Enable discovery of BCL-2 family inhibitors targeting mode ii complexes

Abstract

This application generally relates to pro-survival complex between a guardian and an effector assembled from their intact BCL-2 globular core domains. In particular, the disclosure relates to methods of identifying modulators of BCL2 antagonist / killer (BAK) binding of Myeloid cell leukemia-1 (MCL-1).

Description

ENABLE DISCOVERY OF BCL-2 FAMILY INHIBITORS TARGETING MODE II COMPLEXESCROSS REFERENCE TO RELATED APPLICATIONS

[0001] This claims priority to U.S. Provisional Patent Application Serial No. 63 / 756,764, filed February 10, 2025, titled “ENABLE DISCOVERY OF BCL-2 FAMILY INHIBITORS TARGETING MODE II COMPLEXES,” and U.S. Provisional Patent Application Serial No. 63 / 676,130, filed July 26, 2024, titled “ENABLE DISCOVERY OF BCL-2 FAMILY INHIBITORS TARGETING MODE II COMPLEXES,” the disclosure of each of which is incorporated by reference herein in its entirety.INCORPORATION OF SEQUENCE LISTING

[0002] The present application contains a Sequence Listing which has been submitted in .XML format via Patent Center and is hereby incorporated by reference in its entirety. Said WIPO Sequence Listing was created on July 1 , 2025, XML copy is named 052592-850527_Sequence listing. xml, and is 31 ,000 bytes in size.GOVERNMENTAL RIGHTS

[0003] This invention was made with government support under GM129470 awarded by the National Institutes of Health. The government has certain rights in the invention.FIELD OF THE TECHNOLOGY

[0004] This application generally relates to structural biology. In particular, the disclosure relates to systems and methods for identifying modulators of BCL2 antagonist / killer (BAK) binding of Myeloid cell leukemia-1 (MCL-1 ) and using the same for identifying and assessing on-target modulators of MCL-1.BACKGROUND

[0005] Apoptosis, a cell death program executed through cellular caspase proteolysis, regulates human health and disease. Apoptosis controls homeostasis of theimmune system and when it becomes dysfunctional it can promote autoimmune disease and cancer when apoptosis is attenuated, or cardiovascular disease and neurodegeneration when apoptosis is overactive. Foreign agents such as viruses modulate apoptosis causing human infectious diseases. Apoptosis is triggered by extrinsic or intrinsic stress signals including death receptor signaling and DNA damage, respectively. Both stress signals typically converge on the mitochondria where the B cell lymphoma 2 (BCL-2) family proteins integrate the signals and, depending on the signal strength, they induce or block mitochondrial poration also known as mitochondrial outer membrane permeabilization (MOMP). Mitochondrial poration releases mitochondrial content into the cytosol to activate apoptotic caspases that execute cell death. Early during apoptosis mitochondrial poration releases smaller content from the inter membrane space including cytochrome c (cyt c), second mitochondrial-derived activator of caspase / direct inhibitor of apoptosis-binding protein with low pl (SMAC / DIABLO), and the serine protease high temperature requirement protein A2 (HTRA2) or Omi, their combined effect being apoptotic caspase activation. Cyt c is a potent activator of apoptosis peptidase activating factor 1 (APAF1 ) oligomerization into the apoptosome platform that activates initiator caspase-9, whereas SMAC / DIABLO and HTRA2 / 0mi inhibit the inhibitors of apoptosis (lAPs) which block the caspases. Late during apoptosis, mitochondrial poration releases larger content including matrix components such as mitochondrial DNA, which leaks out of the inner mitochondrial membrane presumably through poration of the inner membrane. Exactly how the inner mitochondrial membrane is porated is unclear, but the activated apoptotic caspases prevent an inflammatory catastrophe which could ensue should mitochondrial DNA activate the STING pathway to promote senescence as one of the major unwanted consequences of failed apoptosis.

[0006] The BCL-2 family proteins function in protein-protein interactions and protein-membrane interactions and are categorized into three functional classes. They include the prosurvival guardians of the mitochondria that prevent MOMP (BCL-2, BCL- xL, BCL-w, MCL-1 and A1 ), the prodeath pore-forming proteins (PFPs) who execute MOMP (BAK, BAX and BOK), and the prodeath BCL-2 homology 3 (BH3)-only proteins who promote MOMP indirectly by integrating upstream signals conveying them to theguardians and the PFPs (BAD, BID, BIM, BIK, BMF, HRK, NOXA, PUMA). We note that the active truncated form of BID (tBID) can execute MOMP unassisted albeit at lower efficiency compared to BAK, BAX, and BOK, and it is now considered as the fourth BCL- 2 family PFP. The current understanding of the protein-protein interactions mediated by the guardian BCL-2 family proteins is based on their ability to block MOMP by sequestering the BH3-only proteins (Mode I) and the PFPs (Mode II). In either Mode the guardians are thought to form one-to-one complexes with the BH3 domains of BH3-only proteins or PFPs. This model stipulates that during apoptosis the concentration of active BH3-only proteins increases, and they engage the available apo guardians at the mitochondria in Mode I. As the levels of active BH3-only proteins become equimolar with those of the guardians, the former begin to activate BAK and BAX and the guardians switch from engaging the BH3-only protein in Mode I to engaging BAK and BAX in Mode II. As the levels of active BH3-only proteins continue to rise, they start to compete for the binding to the guardians in Mode II releasing BAK and BAX. BAK and BAX freed from the Mode II complexes are putative active monomers, which can autoactivate in trans via their exposed BH3 regions the dormant monomers of BAK and BAX to amplify the signaling by the BH3-only proteins. Active BAK and BAX monomers are thought to oligomerize via active dimers but how the apoptotic PFPs execute MOMP remains poorly understood in the absence of pore structures.

[0007] Mechanistically, Mode I and Mode II have been elucidated at the structural level for many of the complexes formed between the guardians and the BH3- only proteins and the PFPs BAK and BAX, respectively. All published high-resolution structural investigations, based on X-ray crystallography and NMR spectroscopy studies, have used a reductionist approach with the truncated BH3 domain of BH3-only proteins or PFPs sequestered with the globular core of guardians. These structures have revealed a similar structural basis for the guardian sequestration in Mode I and Mode II wherein the conserved BH3 region of BH3-only proteins, BAK, or BAX forms an amphipathic helix bound to the hydrophobic groove conserved in each guardian. A low-resolution investigation of tBID bound to FL BCL-xL attached to nanodiscs has suggested that this complex appears to exhibit the Mode I structure of BID BH3 region bound to theconserved hydrophobic groove of BCL-xL, although the structure was not determined. While the intrinsic disordered character of all BH3-only proteins except for BID warrants the use of truncated BH3 regions for Mode I structural analysis because this region has been biochemically shown to be the high affinity domain sequestered by the guardians, it remains unclear how the BH3 region is presented in the context of Mode II from full-length PFPs which form a stable, dormant globular domain. It remains unclear how BH3 regions of effectors are presented in Mode II considering effectors form stable, dormant globular domains. Moreover, poor understanding of the on-target activity of MCL-1 in BAK sequestration casts doubt on MCL-1 inhibitor design.

[0008] Thus, there is an unmet need to characterize the complex between MCL-1 and BAK and use thereof for identification and / or assessment of modulators of MCL-1.SUMMARY

[0009] Provided herein is a method of identifying a modulator of BCL2 antagonist / killer (BAK) binding of Myeloid cell leukemia-1 (MCL-1 ) comprising contacting a test compound with an assay system. The assay system may comprise a fluorescently labelled maltose binding protein (MBP) linked to MCL-1 polypeptide, a BAK polypeptide; and a solid substrate. The method further comprises monitoring fluorescence, wherein the test compound may be identified as a modulator when a difference in the fluorescence is determined in the presence of the test compound compared to the fluorescence determined in absence of the test compound. The fluorescence may be determined in the presence of a detergent. The detergent may be dodecylmaltoside (DDM). The fluorescence label may be a dye, chromogen, or fluorophore. In one aspect, the fluorescence label is a fluorophore Alexa FluorTM. The fluorescence may be monitored using Microscale thermophoresis or using Time Resolved Fluorescence Resonance Energy Transfer (TR-FRET). In one aspect, the BAK polypeptide is further labeled with a fluorescence label. The label may comprise Terbium. The method may further comprise contacting the assay system with an isolated BAK polypeptide.

[0010] The disclosure further provides a method of identifying a modulator of BAK binding of MCL-1 comprising contacting a test compound with an assay system.The assay system may comprise an MCL-1 polypeptide linked to an MBP, a fluorescently labelled alpha helix of BH3 interacting-domain death agonist (BID) polypeptide and a solid substrate. The method may further comprise monitoring fluorescence, wherein the test compound is identified as a modulator when a difference in the fluorescence is determined in the presence of the test compound compared to the fluorescence determined in absence of the test compound. The fluorescence label may be a dye, chromogen, or fluorophore. In one instance, the fluorescence label is Fluorescein (FAM). The fluorescence may be monitored using fluorescence polarization. The method may further comprise contacting the assay system with an isolated BAK polypeptide.

[0011] In one example, the MCL-1 polypeptide linked to the MBP through a GS linker. The MCL-1 polypeptide may comprise an amino acid sequence of any one of SEQ ID NOs: 15-16. The MBP may comprise an amino acid sequence of SEQ ID NO: 14. The MCL-1 polypeptide linked to the MBP may comprise an amino acid sequence of any one of SEQ ID NOs: 19-20. The isolated BAK polypeptide of the assay system may comprise an amino acid sequence of SEQ ID NO: 1 . The BAK polypeptide may comprise an amino acid sequence of any one of SEQ ID NO: 1-12, or 17-18. The BID polypeptide may comprise the amino acid sequence of SEQ ID NO: 13.

[0012] The solid substrate may be a multi-well plate, microarray, a microsphere, or a capillary.

[0013] Further provided herein is an assay system for use with the method. A cell expressing one or more polypeptides of the assay system is further provided. Also provided is a liposome encapsulating one or more polypeptides of the assay system. An isolated mitochondria expressing one or more polypeptides of the assay system is also provided.

[0014] The disclosure further encompasses an assay system comprising a cell expressing a labeled MCL-1 polypeptide, a labeled BAK polypeptide, and a solid substrate. The cell may constitutively express a labeled MCL-1 polypeptide. The labelled MCL-1 polypeptide may be a cerulean labeled MCL-1 polypeptide. The MCL-1 polypeptide may comprise an amino acid sequence of any one of SEQ ID NOs: 15-16. The cerulean labeled MCL-1 polypeptide may comprise an amino acid sequence of SEQID NO: 22. The labeled BAK polypeptide may be a mCherry labeled BAK polypeptide. The expression of labeled BAK polypeptide may be inducible. The expression of labeled BAK polypeptide may be inducible by tetracycline (Tc) or doxycycline (Dox). The BAK polypeptide may comprise an amino acid sequence of any one of SEQ ID NOs: 1-12, or 17-18. The mCherry labeled BAK polypeptide may comprise the sequence of SEQ ID NO: 21. In one instance, the cell does not express endogenous BCL2 proteins. For example, the cell is a BCL2allKO HCT116 cell.

[0015] Further provided herein is a method of identifying a modulator of BAK binding of MCL-1 comprising contacting a test compound with the assay system and monitoring cell death and / or mitochondrial membrane permeabilization. In some instances, the test compound may be identified as a modulator of BAK binding of MCL-1 when a difference in cell death and / or mitochondrial membrane permeabilization is determined in the presence of the test compound compared to the cell death and / or mitochondrial membrane permeabilization determined in absence of the test compound. The cell death may be determined using a dye release or by measuring caspase-3 / 7 activities. The dye may be SYTOX Green. The mitochondrial membrane permeabilization may be monitored by determining the presence of cytochrome c by immunoblotting.

[0016] A method of identifying a modulator of BAK binding of MCL-1 comprising contacting a test compound with the assay system and monitoring the formation or neutralization of MCL-1 : BAK complex using live-cell fluorescence resonance energy transfer (FRET) is further provided. Also provided is a mitochondrion isolated from the cell of the assay system.

[0017] Further provided is a method of identifying a modulator of BAK binding of MCL-1 comprising contacting a test compound with the mitochondrion and monitoring mitochondrial membrane permeabilization. The test compound may be identified as a modulator of BAK binding of MCL-1 when a difference in mitochondrial membrane permeabilization is determined in the presence of the test compound compared to the mitochondrial membrane permeabilization determined in absence of the test compound. The mitochondrial membrane permeabilization may be monitored by determining the presence of cytochrome c by immunoblotting.

[0018] The disclosure further encompasses a method of identifying a modulator of BAK binding of MCL-1 comprising contacting a test compound with the mitochondrion and monitoring a conformational change of the BAK-MCL-1 complex using proteolysis by calpain. In one aspect, the test compound may be identified as a modulator of BAK binding of MCL-1 by determining the presence of one or more cleaved fragments in the presence of the test compound compared to the cleaved fragments determined in absence of the test compound. The cleaved fragments may be determined using immunoblotting. In one instance, the method further comprises contacting the mitochondrion with a cysteine-directed crosslinking agent. The test compound may be identified as a modulator of BAK binding of MCL-1 by determining the presence of one or more monomers or oligomers in the presence of the test compound compared to the monomers or oligomers determined in absence of the test compound. The one or more monomers or oligomers are determined using immunoblotting. The cysteine-directed crosslinking may be performed using bismaleimidohexane (BMH).

[0019] A protein complex comprising MCL-1 polypeptide linked to a maltose binding protein (MBP) and a BAK polypeptide, wherein a linker between the MCL-1 polypeptide and the MBP is a rigidified linker with C-terminal helix of MBP bend at the linker into the N-terminal helix of MCL-1 , is further provided. The rigidified linker comprises an amino acid sequence of II. The BAK polypeptide may have a G126R mutation. The MBP may be linked to the N-terminus of the MCL-1. The complex may further comprise an antibody, or a fragment thereof, that binds to MBP. The antibody may be a Fab fragment. The antibody may be a human Anti-E. coli MBP Recombinant Antibody Clone SAB11 M. The BAK polypeptide in the complex may form a helix a2. In one instance, the BAK polypeptide in the complex does not include a helix a3. The BAK polypeptide may comprise an amino acid sequence of any one of SEQ ID NOs: 1-12 or 17-18. The MBP may comprise an amino acid sequence of SEQ ID NO: 14. The MCL-1 polypeptide may comprise an amino acid sequence of any one of SEQ ID NOs: 15-16. The MCL-1 polypeptide linked to the MBP may comprise an amino acid sequence of SEQ ID NO: 20. The BAK polypeptide may bind to hydrophobic groove of MCL-1 at one or more residues T70, M71 , V74, L78, G82, D83, I85, or Y89 of WT BAK. A method ofidentifying a modulator of BAK binding of MCL-1 comprising contacting a test compound with the protein complex is further disclosed.BRIEF DESCRIPTION OF THE FIGURES

[0020] The application file contains at least one drawing executed in color. Copies of this patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[0021] FIG. 1A-1 F show reconstitution of BAK and MCL-1 activities and interactions. FIG. 1A-1 D shows liposome permeabilization assays measuring BAK- mediated fluorescent dye release over 60 min is represented as the area under the curve of the kinetic traces in FIG. 2A-2D. Data are average and standard deviation representative of n=2 independent experiments performed in triplicate with BAK alone, BAK + direct activators NOXA BH3 and J 19, BAK + MCL-1 + direct activator J 19, and BAK + MCL-1 + direct activator J19 + de-repressor NOXA BH3. FIG. 1 E shows size exclusion chromatography multi angle light scattering (SEC-MALS) profile of MCL- 1 :G126R BAK complex and summary of SEC-MALS profiles of this complex as well as WT BAK and G126R BAK in micellar dodecylmaltoside (DDM ) detergent buffer. Data are average and standard deviation representative of n=3 independent experiments. FIG. 1F shows Microscale thermophoresis (MST) assay of labeled MBP-MCL-1 binding to WT BAK , G126R BAK, and WT BAK BH3. Data are representative of n=3 independent experiments.

[0022] FIG. 2A-2I show MCL-1 inhibition of BAK-dependent liposome permeabilization, G126R BAK crystal structure, and SEC-MALS of WT and G126R BAK (related to FIG. 1A-1F). FIG. 2A-2D show kinetic traces of liposome permeabilization assays related to FIG. 1A-1D monitoring dye release over time. Data are average and standard deviation representative of n=2 independent experiments performed in triplicate with BAK alone, BAK + direct activators NOXA BH3 and J19, BAK + MCL-1 + direct activator J19, and BAK + MCL-1 + direct activator J19 + de-repressor NOXA BH3. FIG. 2E shows cartoon representation of the crystal structure of G126R BAK. FIG. 2F shows cartoon representation of the structure overlay of G126R BAK and the BAK core dimer (left panel) showing the predicted clashes by G126R with the dimer groove. In silicoG126R mutagenesis of the BAK core dimer predicts clashes on both sides of the dimer groove (right panel). FIG. 2G shows size exclusion chromatography multi angle light scattering (SEC-MALS) profile of WT BAK and G126R BAK in micellar dodecylmaltoside (DDM ) detergent buffer. Data are average and standard deviation representative of n=3 independent experiments. FIG. 2H is a line graph showing liposome permeabilization assays measuring G126R BAK-mediated fluorescent dye release over 90 min being represented as the area under the curve of the kinetic traces. Data are average and standard deviation representative of n=2 independent experiments performed in triplicate. FIG. 2I are series of line graph showing monitoring normalized fluorescent dye release over time. Data are average and standard deviation representative of n=2 independent experiments in triplicate.

