Antiviral composition targeting rdrp and niran

Abstract

The present invention relates to a compound exhibiting an antiviral effect and, more particularly, to a novel compound that simultaneously targets RNA-dependent RNA polymerase (RdRP) and Nidovirus RdRP-Associated Nucleotidyltransferase (NiRAN). The compound of the present invention exhibits higher antiviral activity than existing drugs, and thus can be usefully used as a therapeutic agent for viral infections.

Description

Antiviral composition targeting RDRP and NIRAN

[0001] The present invention relates to a compound that simultaneously targets RdRP (RNA-dependent RNA polymerase) and NiRAN (Nidovirus RdRp-Associated Nucleotidyl Transferase), exhibiting low side effects and high antiviral activity. When the compound of the present invention is used as a drug, it can inhibit the activity of RdRP and NiRAN, resulting in significant efficacy even as a monotherapy, and has the advantage of suppressing resistance.

[0002] This invention was carried out with the support of the research project "Seoul National University Integrated Pharmaceutical Research Institute" of the Science and Engineering Research Infrastructure Construction Project supported by the Ministry of Education (Project Unique Number: 2340002209, Subproject Number: NRF-2022R1A6A1A03046247 (1345364311)).

[0003] In addition, the present invention was carried out with the support of the research project "Development of nucleoside derivatives with broad-spectrum antiviral activity" (Project unique number: 2460000946, subproject number: KH136032 (1465040280 / HI23C0721000023)) of the project for development of antiviral treatment against RNA virus infectious diseases (DiseaseX) supported by the Ministry of Health and Welfare.

[0004] In addition, the present invention was carried out with the support of the research project "Evaluation of antiviral efficacy and study of mechanism of action of nucleoside derivatives" (Project unique number: 1465040304, Subproject number: HI23C0721000123 (BB23-03)) of the project for development of antiviral treatment against RNA virus infectious diseases (DiseaseX) supported by the Ministry of Health and Welfare.

[0005] Viral pandemics have been increasing in scale and frequency since the 20th century, beginning with the Hong Kong flu in 1968, followed by the swine flu in 2009 and COVID-19 in 2019. The global antiviral drug market reached $38.96 billion in 2021, and is projected to reach approximately $49 billion by 2023, according to Statsta. According to the World Health Organization (WHO), approximately 357 million people are already infected with four sexually transmitted diseases, including AIDS, and the number of new cases of viral infections increases by more than 1 million each year. Some predict that the global antiviral drug market, which continues to grow at an average annual rate of 4.0%, will reach a total size of $69.2 billion by 2025. Developed drugs primarily target viral polymerase inhibition and integrase inhibition, often used in combination. The target viruses include HIV / AIDS, influenza, hepatitis virus, and herpes virus, and recently, due to the SARS-CoV-2 pandemic, antiviral drugs such as Remdesivir, Molnupiravir, and Nirmatrelvir have been developed and are widely used.

[0006] As of 2022, SARS-CoV-2 treatments accounted for 42% of the total antiviral market, half of which targeted nucleoside-based RdRPs. HIV / AIDS treatments accounted for over 33%, almost all of which were nucleoside-based. These drugs were combinations of drugs targeting reverse transcriptase and integrase inhibitors. Thus, most antiviral drugs are nucleoside-based drugs targeting RNA or DNA polymerases, and can reliably inhibit viral replication by inhibiting viral gene replication. However, these mechanisms are not entirely virus-selective and can also inhibit human gene replication, leading to adverse effects. Therefore, drugs with novel mechanisms, superior antiviral activity, and low toxicity are expected to target the global antiviral market.

[0007] RdRP is an enzyme used by RNA viruses to replicate their genetic information. Most RNA viruses use this enzyme to synthesize their genetic information using nutrients from the body, thereby increasing their viral population. Genetic information encompasses all elements of a virus, from invasion and replication to escape, making it essential for its survival. Therefore, various substances targeting RdRP have been developed, a representative class being Nucleoside Reverse Transcriptase Inhibitors (NRTIs). Viral replication enzymes accept DNA units more flexibly than human replication enzymes. Therefore, substances that mimic the DNA unit and selectively bind to the viral replication enzyme can be used as antiviral agents. However, nucleoside derivatives, which are essentially DNA units, are inherently toxic, even if only minimally. Furthermore, viruses frequently generate errors during DNA replication and lack repair mechanisms, making them prone to drug resistance. Given the current situation with numerous viruses for which there are currently no effective treatments, there is a continuing need for novel antiviral agents that are less toxic and can be used against resistant viruses.

[0008] NiRAN is an enzyme found in viruses belonging to the Nidovirales order, which includes coronaviruses. It initiates replication by linking guanosine to the RNA replication starting point when the virus replicates its genetic information, RNA. Because NiRAN is an enzyme absent in humans, it could be a promising target for antiviral drug development. Since no drugs targeting NiRAN are currently commercially available, it is expected to be used alone or in combination with drugs with different mechanisms of action for synergistic effects.

[0009] Meanwhile, 4'-Thionucleoside refers to a nucleoside derivative in which the central element of a typical nucleoside, oxygen, is replaced with sulfur. Sulfur is located in Group 16 like oxygen, so it has similar properties, but has different characteristics in size and electrical properties. Therefore, if an existing structure is converted to 4'-thionucleoside, a substance with different activity and toxicity from the original substance may be created. Currently, antiviral drugs such as Sofosbuvir, Remdesivir, Tenofovir, and Entecavir, which have been developed and are widely used, are all substances in which the central element of the sugar is replaced with oxygen or carbon, and no substance has been developed yet.

[0010] The present invention aims to provide a composition having low side effects and high antiviral activity by simultaneously targeting RdRP (RNA-dependent RNA polymerase) and NiRAN (Nidovirus RdRp-Associated Nucleotidyl transferase).

[0011] Hereinafter, the present invention will be described in detail. The advantages and features of the present invention, as well as the embodiments that achieve them, will be apparent with reference to the embodiments described below. However, the present invention is not limited to the embodiments disclosed below and may be implemented in various different forms. These embodiments are provided solely to ensure the complete disclosure of the present invention and to fully inform those skilled in the art of the scope of the invention. The present invention is defined solely by the scope of the claims. Like reference numerals designate like elements throughout the specification.

[0012] Unless otherwise defined, all terms (including technical and scientific terms) used herein may be used in a sense commonly understood by those of ordinary skill in the art to which the present invention pertains. Furthermore, terms defined in commonly used dictionaries are not to be interpreted ideally or excessively unless explicitly and specifically defined otherwise. The terminology used herein is for the purpose of describing embodiments and is not intended to limit the present invention. In this specification, singular forms also include plural forms, unless specifically stated otherwise.

[0013] In order to achieve the above object, the present invention provides an inhibitor of RdRP (RNA-dependent RNA polymerase) and NiRAN (Nidovirus RdRp-Associated Nucleotidyl transferase), and an anti-viral composition, comprising a compound of the following chemical formula 1 or chemical formula 2 or a pharmaceutically acceptable salt thereof.

