Thermo Fisher) to a final concentration of 0.01%. The virus titer was measured using the AAVpro® titration kit (Takara Bio) and a probe for the SV40 PolyA region (TAAGCTGCAATAAACAAG (SEQ ID NO: 91)). Quantitation was performed using a real-time PCR system, QuantStudio 7 Flex (Applied Biosystems), and AAV productivity was calculated (Figure 5B). No significant differences in AAV productivity were observed due to the miRNA scaffold. HEK293A cells were infected with AAV at a concentration adjusted to a titer of 1E4-1E11 GC. 24 hours later, cells were transfected with a GFP expression plasmid (100 ng; see Bryan A. Piras et al., (2013) PLoS One. 8(9):e75894) using the jetPEI® reagent (Polyplus Transfection) according to the protocol provided with the reagent. 72 hours after transfection with the GFP expression plasmid, GFP fluorescence intensity was measured as in Example 1. The GFP knockdown efficiency of each miRNA scaffold relative to the GFP fluorescence intensity of the control was calculated as % Inhibition. IC50 values were calculated using GraphPad Prism 10. The results are shown in Figure 5C.The strength of the knockdown activity was in the order of hsa-miR10a > mmu-miR33 > hsa-miRE > hsa-miR451, confirming the same trend as in Example 2.
[0103] To investigate the underlying mechanism behind the high knockdown activity of the hsa-miR10a scaffold, we measured the expression levels of mature miRNAs in AAV-infected cells using qPCR. HEK293A cells were infected with AAV (titer: 1E10 GC), and total RNA was extracted from the cells 72 hours later. miRNAs were quantified from the total RNA by qPCR using the miRCURY LNA microRNA PCR system (Qiagen). The results are shown in Figure 5D. Mature miRNA expression levels tended to be highest when the hsa-miR10a scaffold was used. High expression levels of mature miRNAs are thought to be one of the reasons for the high knockdown activity.
[0104] The present invention can be used to develop pharmaceuticals that can more efficiently induce RNAi against targets.
Claims
(a) a guide strand for a target nucleic acid molecule; (b) a passenger strand; and (c) a combination of a 5' flanking region, a loop region, and a 3' flanking region; or its complementary strand, comprising: The combination of the 5' flanking region, the loop region and the 3' flanking region is selected from the following (i) to (xi): (i) a 5' flanking region comprising a nucleotide sequence having 90% or greater sequence identity to SEQ ID NO:1, a loop region comprising a nucleotide sequence having 90% or greater sequence identity to SEQ ID NO:2, and a 3' flanking region comprising a nucleotide sequence having 90% or greater sequence identity to SEQ ID NO:3; (ii) a 5' flanking region comprising a nucleotide sequence having 90% or greater sequence identity to SEQ ID NO:4, a loop region comprising a nucleotide sequence having 90% or greater sequence identity to SEQ ID NO:5, and a 3' flanking region comprising a nucleotide sequence having 90% or greater sequence identity to SEQ ID NO:6; (iii) a 5' flanking region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:7, a loop region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:8, and a 3' flanking region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO:9; (iv) a 5' flanking region comprising a nucleotide sequence having 90% or greater sequence identity to SEQ ID NO: 10, a loop region comprising a nucleotide sequence having 90% or greater sequence identity to SEQ ID NO: 11, and a 3' flanking region comprising a nucleotide sequence having 90% or greater sequence identity to SEQ ID NO: 12; (v) a 5' flanking region comprising a nucleotide sequence having 90% or greater sequence identity to SEQ ID NO: 13, a loop region comprising a nucleotide sequence having 90% or greater sequence identity to SEQ ID NO: 14, and a 3' flanking region comprising a nucleotide sequence having 90% or greater sequence identity to SEQ ID NO: 15; (vi) a 5' flanking region comprising a nucleotide sequence having 90% or greater sequence identity to SEQ ID NO: 16, a loop region comprising a nucleotide sequence having 90% or greater sequence identity to SEQ ID NO: 17, and a 3' flanking region comprising a nucleotide sequence having 90% or greater sequence identity to SEQ ID NO: 18; (vii) a 5' flanking region comprising a nucleotide sequence having 90% or greater sequence identity to SEQ ID NO: 19, a loop region comprising a nucleotide sequence having 90% or greater sequence identity to SEQ ID NO: 20, and a 3' flanking region comprising a nucleotide sequence having 90% or greater sequence identity to SEQ ID NO: 21; (viii) a 5' flanking region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO: 22, a loop region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO: 2, and a 3' flanking region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO: 23; (ix) a 5' flanking region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO: 24, a loop region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO: 2, and a 3' flanking region comprising a nucleotide sequence having 90% or more sequence identity to SEQ ID NO: 25; (x) a 5' flanking region comprising a nucleotide sequence having 90% or greater sequence identity to SEQ ID NO: 26, a loop region comprising a nucleotide sequence having 90% or greater sequence identity to SEQ ID NO: 2, and a 3' flanking region comprising a nucleotide sequence having 90% or greater sequence identity to SEQ ID NO: 27; and (xi) a 5' flanking region comprising a nucleotide sequence having 90% or more sequence identity with SEQ ID NO: 28, a loop region comprising a nucleotide sequence having 90% or more sequence identity with SEQ ID NO: 2, and a 3' flanking region comprising a nucleotide sequence having 90% or more sequence identity with SEQ ID NO: 29 Any one combination selected from the group consisting of: the passenger strand is disposed between the 5' flanking region and the loop region, and the guide strand is disposed between the 3' flanking region and the loop region; or The non-natural polynucleotide, wherein the guide strand is positioned between the 5' flanking region and the loop region, and the passenger strand is positioned between the 3' flanking region and the loop region.