[0023] FIG. 3A-3F illustrate characterization of the MCL-1 BAK complex by nuclear magnetic resonance (NMR) spectroscopy suggests a BH3-in-groove binding mechanism. FIG. 3A shows two-dimensional (2D) 15N1 H NMR spectra of the complex between visible WT BAK and invisible MCL-1 at 0 hr and 144 hr in micellar DDM buffer. FIG. 3B shows 2D 15N1 H NMR spectra of visible WT BAK in micellar DDM buffer. FIG. 3C shows overlay of 2D 15N1 H NMR spectra for the WT BAK:MCL-1 complex from FIG. 3A at 144 hr and WT BAK from FIG. 3B. FIG. 3D shows overlay of 2D 15N1 H NMR spectra for the G126R BAK:MCL-1 complex in DDM buffer and MCL-1 :BAK BH3 complex. FIG. 3E shows chemical shift perturbation (CSP) analysis for the changes in MCL-1 resonances between the complexes from FIG. 3D. FIG. 3F shows mapping of CSPs onto the crystal structure of the MCL-1 : BAK BH3 complex presented in FIG. 7A- 7F.

[0024] FIG. 4A-4C depict NMR spectroscopy of MCL-1 : BAK complex (related to FIG. 3A-3F). FIG. 4A shows overlay of 2D 15N1 H NMR spectra for the WT BAK:MCL-1 complex at 0 and 144 hr. FIG. 4B shows assigned 2D 15N1 H NMR spectrum of visible MCL-1 and invisible G126R BAK in micellar DDM buffer. FIG. 4C shows assigned 2D 15N1 H NMR spectrum of visible MCL-1 and invisible BAK BH3 in micellar DDM buffer.

[0025] FIG. 5A-5F show cryo-EM and crystal structures of MCL-1 :BAK complex reveal a canonical BH3-in-groove sequestration mechanism. FIG. 5A illustrates a cartoon of Sab11 M:MBP-MCL-1 :G126R BAK complex in DDM micelles and the SEC elution profile and corresponding Coomassie-stained SDS PAGE gel indicating the fraction used for cryo-EM analysis. FIG. 5B shows volume representation of the cryo-EM map used to build the structure of Sab11 M:MBP-MCL-1 :G126R BAK complex in DDM micelles. FIG. 5C depicts cartoon representation of the structure of Sabi 1M:MBP-MCL- 1 :G126R BAK complex in DDM micelles. FIG. 5D-5F show overlay and individual cartoons for the cryo-EM structure Sabi 1 M:MBP-MCL-1 :G126R BAK complex in DDM micelles and the crystal structure MBP-MCL-1 :BAK BH3.

[0026] FIG. 6 shows summary of CryoSPARC cryo-EM data processing for the Sabi 1 M:MBP-MCL-1 :G126R BAK complex in micellar DDM buffer (related to FIG. 5A-5F, Table 2)

[0027] FIG. 7A-7F illustrate cryo-EM and crystal structure of MCL-1 :BAK complexes and structure comparisons (related to FIG. 5A-5F, Tables 1-2). FIG. 7A-7C show cartoon and cryo-EM map representation of Sab11 M:MBP-MCL-1 :G126R BAK complex in micellar DDM buffer showing the full map (FIG. 7A), the map around the linker region between MBP and MCL-1 (FIG. 7B), and the map for the MCL-1 :BAK complex in stereo (FIG. 7C). FIG. 7D shows overlay of MBP-MCL-1 : BAK portion of the cryo-EM structure with the crystal structure of MBP-MCL-1 :BAK BH3 using MBP as reference. FIG. 7E shows overlay of MBP-MCL-1 crystal structure with the crystal structure of MBP- MCL-1 : BAK BH3 using MBP as reference. FIG. 7F shows overlay of MBP-MCL-1 crystal structure with the crystal structure of MBP-MCL-1 :BAK BH3 using MCL-1 as reference. MBP is not shown.

[0028] FIG. 8A-8C show V74A BAK mutagenesis attenuates MCL-1 binding in a side-chain dependent manner without affecting the overall fold of MCL-1 : BAK BH3 complex (related to FIG. 9A-9E). FIG. 8A shows de-repression of MCL-1 :BID SAHB- FAM complex by BAK BH3 peptides and polarization changes as a function of BAK BH3 peptide dose. Data are two representatives of n=3 independent experiments performedin triplicate. FIG. 8B-8C depict cartoon and map representation for the crystal structures of MBP-MCL-1 BAK BH3 (FIG. 8B) and MBP-MCL-1 :V74A BAK BH3 (FIG. 8C).

[0029] FIG. 9A-9E illustrate mutagenesis of BAK BH3 residues supporting the BH3-in-groove sequestration mechanism. FIG. 9A is a cartoon representation of the crystal structure of MCL-1 :BAK BH3 complex identifying mutated residues. FIG. 9B is cartoon of competitive fluorescence polarization assay measuring de-repression of MCL- 1 :BID SAHB-FAM complex by BAK BH3 peptides and polarization changes as a function of BAK BH3 peptide dose. Data are representative of n=3 independent experiments performed in triplicate. FIG. 9C shows a summary of IC50 values and fold change between wild type and mutants of BAK. Amino acid residues of SEQ ID NOs: 1 -12 are shown. FIG. 9D depicts cartoon representation for the overlay of MCL-1 :WT BAK BH3 and MCL-1 :V74A BAK BH3 crystal structures. FIG. 9E shows MST assay of labeled MBP-MCL-1 binding to V74A G126R BAK and G126R BAK. Data for MST trace are from three independent experiments and the bar graph plots their average and standard deviation.

[0030] FIG. 10A-10G show de-repression of MCL-1 :BAK complex by BH3 peptides correlates with direct binding to MCL-1 and direct BAK activation. FIG. 10A shows summary of IC50 values and fold change compared to BIM BH3 for competitive FP assay measuring de-repression of MCL-1 ID SAHB-FAM complex by BH3 peptides and polarization changes as a function of BH3 peptide dose. Amino acid residues of SEQ ID NOs: 13, 27, and 28 are shown. Data are average and standard deviation representative of n=3 independent experiments. FIG. 10B depicts cartoon of competitive MST assay measuring de-repression of MCL-1 :G126R BAK complex by BH3 peptides in micellar DDM detergent and MST changes as a function of BH3 peptide dose. Data are average and standard deviation representative of n=3 independent experiments. FIG. 10C shows MST assays of labeled MBP-MCL-1 binding to BH3 peptides in buffer ± micellar DDM. Data are average and standard deviation representative of n=3 independent experiments. FIG. 10D illustrates a schematic of de-repression / sensitization liposome permeabilization assays. FIG. 10E shows direct activation of WT BAK and V74A BAK by BH3 peptides. FIGs. 10F-10G show neutralization / sensitization of MCL-1 :WTBAK and MCL-1 :V74A BAK complexes by BH3 peptides. Data are average and standard deviation representative of n=2 independent experiments.

[0031] FIG. 11A-11C show de-repression of MCL-1 mode I and mode II complexes with BH3 peptides (related to FIG. 10A-10G). FIG. 11A shows competitive FP assay measuring de-repression of MCL-1 :BID SAHB-FAM complex by BH3 peptides and polarization changes as a function of BH3 peptide dose. Data are average and standard deviation of two representatives of n=3 independent experiments. FIG. 11 B shows competitive MST assay measuring de-repression of MCL-1 :G126R BAK complex by BH3 peptides in micellar DDM detergent and MST changes as a function of BH3 peptide dose. Data are average and standard deviation of two representatives of n=3 independent experiments. FIG. 11C shows liposome permeabilization showing kinetic traces of liposome permeabilization assays related to FIG. 10E-10G monitoring dye release over time for direct activation of WT and V74A BAK and de-repression of their MCL-1 complexes with BH3 peptides.

[0032] FIG. 12A-12H show MCL-1 inhibitory BH3 mimetic are poor in neutralization of MCL-1 :BAK complex. FIG. 12A shows MST assays of labeled MBP- MCL-1 binding to BH3 mimetics in buffer ± micellar DDM. Data are average and standard deviation from of n=3 independent experiments. FIG. 12B illustrates a cartoon of competitive MST assay measuring neutralization of MCL-1 :G126R BAK complex by BH3 mimetics in micellar DDM detergent and MST changes as a function of BH3 mimetic dose. Data are average and standard deviation of n=3 independent experiments. FIG. 12C depicts cartoon of MOMP assay measuring cytochrome c (cyt c) release and immunoblot analysis of MOMP as a function of BH3 mimetic dose of purified mitochondria from DOX- inducible mCherry-BAK (mC-BAK) and constitutive Cerulean-FL MCL-1 (Cer-MCL-1 ) BCL2allKO HCT116 cells. See cartoon of cell line features in FIG. 13B. Data are representative of n=2 independent experiments. FIG. 12D shows assays measuring apoptosis as a result of derepression, sensitization, neutralization of MCL-1 :WT BAK complexes by BH3 mimetics in the BCL2allKO HCT116 expressing DOX-inducible mC- BAK + constitutive Cer-MCL-1. Data are average and standard deviation representative of n=3 independent experiments. FIG. 12E shows control experiments showingresistance to cell death of cells in FIG. 12D upon DOX titrations. Data are average and standard deviation representative of n=3 independent experiments. FIG. 12E shows cell death assays quantifying the area under curve of kinetic traces measuring SYTOX Green (SG) counts over confluence. Assays were set up to measure sensitization and neutralization of MCL-1 :WT BAK complex by MCL-1 inhibitors in the BCL2allKO HCT116 expressing Dox-inducible mC-BAK + constitutive Cer-MCL-1 . The qVD caspase inhibitor control is included. Data are average and standard deviation representative of n=3 independent experiments in triplicate. FIG. 12F shows Neutralization assays performed tested caspase 3 / 7 activities at 24h after Dox addition. Data are average and standard deviation representative of n=3 independent experiments in triplicate. FIG. 12G shows MOMP, calpain limited proteolysis, and crosslinking assays performed on mitochondria purified correlated cyt c release with the known BAK species found in the absence and presence of MCL-1 inhibitors or BH3 peptide activators, confirming considerable levels of endogenous MCL-1 :BAK Mode II complex. * likely mono-ubiquitinated BAK. Data are representative of n=3 independent experiments. FIG. 12H shows fluorescence resonance energy transfer (FRET) assays measuring FRET signal between Cer-MCL-1 donor and mC-BAK acceptor. FRET signal was adjusted to the same contrast for all conditions. All scale bars are 2 pm. Data are representative of n=3 independent experiments measuring three different cells for each condition. P-value was calculated based on unpaired t-test

[0033] FIG. 13A-13K shows de-repression of MCL-1 : BAK mode II complex with BH3 mimetics (related to FIG. 12A-12E). FIG. 13A shows MST assays of labeled MBP-MCL-1 binding to BH3 mimetics in buffer ± micellar DDM. Data are MST traces from n=3 independent experiments. FIG. 13B shows system for interrogating MCL-1 :WT BAK complexes in minimalist BCL-2 family repertoire cell-based system based on BCL2allKO HCT116 expressing Doxycycline (DOX) inducible mCherry-BAK (mC-BAK) and constitutive Cerulean-FL MCL-1 (Cer-MCL-1 ). Dox titration induced expression of mC-BAK based on immunoblotting. The blot on the left was blotted with anti-BAK antibody first, followed by anti-GFP to detect Cer-MCL-1 , and anti-actin as loading control. FIG. 13C shows assays measuring apoptosis as a result of derepression, sensitization, neutralization of MCL-1 :WT BAK complexes by BH3 mimetics in the BCL2allKO HCT116expressing DOX-inducible mC-BAK + constitutive Cer-MCL-1. Data are average and standard deviation of two representatives of n=3 independent experiments. FIG. 13D shows control experiments showing resistance to cell death of cells upon DOX titrations. Data are average and standard deviation of two representatives of n=3 independent experiments. FIG. 13E shows relative levels of MCL-1 and BAK in a given purified mitochondria established by comparing serial dilutions of mitochondrial preparation against purified proteins and immunoblotting with antibodies that recognize epitopes in full-length and E. coli expressed truncated proteins cBAK and MBP-MCL-1. FIG. 13F shows MOMP assay -Dox control. Data are representative of n=2 independent experiments. FIG. 13G shows cell death assays quantifying the area under curve of kinetic traces measuring SYTOX Green (SG) counts over confluence (not shown) testing resistance to apoptosis of mC-BAK + Cer-MCL-1 BCL2allKO HCT116 upon Dox titration. Data are average and standard deviation of n=3 independent experiments in triplicate. FIG. 13H shows cell death assays quantifying the area under curve of kinetic traces measuring SYTOX Green (SG) counts over confluence (some of the corresponding data are in Figure S7H). Assays were set up to measure sensitization and neutralization of MCL-1 : WT BAK complex by MCL-1 inhibitors in the BCL2allKO HCT 116 expressing Dox- inducible mC-BAK + constitutive Cer-MCL-1. The qVD caspase inhibitor control is included. Data are average and standard deviation representative of n=3 independent experiments in triplicate only two shown. -Dox controls are included. FIG. 131 shows neutralization assays which tested caspase 3 / 7 activities at 24h after Dox addition. Data are average and standard deviation representative of n=3 independent experiments in triplicate. FIG. 13J shows kinetic traces of cell death assays in Figure 6D monitoring SG counts divided by % confluence over time. Data are average and standard deviation for one representative of n=3 independent experiments in triplicate. FIG. 13K shows fluorescence resonance energy transfer (FRET) assays measuring FRET signal between Cer-MCL-1 donor and mC-BAK acceptor. FRET signal was adjusted to the same contrast for all conditions. All scale bars are 2 pm. Data are two representatives of n=3 independent experiments measuring three different cells for each condition. P-values were calculated based on unpaired t-test.

[0034] FIG. 14 shows a line graph depicting MBP-MCL-1 binding to GST- BAK G126R in a representative Time Resolved Fluorescence Resonance Energy Transfer (TR-FRET).

[0035] FIG. 15A-15C show Unified model of apoptosis initiation by BCL-2 family proteins-regulated MOMP. FIG. 15A is a schematic showing BCL-2 family proteins regulate mitochondrial integrity through protein-protein interactions and mitochondrial permeabilization. Three functional classes provide redundancy and selectivity to apoptosis stimulation. FIG. 15B is a schematic showing cell stress induces apoptosis by activation of BH3-only initiators which titrate the guardians and effectors. As the levels of BH3-only initiators increases, they interact with guardians in Mode I, directly activate the effectors promoting their conformational opening, which is tightly sequestered by guardians in Mode II, followed by Mode II neutralization to release active effectors which autoactivate, dimerize and oligomerize to induce MOMP. The structure of the Mode II MCL-1 :BAK complex presented here reveals a dynamic conformation of the effector in an otherwise canonical BH3-in-groove complex. FIG. 15C is a schematic showing, based on structural similarities in engaging BH3 ligands among the five guardians and two effectors, their complexes with activated BAK and BAX is predicted to exhibit similar structures to that of the Mode II MCL-1 :BAK complex. It is also predicted that the BH3 complexes of guardians and effectors recapitulate faithfully the structured portions of the full-length complexes. *The BCL-2: BAX complex may exhibit an extended BAX BH3 region predicted by the crystal structure (PDB ID 2xa0). This general mechanism will inform rational targeting of Mode II and autoactivated effector complexes in pathophysiology.DETAILED DESCRIPTION

[0036] The present disclosure is based, in part, on comprehensive characterization of the Mode II complex between MCL-1 and BAK. MCL-1 and BAK form one of the highest affinity complexes among prodeath and guardian BCL-2 family proteins, their complex being of immediate interest to targeted therapies aimed at triggering apoptosis in cancer based on MCL-1 selective drugs designed to derepress Mode I and neutralize Mode II MCL-1 complexes. Among the guardian BCL-2 familyproteins, MCL-1 is unique containing an N-terminal intrinsically disordered region (IDR, amino acids 1-171) appended to the conserved BCL-2 core domain (amino acids 172- 350), which is shared by all guardians. The IDR has been implicated in mitochondrial import into the matrix, post translational modifications, and partial inhibition of access by BH3 ligands to its hydrophobic groove. MCL-1 is also unique among the guardians being actively regulated by proteasome degradation via several E3 ligases, its protein levels widely fluctuating in cellular studies. The inventors developed an integrated structural biology approach combining cryo-EM, X-ray crystallography and NMR spectroscopy to characterize the structural basis of Mode II sequestration of the globular BCL-2 core domain of BAK by the globular BCL-2 core domain of MCL-1 , which was validated biochemically in vitro and in cells. Inventors have further developed systems and methods for identifying modulators of MCL-1. Additionally, pharmacological insights into the effectiveness of MCL-1 selective inhibitors in neutralizing Mode II MCL-1 :BAK complexes, which is of great interest for activating apoptosis in MCL-1 -dependent cancers is also presented.