[0014] [Chemical Formula 1]

[0015]

[0016] [Chemical Formula 2]

[0017]

[0018] R in the above chemical formula 1 or chemical formula 2 1 is a substituted or unsubstituted C1 to C6 straight-chain or branched alkyl group, hydroxyl group, alkoxy group, amino group, carboxyl group, phosphoryl group, monophosphate group, diphosphate group or triphosphate group,

[0019] R in chemical formula 2 is an unsubstituted amino group, or an amino group substituted with an alkyl or aryl having C1 to C6,

[0020] R in chemical formula 2 3is a residue containing carbon and a double bond in the ring, and is an alkene group (-C=C-), a ketone group (-C=O), or an imino group (-C=N-) with an optional substituent.

[0021] Specifically, the chemical formulas 1 and 2 may each be a compound represented by the following chemical formula 3 or chemical formula 4.

[0022] [Chemical Formula 3]

[0023]

[0024] [Chemical Formula 4]

[0025]

[0026] In chemical formula 3 or chemical formula 4, R is a substituted or unsubstituted C1 to C6 straight-chain or branched alkyl group, hydroxy group, alkoxy group, amino group, carboxyl group, phosphoryl group, monophosphate group, diphosphate group, or triphosphate group.

[0027] Representative examples of the above chemical formula 3 include chemical formulas 5 and 6.

[0028] [Chemical Formula 5]

[0029]

[0030] [Chemical Formula 6]

[0031]

[0032] A representative example of the above chemical formula 4 includes chemical formula 7.

[0033] [Chemical Formula 7]

[0034]

[0035]

[0036] In the present invention, the "antiviral" effect refers to effects such as inhibition of viral infection, inhibition of viral proliferation, inhibition of viral infection of host cells, inhibition of viral proliferation in host cells, and inhibition of host cell functions involved in viral release. In particular, the present invention may refer to an inhibitory effect against viruses belonging to the order Nidovirale, but is not limited thereto. For example, the viruses may include coronavirus, Ebola virus, rhinovirus, dengue virus, or influenza virus.

[0037] The present invention also provides a pharmaceutical composition for preventing or treating a viral infection disease, comprising a compound of Chemical Formula 1 and Chemical Formula 2.

[0038] As used herein, the term "prevention" refers to any action that suppresses or delays the onset of symptoms of a viral infection by administering the pharmaceutical composition. The term "treatment" refers to any action that improves or beneficially alters the symptoms of a viral infection by administering the pharmaceutical composition.

[0039] The pharmaceutical composition of the present invention may further comprise a pharmaceutically acceptable carrier, diluent or excipient. Examples of usable carriers, excipients or diluents include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, and one or more selected from among these may be used. In addition, when the therapeutic and preventive agent is a drug, fillers, anticoagulants, lubricants, wetting agents, fragrances, emulsifiers or preservatives may be additionally included.

[0040] The formulation of the pharmaceutical composition of the present invention can be prepared in a desirable form depending on the method of use, and in particular, it is preferable to formulate it by adopting a method known in the art so as to provide rapid, sustained or delayed release of the active ingredient after administration to a mammal.

[0041] Examples of specific dosage forms include: PLASTERS, GRANULES, LOTIONS, LINIMENTS, LEMONADES, AROMATIC WATERS, POWDERS, SYRUPS, OPHTALMIC OINTMENTS, LIQUIDS AND SOLUTIONS, AEROSOLS, EXTRACTS, ELIXIRS, OINTMENTS, FLUIDEXTRACTS, EMULSIONS, SUSPESIONS, DECOCTIONS, INFUSIONS, OPHTHALMIC SOLUTIONS, TABLETS, SUPPOSITIORIES, INJECTIONS, SPIRITS. It may be any one selected from among CATAPLSMA, CAPSULES, CREAMS, TROCHES, TINCTURES, PASTES, PILLS, and soft or hard gelatin capsules. In particular, the pharmaceutical composition of the present invention is preferably in the form of an injection.

[0042] As used herein, the terms "patient," "subject," and "object" refer to an animal, such as a mammal. In certain embodiments, the patient is a human. In other embodiments, the patient is a non-human animal, such as a dog, cat, domestic animal (e.g., a horse, pig, or donkey), chimpanzee, or monkey.

[0043] In the present invention, the description of pharmaceutical compositions primarily relates to pharmaceutical compositions intended for administration to humans. However, those skilled in the art will appreciate that such compositions are generally suitable for administration to all types of animals (particularly mammals other than humans). A skilled veterinarian or pharmacologist, with a thorough understanding of the various modifications of pharmaceutical compositions intended for administration to various animals, can design and / or implement such modifications, if necessary, simply through routine experimentation.

[0044] The term "therapeutically effective amount" as used herein refers to the amount of a compound or pharmaceutical composition effective for treating or preventing a viral infection disease. Specifically, a "therapeutically effective amount" means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment, and the effective dosage level can be determined based on factors including the type and severity of the individual, age, sex, type of disease, activity of the drug, sensitivity to the drug, time of administration, route of administration and excretion rate, duration of treatment, concurrently used drugs, and other factors well known in the medical field. The pharmaceutical composition of the present invention can be administered as an individual therapeutic agent or in combination with other therapeutic agents, and can be administered sequentially or simultaneously with commercially available therapeutic agents. And it can be administered singly or in multiple doses. Taking all of the above factors into consideration, it is important to administer an amount that can achieve the maximum effect with the minimum amount without side effects, and since the compound represented by the chemical formula of the present invention, its derivative, its isomer or pharmaceutically acceptable salt exhibits a dose-dependent effect, the administration dosage can be easily determined by those skilled in the art according to various factors such as the patient's condition, age, sex and complications. Since the active ingredient of the pharmaceutical composition of the present invention has excellent safety, it can be used in amounts exceeding the determined administration dosage.

[0045] Meanwhile, in the pharmaceutical composition of the present invention, the dosage should preferably be determined in consideration of the administration method, dosage form, age, sex, and body weight of the recipient, and the severity of the disease. For example, based on the effective ingredient, the extract of the great dandelion (dry weight), 0.1 to 100 mg / kg (body weight) can be administered once or more per day. However, the above dosage is merely an example and may vary depending on the recipient's condition and the doctor's prescription.

[0046] The present invention also provides a method for enhancing antiviral activity, comprising administering to a subject a compound of Chemical Formula 1 or Chemical Formula 2, a derivative thereof, or a pharmaceutically acceptable salt thereof. The subject in the method for enhancing antiviral activity includes an animal other than a human in need of immune enhancement.

[0047] In one embodiment of the present invention, the use of a compound of Formula 1 or Formula 2 for the prevention, treatment, or improvement of a viral disease is provided. Accordingly, the present invention provides a method for preventing or treating a viral disease, comprising administering to a subject in need thereof a compound of Formula 1 or Formula 2, or a pharmaceutically acceptable salt thereof.

[0048] The matters mentioned in the pharmaceutical composition, use, and prevention or treatment method of the present invention are equally applicable unless they are contradictory.

[0049] The compounds provided according to the present invention exhibit high inhibitory effects against RdRP (RNA-dependent RNA polymerase) and NiRAN (Nidovirus RdRp-Associated Nucleotidyl Transferase), and thus possess potent antiviral activity against various viruses, including viruses belonging to the order Nirovirus. The compounds of the present invention can be usefully utilized as therapeutic agents for viral infections, etc.