2. The non-natural polynucleotide of claim 1, wherein the 5' flanking region and / or the 3' flanking region is 15 to 100 bases in length. The non-natural polynucleotide of claim 1 or 2, wherein each of (i) to (xi) has a sequence identity of 95% or more. The non-natural polynucleotide according to any one of claims 1 to 3, wherein each of (i) to (xi) has 100% sequence identity.
3. The non-naturally occurring polynucleotide of claim 1 or 2, wherein the combination of the 5' flanking region, the loop region, and the 3' flanking region is any one of the combinations (i), (viii), and (ix), and wherein the 5' flanking region comprises a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence of positions 21 to 30 of SEQ ID NO:1, and / or the 3' flanking region comprises a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence of positions 26 to 35 of SEQ ID NO:
3. The combination of the 5' flanking region, the loop region and the 3' flanking region is a combination of a 5' flanking region consisting of the nucleotide sequence shown in SEQ ID NO: 1, a loop region consisting of the nucleotide sequence shown in SEQ ID NO: 2, and a 3' flanking region consisting of the nucleotide sequence shown in SEQ ID NO: 3; a combination of a 5' flanking region consisting of the nucleotide sequence set forth in SEQ ID NO: 22, a loop region consisting of the nucleotide sequence set forth in SEQ ID NO: 2, and a 3' flanking region consisting of the nucleotide sequence set forth in SEQ ID NO: 23, or A combination of a 5' flanking region consisting of the nucleotide sequence shown in SEQ ID NO: 24, a loop region consisting of the nucleotide sequence shown in SEQ ID NO: 2, and a 3' flanking region consisting of the nucleotide sequence shown in SEQ ID NO: 25 6. The non-natural polynucleotide of any one of claims 1 to 5, wherein: The combination of the 5' flanking region, the loop region and the 3' flanking region is A combination of a 5' flanking region consisting of the nucleotide sequence shown in SEQ ID NO: 24, a loop region consisting of the nucleotide sequence shown in SEQ ID NO: 2, and a 3' flanking region consisting of the nucleotide sequence shown in SEQ ID NO: 25 7. The non-naturally occurring polynucleotide of claim 6, wherein:
8. The non-natural polynucleotide of claim 1, wherein the guide strand is at least 70% complementary to a nucleotide sequence within the target nucleic acid molecule.
9. The non-natural polynucleotide of claim 1, wherein the passenger strand is at least 70% complementary to the guide strand. The non-natural polynucleotide of any one of claims 1 to 9, which is not identical to any of hsa-miR10a, hsa-miR33, hsa-miR143, hsa-miR22, hsa-miR27b, hsa-miR92 and hsa-miR182. The non-natural polynucleotide of any one of claims 1 to 10, which is RNA. A non-naturally occurring polynucleotide comprising a sequence encoding the non-naturally occurring polynucleotide of any one of claims 1 to 11.
13. The non-naturally occurring polynucleotide of claim 12, which is DNA.
14. The non-naturally occurring polynucleotide of claim 13, which is single-stranded DNA. A vector comprising the non-naturally occurring polynucleotide of any one of claims 1 to 14. The vector of claim 15, which is an adeno-associated virus (AAV) vector. An AAV genome comprising the non-natural polynucleotide of claim 14 between two ITR sequences.
18. The AAV genome of claim 17, comprising a promoter and a polyA sequence arranged to express the non-natural polynucleotide. A recombinant AAV comprising the AAV genome and AAV capsid protein of claim 17 or 18. A cell comprising a non-naturally occurring polynucleotide according to any one of claims 1 to 14, a vector according to claim 15 or 16, an AAV genome according to claim 17 or 18 or a recombinant AAV according to claim 19. The cell of claim 20, which is derived from a HEK293 cell or a HeLa cell.
1. A method for producing a recombinant AAV, comprising: A method comprising the step of culturing an AAV producer cell transfected with at least one polynucleotide encoding an AAV Rep protein, at least one polynucleotide encoding an AAV Cap protein, and the AAV genome described in claim 17 or 18. The method of claim 22, wherein the AAV producing cells are derived from HEK293 cells or HeLa cells. A pharmaceutical composition comprising a non-naturally occurring polynucleotide according to any one of claims 1 to 14, a vector according to claim 15 or 16, an AAV genome according to claim 17 or 18, or a recombinant AAV according to claim 19.
25. The pharmaceutical composition according to claim 24, which is administered intravenously, intramuscularly, intravitreally, intrapancreatically, intracerebrally and / or intraventricularly. A pharmaceutical composition according to claim 24 or 25 for expressing the non-natural polynucleotide according to any one of claims 1 to 11 in a cell. The pharmaceutical composition according to any one of claims 24 to 26, for cleaving the target nucleic acid molecule in a cell or inhibiting its translation into a protein.
12. A method for expressing a non-naturally occurring polynucleotide according to any one of claims 1 to 11 in a cell, comprising: A method comprising the step of administering to a subject a non-naturally occurring polynucleotide described in any one of claims 1 to 14, a vector described in claim 15 or 16, an AAV genome described in claim 17 or 18, or a recombinant AAV described in claim 19.
1. A method for cleaving a target nucleic acid molecule or inhibiting its translation into protein in a cell, comprising: A method comprising the step of administering to a subject a non-naturally occurring polynucleotide described in any one of claims 1 to 14, a vector described in claim 15 or 16, an AAV genome described in claim 17 or 18, or a recombinant AAV described in claim 19.
Citation Information
Patent Citations
Modified AAV constructions and uses thereof
WO2016172008A1