[0037] Other aspects and iterations of the disclosure are described more thoroughly below.L Definitions

[0038] So that the present disclosure may be more readily understood, certain terms are first defined. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which aspects of the disclosure pertain. Many methods and materials similar, modified, or equivalent to those described herein can be used in the practice of the various aspects of the present disclosure without undue experimentation, the preferred materials and methods are described herein. In describing and claiming the aspects of the present disclosure, the following terminology will be used in accordance with the definitions set out below.

[0039] Concentrations, amounts, and other numerical data may be expressed or presented herein in a range format. It is to be understood that such a range format is used merely for convenience and brevity and should be interpreted flexibly toinclude not only the numerical values explicitly recited as the limits of the range, but also to include all the individual numerical values or sub-ranges encompassed within that range as if each numerical value and sub-range is explicitly recited. As an illustration, a numerical range of “about 2 to about 50” should be interpreted to include not only the explicitly recited values of 2 to 50, but also include all individual values and sub-ranges within the indicated range. Thus, included in this numerical range are individual values such as 2, 2.4, 3, 3.7, 4, 5.5, 10, 10.1 , 14, 15, 15.98, 20, 20.13, 23, 25.06, 30, 35.1 , 38.0, 40, 44, 44.6, 45, 48, and sub-ranges such as from 1-3, from 2-4, from 5-10, from 5-20, from 5-25, from 5-30, from 5-35, from 5-40, from 5-50, from 2-10, from 2-20, from 2-30, from 2-40, from 2-50, etc. This same principle applies to ranges reciting only one numerical value as a minimum or a maximum. Furthermore, such an interpretation should apply regardless of the breadth of the range, or the characteristics being described.

[0040] The term “about,” as used herein, refers to variation of in the numerical quantity that can occur, for example, through typical measuring techniques and equipment, with respect to any quantifiable variable, including, but not limited to, mass, volume, time, distance, and amount. Further, given solid and liquid handling procedures used in the real world, there is certain inadvertent error and variation that is likely through differences in the manufacture, source, or purity of the ingredients used to make the compositions or carry out the methods and the like. The term “about” also encompasses these variations, which can be up to ± 5%, but can also be ± 4%, 3%, 2%, 1 %, etc. Whether or not modified by the term “about,” the claims include equivalents to the quantities.

[0041] In this disclosure, “comprises,” “comprising,” “containing,” and “having” and the like can have the meaning ascribed to them in U.S. Patent Law and can mean “includes,” “including,” and the like, and are generally interpreted to be open ended terms. The terms “consisting of” or “consists of” are closed terms, and include only the components, structures, steps, or the like specifically listed in conjunction with such terms, as well as that which is in accordance with U.S. Patent law. “Consisting essentially of” or “consists essentially of” have the meaning generally ascribed to them by U.S. Patent law. In particular, such terms are generally closed terms, with the exception of allowinginclusion of additional items, materials, components, steps, or elements, that do not materially affect the basic and novel characteristics or function of the item(s) used in connection therewith. For example, trace elements present in a composition, but not affecting the composition’s nature or characteristics would be permissible if present under the “consisting essentially of” language, even though not expressly recited in a list of items following such terminology. In this specification when using an open ended term, like “comprising” or “including,” it is understood that direct support should be afforded also to “consisting essentially of’ language as well as “consisting of” language as if stated explicitly and vice versa.

[0042] As used herein, the term “protein complex” or “complex” or “assembled protein(s)” refers to a group of two or more associated macromolecules, whereby at least one of the macromolecules is a protein. A protein complex, as used herein, typically refers to associations of macromolecules that can be formed under physiological conditions. Individual members of a protein complex are linked by non- covalent interactions. A protein complex can be a non-covalent interaction of only proteins, and is then referred to as a protein-protein complex; for instance, a non-covalent interaction of two proteins, of three proteins, of four proteins, etc. It will be understood that a protein complex can be multimeric. Protein complex assembly can result in the formation of homo-multimeric or hetero-multimeric complexes. Moreover, interactions can be stable or transient. The term “multimer(s)”, “multimeric complex”, or “multimeric protein(s)” comprises a plurality of identical or heterologous polypeptide monomers. Polypeptides can be capable of self-assembling into multimeric assemblies (i.e.: dimers, trimers, hexamers, pentamers, octamers, etc.) formed from self-assembly of a plurality of a single polypeptide monomers (i.e., “homo-multimeric assemblies”). As used herein, a “plurality” means 2 or more. The multimeric assembly comprises 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, or more polypeptide monomers. The multimeric assemblies can be used for any purpose, and provide a way to develop a wide array of protein “nanomaterials.” In addition to the finite, cage-like or shell-like protein assemblies, they may be designed by choosing an appropriate target symmetric architecture. The monomers and / or multimeric assemblies of the invention can be used in the design of higher order assemblies with theattendant advantages of hierarchical assembly. The resulting multimeric assemblies are highly ordered materials with superior rigidity and monodispersity, and can form the basis of advanced functional materials and custom-designed molecular machines with wide- ranging applications.

[0043] As used herein “binding” means any interaction, be it direct or indirect. A direct interaction implies a contact between the binding partners. An indirect interaction means any interaction whereby the interaction partners interact in a complex of more than two molecules. The interaction can be completely indirect, with the help of one or more bridging molecules, or partly indirect, where there is still a direct contact between the partners, which is stabilized by the additional interaction of one or more molecules.

[0044] As used herein, “MCL-1” refers to MCL-1 gene and MCL-1 gene products such as mRNA of MCL-1 gene and protein encoded by MCL-1 gene. MCL-1 gene encodes proteins belonging to the BCL-2 family. Alternative splicing of the MCL-1 gene generates at least two proteins, the longer one enhancing cell survival by inhibiting apoptosis while the shorter protein promoting apoptosis and cell death. Human MCL-1 gene has a Gene ID of 4170 in NCBI database. The mRNA transcripts of the human MCL- 1 gene have NCBI reference sequences of NM_021960.5, NM_182763.2 and NM_001197320.1 . The proteins encoded by the human MCL-1 gene have NCBI reference sequences of NP_068779.1 , NP_877495.1 and NP_001184249.1.

[0045] As used herein, “BID” refers to BID gene and BID gene products such as mRNA of BID gene and protein encoded by BID gene. BID, or BH3 interactingdomain death agonist, is a pro-apoptotic member of the BCL-2 family that contains only the BH3 domain. In response to apoptotic signaling, BID interacts with another BCL-2 family protein, BAX (or BAK), leading to the insertion of activated BAX (or BAK) into outer mitochondrial membrane. The anti-apoptotic BCL-2 family member, including BCL-2 itself, can bind BID and inhibit BID'S ability to activate BAX (or BAK). The expression of BID is upregulated by p53 and involved in p53-mediated apoptosis. Human BID gene has a Gene ID of 637 in NCBI database. The mRNA transcripts of the human BID gene have NCBI reference sequences of NM_001196, NM_001244567, NM_001244569,NM_001244570 and NM_001244572. The proteins encoded by the human BID gene have NCBI reference sequences of NP_001187, NP_001231496, NP_001231498, NP_001231499 and NP_001231501 .

[0046] As used herein, “BAK” refers to BAK gene and BAK gene products such as mRNA of BAK gene and protein encoded by BAK gene. BAK, also known as BCL-2 homologous antagonist / killer, is a pro-apoptotic member of BCL-2 family. BAK protein interacts with and accelerates the opening of the mitochondrial voltage-dependent anion channel, which leads to a loss in membrane potential and the release of cytochrome c. Human BAK gene has a Gene ID of 578 in NCBI database. The mRNA transcript of the human BAK gene has NCBI reference sequence of NM_001188. The protein encoded by the human BAK gene has NCBI reference sequence of NP_001179.

[0047] As used herein, “BIM” refers to BIM gene and BIM gene products such as mRNA of BIM gene and protein encoded by BIM gene. BIM, also known as BCL- 2-like protein 11 , is a pro-apoptotic BCL-2 family member that has been shown to interact with BCL-2, BCL-XL and MCL-1. Human BIM gene has a Gene ID of 10018 in NCBI database. The mRNA transcripts of the human BIM gene have NCBI reference sequences of NM_001204106, NM_001204107, NM_001204108, NM_001204109 and NM_001204110. The proteins encoded by the human BIM gene have NCBI reference sequences of NP_001191035, NP_001191036, NP_001191037, NP_001191038 and NP_001191039.

[0048] As used herein, “NOXA” refers to NOXA gene and NOXA gene products such as mRNA of NOXA gene and protein encoded by NOXA gene. NOXA, also known as PMAIP1 , APR, or phorbol-12-myristate-13-acetate-induced protein 1 , is a is a pro-apoptotic member of the BCL-2 protein family. The expression of Noxa is regulated by the tumor suppressor p53, and Noxa has been shown to be involved in p53-mediated apoptosis. The mRNA transcripts of the human NOXA gene has NCBI reference sequence NM_021127.3. The proteins encoded by the human NOXA gene have NCBI reference sequences of NP_066950, NP_001369544, NP_001369545, NP_001369546, and NP_001369547.

[0049] The term “nucleic acid” or “polynucleotide” refers to deoxyribonucleic acids (DNA) or ribonucleic acids (RNA) and polymers thereof in either single- or doublestranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogues of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions), alleles, orthologs, SNPs, and complementary sequences as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and / or deoxyinosine residues See, e.g., Batzer et al., Nucleic Acid Res. 19:5081 (1991 ), the disclosure of which is incorporated in its entirety herein.

[0050] The terms “peptide,” “polypeptide,” and “protein” are used interchangeably, and refer to a compound comprised of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids that can comprise a protein's or peptide's sequence. Polypeptides include any peptide or protein comprising two or more amino acids joined to each other by peptide bonds. As used herein, the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types. “Polypeptides” include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, among others. A polypeptide includes a natural peptide, a recombinant peptide, or a combination thereof.

[0051] Within the context of the application a protein is represented by an amino acid sequence and correspondingly a nucleic acid molecule or a polynucleotide represented by a nucleic acid sequence. Identity and similarity between sequences: throughout this application, each time one refers to a specific amino acid sequence SEQID NO (take SEQ ID NO: Y as example), one may replace it by: a polypeptide represented by an amino acid sequence comprising a sequence that has at least 60%, 70%, 75%, 80%, 85%, 90%, 95, or 99% sequence identity or similarity with amino acid sequence SEQ ID NO: Y.

[0052] Each amino acid sequence described herein by virtue of its identity or similarity percentage with a given amino acid sequence respectively has in a further preferred aspect an identity or a similarity of at least 60%, at least 61 %, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71 %, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81 %, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% with the given nucleotide or amino acid sequence, respectively. The terms “homology”, “sequence identity” and the like are used interchangeably herein. Sequence identity is described herein as a relationship between two or more amino acid (polypeptide or protein) sequences or two or more nucleic acid (polynucleotide) sequences, as determined by comparing the sequences. In a preferred aspect, sequence identity is calculated based on the full length of two given SEQ ID NO’s or on a part thereof. Part thereof preferably means at least 50%, 60%, 70%, 80%, 90%, or 100% of both SEQ ID NO’s. In the art, “identity” also refers to the degree of sequence relatedness between amino acid or nucleic acid sequences, as the case may be, as determined by the match between strings of such sequences. The degree of sequence identity between two sequences can be determined, for example, by comparing the two sequences using computer programs commonly employed for this purpose, such as global or local alignment algorithms. Nonlimiting examples include BLASTp, BLASTn, Clustal W, MAFFT, Clustal Omega, AlignMe, Praline, GAP, BESTFIT, or another suitable method or algorithm. A Needleman and Wunsch global alignment algorithm can be used to align two sequences over their entire length or part thereof (part thereof may mean at least 50%, 60%, 70%, 80%, 90% of the length of the sequence), maximizing the number of matches and minimizes thenumber of gaps. Default settings can be used and preferred program is Needle for pairwise alignment (in an aspect, EMBOSS Needle 6.6.0.0, gap open penalty 10, gap extent penalty: 0.5, end gap penalty: false, end gap open penalty: 10 , end gap extent penalty: 0.5 is used) and MAFFT for multiple sequence alignment ( in an aspect, MAFFT v7Default value is: BLOSUM62 [bl62], Gap Open: 1.53, Gap extension: 0.123, Order: aligned , Tree rebuilding number: 2, Guide tree output: ON [true], Max iterate: 2 , Perform FFTS: none is used).

[0053] “Similarity” between two amino acid sequences is determined by comparing the amino acid sequence and its conserved amino acid substitutes of one polypeptide to the sequence of a second polypeptide. Similar algorithms used for determination of sequence identity may be used for determination of sequence similarity. Optionally, in determining the degree of amino acid similarity, the skilled person may also take into account so-called conservative amino acid substitutions. As used herein, “conservative” amino acid substitutions refer to the interchangeability of residues having similar side chains.

[0054] For example, a group of amino acids having aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; a group of amino acids having aliphatic- hydroxyl side chains is serine and threonine; a group of amino acids having amide- containing side chains is asparagine and glutamine; a group of amino acids having aromatic side chains is phenylalanine, tyrosine, and tryptophan; a group of amino acids having basic side chains is lysine, arginine, and histidine; and a group of amino acids having Sulphur-containing side chains include cysteine and methionine. Preferred conservative amino acids substitution groups are: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, and asparagine-glutamine. Substitutional variants of the amino acid sequence disclosed herein are those in which at least one residue in the disclosed sequences has been removed and a different residue inserted in its place. The amino acid change may be conservative. Conservative substitutions for each of the naturally occurring amino acids may be as follows: Ala to Ser; Arg to Lys; Asn to Gin or His; Asp to Glu; Cys to Ser or Ala; Gin to Asn; Glu to Asp; Gly to Pro; His to Asn or Gin; He to Leu or Vai; Leu to He or Vai; Lys to Arg; Gin or Glu;Met to Leu or He; Phe to Met, Leu or Tyr; Ser to Thr; Thr to Ser; Trp to Tyr; Tyr to Trp or Phe; and, Vai to He or Leu.

[0055] As used herein, “binding affinity” refers to the apparent association constant or KA. The KA is the reciprocal of the dissociation constant (KD).

[0056] As used herein, the term “wild-type sequence” refers to a DNA or RNA sequence that is considered typical for a particular species or population under normal, natural conditions. It represents the standard or ancestral genetic information before any alterations or mutations have occurred. The wild-type sequence is used as a reference point for comparing genetic variations and mutations in sequences, individuals or populations. The wild-type sequence may be compared with a mutant sequence to understand the functional consequences of genetic changes, study the role of specific genes, and investigate the genetic basis of traits or diseases. What is considered wild type can vary depending on the context, and in some cases, a reference genome for a specific species may serve as the standard wild-type sequence.

[0057] As used herein, “label” or “detectable label,” or “detection molecule” or “detectible molecule” or “conjugate” as used herein, refers to any chemical group or moiety that can be linked to a substance that is to be detected or quantitated, e.g., an antibody. A label is a detectable label that is suitable for the sensitive detection or quantification of a substance. Non-limiting examples of detectable labels include, but are not limited to, luminescent labels, e.g., fluorescent, phosphorescent, chemiluminescent, bioluminescent and electrochemiluminescent labels, radioactive labels, enzymes, particles, magnetic substances, electroactive species and the like. Alternatively, a detectable label may signal its presence by participating in specific binding reactions. Non-limiting examples of such labels include haptens, antibodies, biotin, streptavidin, his- tag, nitrilotriacetic acid, glutathione S-transferase, glutathione and the like. Further specific examples are provided in the current disclosure.

[0058] As used herein, “apoptosis” refers to a regulated network of biochemical events which lead to a selective form of cell death that is characterized by readily observable morphological and biochemical changes, such as the fragmentation of the deoxyribo-nucleic acid (DNA), condensation of the chromatin, which may or may notbe associated with endonuclease activity, chromosome migration, margination in cell nuclei, the formation of apoptotic bodies, mitochondrial swelling, widening of the mitochondrial cristae, opening of the mitochondrial permeability transition pores and / or dissipation of the mitochondrial proton gradient.