[0050] Figure 1 is a schematic diagram showing the antiviral effect of compounds of chemical formula 5 (LJ-5144) and chemical formula 6 (LJ-5258) synthesized according to the present invention.

[0051] Figure 2 shows the chemical structure of compound 1.

[0052] Figure 3 shows the results of comparing the antiviral efficacy of the compound of chemical formula 5 (LJ-5144) according to the present invention with that of the control group (Remdesivir) using Vero cells (SARS-CoV-2, 0.01 MOI).

[0053] Figure 4 shows the cytotoxicity and antiviral efficacy (EC) of the compound of chemical formula 5 (LJ-5144) according to the present invention and the control group (Remdesivir) 50 and CC 50 ) is a graph comparing them.

[0054] Figure 5 compares the antiviral effects of the compound of formula 5 (LJ-5144) and the control group (Remdesivir and Molnupiravir (EIDD-1931)) against SARS-CoV-2. The left image of Figure 5 shows the expression level of nucleoprotein after treatment with each substance, and the right image shows the expression level of viral RNA.

[0055] Figure 6 shows the results of confirming the RdRp inhibitory effect of the compound of chemical formula 6 (LJ-5258) on SARS-CoV-2.

[0056] Figure 7 shows the results of confirming the NiRAN activity inhibitory effect of the compound of chemical formula 6 (LJ-5258).

[0057] Figure 8 is a graph showing the plasma concentration-time response to administration of the compound of chemical formula 5 (LJ-5144) as a result of an in vivo PK experiment in mice.

[0058] Figure 9 shows the results of an in vivo PK experiment (female mice, n = 3) of the compound of chemical formula 5 (LJ-5144) and the meaning of each parameter applied to the experiment.

[0059] Figure 10a shows the results of confirming the antiviral activity of the compound of formula 5 (LJ-5144) against MERS-CoV and the 2-day cytotoxicity against Huh-7, Figure 10b shows the antiviral activity of the compound of formula 5 (LJ-5144) against hCoV-OC43 and the 5-day toxicity against RD cells, Figure 10c shows the antiviral activity of the compound of formula 5 (LJ-5144) against hCoV-NL63, and Figure 10d shows the results of confirming the 5-day toxicity of the compound of formula 5 (LJ-5144) against LLC-MK2 cells.

[0060] Figure 11 shows the results of confirming the inhibitory effect of the compound of chemical formula 5 (LJ-5144) and the control group (OSV-C (Oseltamivir carboxylate)) on influenza virus.

[0061] Figure 12 shows the results of confirming the inhibitory effect of the compound of chemical formula 5 (LJ-5144) and the control group (Ribavirin) on dengue virus.

[0062] Below, various examples are presented to aid understanding of the invention. These examples are provided solely to facilitate understanding of the invention and are not intended to limit the scope of protection of the invention.

[0063] The present invention relates to an antiviral composition comprising a compound of Chemical Formula 1 or Chemical Formula 2 or a pharmaceutically acceptable salt thereof as an active ingredient. The antiviral composition comprising a compound of Chemical Formula 1 or Chemical Formula 2 of the present invention, a derivative thereof or a pharmaceutically acceptable salt thereof not only has the effect of inhibiting viral infection and proliferation by simultaneously inhibiting the activities of RdRP (RNA-dependent RNA polymerase) and NiRAN (Nidovirus RdRp-Associated Nucleotidyl transferase), but also exhibits almost no cytotoxicity or side effects, so that it can be used with confidence even for long-term administration.

[0064] The antiviral composition of the present invention is effective against "Nidovirales", and subdivisions of the Nidovirales include, but are not limited to, Arteriviridae, Coronaviridae, Mesoniviridae, and Roniviridae. The viruses of the present invention may include coronaviruses, Ebola viruses, rhinoviruses, dengue viruses, and influenza viruses.

[0065] In the present invention, "coronavirus" may be, but is not limited to, severe acute respiratory syndrome coronavirus 2 (SARS-Cov-2 or 2019 novel coronavirus or 2019-nCoV). The "coronavirus infection" in the present invention may be a coronavirus respiratory infectious disease. The viral respiratory infectious disease may exhibit symptoms such as coughing, sneezing, headache, nasal congestion, sore throat, diarrhea, discoloration of fingers or toes, conjunctivitis, high fever, wheezing, bronchitis, bronchiolitis, pneumonia, asthma, loss of smell and taste, and respiratory failure. When the coronavirus is severe acute respiratory syndrome coronavirus 2 (SARS-Cov-2), the main symptoms include fever and respiratory symptoms (cough, sore throat, dyspnea), and in addition, headache, muscle pain, hemoptysis, nausea, chills, chest pain, and diarrhea. Additionally, the above coronavirus infection may be coronavirus disease 19 (COVID-19).

[0066] In the present invention, "dengue virus (DENV)" is a single positive-stranded RNA virus of the genus Flaviviridae that is the cause of dengue fever and is transmitted by mosquitoes. Dengue fever, which is a "dengue virus (DENV) infection", is caused when dengue mosquitoes, which mainly live in tropical and subtropical regions, bite a person carrying the virus during the day and then bite another person to transmit the virus. Symptoms of dengue fever include fever, rash, headache, muscle pain, joint pain, loss of appetite, etc. after an incubation period of 3 to 14 days. In addition, there are symptoms such as 'dengue hemorrhagic fever' in which skin rashes, nosebleed, gum bleeding, excessive menstruation, and bleeding in various parts of the body occur, and 'dengue shock syndrome' in which blood pressure drops along with bleeding.

[0067] In the present invention, "influenza virus" refers to a pathogen that is the main cause of viral respiratory disease, and is broadly classified into types A, B, and C based on the antigenic differences in the NP (nucleocapsid) and M (matrix) proteins. Among these, type A is further classified into subtypes H1 to H16 based on the hemagglutinin protein antigen characteristics, and N1 to N9 based on the neuramidase protein antigen characteristics. In the present invention, "influenza virus infection" refers to a pathological disease that appears when an individual is infected with an influenza virus. For example, "new flu," a disease caused by infection with a mutant strain of type A influenza virus, is known to exhibit symptoms such as fever, chills, headache, cough, sore throat, runny nose, and difficulty breathing, as well as muscle pain, joint pain, fatigue, vomiting, and diarrhea.

[0068]

[0069] The following examples are presented to help understand the invention and do not limit the scope of protection of the invention.

[0070]

[0071] [Manufacturing example]

[0072] ingredient

[0073] Cells and viruses

[0074] African green monkey kidney cell lines (Vero) purchased from the American Type Culture Collection (ATCC) were maintained in Dulbecco's Modified Eagle's medium (DMEM; HyClone) supplemented with 10% fetal bovine serum (FBS; Atlas Biologicals). SARS-CoV-2 (hCoV-19 / Korea / KCDC06 / 2020), SARS-CoV-2 (Wuhan-like), SARS-CoV-2 (Gamma), SARS-CoV-2 (Delta), and SARS-CoV-2 (Omicron) were provided by the Korea Disease Control and Prevention Agency (KDCA). Human isolates of Middle East respiratory syndrome coronavirus (MERS-CoV; MERS-CoV-KOR / KNIH / 002_02_2015) and alphacoronavirus NL63 (hCoV-NL63) were provided by the Korea Centers for Disease Control and Prevention (KCDA), and human betacoronavirus OC43 (hCoV-OC43), HCoV-NL63, and alphacoronavirus 229E (hCoV-229E) were provided by ATCC. BHK-21 cells harboring a DENV replicon expressing luciferase (BHK-D2-Rluc) were provided by Emory University (Professor B. Kim). Influenza A viruses, including PR8 (A / H1N1) and HK (A / H3N2), and influenza B viruses (Lee strain, B / Lee / 1940) were obtained from ATCC.

[0075]

[0076] Cell harvesting and culture

[0077] Vero, Calu-3, LLC-MK2, Madin-Darby canine kidney (MDCK), 293T, and H1HeLa cells were obtained from the American Type Culture Collection (ATCC). The Huh-7 cell line was obtained from the Korea Cell Line Bank (KCLB). Vero, LLC-MK2, Huh-7, and 293T cells were cultured in Dulbecco's modified Eagle's medium (DMEM; HyClone), Calu-3 cells in Eagle's minimum essential medium (EMEM; Corning), and MDCK and H1HeLa cells in minimum essential medium (MEM; HyClone), each supplemented with 10% fetal bovine serum (FBS; Atlas Biologicals). BHK-21 cell line (BHK-D2-Rluc) harboring a dengue virus subtype 2 (DENV2) genome clone expressing Renilla luciferase was provided by Professor B. Kim (Emory University) and cultured in DMEM supplemented with 10% FBS and 1 μg / mL puromycin.

[0078]

[0079] antiviral compounds

[0080] Molnupiravir (purity ≥98%); TOCRIS, remdesivir triphosphate (RDV-TP; purity 99.98%); MedChemExpress LLC, remdesivir (RDV; purity, >98%), and the phosphoramidate prodrug of adenosine C-nucleoside were purchased from Adoo. EIDD-1931 (purity, >98%) and β-D-N4-hydroxycytidine were purchased from Sigma-Aldrich. AT-9010, a guanosine analogue 5'-triphosphate, was purchased as a tetrasodium salt from ChemScene LLC (purity, 99.35%).

[0081]

[0082] 1) Synthesis of Comparative Groups 9 to 18 and Compound 5 (Synthesis of 4'-thiouridine and its analogs)

[0083]

[0084] Starting from D-ribose, compound 12, an acetate compound, was synthesized as a key intermediate. Compound 12 (a 4'-thio-ribose derivative with a TBDPSO protecting group) was used as the starting material.

[0085] (Step 1: N-glycosylation with 4-substituted thiouracil)

[0086] Acetate 12 and uracil and its analogs were condensed with thiosugar via Vorbruggen condensation to form compounds 13a-g and 14a-f, which are β- and α-isomers.

[0087] Specifically, compound 12 (1.0 equiv) was dissolved in dry acetonitrile (MeCN), and then bis(trimethylsilyl)acetamide (BSA, 3.0 equiv) and trimethylsilyl trifluoromethanesulfonate (TMSOTf, 1.2 equiv) were added. To this mixture, selected 4-substituted thiouracil derivatives (1.2 equiv, X = F, Cl, Br, I, H, Me, CF3) were added, and the mixture was reacted at room temperature to 80°C for 1 hour. After the reaction, the organic layer was concentrated and purified by column chromatography to obtain glycosylation products 13a-13g and a mixture of isomers 14a-14f.

[0088] (Step 2: Deprotection and Purification) The obtained compounds 13a-13g or 14a-14f were dissolved in a 60% TFA / THF (1:1 v / v) solution and stirred at room temperature for 15 hours. After the reaction, the solvent was concentrated under reduced pressure and purified to obtain 4'-thio-4-thiouridine derivatives (3a-3g or 4a-4f).

[0089]

[0090] 2) Synthesis of Comparative Group 19 (Synthesis of 4'-thio-4-thiouridine)

[0091]

[0092] (Step 1: 4-thiolation reaction of compound 13e (preparation of compound 15)) Compound 13e (0.2 mmol) was dissolved in dried 1,4-dioxane (10 mL), and Lawesson's reagent (0.4 mmol, 2.0 equivalents) was added. The reaction mixture was stirred under a nitrogen atmosphere at reflux conditions (approximately 101°C) for 12 hours. After completion of the reaction, the mixture was cooled to room temperature, and the solvent was concentrated under reduced pressure. The residue was purified through silica gel column chromatography (hexane / ethyl acetate mixed solvent) to obtain compound 15 in a 72% yield.

[0093] (Step 2: Preparation of the final compound through removal of the protecting group) Compound 15 was dissolved in a 50% TFA / water mixture (v / v, 5 mL) and stirred at room temperature for 15 hours to remove the TBDPS and acetonide protecting groups. After completion of the reaction, the reaction mixture was concentrated under reduced pressure, and the product was purified through HPLC or column chromatography to obtain the final compound (4'-thio-4-thiouridine) in 53% yield.

[0094]

[0095] 3) Comparative groups 20 to 23, synthesis of compound 7 (synthesis of 4'-thiocytidine and its analogues)

[0096]

[0097] Reagents and conditions: (a) Ac2O, pyridine, room temperature, 15 h; (b) POCl3, 1,2,4-triazole, Et3N, CH3CN, 0°C→ room temperature, 24 h; (c) (i) 0.2 M NH4OH, 1,4-dioxane, room temperature, 15 h, then concentrated under reduced pressure; (ii) NH3 / MeOH, room temperature, 15 h; (d) N 4 -Benzoylcytosine, TMSOTf, Et3N, toluene / CH2Cl2, room temperature, 15 hours; (e) 60% TFA / THF (1:1), room temperature, 15 hours, followed by Amberlite® FPA66 free base resin, room temperature, 15 hours; (f) NH3 / EtOH, in a plastic bomb, room temperature, 4 days.

[0098] To synthesize 4'-thiocytidine analogs, the hydroxyl groups of 4'-thiouridine analogs 3a-e were protected with acetyl groups to obtain compounds 16a-d. The 4-position of these intermediates was activated with POCl3 and then substituted with 1,2,4-triazole to form compounds 17a-d. Since these intermediates were unstable, the subsequent step of ammonia treatment was performed directly without further purification, resulting in the final products, 4'-thiocytidine analogs 6a-e.

[0099]

[0100] 4) Synthesis of Comparative Groups 1 to 5 (synthesis of 4'-thioadenosine, its analogues and 4'-thioinosine)

[0101]

[0102] Reagents and conditions: (a) BSA, 6-chloropurine (for 21a) or 2,6-dichloropurine (for 21b), TMSOTf, MeCN, room temperature to 80°C, 1 h; (b) 60% TFA / THF (1:1), room temperature, 3 h; (c) NH3 / t-BuOH in a steel bomb, 100°C (for 7b, 8b) or 2 M MeNH2 in THF, Et3N, 50°C, 15 h (for 7c, 8c); (d) 1 M TBAF in THF, THF, room temperature, 2 h; (e) 80% TFA, room temperature, 12 h.