[0059] The term “modulate” as used herein with reference to a compound refers to the activation or inhibition of BAK binding of MCL-1 , or other protein -protein interaction involving a BCL-2 family member that regulates a biochemical pathway (e.g. unfolded protein response, glucose-stimulated insulin secretion) that can include both anti-apoptotic and pro-apoptotic activity. Methods for assaying both anti-apoptotic, pro- apoptotic, and other biochemical activities (e.g. unfolded protein response, glucose- stimulated insulin secretion) are well known in the art and described herein.

[0060] As used herein, “activates” refers to an increase in BAK binding of MCL-1. Such a compound may have pro-apoptotic activity. In one aspect, a compound that has a pro-apoptotic activity will cause a 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70% or more increase in the pro-apoptotic for e.g., cell death, activity of the BCL-2 family polypeptide when compared with a control lacking the compound. An activator of BAK may increase BAK binding to MCL-1 . The activator may increase pro-apoptotic activity in combination with inhibitors of MCL-1 .

[0061] As used herein, “inhibits” refers to a decrease or blocking of BAK binding of MCL-1 . Such a compound may have pro-apoptotic activity. For example, a compound that inhibits BAK binding of MCL-1 may enhance apoptosis. In one aspect, a compound that has a pro-apoptotic activity will cause a 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70% or more increase in the pro-apoptotic activity for e.g., cell death when compared with a control lacking the compound.

[0062] In one aspect, a compound that has an anti-apoptotic activity will cause a 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70% or more increase in the anti-apoptotic activity for e.g., cell survival when compared with a control lacking the compound.

[0063] As used herein, “individual”, “subject”, “host”, and “patient” can be used interchangeably and may refer to any human or non-human mammalian subject for whom diagnosis, treatment, prophylaxis or therapy is desired, for example, humans, pets,livestock, horses or other animals. In some aspects, the subject is a human. In other aspects, the subject is a human in need of treatment for cancer.

[0064] The terms “treat,” "treating," or "treatment" as used herein, refer to both therapeutic treatment and prophylactic or preventative measures, wherein the object is to prevent or slow down (lessen) an undesired physiological change or disease / disorder. Beneficial or desired clinical results include, but are not limited to, alleviation of symptoms, diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, a delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable. “Treatment” can also mean prolonging survival as compared to expected survival if not receiving treatment. Those in need of treatment include those already with the disease, condition, or disorder as well as those prone to have the disease, condition, or disorder or those in which the disease, condition or disorder is to be prevented.

[0065] As used herein “cancer,” “tumor,” or “malignancy” may refer to one or more neoplasm or cancer. The neoplasm may be malignant or benign, the cancer may be primary or metastatic; the neoplasm or cancer may be early stage or late stage. Nonlimiting examples of neoplasms or cancers may include acute lymphoblastic leukemia, acute myeloid leukemia, adrenocortical carcinoma, AIDS-related cancers, AIDS-related lymphoma, anal cancer, appendix cancer, astrocytoma (childhood cerebellar or cerebral), basal cell carcinoma, bile duct cancer, bladder cancer, bone cancer, brainstem glioma, brain tumors (cerebellar astrocytoma, cerebral astrocytoma / malignant glioma, ependymoma, medulloblastoma, supratentorial primitive neuroectodermal tumors, visual pathway and hypothalamic gliomas), breast cancer, bronchial adenomas / carcinoids, Burkitt lymphoma, carcinoid tumors (childhood, gastrointestinal), carcinoma of unknown primary, central nervous system lymphoma (primary), cerebellar astrocytoma, cerebral astrocytoma / malignant glioma, cervical cancer, childhood cancers, chronic lymphocytic leukemia, chronic myelogenous leukemia, chronic myeloproliferative disorders, colon cancer, cutaneous T-cell lymphoma, desmoplastic small round cell tumor, endometrial cancer, ependymoma, esophageal cancer, Ewing's sarcoma in the Ewing family of tumors, extracranial germ cell tumor (childhood), extragonadal germ cell tumor,extrahepatic bile duct cancer, eye cancers (intraocular melanoma, retinoblastoma), gallbladder cancer, gastric (stomach) cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor, germ cell tumors (childhood extracranial, extragonadal, ovarian), gestational trophoblastic tumor, gliomas (adult, childhood brain stem, childhood cerebral astrocytoma, childhood visual pathway and hypothalamic), gastric carcinoid, hairy cell leukemia, head and neck cancer, hepatocellular (liver) cancer, Hodgkin lymphoma, hypopharyngeal cancer, hypothalamic and visual pathway glioma (childhood), intraocular melanoma, islet cell carcinoma, Kaposi sarcoma, kidney cancer (renal cell cancer), laryngeal cancer, leukemias (acute lymphoblastic, acute myeloid, chronic lymphocytic, chronic myelogenous, hairy cell), lip and oral cavity cancer, liver cancer (primary), lung cancers (non-small cell, small cell), lymphomas (AIDS-related, Burkitt, cutaneous T-cell, Hodgkin, non-Hodgkin, primary central nervous system), macroglobulinemia (Waldenstrom), malignant fibrous histiocytoma of bone / osteosarcoma, medulloblastoma (childhood), melanoma, intraocular melanoma, Merkel cell carcinoma, mesotheliomas (adult malignant, childhood), metastatic squamous neck cancer with occult primary, mouth cancer, multiple endocrine neoplasia syndrome (childhood), multiple myeloma / plasma cell neoplasm, mycosis fungoides, myelodysplastic syndromes, myelodysplastic / myeloproliferative diseases, myelogenous leukemia (chronic), myeloid leukemias (adult acute, childhood acute), multiple myeloma, myeloproliferative disorders (chronic), nasal cavity and paranasal sinus cancer, nasopharyngeal carcinoma, neuroblastoma, non-Hodgkin lymphoma, non-small cell lung cancer, oral cancer, oropharyngeal cancer, osteosarcoma / malignant fibrous histiocytoma of bone, ovarian cancer, ovarian epithelial cancer (surface epithelial-stromal tumor), ovarian germ cell tumor, ovarian low malignant potential tumor, pancreatic cancer, pancreatic cancer (islet cell), paranasal sinus and nasal cavity cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pheochromocytoma, pineal astrocytoma, pineal germinoma, pineoblastoma and supratentorial primitive neuroectodermal tumors (childhood), pituitary adenoma, plasma cell neoplasia, pleuropulmonary blastoma, primary central nervous system lymphoma, prostate cancer, rectal cancer, renal cell carcinoma (kidney cancer), renal pelvis and ureter transitional cell cancer,retinoblastoma, rhabdomyosarcoma (childhood), salivary gland cancer, sarcoma (Ewing family of tumors, Kaposi, soft tissue, uterine), Sezary syndrome, skin cancers (nonmelanoma, melanoma), skin carcinoma (Merkel cell), small cell lung cancer, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma, squamous neck cancer with occult primary (metastatic), stomach cancer, supratentorial primitive neuroectodermal tumor (childhood), T-Cell lymphoma (cutaneous), testicular cancer, throat cancer, thymoma (childhood), thymoma and thymic carcinoma, thyroid cancer, thyroid cancer (childhood), transitional cell cancer of the renal pelvis and ureter, trophoblastic tumor (gestational), unknown primary site (adult, childhood), ureter and renal pelvis transitional cell cancer, urethral cancer, uterine cancer (endometrial), uterine sarcoma, vaginal cancer, visual pathway and hypothalamic glioma (childhood), vulvar cancer, Waldenstrom macroglobulinemia, and Wilms tumor (childhood).

[0066] As used herein “control sample” or “control cell” can be procured from a healthy subject and / or a subject with cancer procured prior to the start of treatment (baseline). A control subject is a healthy subject, or a subject not receiving treatment. In some aspects, the parameters measured during treatment can be an average of several control subjects, or a population average. In some aspects, the control sample can comprise of non-cancer cells. In some aspects, the non-cancer cells can be from the same tissue type as the cancer cells. For example, if the cancer cells are from breast cancer, then the non-cancer cells can be from healthy breast tissue. In some aspects, the control can comprise of an average level of the analyte in a sample from a subject before onset of cancer. In some aspects, control sample can be a sample from the subject prior to diagnosis or treatment. In certain aspects, the analyte can be measured in a person or persons other than the subject with cancer. In some aspects, the control a person or persons with similar characteristics to the subject with cancer. In some aspects, the control can be an average of the combination of disclosed analyte levels from different healthy sources (e.g., more than one healthy control subject and / or more than one subject prior to the start of treatment (baseline)). In some aspects, the control sample can be pooled sample.

[0067] As used herein, a biological sample may be of any biological tissue, fluid, or cell from the subject. The sample can be solid or fluid. The sample can be a heterogeneous cell population. Non-limiting examples of suitable biological samples include sputum, serum, blood, blood cells (e.g., white cells), a biopsy, urine, peritoneal fluid, pleural fluid, or cells derived therefrom. The biopsy can be a fine needle aspirate biopsy, a core needle biopsy, a vacuum assisted biopsy, an open surgical biopsy, a shave biopsy, a punch biopsy, an incisional biopsy, a curettage biopsy, or a deep shave biopsy. Biological samples may also include sections of tissues, such as frozen sections or formalin fixed sections taken for histological purposes. A sample can be a tumor tissue, tissue surrounding a tumor, or non-tumor tissue. Methods of procuring a biological sample from a subject are well known in the art.Protein complex

[0068] The present disclosure encompasses a protein complex comprising Myeloid cell leukemia-1 (MCL-1) polypeptide linked to a maltose binding protein (MBP) and a BCL2 antagonist / killer (BAK) polypeptide. The complex disclosed herein may be used in identifying a modulator of BAK binding of MCL-1. Such modulators may find use in treating, preventing or reducing one or more symptoms of conditions associated with deregulation of MCL-1 , or other members of the BCL-2 family.

[0069] The MCL-1 polypeptide of the complex may comprise an amino acid sequence of any one of SEQ ID NOs: 15-16. In some aspects, the MCL-1 polypeptide comprises an amino acid sequence at least about 80% to about 85%, or about 85% to about 90%, or about 90% to about 95%, or about 95% to about 100% identical to one of the amino acid sequence of SEQ ID NOs: 15-16 or at least about 60% to about 65%, or about 65% to about 70%, or about 70% to about 75%, or about 75% to about 80% or about 80 to about 85%, or about 85% to about 90%, or about 90% to about 95%, or about 95% to about 100% identical to one or more of amino acid sequence of the SEQ ID NOs: 15-16.

[0070] The linker between the MCL-1 polypeptide and the MBP may be a rigidified linker. The rigidified linker may comprise ten, nine, eight, seven, six, five, four, three, or more preferably two amino acid residues. The rigidified linker may include arigidified GS linker. The GS linker may comprise a (GaSb)n motif. The rigidified linker of the protein complex, in one instance can comprise an amino acid sequence of II. In one aspect, the C-terminal helix of MBP may bend at the linker into the N-terminal helix of MCL-1.

[0071] The MBP may be linked to MCL-1 at the N-terminus or C-terminus of MCL-1 . In specific instance, the MBP may be linked to the MCL-1 at the N-terminus of MCL-1. The MBP of the complex may comprise an amino acid sequence at least 80% identical to the amino acid sequence of SEQ ID NO: 14. In some aspects, the MBP comprises an amino acid sequence at least about 80% to about 85%, or about 85% to about 90%, or about 90% to about 95%, or about 95% to about 100% identical to amino acid sequence of SEQ ID NO: 14 or at least about 60% to about 65%, or about 65% to about 70%, or about 70% to about 75%, or about 75% to about 80% or about 80 to about 85%, or about 85% to about 90%, or about 90% to about 95%, or about 95% to about 100% identical to amino acid sequence of SEQ ID NO: 14.

[0072] The MCL-1 polypeptide linked to the MBP in the complex may comprises an amino acid sequence at least 80% identical to the amino acid sequence of SEQ ID NO: 20. In some aspects, the MCL-1 polypeptide linked to the MBP in the complex comprises an amino acid sequence at least about 80% to about 85%, or about 85% to about 90%, or about 90% to about 95%, or about 95% to about 100% identical to the amino acid sequence of SEQ ID NO: 20 or at least about 60% to about 65%, or about 65% to about 70%, or about 70% to about 75%, or about 75% to about 80% or about 80 to about 85%, or about 85% to about 90%, or about 90% to about 95%, or about 95% to about 100% identical to the SEQ ID NO: 20.

[0073] The BAK polypeptide of the protein complex may comprise a polypeptide sequence or part thereof that is wild type BAK polypeptide or a mutant polypeptide having at least one amino acid substitution, deletion, or addition as compared to the wild type polypeptide. In certain aspects, the BAK polypeptide may comprise a G126R mutation.

[0074] The BAK polypeptide can comprise an amino acid sequence at least 80% identical to the amino acid sequence of any one of SEQ ID NOs: 1 -12 or 17-18. Insome aspects, the BAK polypeptide comprises an amino acid sequence at least about 80% to about 85%, or about 85% to about 90%, or about 90% to about 95%, or about 95% to about 100% identical to one of the amino acid sequence of SEQ ID NOs: 1 -12 or 17-18 or at least about 60% to about 65%, or about 65% to about 70%, or about 70% to about 75%, or about 75% to about 80% or about 80 to about 85%, or about 85% to about 90%, or about 90% to about 95%, or about 95% to about 100% identical to one or more of amino acid sequence of the SEQ ID NOs: 1 -12 or 17-18.

[0075] In some aspects, the one or more polypeptides in the complex disclosed herein may form a structure. For example, the BAK polypeptide of the complex may form a helix ct2. The BAK polypeptide of the complex may optionally not form a helix a3. The BAK polypeptide of the complex may further bind to specific residues and / or specific location on MCL-1. In one aspect, the BAK polypeptide may bind at the hydrophobic groove of MCL-1 . Further, the BAK polypeptide of the complex may bind at one or more residues T70, M71 , V74, L78, G82, D83, I85, Y89, and a combination thereof, of WT BAK.

[0076] The complex may further comprise an antibody, or a fragment thereof. For example, the complex may comprise an antibody, or a fragment that binds to MBP. Examples of antibody include but not limited to monoclonal antibodies, polyclonal antibodies, recombinant antibody, single domain antibodies, nanobodies, multispecific antibodies (e.g., bispecific antibodies), and antibody fragments. Examples of antibody fragments include but are not limited to Fv, Fab, Fab', Fab'-SH, F(ab')2; diabodies; linear antibodies; single-chain antibody molecules (e.g., scFv); and multispecific antibodies formed from antibody fragments. In one instance, the antibody is a Fab fragment, optionally a human Anti-E. coli MBP Recombinant Antibody Clone sAB11 M.

[0077] The protein complex may be used in a method for screening and / or identifying a modulator of BAK binding of MCL-1. Such a method may comprise contacting a test compound with the protein complex disclosed herein. Compounds may include a chemical compound, protein, small molecule, nucleotide, antibody, a therapeutic agent, or other biological inhibitor.

[0078] The protein complex of the disclosure may be expressed or incorporated in a cell. Further provided herein is one or more cells comprising the protein complex. Also provided is a mitochondrion comprising the protein complex. The cell or mitochondrion may be used in a method for screening and / or identifying a modulator of BAK binding of MCL-1. Such cell or mitochondrion may further used for predicting sensitivity of a cell or mitochondrion to a pro-apoptotic or anti-apoptotic compound. In certain aspects, the cell or mitochondrion may be isolated from a subject. The subject may be diagnosed, at risk, or suspected to have cancer. The cell or mitochondrion thereof may be a cancer cell.Methods

[0079] A method of identifying a modulator of BAK binding of MCL-1 is further provided. The method comprises contacting a test compound with an assay system. The method disclosed herein can be used for screening, identifying, and assessing activity of a test compound to modulate binding of BAK with MCL-1 .

[0080] In one instance, the assay system may comprise a fluorescently labelled maltose binding protein (MBP) linked to MCL-1 polypeptide, a BAK polypeptide and a solid substrate. The method further comprises monitoring and / or determining fluorescence. When a difference in fluorescence is determined or observed in the presence of the test compound compared to the fluorescence determined or observed in absence of the test compound, the test compound may be determined as a modulator of BAK binding of MCL-1. In certain aspect, the BAK polypeptide may further be labeled with a fluorescence label.

[0081] In another aspect, the assay system comprises an MCL-1 polypeptide linked to an MBP, a fluorescently labelled alpha helix of BH3 interactingdomain death agonist (BID) polypeptide, and a solid substrate. The method further comprises monitoring and / or determining fluorescence. When a difference in fluorescence is determined or observed in the presence of the test compound compared to the fluorescence determined or observed in absence of the test compound, the test compound may be determined as a modulator of BAK binding of MCL-1 .

[0082] Test compound may be any chemical compound, protein, small molecule, nucleotide, antibody, a therapeutic agent, or other biological inhibitor, which is tested by the methods of the disclosure and may be found to modulate BAK binding of MCL-1 , for example an inhibitor of the binding, or an activator of binding.

[0083] The MCL-1 polypeptide may be linked to the MBP through a GS linker. The linker may comprise ten, nine, eight, seven, six, five, four, three, or two amino acid residues. The GS linker may comprise a (GaSb)n motif.

[0084] The MCL-1 polypeptide of the assay system may comprise an amino acid sequence of any one of SEQ ID NOs: 15-16. In some aspects, the MCL-1 polypeptide comprises an amino acid sequence at least about 80% to about 85%, or about 85% to about 90%, or about 90% to about 95%, or about 95% to about 100% identical to one of the amino acid sequence of SEQ ID NOs: 15-16 or at least about 60% to about 65%, or about 65% to about 70%, or about 70% to about 75%, or about 75% to about 80% or about 80 to about 85%, or about 85% to about 90%, or about 90% to about 95%, or about 95% to about 100% identical to one or more of amino acid sequence of the SEQ ID NOs: 15-16.

[0085] The MBP may be linked to the MCL-1 at the N-terminus or C- terminus of the MCL-1. In specific instance, the MBP may be linked to the MCL-1 at the N-terminus of MCL-1. The MBP of the assay system may comprise an amino acid sequence at least 80% identical to the amino acid sequence of SEQ ID NO: 14. In some aspects, the MBP comprises an amino acid sequence at least about 80% to about 85%, or about 85% to about 90%, or about 90% to about 95%, or about 95% to about 100% identical to amino acid sequence of SEQ ID NO: 14 or at least about 60% to about 65%, or about 65% to about 70%, or about 70% to about 75%, or about 75% to about 80% or about 80 to about 85%, or about 85% to about 90%, or about 90% to about 95%, or about 95% to about 100% identical to amino acid sequence of SEQ ID NO: 14.

[0086] The MCL-1 polypeptide linked to the MBP in the assay system may comprises an amino acid sequence at least 80% identical to the amino acid sequence of one of SEQ ID NOs: 19 or 20. In some aspects, the MCL-1 polypeptide linked to the MBP in the complex comprises an amino acid sequence at least about 80% to about 85%, orabout 85% to about 90%, or about 90% to about 95%, or about 95% to about 100% identical to the amino acid sequence of one of SEQ ID NOs: 19 or 20 or at least about 60% to about 65%, or about 65% to about 70%, or about 70% to about 75%, or about 75% to about 80% or about 80 to about 85%, or about 85% to about 90%, or about 90% to about 95%, or about 95% to about 100% identical to one of the SEQ ID NOs: 19 or 20.

[0087] The BAK polypeptide of the assay system may comprise a polypeptide sequence or part thereof that is wild type BAK polypeptide or a mutant polypeptide having at least one amino acid substitution, deletion, or addition as compared to the wild type polypeptide. In certain aspects, the BAK polypeptide may comprise a G126R mutation.

[0088] The BAK polypeptide of the assay system may comprise an amino acid sequence at least 80% identical to the amino acid sequence of any one of SEQ ID NOs: 1-12 or 17-18. In some aspects, the BAK polypeptide comprises an amino acid sequence at least about 80% to about 85%, or about 85% to about 90%, or about 90% to about 95%, or about 95% to about 100% identical to one of the amino acid sequence of SEQ ID NOs: 1-12 or 17-18 or at least about 60% to about 65%, or about 65% to about 70%, or about 70% to about 75%, or about 75% to about 80% or about 80 to about 85%, or about 85% to about 90%, or about 90% to about 95%, or about 95% to about 100% identical to one or more of amino acid sequence of the SEQ ID NOs: 1 -12 or 17-18. In a specific aspect, the BAK polypeptide may comprise an amino acid sequence of SEQ ID NO: 1.

[0089] The BID polypeptide of the assay system may comprise an amino acid sequence at least 80% identical to the amino acid sequence of SEQ ID NO: 13. In some aspects, the BID polypeptide comprises an amino acid sequence at least about 80% to about 85%, or about 85% to about 90%, or about 90% to about 95%, or about 95% to about 100% identical to the amino acid sequence of SEQ ID NO: 13 or at least about 60% to about 65%, or about 65% to about 70%, or about 70% to about 75%, or about 75% to about 80% or about 80 to about 85%, or about 85% to about 90%, or about 90% to about 95%, or about 95% to about 100% identical to amino acid sequence of the SEQ ID NO: 13.

[0090] The fluorescence from the assay system may be determined in the presence of a detergent. Any detergent known in the art may be optimized for use with the assay system. In one instance, the detergent may be dodecylmaltoside (DDM).

[0091] The fluorescence label may be a dye, a chromogen, or a fluorophore, or a fluorescent protein. Non-limiting examples of fluorescence label include 6- carboxyfluorescein (FAM), tetrachlorofluorescein (TET), tetramethylrhodamine (TMR), hexachlorofluorescein (HEX), JOE, ROX, CAL Fluor™, Pulsar™, Quasar™, Texas Red™, Cy™3 and Cy™5. Other examples of fluorophores are provided in U.S. Patent No. 5,866,366. These include: 4-acetamido-4'- isothiocyanatostilbene-2,2'disulfonic acid, acridine and derivatives such as acridine and acridine isothiocyanate, 5-(2'- aminoethyl)amino-naphthalene-l-sulfonic acid (EDANS), 4-amino-N-[3- vinylsulfonyl)phenyl]-naphthalimide-3,5 disulfonate (Lucifer Yellow VS), N-(4-anilino-l- naphthyl)-maleimide, anthranilamide, Brilliant Yellow, coumarin and derivatives such as coumarin, 7-amino-4-methylcoumarin (AMC, Coumarin 120), 7-amino-4- trifluoromethylcouluarin (Coumaran 151 ); cyanosine; 4',6-diaminidino-2-phenylindole (DAPI); 5', 5"-dibromopyrogallol- sulfonephthalein (Bromopyrogallol Red); 7- diethylamino-3-(4'-isothiocyanatophenyl)-4- methylcoumarin; diethylenetriamine pentaacetate; 4,4'-diisothiocyanatodihydro-stilbene-2,2'- disulfonic acid; 4,4'- diisothiocyanatostilbene-2,2'-disulfonic acid; 5-[dimethyl-amino]naphthalene- 1 -sulfonyl chloride (DNS, dansyl chloride); 4-(4'-dimethyl-aminophenylazo)benzoic acid (DABCYL); 4-dimethylaminophenylazophenyl-4'-isothiocyanate (DABITC); eosin and derivatives such as eosin and eosin isothiocyanate; erythrosin and derivatives such as erythrosin B and erythrosin isothiocyanate; ethidium; fluorescein and derivatives such as 5- carboxyfluorescein (FAM), 5-(4,6-dichlorotriazin-2-yl)aminofluorescein (DTAF), 2'7'- dimethoxy-4'5'-dichloro-6-carboxyfluorescein (JOE), fluorescein, fluorescein isothiocyanate (FITC), and QFITC (XRITC); fluorescamine; IR144; IR1446; Malachite Green isothiocyanate; 4-methylumbelliferone; ortho cresolphthalein; nitrotyrosine; pararosaniline; Phenol Red; B-phycoerythrin; o-phthaldialdehyde; pyrene and derivatives such as pyrene, pyrene butyrate and succinimidyl 1 -pyrene butyrate; Reactive Red 4 (Cibacron .RTM. Brilliant Red 3B-A); rhodamine and derivatives such as 6- carboxy-X-rhodamine (ROX), 6-carboxyrhodamine (R6G), lissamine rhodamine B sulfonyl chloride, rhodamine (Rhod), rhodamine B, rhodamine 123, rhodamine X isothiocyanate, sulforhodamine B, sulforhodamine 101 and sulfonyl chloride derivative of sulforhodamine 101 (Texas Red); N,N,N',N'-tetramethyl-6-carboxyrhodamine (TAMRA); tetramethyl rhodamine; tetramethyl rhodamine isothiocyanate (TRITC); riboflavin; rosolic acid and terbium chelate derivatives, cyanine, merocyanine, stryl, and oxonyl compound, green fluorescent proteins, blue fluorescent proteins, cyan fluorescent proteins, yellow fluorescent proteins, orange fluorescent proteins, red fluorescent proteins and modified versions thereof.

[0092] In one instance, the fluorescently labelled MBP comprise a fluorophore Alexa Fluor™. In one example, the BAK is further labeled with a fluorescence label, optionally a label comprising Terbium. In another aspect, the fluorescently labelled BID polypeptide comprises a fluorescence label Fluorescein (FAM).

[0093] The solid substrate can be any solid material which can be used with the assay system disclosed herein. Examples of solid supports include, but are not limited to, beads (such as those composed of glass, metal, or plastic), tissue culture plates (such as a multi-well plate), microarray, microsphere, affinity matrices (such as an affinity column), or a capillary.

[0094] The BAK binding of MCL-1 may be determined or monitored using methods including but not limited to Microscale thermophoresis (MST), Time Resolved Fluorescence Resonance Energy Transfer (TR-FRET), fluorescence polarization, surface plasmon resonance (SPR), nuclear magnetic resonance (NMR) spectroscopy, differential scanning fluorimetry (DSF), thermal shift assay (TSA), isothermal titration calorimetry (ITC), biolayer interferometry (BLI), X-ray crystallography, DNA-Encoded Library (DEL) screens, affinity selection-mass spectrometry (AS-MS), covalent fragment screens, luciferase complementation, a yeast two-hybrid assay, an AlphaScreen, a yeast mating based interaction assay, fluorescence resonance energy transfer microscopy (FRET). In a specific aspect, the BAK binding of MCL-1 may be determined using MST, TR-FRET, and fluorescence polarization.

[0095] Further provided herein is an assay system comprising a fluorescently labelled maltose binding protein (MBP) linked to MCL-1 polypeptide, a BAK polypeptide and a solid substrate. In certain aspect, the BAK polypeptide may further be labeled with a fluorescence label. Also provided is an assay system comprising an MCL- 1 polypeptide linked to an MBP, a fluorescently labelled alpha helix of BH3 interactingdomain death agonist (BID) polypeptide, and a solid substrate.

[0096] In a specific aspect, the assay system comprises an Alexa Fluor™ MBP linked to an MCL-1 polypeptide, a BAK polypeptide, and a solid substrate. In such aspects, the fluorescence is monitored using Microscale thermophoresis.

[0097] In another aspect, the assay system comprises an Alexa Fluor™ MBP linked to an MCL-1 polypeptide, a BAK polypeptide comprising a label, and a solid substrate. The label on BAK polypeptide may comprise Terbium. In such aspects, the fluorescence is monitored using TR-FRET.

[0098] In an alternative aspect, the assay system comprises an MCL-1 polypeptide linked to an MBP, a FAM labelled alpha helix of BH3 interacting-domain death agonist (BID) polypeptide, and a solid substrate. In such aspects, the fluorescence is monitored using fluorescence polarization.

[0099] The disclosure further encompasses a cell or a part thereof expression one or more of the polypeptides of the assay system described herein. A cellbased assay in which a cell that expresses one or more of the polypeptides may be contacted with a test compound, and the ability of the test compound to modulate BAK binding of MCL-1 may be determined.

[0100] The cell may be a mammalian cell, an insect cell, a murine cell, a bacterial cell, a viral cell, or a fungal cell. The cell may be a cancer cell line, such as a monocytic leukemia-derived cell line, mast cell type-derived cell line, liver cancer- derived cell line, neuroblastoma cell-derived cell line, or a breast cancer-derived cell line. A cell may be a human cell. Human cancer cell lines include brain, breast, colon, head and neck, kidney, leukemia, liver, lung, metastatic lines, melanoma, lymphoma, and prostate. The cancer cells may be tumor cells from cell lines, such as the cell lines listed hereafter: BT20, Caki-2, HT29, SK-OV-3, 769-P, 786-0, COV504, MCF-7, MDA-MB-231 ,MDA-MB-468, NB4, BLM, Hs895.T, HCT116, HeLa, K562, SW480, RAJI, RKO, lgR39D, HAP-1 , OVCAR-3, MZ1851 RC, NCI-60, SK-BR-3, which are well known in the art. In some exemplary aspects, the cell lines are ovarian cancer cell lines including but not limited to A2780, OVCAR-3, OV-90, COV504, CAOV-3 and / or SK-OV-3. Tumor cell lines may easily be obtained from the American Type Culture Collection (ATCC, Manassas, Virginia) and the like. In another instance, the cancer cell may be obtained from a subject diagnosed, suspected, or at risk of cancer.

[0101] Methods for engineering cells to express one or more polypeptides disclosed herein, are well known in the art. Cells can be transformed using any known method in the art. For example, polynucleotide encoding the nucleic acid sequence of the polypeptide such as a plasmid vector, a viral vector, or a transposon may be used to transform cells to express one or more of the polypeptides of the assay system. Vectors can include but not limited to, plasmids, transposons, cosmids, chromosomes, artificial chromosomes, viruses, virions, and the like. A vector may also be a chemical vector, such as a lipid complex or naked DNA. "Naked DNA” or "naked nucleic acid” refers to a nucleic acid molecule that is not contained in encapsulating means that facilitates delivery of a nucleic acid into the cytoplasm of a target host cell. Naked DNA may be circular or linear (linearized DNA sequence). Optionally, a naked nucleic acid can be associated with standard means used in the art for facilitating its delivery of the nucleic acid to the target cell, for example to facilitate the transport of the nucleic acid through the cell membrane. Non-viral methods may also be used, such as transfections. Engineered cells may thus also be "stably transfected cells" or "transiently transfected cells". Transfection refers to non-viral methods to transfer DNA (or RNA) to cells such that a gene is expressed. Transfection methods are widely known in the art, such as calcium phosphate transfection, PEG transfection, and liposomal or lipoplex transfection of nucleic acids. Such a transfection may be transient but may also be a stable transfection wherein cells can be selected to have the gene construct integrated in their genome. In some cases, genetic engineering systems such as CRISPR or Argonaute may be utilized to design engineered cells that express a polypeptide described herein. Transformed cells may beselected by phenotype determined by a selectable marker, commonly drug resistance or the ability to grow in the absence of a particular nutrient (e.g., leucine).

[0102] An isolated mitochondrion expressing one or more polypeptides of the assay system is further provided. Mitochondrion may be isolated from cells expressing one or more polypeptides of the assay system described herein. The mitochondria according to the disclosure may be obtained by methods known in the art. Commercially available mitochondria isolation kits include, for example, Mitochondria Isolation Kit, MITOISO1 (Sigma-Aldrich), among others. % According to one aspect, the mitochondria are derived from a mammalian cell. The mammalian cell is a human cell. In other aspects, the mitochondria are derived from cells in culture. The cells may be a cell line such as a cancer cell line, or may be isolated from a subject diagnosed, suspected or at risk of cancer. According to another aspect, the mitochondria are derived from a tissue.

[0103] The disclosure further encompasses a liposome encapsulating one or more polypeptides of the assay system. The polypeptide may be encapsulated in the aqueous interior of a liposome, interspersed within the lipid bilayer of a liposome, attached to a liposome via a linking molecule that is associated with both the liposome and the polypeptide, entrapped in a liposome, complexed with a liposome, dispersed in a solution containing a lipid, mixed with a lipid, combined with a lipid, contained as a suspension in a lipid, contained or complexed with a micelle, or otherwise associated with a lipid. Lipid or lipid / polypeptide associated compositions are not limited to any particular structure in solution. For example, they may be present in a bilayer structure, as micelles, or with a “collapsed” structure. They may also simply be interspersed in a solution, possibly forming aggregates that are not uniform in size or shape. Lipids are fatty substances which may be naturally occurring or synthetic lipids. For example, lipids include the fatty droplets that naturally occur in the cytoplasm as well as the class of compounds which contain long- chain aliphatic hydrocarbons and their derivatives, such as fatty acids, alcohols, amines, amino alcohols, and aldehydes. Lipids suitable for use can be obtained from commercial sources. For example, dimyristyl phosphatidylcholine (“DMPC”) can be obtained from Sigma, dicetyl phosphate (“DCP”) can be obtained from K & K Laboratories; cholesterol(“Choi”) can be obtained from Calbiochem-Behring; dimyristyl phosphatidylglycerol (“DMPG”) and other lipids may be obtained from Avanti Polar Lipids, Inc.

[0104] In some aspects, the liposomes described herein may have different sizes, lamellarity and structure. In some aspects, the liposomes herein have an average diameter of about 50 nm to about 500 nm. In some aspects, the liposomes have a diameter of about 50 nm, about 75 nm, about 100 nm, about 125 nm, about 150 nm, about 175 nm, about 200 nm, about 225 nm, about 250 nm, about 275 nm, about 300 nm, about 325 nm, about 350 nm, about 375 nm, about 400 nm, about 425 nm, about 450 nm, about 475 nm, or about 500 nm. In some aspect, liposome has diameter of about 200 nm. The mean diameter of liposomes can be measured using techniques known in the art such as transmission electron microscopy.