[0103] Using the Vorbruggen condensation reaction, acetate 12 was converted to 6-chloropurine and 2,6-dichloropurine 4'-thionucleoside. The resulting intermediates were deprotected with TFA to give triol compounds 7a and 8a. The 6-chloro groups of 7a and 8a were then replaced by 6-amino and 6-methylamino groups to give 4'-thioadenosine and its analogs, compounds 7b-c and 8b-c. Next, 4'-thioinosine (9) was synthesized using 7a as the starting material by treatment with 80% TFA for 12 h.

[0104]

[0105] 5) Synthesis of Comparative Groups 6 to 8 (Synthesis of 4'-thioguanosine and its analogues)

[0106]

[0107] Reagents and conditions: (a) BSA, 2-amino-6-chloropurine, TMSOTf, MeCN, room temperature to -80°C, 1 h; (b) NH3 / t-BuOH, in a steel bomb, 100°C (for 23a); 2 M MeNH2 in THF, Et3N, 50°C, 15 h (for 23b); (c) 60% TFA / THF (1:1), room temperature, 15 h, followed by Amberlite® FPA66 free base resin, room temperature, 15 h.

[0108] Compound 23 was synthesized as a key intermediate using the Vorbruggen condensation reaction starting from acetate 12. The 6-chloro group of compound 23 was replaced by 6-amino and 6-methylamino groups, respectively, to give compounds 24a and 24b. The TBDPS and acetonide protecting groups present in 24a and 24b were removed using TFA, yielding the final products 10a and 10b. Next, TFA was used to synthesize 4'-thioguanosine (10c) from intermediate 23, which induced overall deprotection and converted the 6-chloro group to a 6-hydroxy group, thereby converting the intermediate to the guanine base.

[0109]

[0110] [Example 1]

[0111] 1-1. Experiment to confirm antiviral effect against SARS-CoV-2

[0112] Vero cells at 2 x10 per well 4Cells were seeded into 96-well plates at a density of 10 μg / mL. The following day, cells were infected with SARS-CoV-2 at a multiplicity of infection (MOI) of 0.001 for 30 minutes, and then serially diluted 3-fold with Formula 5 (LJ-5144). Remdesivir (99.7%; MedChem Express) and molnupiravir (purity ≥98%; TOCRIS) were used as controls. On day 2 post-infection, SARS-CoV-2 spike (S) protein expression was visualized by immunostaining using mouse anti-S antibody (Genetex) and its secondary antibody, AlexaFluor 488-conjugated goat anti-mouse IgG (Invitrogen). Cell confluency was determined by counterstaining nuclei with 4',6-diamidino-2-phenylindole (DAPI, Invitrogen). To measure cytotoxicity, mock-infected Vero cells were treated with each compound at the same concentration for 2 days. Cell viability was measured using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Sigma-Aldrich). Antiviral activity was expressed as the 50% effective concentration (EC 50 ) was calculated and quantified, which was defined as the compound concentration that reduced the number of S-positive cells by 50% after normalizing to the number of DAPI-stained cells. Cell viability was defined as 50% (CC 50 ) was determined by estimating the compound concentration that reduces the cytotoxicity. The selectivity index was CC 50 Great EC 50 is the ratio (see Figs. 3, 4 and 5).

[0113]

[0114] 1-2. Experiments to confirm antiviral effects against other coronaviruses

[0115] In this example, a CPE inhibition assay was performed to quantify the antiviral activity against each coronavirus. Briefly, Huh7 cells, MRC-5 cells, and LLC-MK2 cells (ATCC) were cultured at approximately 2×10 per well. 4 Cells were seeded individually in 96-well plates at a density of 100 μg / cm. The following day, these cell lines were infected with various coronaviruses, including MERS-CoV (MOI, 0.1 for Huh7 cells), hCoV-OC43 (MOI, 0.01 for MRC-5 cells), and hCoV-NL63 (MOI, 0.1 for LLC-MK2 cells), in the presence (at various concentrations) of compound 5 (LJ-5144). Infection-induced CPE was quantified by cell viability assay using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Sigma-Aldrich) at days 2 (for MERS-CoV), 5 (for hCoV-NL63), and 6 (for hCoV-OC43) post-infection. Afterwards, the compound concentration required to reduce the viability of each cell line by half was estimated to be EC 50 The values ​​were determined (Figs. 10a to 10d).

[0116]

[0117] 1-3. Confirmation of antiviral effect against influenza virus

[0118] MDCK cells were seeded in 96-well plates (3 x 10 per well) 4Cells) were seeded and infected with individual influenza viruses at an MOI of 0.001 in serum-free MEM at 35°C or 37°C for 1 hour. After washing with phosphate-buffered saline (PBS), the cells were treated with each compound (compound of formula 5 (LJ-5144) and the control (OSV-C (Oseltamivir))) diluted in MEM containing 2 ug / ml of TPCK-trypsin. After culturing at the same temperature for 3 days for virus infection, the inhibition of influenza virus-induced CPE was measured by adding 2.5 mg / ml of 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide (MTT). The dose response to a compound according to the present invention or a control (reference antiviral compound) was determined by treating mock- or virus-infected cells with serial dilutions of the test compound. CC 50 and EC 50 Values ​​were calculated using GraphPadPrism 6 software (GraphPad, La Jolla, CA) (Fig. 11).

[0119]

[0120] 1-4. Confirmation of antiviral effect against dengue virus

[0121] DENV RNA replication efficiency was determined using BHK-21 cells encoding a luciferase-expressing DENV-2 replicon (BHK-D2-Rluc). Briefly, BHK-21 replicon cells were seeded in 96-well plates and incubated with various concentrations of compound 5 (LJ-5144) (or control (Ribavirin)) at 37°C for 24 h at the indicated time points. After incubation, antiviral activity was measured using the Renilla Luciferase Assay (Promega, Madison, WI, USA) in a microplate luminometer (Tecan, Mannedorf, Switzerland) (Fig. 12).

[0122]

[0123] 1-5. Confirmation of antiviral effects on other compounds

[0124] The same method as in Example 1-1 was used, but instead of Chemical Formula 5, compounds of Chemical Formula 6, 7 or Comparative Groups 1 to 23 were used. The viability was 50% (CC 50 ) was determined by estimating the compound concentration that reduces cytotoxicity, and the selectivity index was CC 50 Great EC 50 is the ratio of

[0125]

[0126] [Example 2]

[0127] Experimental method

[0128] 2-1. Western blot analysis

[0129] 5X10 per well 5 Vero cells seeded in 6-well plates at a density of 10 cells / well were infected with SARS-CoV-2 at an MOI of 0.001. Subsequently, RDV and EIDD-1931 were treated with DMSO vehicle or increasing concentrations of Formula 5 (LJ-5144) as controls. The following day, cell lysates were harvested for immunoblotting using mouse anti-SARS-CoV-2 nucleoprotein (N) antibody (Sino Biological) and HRP-conjugated goat anti-mouse IgG. β-Actin served as a loading control.

[0130]

[0131] 2-2. Quantification of viral RNA

[0132] In the above examples, cell culture supernatants from Vero cells infected with SARS-CoV-2 and treated with compounds were collected for viral RNA purification using the QIAamp Viral RNA Mini Kit (Qiagen). Viral RNA copy numbers were quantified using a one-step RT-PCR master mix targeting the N gene (PCL Inc.) and a CFX96 real-time PCR instrument (Bio-Rad).