[0105] In some aspects, the lipid mixture forming the liposome can be selected to achieve a specified degree of fluidity or rigidity, to control the stability of the liposome in serum and to control the rate of release of the entrapped agent in the liposome.

[0106] In some aspects, the liposomes herein comprise a lipid that may be of natural source, semi-synthetic or fully synthetic lipid, and neutral, negatively or positively charged. In some aspects, the synthetic vesicle-forming lipids and naturally- occurring vesicle-forming lipids, include the phospholipids (for e.g., egg phophatidylcholine (EPC), 1 -palm itoyl-2 -oleoylphosphatidyl choline (POPC), distearoylphosphatidylcholine (DSPC) or hydrogenated soy phosphatidylcholine (HSPC)), such as phosphatidylcholine (PC), phosphatidylinositol (PI), phosphatidylglycerol (PG), dimyristoyl phosphatidylglycerol (DMPG); egg yolk phosphatidylcholine (EPC), 1 -palm itoyl-2 -oleoylphosphatidyl choline (POPC), distearoylphosphatidylcholine (DSPC), dimyristoyl phosphatidylcholine (DMPC); phosphatidic acid (PA), phosphatidylserine (PS) 1 -palmitoyl-2-oleoylphosphatidyl choline (POPC), and the sphingophospholipids such as sphingomyelins (SM) having 12-24 carbon atom acyl or alkyl chains. The above-described lipids and phospholipids whose hydrocarbon chain (acyl / alkyl / alkenyl chains) have varying degrees of saturation can be obtained commercially or prepared according to published methods. Other suitable lipidsincluded in the liposomes are glyceroglycolipids and sphingoglycolipids and sterols (such as cholesterol or plant sterol).

[0107] In some aspects, liposomes disclosed herein may comprise neutral, and / or anionic lipids. Non-limiting examples of neutral or anionic lipids may be selected from sterols or lipids such as cholesterol, phospholipids, lysolipids, lysophospholipids, sphingolipids or pegylated lipids with a neutral or negative net charge. In certain aspects, neutral and anionic lipids include: phosphatidylserine, phosphatidylglycerol, phosphatidylinositol (not limited to a specific sugar), fatty acids, sterols, containing a carboxylic acid group for example, cholesterol, 1 ,2-diacyl-sn-glycero-3- phosphoethanolamines, including, but not limited to, 1 ,2-dioleylphosphoethanolamine (DOPE), 1 ,2-dihexadecylphosphoethanolamine (DHPE), 1 ,2-diacyl-glycero-3- phosphocholines, including, but not limited to 1 ,2-distearylphosphatidylcholine (DSPC), 1 ,2-dipalmitylphosphatidylcholine (DPPC), 1 ,2-dimyristylphosphosphatidylcholine (DMPC), phosphatidylcholine preferably egg PC, soy PC, sphingomyelin, or any combination thereof.

[0108] In some aspects, liposomes herein, may comprise cationic lipids (mono and polycationic), where the cationic lipid may be included as a minor component of the lipid composition or as a major or sole component. In such aspects, cationic lipids may have a lipophilic moiety, such as a sterol, an acyl or diacyl chain, and where the lipid has an overall net positive charge. In some aspects, the head group of the lipid may carry the positive charge. Non-limiting examples of monocationic lipids may for use in liposomes described herein include, 1 ,2-dimyristoyl-3-trimethylammonium propane (DMTAP) 1 ,2-dioleyloxy-3-(trimethylamino)propane (DOTAP); N-[1 -(2,3,- ditetradecyloxy)propyl]-N,N-dimeth-yl-N-hydroxyethylammonium bromide (DMRIE); N- [1 -(2,3,-dioleyloxy)propyl]-N,N-dimethyl-N-hydroxy ethyl-ammonium bromide (DORIE); N-[1 -(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA); 3[3[N — (N',N'- dimethylaminoethane)carbamoly]cholesterol (DC-Chol); and dimethyldioctadecylammonium (DDAB).

[0109] In some aspects, polycationic lipids include a similar lipophilic moiety as with the mono cationic lipids, to which polycationic moiety is attached. Exemplarypolycationic moieties include spermine or spermidine (as exemplified by DOSPA and DOSPER), or a peptide, such as polylysine or other polyamine lipids. In some aspects, the neutral lipid (DOPE) can be derivatized with polylysine to form a cationic lipid, polycationic lipids include, without being limited thereto, N-[2-[[2,5-bis[3- aminopropyl)amino]-1-oxopentyl]amino]ethyl]-N,N-dimethyl-2,3-bis[(1 -oxo-9- octadecenyl)oxy]-1-propanaminium (DOSPA), and ceramide carbamoyl spermine (CCS).

[0110] In some aspects, the liposomes may include a lipid derivatized with a hydrophilic polymer (for e.g., lipopolymers). In some aspects, lipopolymers comprise lipids modified at their head group with a polymer. The attachment of the hydrophilic polymer head group to the lipid region may be a covalent or non-covalent attachment, however, is preferably via the formation of a covalent bond (optionally via a linker). The outermost surface coating of hydrophilic polymer chains is effective to provide a liposome with a long blood circulation lifetime in vivo. In some aspects, the lipopolymer may be introduced into the liposome by adding the lipopolymer to a lipid mixture forming the liposome. The lipopolymer will be incorporated and exposed at the inner and outer leaflets of the liposome bilayer. In some aspects, the lipopolymer may be introduced into the liposome by incorporating the lipopolymers to the external leaflet of the pre-formed liposome either by incubation at temperature above the Tm of the lipopolymer and liposome-forming lipids, or by short term exposure to microwave irradiation. Non limiting examples of%polymers used as lipid modifiers include, polyethylene glycol (PEG), polysialic acid, polylactic (also termed polylactide), polyglycolic acid (also termed polyglycolide), apolylactic-polyglycolic acid, polyvinyl alcohol, polyvinylpyrrolidone, polymethoxazoline, polyethyloxazoline, polyhydroxyethyloxazoline, polyhydroxypropyloxazoline, polyaspartamide, polyhydroxypropyl methacrylamide, polymethacrylamide, polydimethylacrylamide, polyvinylmethylether, polyhydroxyethyl acrylate, derivatized celluloses such as hydroxymethylcellulose or hydroxyethylcellulose. The polymers may be used as homopolymers or as block or random copolymers.

[0111] In some aspects, liposomes disclosed herein phosphatidyl ethanolamine (PE). In some aspects, the liposomes disclosed herein comprise distearylphosphatidylethanolamine (DSPE). In some aspects, the disclosed comprisePEG attached to DSPE. In some aspects, the PEG polymer is linked to the lipid via a carbamate linkage. In some aspects, different lengths of PEG chains can be employed. In some aspects, the PEG has a molecular weight of from about 750 Daltons to about 20,000 Daltons. In some aspects, the molecular weight is from about 750 Daltons to about 12,000 Daltons and some aspect between about 1 ,000 Daltons to about 5,000 Daltons. In some aspects, PEG, has a molecular weight between 500-10,000 Daltons, between 750-10,000 daltons, between 750-5000 daltons. In some aspects, the PEG is Methoxy or ethoxy-capped analogues of PEG. In some aspects, PEG is commercially available PEG in a variety of polymer sizes, e.g., 120-20,000 Daltons. In some aspects, PEG-DSPE employed herein comprise PEG with a molecular weight of 2000 Da.

[0112] In some aspects, the PEG chains can be functionalized to comprise reactive groups suitable for coupling with, for example, sulfhydryls, amino groups, and aldehydes or ketones present in a wide variety of ligands. Examples of such PEG-terminal reactive groups include maleimide (for reaction with sulfhydryl groups), N- hydroxysuccinimide (NHS) or NHS-carbonate ester (for reaction with primary amines), hydrazide or hydrazine (for reaction with aldehydes or ketones), iodoacetyl (preferentially reactive with sulfhydryl groups) and dithiopyridine (thiol-reactive).

[0113] It will be appreciated that any of the hydrophilic polymers recited above in combination with any of the vesicle-forming lipids recited above can be employed as modifying agents to prepare the lipid-polymer-ligand targeting conjugate and suitable reaction sequences for any selected polymer can be determined by those of skill in the art.

[0114] The methods for preparation of liposomes can include thin-film hydration method, ethanol injection method, reverse-phase evaporation method and double emulsion method. In some aspects, the disclosed liposome are prepared using thin-film hydration method. Briefly, thin-film hydration method involves dissolving phospholipids in an organic solvent, making a thin lipid film in a container (for example, round-bottom flask) by the removal of organic solvent, by evaporating to dryness. Dispersion medium is added, and the mixture may be optionally heated to above the phase transition temperature, and agitated which results in the formation ofheterogeneous liposomes. The method can further comprise extrusion through polycarbonate membranes, to obtain homogeneous liposomes.

[0115] In some aspects, liposome are prepared using a continuous method for preparation of liposomes from a starting suspension or solution comprising lipids, and dehydrating said liposomes by spray-drying or spray-freeze-drying, whereby the method comprises extruding a suspension or solution comprising lipids through a porous device and subsequently passing the suspension or solution through a nozzle, whereby the suspension is atomized to form droplets.Inducible assay system

[0116] Further disclosed herein is an assay system comprising a cell expressing a labeled MCL-1 polypeptide, a labeled BAK polypeptide, and a solid substrate. The expression of MCL-1 polypeptide or BAK polypeptide may be inducible. Alternatively, the expression of MCL-1 polypeptide or BAK polypeptide may be constitutive. Such systems may be used for identifying a modulator of BAK binding of MCL-1.

[0117] In one instance, the MCL-1 or BAK polypeptide may be expressed constitutively in the cell. The MCL-1 or BAK polypeptide may be expressed in a cell using a constitutively active promoter. Examples of constitutive eukaryotic promoters include but not limited to the promoter of the Cytomegalovirus (CMV), mouse metallothionein I gene, TK promoter of herpes virus, SV40, CAG promoter, 35S, ubiquitin, T7, and Sp6.

[0118] In another instance, the expression of MCL-1 or BAK polypeptide may be inducible. The MCL-1 or BAK polypeptide may be expressed in a cell using an inducible promoter. Inducible promoters can be triggered by a variety of factors including chemical agents, temperature, or light. Examples of inducible promoters include, but not limited to lsopropyl-[3-D-thiogalactoside (IPTG), WY195, GAL1 , MET25, CUP1 , Hsp70, Hsp90, lacZ, Tetracycline (Tet), Doxycycline (Dox), glaA, and Lac operon. In one example, the inducible promoter is a Tet promoter and / or a Dox promoter.

[0119] In a specific aspect, the MCL-1 polypeptide may be expressed in the cell constitutively. In a further aspect, the expression of BAK1 polypeptide may beinducible. For example, the expression of BAK polypeptide may be inducible by tetracycline or doxycycline.

[0120] The MCL-1 or BAK polypeptide of the assay system may be labeled. The fluorescence label may be a dye, a chromogen, or a fluorophore, or a fluorescent protein. Non-limiting examples of fluorescence label include 6-carboxyfluorescein (FAM), tetrachlorofluorescein (TET), tetramethylrhodamine (TMR), hexachlorofluorescein (HEX), JOE, ROX, CAL Fluor™, Pulsar™, Quasar™, Texas Red™, Cy™3 and Cy™5. Other examples of fluorophores are provided in U.S. Patent No. 5,866,366. These include: 4- acetamido-4'- isothiocyanatostilbene-2,2'disulfonic acid, acridine and derivatives such as acridine and acridine isothiocyanate, 5-(2'-aminoethyl)amino-naphthalene-l -sulfonic acid (EDANS), 4-amino-N-[3- vinylsulfonyl)phenyl]-naphthalimide-3,5 disulfonate (Lucifer Yellow VS), N-(4-anilino-l- naphthyl)-maleimide, anthranilamide, Brilliant Yellow, coumarin and derivatives such as coumarin, 7-amino-4-methylcoumarin (AMC, Coumarin 120), 7-amino-4-trifluoromethylcouluarin (Coumaran 151 ); cyanosine; 4',6-diaminidino-2- phenylindole (DAPI); 5', 5"-dibromopyrogallol- sulfonephthalein (Bromopyrogallol Red); 7-diethylamino-3-(4'-isothiocyanatophenyl)-4- methylcoumarin; diethylenetriamine pentaacetate; 4,4'-diisothiocyanatodihydro-stilbene-2,2'- disulfonic acid; 4,4'- diisothiocyanatostilbene-2,2'-disulfonic acid; 5-[dimethyl-amino]naphthalene- 1 -sulfonyl chloride (DNS, dansyl chloride); 4-(4'-dimethyl-aminophenylazo)benzoic acid (DABCYL); 4-dimethylaminophenylazophenyl-4'-isothiocyanate (DABITC); eosin and derivatives such as eosin and eosin isothiocyanate; erythrosin and derivatives such as erythrosin B and erythrosin isothiocyanate; ethidium; fluorescein and derivatives such as 5- carboxyfluorescein (FAM), 5-(4,6-dichlorotriazin-2-yl)aminofluorescein (DTAF), 2'7'- dimethoxy-4'5'-dichloro-6- carboxyfluorescein (JOE), fluorescein, fluorescein isothiocyanate (FITC), and QFITC (XRITC); fluorescamine; IR144; IR1446; Malachite Green isothiocyanate; 4-methylumbelliferone; ortho cresolphthalein; nitrotyrosine; pararosaniline; Phenol Red; B-phycoerythrin; o-phthaldialdehyde; pyrene and derivatives such as pyrene, pyrene butyrate and succinimidyl 1 -pyrene butyrate; Reactive Red 4 (Cibacron .RTM. Brilliant Red 3B-A); rhodamine and derivatives such as 6- carboxy-X- rhodamine (ROX), 6-carboxyrhodamine (R6G), lissamine rhodamine B sulfonyl chloride,rhodamine (Rhod), rhodamine B, rhodamine 123, rhodamine X isothiocyanate, sulforhodamine B, sulforhodamine 101 and sulfonyl chloride derivative of sulforhodamine 101 (Texas Red); N,N,N',N'-tetramethyl-6-carboxyrhodamine (TAMRA); tetramethyl rhodamine; tetramethyl rhodamine isothiocyanate (TRITC); riboflavin; rosolic acid and terbium chelate derivatives, cyanine, merocyanine, stryl, and oxonyl compound, green fluorescent proteins, blue fluorescent proteins, cyan fluorescent proteins, yellow fluorescent proteins, orange fluorescent proteins, red fluorescent proteins and modified versions thereof. In one aspect, the MCL-1 polypeptide is labeled using a cerulean label. In another aspect, the BAK polypeptide is labeled using a mCherry label.

[0121] The MCL-1 polypeptide of the inducible assay system may comprise an amino acid sequence of any one of SEQ ID NOs: 15-16. In some aspects, the MCL-1 polypeptide comprises an amino acid sequence at least about 80% to about 85%, or about 85% to about 90%, or about 90% to about 95%, or about 95% to about 100% identical to one of the amino acid sequence of SEQ ID NOs: 15-16 or at least about 60% to about 65%, or about 65% to about 70%, or about 70% to about 75%, or about 75% to about 80% or about 80 to about 85%, or about 85% to about 90%, or about 90% to about 95%, or about 95% to about 100% identical to one or more of amino acid sequence of the SEQ ID NOs: 15-16.

[0122] The BAK polypeptide of the inducible assay system may comprise an amino acid sequence at least 80% identical to the amino acid sequence of any one of SEQ ID NOs: 1-12 or 17-18. In some aspects, the BAK polypeptide comprises an amino acid sequence at least about 80% to about 85%, or about 85% to about 90%, or about 90% to about 95%, or about 95% to about 100% identical to one of the amino acid sequence of SEQ ID NOs: 1-12 or 17-18 or at least about 60% to about 65%, or about 65% to about 70%, or about 70% to about 75%, or about 75% to about 80% or about 80 to about 85%, or about 85% to about 90%, or about 90% to about 95%, or about 95% to about 100% identical to one or more of amino acid sequence of the SEQ ID NOs: 1-12 or 17-18. In a specific aspect, the BAK polypeptide may comprise an amino acid sequence of SEQ ID NO: 1.

[0123] The solid substrate can be any solid material which can be used with the assay system disclosed herein. Examples of solid supports include, but are not limited to, beads (such as those composed of glass, metal, or plastic), tissue culture plates (such as a multi-well plate), microarray, microsphere, affinity matrices (such as an affinity column), or a capillary.

[0124] The cell of the inducible assay system may be a mammalian cell, an insect cell, a murine cell, a bacterial cell, a viral cell, or a fungal cell. The cell may be a cancer cell line, such as a monocytic leukemia-derived cell line, mast cell type- derived cell line, liver cancer-derived cell line, neuroblastoma cell-derived cell line, or a breast cancer-derived cell line. A cell may be a human cell. Human cancer cell lines include brain, breast, colon, head and neck, kidney, leukemia, liver, lung, metastatic lines, melanoma, lymphoma, and prostate. The cancer cells may be tumor cells from cell lines, such as the cell lines listed hereafter: BT20, Caki-2, HT29, SK-OV-3, 769-P, 786-0, COV504, MCF-7, MDA-MB-231 , MDA-MB-468, NB4, BLM, Hs895.T, HCT116, HeLa, K562, SW480, RAJI, RKO, lgR39D, HAP-1 , OVCAR-3, MZ1851 RC, NCI-60, SK-BR-3, which are well known in the art. In some exemplary aspects, the cell lines are ovarian cancer cell lines including but not limited to A2780, OVCAR-3, OV-90, COV504, CAOV- 3 and / or SK-OV-3. Tumor cell lines may easily be obtained from the American Type Culture Collection (ATCC, Manassas, Virginia) and the like. In another instance, the cancer cell may be obtained from a subject diagnosed, suspected, or at risk of cancer.

[0125] Further, the cell of the inducible assay system may be engineered to not express one or more endogenous BCL2 proteins. Engineering cells to reduce or knock out one or more endogenous genes are well known in the art.

[0126] The inducible assay system may be used in a method of identifying a modulator of BAK binding of MCL-1. The method may comprise contacting a test compound with the assay system, and monitoring cell death and / or mitochondrial membrane permeabilization. The test compound may be identified as a modulator of BAK binding of MCL-1 when a difference in cell death and / or mitochondrial membrane permeabilization is determined in the presence of the test compound compared to the cell death determined in absence of the test compound.

[0127] Cell death can be monitored using any known method in the art. For example, cell death may be monitored using staining (for example annexin A5 and propidium iodide or 7-aminoactinomycin), flow cytometry, raman spectroscopy, intracellular protein release, mitochondrial dehydrogenase, mitochondrial membrane potential, cell viability tests, measuring protein synthesis, measuring unscheduled DNA synthesis, measuring DNA damage, measuring cytosolic free Ca2+ levels, and measuring the activities of proteases such as calpains and caspases, and dye release. In one aspect, the cell death may be monitored using a dye release. In such aspect, the dye may be SYTOX Green. Cell viability may be measured, e.g., by determining in a cell the uptake of a dye such as neutral red, trypan blue, Crystal Violet, or ALAMAR™ blue. In such an assay, the cells are incubated in media containing the dye, the cells are washed, and the remaining dye, reflecting cellular uptake of the dye, is measured spectrophotometrically. Cell viability may also be measured, e.g., by quantifying ATP, an indicator of metabolically active cells.

[0128] Cell death or apoptosis may also be monitored by measuring activity of caspase-3 and caspase-7, for example using caspase- gio 3 / 7 assay. The assay provides a luminogenic caspase-3 / 7 substrate in a reagent optimized for caspase activity, luciferase activity, and cell lysis. In some aspects, adding Caspase-Glo(R) 3 / 7 Reagent in an “add-mix-measure” format may result in cell lysis, followed by caspase cleavage of the substrate and generation of a “glow-type” luminescent signal, produced by luciferase. The luminescence may be proportional to the amount of caspase activity present, and may serve as an indicator of apoptosis. Other morphological changes that can be measured to determine apoptosis include, e.g., cytoplasmic condensation, increased membrane blebbing, and cellular shrinkage.

[0129] Mitochondrial membrane permeabilization can be monitored using any known method in the art. For example, lipophilic cationic fluorescent dyes can be used to measure membrane potential in live cells. Fluorescence imaging and flow cytometry are examples of fluorescence techniques that can be used to measure changes in mitochondrial membrane potential. Other methods include mechanical or detergentbased fractionation to identify proteins released from the intermembrane space. In aspecific aspect, mitochondrial membrane permeabilization is monitored by determining the presence of cytochrome c by immunoblotting.

[0130] In one instance, the method of identifying a modulator of BAK binding of MCL-1 may use live-cell fluorescence resonance energy transfer (FRET). In such aspects, the method may comprise contacting a test compound with the assay system disclosed herein and monitoring the formation or neutralization of MCL-1 :BAK complex using live-cell fluorescence FRET. The modulator may be identified by monitoring the changes in FRET signal in the presence of a test compound compared to the FRET signal in the absence of the test compound. The FRET signal may comprise fluorescence from the donor, for example Cerulean labeled MCL-1 , the acceptor, for example, mCherry labeled BAK. The FRET signal may increase, decrease, or remain the same in the presence of the test compound. For example, a decrease in the FRET signal may indicate the presence of an inhibitor of MCL-1 .

[0131] The FRET signal measurements may be performed using a fluorescence microscope, such as confocal fluorescence microscope. The acceptor and donor may be any substance as long as the emission spectrum of the fluorescence donor and the absorption spectrum of the fluorescence acceptor overlap each other to cause FRET or fluorescence reduction. Therefore, as the fluorescence donor, fluorescent proteins and fluorescent dyes of various wavelengths, bioluminescent proteins, quantum dots, and the like may be used, and as the fluorescence acceptor, fluorescent proteins, fluorescent dyes, quantum dots, and the like, having different wavelengths from that of the fluorescent donor, may be used. Considering properties of the fluorescence donor and the fluorescence acceptor such as the extinction coefficient, quantum efficiency, photostability, and convenience of use, fluorescent proteins, e.g., enhanced cyan fluorescence protein (ECFP) and enhanced yellow fluorescent protein (EYFP), may be used in the FRET.

[0132] Further disclosed is a mitochondrion isolated from the cell of the inducible assay system. The mitochondria according to the disclosure may be obtained by methods known in the art. Commercially available mitochondria isolation kits include, for example, Mitochondria Isolation Kit, MITOISO1 (Sigma-Aldrich), among others. Theisolated mitochondria may be used in method of identifying a modulator of BAK binding of MCL-1 . The method may comprise contacting a test compound with the assay system, and monitoring cell death and / or mitochondrial membrane permeabilization. The test compound may be identified as a modulator of BAK binding of MCL-1 when a difference in cell death and / or mitochondrial membrane permeabilization is determined in the presence of the test compound compared to the cell death determined in absence of the test compound.

[0133] One or more of the assays systems or protein complexes disclosed herein can be used to assess or determ ine the on-target efficacy of a new drug or a known drug. The assay systems or protein complex disclosed herein can further assess or determine the use of the drug in modulating the MCL-1 :BAK complex, which is a major cancer drug target. The assay systems or protein complex can be used to assess or determine the efficacy in neutralizing the MCL-1 : BAK complex or determine the dosage to initiate apoptosis. The assay systems or protein complex may further be used to determine toxicity of a known drug or a new drug.

[0134] Further disclosed herein is a method of identifying a modulator of BAK binding of MCL-1 using proteolysis by calpain. The method may comprise contacting a test compound with the mitochondrion or cell disclosed herein and monitoring conformational changes using proteolysis by calpain. The test compound may be identified as a modulator of BAK binding of MCL-1 by determining the presence of one or more cleaved fragments in the presence of the test compound compared to the cleaved fragments determined in absence of the test compound. The cleaved fragments are determined using immunoblotting. The method may further comprise contacting the mitochondrion or cells disclosed herein with a cysteine-directed crosslinking agent. In one example, the cysteine-directed crosslinking agent is bismaleimidohexane (BMH). The method may further comprise determining the presence of one or more monomers or oligomers. In such instance, the test compound may be identified as a modulator of BAK binding of MCL-1 by determining the presence of one or more monomers or oligomers in the presence of the test compound compared to the monomers or oligomers determinedin absence of the test compound. The one or more monomers or oligomers are determined using immunoblotting.

[0135] Immunoblotting disclosed herein may be performed using anti-BAK antibody, such as an anti-BAK antibody which recognizes residues surrounding Gly82 of human BAK.Method of treatment

[0136] The disclosure further encompasses a method of treating a condition in a subject in need thereof, with the drugs or compounds identified using the protein complex or assay systems disclosed herein. The condition may include but not limited to cancer, autoimmune disease, cellular loss, and neurodegeneration. The method can comprise administering to the subject an amount of a compound that modulates the BAK binding of MCL-1 . The subjects may be administered additional treatment in combination with the drugs or compounds.

[0137] In further aspects, a method for treating a condition in a subject in need thereof comprises treating the cells in the sample obtained from the subject with a modulator identified using the protein complex or assay systems disclosed herein, and determining if the treatment results in one or more symptoms associated with the condition. Such a method could be useful for identifying and / or selecting a subject for a treatment using a compound that modulates the BAK binding of MCL-1 .Drug development

[0138] The protein complex may further be used for development and identification of compounds which are capable of modulating BAK binding of MCL-1 . The active sites of the protein complex can be used, for example, in a three-dimensional computer-generated interaction template of BAK. This can be generated by one of ordinary skill in the art and used to design activators and inhibitors specific for the BAK active site. In another aspect, one of ordinary skill in the art can apply the BAK active site to identify corresponding active sites in other BCL-2 family members. This information may then be used to identify / develop compounds capable of modulating the other BCL-2 family polypeptides.

[0139] In a further aspect, potential modulators that can be analyzed according to the methods, assay systems and protein complex of the invention can be obtained using any of the numerous approaches in combinatorial library methods known in the art. In one aspect, potential modulators are first identified for pro-apoptotic or anti- apoptotic activity using the in vitro assays described herein or known in the art. Once potential modulators are identified, and their structures determined, further optimization can be carried out by methods, assay systems and protein complex described herein. Kits

[0140] Also provided here are kits comprising protein complex and / or one or more assay systems. The kits can further comprise instructions on carrying out one or more methods disclosed herein.EXAMPLES

[0141] The following examples are included to demonstrate various embodiments of the present disclosure. It should be appreciated by those of skill in the art that the techniques disclosed in the examples that follow represent techniques discovered by the inventors to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.Materials and MethodsCloning of constructs for protein expression in E. coli and mutagenesis

[0142] The gene block coding for the fusion of MBP to the residues 171 -321 of human MCL-1 , previously designed for co-crystallography of MCL-1 bound to drugs was purchased from IDT and it was PCR amplified and cloned by ligation independent cloning (LIC) in the pGTLV2-Kan plasmid. Similarly, the DNA coding for residues 22-186 of human BAK was PCR amplified from a previously cloned Moldoveanu lab WT BAK construct for pGTLV2-Kan LIC. The DNA coding for the fusion of SUMO to the residues171-321 of human MCL-1 was PCR amplified for infusion cloning in the pET28b-kan vector. Previously cloned constructs included pRL574-Amp MEAS-BAK-ATM-His6, pRL296-Amp GST-MEAS-BAK, and RH2.2-Amp Sab11 M antibody fragment targeting MBP.

[0143] The Quikchange II XL mutagenesis kit (Agilent) was used to mutate MCL-1 and BAK as follows. For cryo-EM, the GS linker in MBP-GS-MCL-1 was mutated to II, and C258A and V321 C in MCL-1 (human MCL-1 numbering). The latter mutation was installed to enable cysteine-mediated crosslinking to free cysteines installed in BAK, although this strategy was eventually abandoned yet V321 C was kept in the final construct. For NMR spectroscopy the MCL-1 constructs was mutated at C258A while for NMR spectroscropy and X-ray crystallography the BAK construct was mutated at G126R, respectively. For TR-FRET analysis the GST-BAK WT construct was mutated as V74A / G126R and M71A / G126R (human BAK numbering).Protein expression and purification

[0144] All MCL-1 and BAK E. coli expressed proteins were produced in T7 Express or T7 Express lysY / lq E. coli cells (New England Biolabs). The Sabi 1 M antibody fragment which was produced in BL21 E. coli (New England Biolabs). MCL-1 and BAK- expressing bacteria were grown to OD 0.8-1.0 in Luria-Bertani medium with appropriate antibiotic at 37 °C before induction of protein expression with 100 mg / L IPTG at 21 °C O / N. In the morning, bacteria were harvested by centrifugation 20 min at 4000 x g in a floor centrifuge (Beckman JXN26 with J-Lite JLA-8.1000 rotor or ThermoFisher Sorval LYNX 6000 with Fiberlite F9-6x1000 LEX carbon fiber rotor). The bacterial pellets were resuspended in Ni2+- affinity resin running buffer (buffer N, 50 mM TRIS pH 7.6, 250 mM NaCI, 5 mM imidazole). All proteins were soluble in the bacterial cytosol and to access them the bacterial pellets were lysed in an Avestin EmulsiFlex-C3 cell homogenizer or a Branson Ultrasonics SFX250 Sonifier cell disruptor followed by centrifugation at 35000 x g in a floor centrifuge to separate the membrane debris pellet from the supernatant, which was subsequently used for protein purification

[0145] All MCL-1 and BAK proteins were initially batch-affinity purified on Ni2+- nitrilotriacetic acid (NTA) affinity resin (Goldbio), eluted with 250 mM imidazole inbuffer N, followed by size exclusion (S75, S100, S200 GL or HR columns) and a NaCI gradient-based ion exchange (SP FF, Q FF columns) fast protein liquid chromatrography (FPLC on Cytiva AKTA Pure). When the affinity purification tags needed to be removed the proteolytic digestion of the tag [e.g. with tobacco etch virus (TEV) protease or ubiquitin-like-specific protease 1 (ULP1 ) SUMO protease] was performed after the Ni2+- NTA affinity purification step. Sabi 1 M was purified by first heating the lysate supernatant for 30 min at 60 °C followed by centrifugation at 35000 x g in a floor centrifuge. The supernatant was loaded onto captoL batch chromatography (Cytiva) and the protein was eluted with 0.1 M acetic acid, followed by a NaCI gradient-based cation exchange chromatography on SP FF column in sodium acetate buffer (Cytiva). All proteins were buffer exchanged to 20 mM HEPES pH 7.0, 150 mM NaCI by three consecutive centrifugation and dilution steps in Am icon centricon concentrators (Millipore), their concentration was determined, and they were flash frozen in liquid nitrogen for storage until used for downstream experiments.Peptide synthesis

[0146] The BH3 peptides used in this study were produced at the Peptide Synthesis Facility at the St. Jude Hartwell Center for Biotechnology (Memphis, USA) and Biomatik (Ontario, Canada) by FMOC-based synthesis. All unstapled BH3 peptides were N-terminal acetylated and C-terminal amidated. The BID BH3 stabilized alpha helix of a BCL-2 protein (SAHB)-fluoresceine (SAHB-FAM) was N-terminally acetylated and C- terminally derivatized with ethylene diamine 5’ 6-fluorescein phosphoramidite (FAM, *) (EDIIRNIARHLAXVGDXBDRSI* (SEQ ID NO: 29); X, (S)-2-(4-pentenyl)alanine; B, norleucine). Ruthenium-catalyzed ring closure metathesis of the SAHB was performed after cleavage from the polystyrene resin. All peptides were HPLC purified and were >95% according to quality control high performance liquid chromatography (HPLC) and matrix-assisted laser desorption ionization time of flight (MALDI-TOF) mass spectrometry. All peptides were prepared from powder as 100 mM deuterated DMSO stocks and diluted for downstream experiments as needed ensuring that the final DMSO concentration did not exceed 2%.Cryo-EM sample purification, grid preparation and data collection

[0147] The cryo-EM Sabi 1 M:MBP-MCL1 :BAK complex was prepare in a final volume of 2 mL from purified components MBP-ll-MCL-1 (0.1 mM), BAKG126R (0.15 mM), and Sabi 1 M (0.15 mM) in buffer containing 25 mM HEPES pH 7.0, 150 mM NaCI, 1 mM maltose and 3.4 mM DDM [i.e. ~20 x critical micelle concentration (CMC)]. The complex was loaded onto an S200GL size exclusion column equilibrated with S200GL running buffer [25 mM HEPES pH 7.0, 150 mM NaCI, 1 mM maltose and 0.25 mM DDM (i.e. ~1.5 x CMC)]. The fractions were analyzed by SDS-PAGE, transferred to Eppendorf tubes and flash frozen in liquid nitrogen for shipping to the Dubochet Center for Imaging of EPFL at the University of Lausanne (DCI-Lausanne) where all subsequent manipulations for cyro-EM analysis were performed.