[0133]

[0134] 2-3. Protein purification

[0135] Recombinant viral proteins, including Nsp7, Nsp8, Nsp9, and Nsp12, were purified according to a previously described method. Briefly, to express His-SUMO-Nsp12 protein, E. coli BL21-CodonPlus(DE3)-RIL cells (Agilent Technologies) were transformed with the pIA1400 plasmid (Addgene #172519; kindly provided by Irina Artsimovitch) and cultured in LB broth supplemented with 50 μg / ml kanamycin and 34 μg / ml chloramphenyl at 37°C until an OD600 of 0.7 was reached. Induction of Nsp12 protein expression was initiated by adding 0.5 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) and further incubated at 16°C for 16 h. After sonication and centrifugation, cell lysates were loaded onto Ni-NTA resin (Cytiva). The immobilized His-SUMO-Nsp12 protein was eluted by on-column tag cleavage using Ulp-1 enzyme (SUMO protease). The eluted Nsp12 protein was further purified by heparin affinity (Hitrap heparin HP) and anion exchange chromatography (Hitrap Capto Q ImpRes). The purified Nsp12 protein was loaded onto a HiLoad 16 / 600 Superdex 200 column (Cytiva) equilibrated with storage buffer containing 20 mM Tris-HCl (pH 8.0), 300 mM NaCl, 5% (v / v) glycerol, 2 mM MgCl2, and 2 mM 2-mercaptoethanol.

[0136] For His-SUMO-Nsp9 protein, E. coli cells transformed with the pIA1414 plasmid (Addgene; a gift from Irina Artsimovitch) were cultured in Terrific broth (TB) supplemented with 50 μg / ml kanamycin and 34 μg / ml chloramphenicol at 37°C. Cells were disrupted by sonication and removed by centrifugation. His-SUMO-Nsp9 protein was immobilized on Ni-NTA resin as described above, and the untagged nsp9 protein was eluted by on-column tag cleavage. The eluted Nsp9 protein was passed through a HiTrap Capto Q ImpRes column (Cytiva) and loaded onto a HiLoad 16 / 600 Superdex 200 column (Cytiva) equilibrated with a buffer containing 20 mM Tris-HCl (pH 8.0), 150 mM NaCl, 10% (v / v) glycerol, and 2 mM 2-mercaptoethanol.

[0137] For purification of the viral polymerase complex, three different proteins, including Nsp7, N-terminal His-tagged Nsp8, and Nsp12, were co-expressed in Escherichia coli cells using pRSFDuet-1(nsp8-nsp7)(nsp12) (Addgene; kindly provided by Marc Delarue). The cells were cultured at 37°C in tuberculosis medium supplemented with 50 μg / ml kanamycin and 34 μg / ml chloramphenicol. Protein expression was induced with 0.1 mM IPTG for 4 h at 30°C. The harvested cell lysate was loaded onto Ni-NTA resin, and the target protein complex was eluted with elution buffer containing 20 mM Tris-HCl pH 8.0, 150 mM NaCl, 250 mM imidazole, and 2 mM 2-mercaptoethanol. The N-terminal His-tag of Nsp8 was cleaved by TEV protease, and the untagged protein complex was further purified by anion exchange chromatography using HiTrap Capto Q ImpRes (Cytiva). The Nsp12-7-82 complex protein was finally purified by size exclusion chromatography using a HiLoad 16 / 600 Superdex 200 column (Cytiva) equilibrated with a buffer containing 20 mM Tris-HCl (pH 8.0) and 300 mM NaCl. After purification, all proteins were concentrated and stored at -80°C until use.

[0138]

[0139] 2-4. Primer extension analysis

[0140] Template RNA (5'-AUUAUUGUCAGUGAUUUUAAUAGCUUCUUAGGAGAAUGAC-3') and primer RNA (800CW-5'-GUCAUUCUCCUAAGAAGCUA-3'), labeled at the 5' end with a near-infrared fluorescent dye, were synthesized (Integrated DNA Technologies) and partially double-stranded (ds) RNA by heat shock. Primer extension experiments were performed using 5 nM partial dsRNA substrate and 3 μM Nsp12-7-82 complex in 10 μl RNA-dependent RNA polymerase buffer (20 mM HEPES [pH 7.0], 5 mM MgCl2, 10 mM DTT, 0.01% Tween 20). The reaction was initiated by adding rNTP mixture together with formula 6 (LJ-5258) or ribavirin 5'-triphosphate (RBV-TP). After incubation at 37°C for 30 min, the mixture was stopped by adding 20 μl of Gel Loading Buffer II (Invitrogen). The samples were denatured at 95°C for 10 min and loaded onto an 8 M urea / 10% polyacrylamide gel for electrophoresis. The gel was scanned using an image analyzer (Typhoon FLA 7000, GE Healthcare) to visualize the infrared dye-labeled RNA.

[0141]

[0142] 2-5. RNAylation and NMPylation of Nsp9 by Nsp12

[0143] Nsp9 RNAylation by Nsp12 was performed according to a previously described method with some modifications. Briefly, 10 μM Nsp9, 1 μM Nsp12, 1 mM 5'-triphosphate RNA 5'pppLS10 (5'-ppp-'; TriLink), and 0.1 unit / μl yeast inorganic phosphatase (New England Biolabs) were mixed together in 10 μl RNAylation buffer (50 mM HEPES [pH 7.0], 100 mM NaCl, and 2 mM MnCl2) or in the presence of increasing concentrations of formula 6 (LJ-5258), using AT-9010 as a control. After incubation at 37°C for 1 h, the reaction was stopped by the addition of Laemmli sample buffer, and the samples were analyzed on a 15% SDS-PAGE gel and stained with Commassie blue.

[0144] For NMPylation assays, 16 μM Nsp9 and 50 nM Nsp12 were preincubated with DMSO vehicle, formula 6 (LJ-5258), or AT-9010 (control) in 20 μl RNAylation buffer supplemented with 1 mM MgCl2 for 5 min at 30°C. The reaction was initiated by adding a mixture of 25 μM ATP and 75 nM [α-32P]ATP (equivalent to 12.5 uCi; PerkinElmer) or 25 μM UTP and 75 nM [α-32P]UTP (equivalent to 12.5 μCi; PerkinElmer) for 10 min at the same temperature. The reaction was stopped with 50 mM EDTA and Laemmli sample buffer. Denatured samples were loaded onto 15% SDS-PAGE gels for analysis of radioactive AMP- or UMP-conjugated Nsp9 using an image analyzer (Typhoon FLA 7000).

[0145]

[0146] 2-6. In vivo pharmacokinetic experimental method

[0147] In this example, in vivo pharmacokinetic experiments were conducted to examine the compound's absorption, distribution, metabolism, and excretion within the body. This allows for the identification of the compound's drug-like properties and, furthermore, provides information necessary for interpreting the drug's efficacy and toxicity.

[0148] In this experiment, Dimethyl sulfoxide (Cat # D4540, Sigma), Polyethylene glycol 400 (Cat # 35322-68-3, DSPGR reagent), Acetonitrile (Cat # AH014, B&J), and Animal blank plasm were used as materials.

[0149] For this experiment, 7-9 week old ICR mice that had undergone an acclimatization period were administered a drug containing the compound of formula 5 (LJ-5144), and blood samples were collected at designated times. The blood was centrifuged to separate the plasma, and 9 times the volume of cold acetonitrile containing the internal standard was added, followed by protein deproteinization. After centrifugation (13,000 rpm, 4℃, 10 min), the supernatant was analyzed by LC-MS / MS. For the calibration curve samples (0.5-8,000 ng / mL), 10 times higher concentration solutions were added to blank plasma and prepared in the same manner as the test samples. The PK parameter was calculated using the Phoenix WinNonlin (Pharsight ver. 6.4, USA) non-compartmental analysis model.

[0150]

[0151] [Example 3]

[0152] result

[0153] 3-1. Confirmation of the antiviral effect of compound 5 (LJ5144) against SARS-CoV-2

[0154] Referring to Figure 3 (SARS-CoV-2, 0.01 MOI) and Figure 4, the results of the experiment using Vero cells showed that the compound of chemical formula 5 (LJ-5144) had a better antiviral effect against SARS-CoV-2 than the control substance, remdesivir (LJ-5144, EC 50 = 0.84 μM; CC 50 >100 μM; SI >119.0; Remdesivir, EC 50 = 10.3 μM; CC 50 >100 μM; SI > 9.7). In addition, both compound 5 (LJ-5144) and remdesivir showed little cytotoxicity in Vero cells at concentrations below 100 μM.

[0155] In addition, when the antiviral effects of the compound of chemical formula 5 (LJ-5144) were compared with those of Remdesivir and Molnupiravir (EIDD-1931), LJ-5144, Remdesivir, and Molnupiravir were found to have a virus killing effect at a concentration of 10 μM (Fig. 5A). Molnupiravir and LJ-5144 were more effective than Remdesivir, and the antiviral effects of LJ-5144 and Molnupiravir were found to be relatively similar (Fig. 5B).

[0156]

[0157] 3-2. Confirmation of the antiviral effect of compound 6 (LJ5258) against SARS-CoV-2

[0158] We tested whether LJ-5258, a triphosphate form of LJ-5144, inhibits the RdRP of SARS-CoV-2 (Fig. 6A). The experimental results showed that LJ-5258 not only interferes with normal viral RNA synthesis by replacing UTP during viral RNA synthesis, but also reduces the efficiency of newly created RNA elongation, exerting its antiviral effect (Fig. 6B). Sofosbuvir-TP, used as a control, is a uridine derivative, similar to LJ-5258, but inhibited the initiation of RNA synthesis itself. Meanwhile, the triphosphate form of Remdesivir (RDV), a clinically approved coronavirus treatment, inhibits viral RNA elongation through misincorporation via a mechanism similar to LJ-5258, but reacts competitively with ATP (Fig. 6C). Tenofovir-DP, an acyclic nucleoside derivative of adenosine, also inhibited the initiation of viral RNA synthesis.

[0159] In the above experiment, we were able to confirm that LJ-5258 reacts competitively with UTP and participates in abortive RNA synthesis through misincorporation at the RdRP step (Fig. 6). UTP is also known to have good binding affinity to the NiRAN domain of Nsp12 in previous studies. As shown in the results of these previous studies, the compound of formula 6 (LJ-5258) inhibited the NiRAN activity of Nsp12 by reducing the amount of RNAylated Nsp9 in a concentration-dependent manner. This suggests that the compound of formula 6 (LJ-5258) inhibited the NiRAN activity by NMPylating Nsp9, and this activity led to the antiviral effect. This phenomenon is similar to AT-9010, which is known as an RdRP, NiRAN dual inhibitor in terms of mechanism and efficacy (Fig. 7).

[0160] According to the present invention, as the concentration of LJ-5258 increased, the length of aberrantly transcribed RNA primers from SARS-CoV-2 also increased, but did not exceed the 27-mer length. This suggests that the frequency of misincorporation of LJ-5258 varies depending on concentration. Meanwhile, sofosbuvir-TP was confirmed not to be incorporated into RNA transcripts, suggesting that the mechanism by which LJ-5258 induces aberrant transcription differs from that of sofosbuvir-TP, which shares the same uracil base.

[0161]

[0162] 3-3. In vivo pharmacokinetic experiment results

[0163] In vivo PK study in mice showed that the half-life was 8.87 h when administered IV, and AUC ∞ is 20.5 μgh / mL, CL is 0.25 L / h / kg, Vss is 2.8 L / kg, MRT ∞ was 11.35 h, and when administered PO, T max is 1 h, C max is 4.98 μg / mL, half-life is 82 h, AUC ∞ is 43.57 μgh / mL, MRT ∞ showed excellent PK data with 10.51 h and Ft of over 99% (Fig. 8, Fig. 9).

[0164]

[0165] 3-4. Confirmation of antiviral effects against other coronaviruses

[0166] To evaluate the antiviral efficacy against other coronaviruses, cell-level antiviral tests were performed against MERS-CoV, HCoV-OC43, and hCoV-NL63. The results showed that the EC for MERS-CoV 50 is 3.75 μM, EC for HCoV-OC43 50 is 12.1 μM, EC for hCoV-NL6350 It was shown to exhibit an efficacy of 6.4 μM (Figs. 10a to 10b). Therefore, it can be seen that LJ-5144 has antiviral efficacy not only against SARS-CoV-2 but also against various beta coronaviruses and alpha coronaviruses.

[0167]

[0168] 3-5. Confirmation of antiviral effect against influenza virus

[0169] To determine the broad-spectrum antiviral effect of the compound of chemical formula 5 (LJ-5144), we first investigated its effect on influenza. Experiments were conducted using PR8 flu, which is a FluA virus with H1N1 and H3N2 genotypes, Hong Kong flu, and Lee flu, which is a FluB virus. The results showed that the antiviral effect was lower than that of Oseltamivir, but each EC 50 The concentrations were 17.2 μM, 20.1 μM, and 45.6 μM. CC 50 It was shown to be less toxic as it was greater than 100 μM (Fig. 11).

[0170]

[0171] 3-6. Confirmation of antiviral effect against dengue virus

[0172] To examine the dengue virus inhibitory effect of the compound of chemical formula 5 (LJ-5144), its antiviral effect was compared with that of Ribavirin. Ribavirin (EC 50 = 3.47 μM) but the inhibitory activity was lower than that of EC 50 showed a satisfactory effect at 41.94 μM. CC 50 It was found to have low toxicity at 93.7 μM (Fig. 12).

[0173]

[0174] 3-7. Comparison of antiviral effects with similar compounds

[0175] The antiviral effects of compounds of chemical formulas 5, 6, and 7 and the comparative compounds against SARS-CoV-2 were compared. The results are shown in Tables 1 to 6 below.

[0176] In Tables 1 to 6 below, the comparative values ​​described are the EC of Remdesivir, the control substance, in each experiment. 50 It refers to a relative comparison of values. The candidate substances of the present invention have various structures and their synthesis times are different, so the assay for evaluating antiviral activity could not be performed uniformly at the same time. Accordingly, the EC of Remdesivir, which was used as a control substance at each experimental time point, was compared. 50 The values ​​were measured differently, which is the EC 50 This is because the value is not an absolutely fixed value and may vary depending on the experimental conditions (e.g., cell density, drug concentration, time, etc.). Therefore, in the present invention, the EC of Remdesivir measured for each experiment 50 Based on the value, the EC of the compound of the present invention in the experiment 50 Antiviral activity was evaluated by relatively comparing the values.

[0177] Referring to Tables 1 to 6 below, Compound 5 (including its active form Compound 6) and Compound 7 have EC 50 (Half-maximal Effective Concentration) were 1.71 ± 0.130 and 2.40 ± 0.377, respectively, CC 50 (Half-maximal Cytotoxic Concentration) was >100, confirming excellent virus inhibition while exhibiting low cellular toxicity. This is a superior effect compared to compounds with similar main skeletal structures.

[0178]

[0179]

[0180]

[0181]

[0182]

[0183]

[0184]

[0185]

[0186] The results of broad spectrum antiviral activity of the compound of specific chemical formula 5 (hereinafter, Compound 5 in Table 7) against each virus are as shown in Table 7 below (the basic experimental conditions followed the description in Examples 1 and 2, and were performed only by changing the cell line and the type of virus used for infection. The experimental methods used were known methods that a person skilled in the art could understand and perform based on common knowledge, unless otherwise specified). According to the results in Table 7, the compound of chemical formula 5 was effective against various variants of SARS-CoV-2, and it can be seen that it has an antiviral effect against other coronaviruses such as MERS.

[0187]

[0188]

[0189]

[0190] In Table 7, the superscript a represents the 50% effective concentration (EC 50 ) (n=3), superscript b indicates 50% cytotoxic concentration (CC 50 ) (n=3), the superscript c is the selectivity index (SI) and EC 50 Wow CC 50 It represents the ratio of .

[0191]

[0192] According to the above examples, the antiviral effects of the compounds represented by Chemical Formulas 5, 6, and 7 were verified, and it was found that these effects arise from the (activity) inhibitory action of RdRP and NiRAN of the compounds represented by Chemical Formulas 1 and 2. Therefore, the compounds of the present invention can be used as antiviral compositions or pharmaceutical compositions for preventing and treating viral infectious diseases.

[0193]

[0194] The present invention has been described above, focusing on preferred embodiments thereof. Those skilled in the art will appreciate that the present invention can be implemented in modified forms without departing from its essential characteristics. Therefore, the disclosed embodiments should be considered illustrative rather than limiting. The scope of the present invention is set forth in the claims, not the foregoing description, and all differences within the scope equivalent thereto should be construed as being encompassed by the present invention.

[0195]

[0196] Sequence number 1

[0197] Template 1

[0198] AUUAUUGUCAGUGAUUUUAAUAGCUUCUUAGGAGAAUGAC

[0199]

[0200] Sequence number 2

[0201] Primer 1

[0202] GUCAUUCUCCUAAGAAGCUA

Claims

1. An inhibitor of RdRP (RNA-dependent RNA polymerase) and NiRAN (Nidovirus RdRp-Associated Nucleotidyl transferase) comprising a compound of the following chemical formula 1, chemical formula 2 or a pharmaceutically acceptable salt thereof: [Chemical Formula 1] [Chemical Formula 2] R in the above chemical formula 1 or chemical formula 2 1 is a substituted or unsubstituted C1 to C6 straight-chain or branched alkyl group, hydroxyl group, alkoxy group, amino group, carboxyl group, phosphoryl group, monophosphate group, diphosphate group or triphosphate group, R in chemical formula 2 is an unsubstituted amino group, or an amino group substituted with an alkyl or aryl having C1 to C6, R in chemical formula 2 3 is a residue containing carbon and a double bond within a ring, and is a ketone group (-C=O) or imino group (-C=N-) with an optional substituent.

2. An antiviral pharmaceutical composition comprising a compound of the following chemical formula 1 or chemical formula 2 or a pharmaceutically acceptable salt thereof: [Chemical Formula 1] [Chemical Formula 2] R in the above chemical formula 1 or chemical formula 2 1 is a substituted or unsubstituted C1 to C6 straight-chain or branched alkyl group, hydroxyl group, alkoxy group, amino group, carboxyl group, phosphoryl group, monophosphate group, diphosphate group or triphosphate group, R in chemical formula 2 is an unsubstituted amino group, or an amino group substituted with an alkyl or aryl having C1 to C6, R in chemical formula 2 3 is a residue containing carbon and a double bond within a ring, and is a ketone group (-C=O) or imino group (-C=N-) with an optional substituent.

3. In paragraph 2, The above chemical formula 1 is an antiviral pharmaceutical composition, which is a compound represented by the following chemical formula 5 or chemical formula 6: [Chemical Formula 5] [Chemical Formula 6] 4. In paragraph 2, The above chemical formula 2 is an antiviral pharmaceutical composition, which is a compound represented by the following chemical formula 7: [Chemical Formula 7] 5. In paragraph 2, An antiviral pharmaceutical composition, wherein the above antiviral agent exhibits an inhibitory effect against a virus belonging to the order Nidovirale.

6. In paragraph 2, An antiviral pharmaceutical composition wherein the virus is a coronavirus, an Ebola virus, a rhinovirus, a dengue virus or an influenza virus.

7. In paragraph 2, The above composition is an antiviral pharmaceutical composition that inhibits the activity of RdRP and NiRAN.

8. A pharmaceutical composition for preventing or treating a viral infection disease, comprising a compound of the following chemical formula 1 or chemical formula 2 or a pharmaceutically acceptable salt thereof: [Chemical Formula 1] [Chemical Formula 2] R in the above chemical formula 1 or chemical formula 2 1 is a substituted or unsubstituted C1 to C6 straight-chain or branched alkyl group, hydroxyl group, alkoxy group, amino group, carboxyl group, phosphoryl group, monophosphate group, diphosphate group or triphosphate group, R in chemical formula 2 is an unsubstituted amino group, or an amino group substituted with an alkyl or aryl having C1 to C6, R in chemical formula 2 3 is a residue containing carbon and a double bond within a ring, and is a ketone group (-C=O) or imino group (-C=N-) with an optional substituent.

9. In paragraph 8, A pharmaceutical composition for preventing or treating a viral infection disease, wherein the above virus is a virus belonging to the order of Nidovirale.

10. In paragraph 8, A pharmaceutical composition for preventing or treating a viral infection disease, wherein the virus is a coronavirus, Ebola virus, rhinovirus, dengue virus or influenza virus.

11. An antiviral health functional food composition comprising a compound of the following chemical formula 1 or chemical formula 2 or a pharmaceutically acceptable salt thereof: [Chemical Formula 1] [Chemical Formula 2] R in the above chemical formula 1 or chemical formula 2 1 is a substituted or unsubstituted C1 to C6 straight-chain or branched alkyl group, hydroxyl group, alkoxy group, amino group, carboxyl group, phosphoryl group, monophosphate group, diphosphate group or triphosphate group, R in chemical formula 2 is an unsubstituted amino group, or an amino group substituted with an alkyl or aryl having C1 to C6, R in chemical formula 2 3 is a residue containing carbon and a double bond within a ring, and is a ketone group (-C=O) or imino group (-C=N-) with an optional substituent.

Images