[0148] Vitrification by plunge freezing in liquid ethane of samples from the most highly concentrated fraction from the S200GL elution (5.8 mg / mL) was optimized using MarkIV Vitrobot (ThermoFisher), EM GP2 (Leica), and Chameleon (STP Labtech). For the Vitrobot and EM GP2, Quantifoil QF 1.2 / 1.3 300 or ultrafoil UF 1.2 / 1.3 300 grids were prepared by glow discharging at 15 mA for 90 sec using a PELCO easiGlow (Ted Pella). Samples were diluted to 1.5 mg / mL in S200GL running buffer and 3 pL were applied to the grids at 10 °C and 95% humidity. The Vitrobot blotting force was set at 10 with blotting times 4 sec and 1 sec, while the EM GP2 blotting time was 6 sec. For the Chameleon the undiluted sample of the 5.8 mg / mL S200GL fraction was used. Grids from all three vitrification devices were clipped in autogrid C-clip rings (ThermoFisher), loaded into the autoloader and grid screened was done on the 300 kV Titan Krios G4i transmission electron microscope (ThermoFisher) equipped with a Coif FEG emission gun, SelectrisX energy filter and a Falcon IV direct electron detector. One of the Chameleon grids had the best particle distribution and was selected for data collection. A two-day long dataset was collected using the EPU automated software (ThermoFisher) with a pixel size at detector of 0.726 A per pixel and total electron exposure of 40 e- / A2. Cryo-EM data processing

[0149] CryoSPARC was used for cryo-EM image processing. Around 34000 micrographs were motion corrected and analyzed by contrast transfer function (CTF) estimation. More than 1.8 million particles were auto-picked and extracted with Fouriercropping four time (bin4 data). After several rounds of two-dimensional (2D) classification four 2D classes were defined. However, only class I produced an interpretable ab initio reconstruction for an initial three-dimensional (3D) structure, while classes 11— IV suffered from preferred orientation and precluded fruitful 3D analyses. The volume of 150154 particles from class I was non-uniformly refined to 3.30 A resolution, and further refined upon 3D flex refinement to 2.94 A. 3D variability analysis identified 40263 particles whose volume was non-uniform refined to 3.62 A, and a subsequent 3D flex refinement generated a final volume at 3.34 A resolution that exhibited good quality and connectivity corresponding to the MCL-1 AK complex.Cryo-EM model building and refinement

[0150] The crystal structures of Sabi 1 M:MBP crystal structure (PDB ID 5bjz) and MBP-GS-MCL-1 : WT BAK BH3 were fitted as a rigid bosy into the cryo-EM volumes using fit map command in Chimera (ref). Several cycles of manual building in COOT and real space refinement in Phenix (ref) were then performed for each model. Restraints for maltose ligand were generated using the ELBOW algorithm integrated in the Phenix suite (ref). Hydrogens were added to the model by Phenix ReadySet utility (Ref) that improves the geometry following the real space refinement in Phenix. The refined model was further used in coot to examine the Ramachandran plot, subsequently performing geometry and Rotamer analysis to further improve the quality of the model for validation and deposition to PDB server.X-ray crystallography

[0151] Crystallization of G126R G184C C166S BAK (residues 22-186) was performed by hanging drop diffusion method in 15-25% PEG 3350, 0.1 M sodium acetate, 0.1 M HEPES pH 7.5. Crystals were cryoprotected by sequentially moving them from the hanging drop to three consecutive 50:50 parabar: paraffin oil 5 pL drops to remove residual aqueous layer, flash frozen and stored in liquid nitrogen. The X-ray data was collected at the AMX beamline at the National Light Source II, Brookhaven National Laboratories and was processed with XDS and HKL2000. The crystal structure of G126R BAK G184C C166S was determined by molecular replacement using apo BAK (PDB ID2imt) as a search model with the Phaser module of PHENIX. Data model was built in Coot and was refined in PHENIX and REFMAC.

[0152] Crystallization of WT and V74A BAK BH3 peptide complexes with MBP-GS-MCL-1 was performed by hanging drop diffusion method in 15-25% PEG 4000, 0.2 M lithium sulfate, 0.1 M TRIS pH 8.5. Crystals were cryoprotected by sequentially moving them from the hanging drop to three consecutive 50:50 parabar: paraffin oil 5 pL drops to remove residual aqueous layer, flash frozen and stored in liquid nitrogen. The X- ray data were collected at the SERCAT 22ID beamline, Argonne National Laboratories and were processed with XDS and HKL2000. The crystal structure of MBP-MCL-1 :BAK BH3 WT and MBP-MCL-1 :BAK BH3 V74A were determined by molecular replacement using the MBP and MCL-1 domains of MBP-MCL-1 (PDB ID 4wms) as search modeld with the Phaser module of PHENIX. Data model was built in Coot (ref) and was refine in PHENIX and REFMAC.NMR Spectroscopy

[0153] BAK dimer

[0154] WT BAK: MCL-1 unsuccessful complex

[0155] G126R BAK:MCL-1 complexFluorescence polarization binding assays

[0156] A competitive fluorescence polarization assay was developed to measure the displacement from MBP-MCL-1 of the fluorescent BID BH3 peptide stabilized alpha helix of BCL-2 family protein (BID SAHB-FAM) by unlabeled BH3 peptides from BAK, BID, BIM, and NOXA. This assay was performed in 384-well Corning black polyester plates by dispensing 15 pL master mix containing 50 mM tris-HCL pH 7.5, 50 mM KCI, 0.1 mg / mL BSA, 2 mM DTT, 0.005% Tween 20, 0.8 nM BID SAHB-FAM (probe), and 20 nM MBP-MCL-1 and 5 pL BH3 peptides titrated to achieve a final concentration of 3000 nM to 0.18 nM. Plates were centrifuged to remove air bubbles for one minute at 1000 rpm. Polarization intensity was measured in milli polarization units (mP) using CLARIOstar microplate reader (BMG LabTech) set with excitation and emission wavelength of 498 nm and 517 nm, respectively. Controls such as probe alone, and probe + peptide were used to account for background polarization intensity. At leastthree independent dose-response experiments for each peptide were performed in triplicate. The IC50 values were derived from the dose-response curves using competitive one site fit of loglC50 equation in GraphPad Prism version 10.2.3.Microscale thermoohoresis binding assays

[0157] A direct binding capillary-based microscale thermophoresis (MST) assay was designed to measure the KD values for the interaction between labeled MBP- MCL-1 and BAK proteins, BH3 peptides, and MCL-1 -selective BH3 mimetics. MBP-MCL- 1 was labeled with the amine-targeted Alexa Fluor 647 (AF647) following the standard protocol suggested by LifeTechnologies to achieve 2 fluorophore labels per protein. Samples of 20 pL final volume were prepared by mixing 10 pL of labeled receptor and 10 pL of unlabeled ligand in a 384 well-plate using a buffer consisting of 50 mM Tris-HCI pH 7.5, 50 mM KCI, 0.1 mg / ml BSA, 2mM DTT. Master mix of the reaction buffer with 20 nM of labeled receptor AF647-MBP-MCL-1 was titrated against the ligands serially diluted in the same reaction buffer to achieve the following final concentrations: 10 nM AF647-MBP- MCL-1 and ligand at 9 pM to 0.3 nM WT BAK, 2 pM to 0.06 nM G126R BAK, 20 pM to 0.6 nM V74A G126R BAK, 9 pM to 0.3 nM BH3 peptides, and 9 pM to 0.3 nM BH3 mimetic. For all ligands binding measurements were performed in presence of 5x CMC DDM (0.85 mM DDM) as well as in absence of DDM. The reaction plate was mixed using an Eppendorf Thermomixer at 600 rpm for 5 min followed by centrifugation at 1000 rpm for 2 min at room temperature. Samples were suctioned into Monolith capillaries (NanoTemper MO-KO22), placed in the capillary holder from highest to lowest protein concentration and MST signals recorded on the Monolith X instrument measuring the fluorescence ratio at 650nm / 670nm as a function of ligand dose to derive the KD values. Data were exported for plotting in GraphPad Prism version 10.2.3.

[0158] A competitive binding MST assay was designed to evaluate the derepression of MCL-1 :BAK complex by BH3 peptides and BH3 mimetics. This assay used the same buffer system as the direct binding MST assay each reaction combining 10 pL of master mix of 10 nM AF647-MBP-MCL-1 and 60 nM G126R BAK in 10x CMC DDM (1.7 mM) and 10 pL BH3 peptides or BH3 mimetics serially diluted in a detergent free buffer to achieve a final concentration of 5x CMC DDM. The reaction plate, capillaryloading, measurements, and data analysis were handled as described above. Apparent IC50 values were also estimated from the dose-response curves using competitive one site fit of loglC50 equation in GraphPad Prism version 10.2.3.Liposome permeabilization assays

[0159] Liposome permeabilization assays were performed as previously described. Lipid films of ratios resembling mitochondrial outer membrane composition of phosphatidylcholine (40.9%), phosphatidylethanolamine (26.6%), phosphatidylinositol (9.1 %), phosphatidylserine (8.3%), cardiolipin (7%) and containing the Ni2+- affinity lipid 1 ,2-dioleoyl-sn-glycero-3-[(N-(5-amino-1 -carboxypentyl)iminodiacetic acid)succinyl] (nickel salt) [DGS NTA(Ni), 8%, 2.5 pM final concentration in each assay] (Avanti Polar Lipids). Lipid films were hydrated in liposome assay buffer (10 mM HEPES pH 7.0, 200 mM KCI and 5 mM MgCI2) containing 12.5 mM 8-aminonaphthalene-1 , 3, 6-trisulfonic acid, disodium salt (ANTS) and 45 mM p-xylene-bis-pyridiniumbromide (DPX) fluorquencher dye pair, vortexed and sonicated ~15 min followed by extrusion through 2 pM pore size polycarbonate membrane (Avanti Polar Lipids) to prepare homogenous large unilamellar vesicles (LUVs). LUVs were purified by S500 size exclusion chromatography and stored at 4 °C in the dark. Liposome permeabilization assays were performed in 100 pL final volume in float bottom 96-well plates (Costar or Greiner) by mixing LUV buffer with serially diluted proteins, BH3 peptides, and J19 compounds to achieve the final desired doses. MEAS-BAK-His6 (ref) and MCL-1 -His6 (residues 173- 321 ) proteins were used in these assays. Reactions were initiated by addition of 5 pL of liposomes on ice and placing the plates in the CLARIOstar plate reader (BMG LabTech) at 37 °C. Permeabilization was monitored for 60 min by the release of ANTS from liposomes and its unquenching which increases fluorescence, and setting the excitation and emission wavelength to 360 nm and 530 nm, respectively. The extent of liposome permeabilization was normalized to that induced by buffer (minimum fluorescence) and 3% CHAPS (maximum fluorescence) and was quantified by integrating the area under curve (AUC) of normalized kinetic traces using the Simpson method implemented in Excel. Data was visualized in GraphPad Prism version 10.2.3.Cloning and production of cells expressing BAK and MCL1

[0160] For mammalian cell culture experiments, the full length human BAK cDNA was cloned into the pCRBIunt ll-TOPO vector and the BAK ORF was PCR amplified for cloning into the Bam HI and Notl sites of pRETROX-mCherry vector for retroviral transduction (BAK BamHI_For:TATATATATAGGATCCATGGCTTCGGGGCAAGGCCC (SEQ ID NO: 23); BAK Notl_Rev: TATATATATAGCGGCCGCTCATGATTTGAAGAATCTTC (SEQ ID NO: 24). The full length human MCL1 cDNA fused to mCerulean (cer) was also cloned into the pCRBIunt ll-TOPO vector and the cer-MCL1 ORF was PCR amplified for cloning into the SnaBI and Sall sites of the retroviral pMx-IRES-GFP vector, removing IRES-GFP and generating pMx-cer-MCL1 (cer-MCL1_For:GATCTAGCTAGTTAATTAAGGATCCACCATGGACTACAAGGACGACG (SEQ ID NO: 25); cer-MCL1_rev:AAATAAAATCTTTTATTTTATCGTCGACCTATCTGATCAAATAAGCCAAGCC (SEQ ID NO: 26)).

[0161] To test direct BAK inhibition, cells stably expressing mCherry-BAK (mC-BAK) ± cer-MCL1 were produced on a genetic background devoid of the entire BCL- 2 family repertoire (all 17 BCL-2 genes), BCL2allKO HCT116, as previously described. Wild type mC-BAK was expressed using the doxycycline (Dox)-based inducible Tet-On 3G retroviral system from the pRetroX-TRE3G- PuroR in BCL2allKO HCT116 cells expressing the Tet3G from pRetroX-Tet3G-BlastR. Stably transduced cells were selected with puromycin (2.5 pg / mL) and blasticidin (2 pg / mL) starting at 2 days after retroviral transduction. To enrich for populations of cells expressing mC-BAK, cells were treated with low Dox dose (30 ng / mL) overnight and mCherry positive cells were sorted using Fluorescence Activated Cell Sorting (FACS) on a FACSArialll cell sorter. Enrichment for m Cherry-expressing cells was performed twice before cell death assays. Constitutive expression of cer-MCL1 in mC-BAK expressing BCL2allKO HCT116 was achieved by retroviral transduction with pMx-cer-MCL1 . Two rounds of FACS sorting gating on mCherry and cerulean positive cells were performed to enrich for populations of cells expressing both BAK and MCL1 , before cells were used in the cell death assays. Cells were maintained at 37°C with 5% CO2 in MacCoy’s 5A media supplemented with 10%FBS, L-glutamine, sodium pyruvate, non-essential amino acids and puromycin (2.5 pg / mL) plus blasticidin (2 pg / mL).Cell death assays

[0162] Inducible Tet-On mC-BAK + constitutive Cer-MCL-1 BCL2allKO HCT116 cells were seeded in 384-well plates (4,800 cells / well) in 20 pL / well of growth media. After 24h of attachment, BAK expression was induced with Dox (up to 1000 ng / mL) and cell death monitored by SYTOX Green (120 nM) uptake using the CellcyteX live cell imager (Cytena) up to 48h. As SYTOX green marks cells with compromised plasma membrane integrity, cell death was evaluated as the number of green fluorescent positive cells over the total number of cells per well. MCL1 inhibitor compounds, S63845, AZD5991 and AMG-176 were added to the cells simultaneously with Dox. Concentrations up to 50 pM were tested for one Dox dose that induced robust cell death, and compound associated-cell death was monitored as above described. BAK mediated-caspase activity was blocked with q-VD-OPh (40 pM). Cell death was quantified by integrating the area under curve (AUC) of normalized kinetic traces using the Simpson method implemented in Excel.

[0163] Apoptosis under the same conditions as for the 384-well live-cell imaging described above was quantified based on endpoint caspase-glo 3 / 7 assay (Promega) performed according to the manufacturer’s protocol. The assays measured caspase activity 24h after Dox addition in neutralization experiments with MCL-1 inhibitors added at 12h after Dox addition. BAK mediated-caspase activity was blocked with qVD (5 pM). The data are presented as luminescence values divided by confluence estimated in the CellCyteX. Luminescence was measured in relative light unit (RLU) using a CLARIOstar microplate reader (BMG LabTech).

[0164] Data for both assays was visualized and EC50 values were estimated from the MCL-1 inhibitor dose-response curves using agonist vs response three parameters equation in in GraphPad Prism version 10.3.1. Immunoblot analysis

[0165] mC-BAK and cer-MCL1 expression by mC-BAK ± cer-MCL1 cells was monitored by immunoblotting. Cells seeded in 24-well plates (160,000 cells / well)were let to adhere and then treated with Dox (up to 1000 ng / mL) and q-VD (40 pM) for 24h. Cells were then collected in RIPA buffer plus protease inhibitor cocktail and BAK and cer-MCL1 were detected with mouse monoclonal antibodies against BAK (1 :500 dilution, Ab-1 , Calbiochem) and GFP (1 :500 dilution, B2, Santa Cruz Biotechnology) (mCerulean share 94% sequence homology with GFP). As loading controls, global protein levels were monitored by ponceau S staining and actin (1 :1000 dilution, clone C4, EMD Millipore).

[0166] Horseradish peroxidase (HRP) conjugated-sheep anti mouse IgG (1 :1000 dilution, Cytiva) was used as secondary antibody.Mitochondria Outer Membrane Permeabilization assay

[0167] Cytochrome c release assays were performed on mCherry (+) cer (+) BAK and MCL1 -expressing BCL2allKO HCT116. Mitochondria were isolated from cells treated overnight with 1000 ng / mL Dox to induce BAK expression. Isolated mitochondria were incubated with BH3 peptides BID, NOXA, BIM or MCL1 inhibitors S63845, AZD5991 and AMG-176 (0.05 pM, 0.5 pM, or 5 pM) for 30-45 min at 37°C. Supernatant and pellet fractions were separated by centrifugation at 6300 rpm, 10 min, 4 °C (Sorvall Legend XTR centrifuge) and analyzed for presence of cytochrome c by immunoblotting.Protease sensitivity and cross-linking assays

[0168] Purified mitochondria from mC-BAK + Cer-MCL-1 -expressing BCL2allKO HCT116 cells were incubated with BH3 peptides BID, NOXA, or BIM (5 pM ) or MCLI inhibitors S6, AZD, or AMG (1 pM ) for 30 min at 37°C. Calpain limited proteolysis was performed by incubating the MOMP reactions with 1 pM recombinant m-calpain plus 1 mM CaCI2 for up to 60 min at room temperature, as previously described19,47. Thiol- directed crosslinking assays were performed by incubating the MOMP reactions with 0.5 pM bismaleimidohexane (BMH, Thermo Fisher Scientific) at room temperature for an additional 30 min, as previously described. Reactions were then analyzed by immunoblotting with rabbit polyclonal anti-BAK antibody (1 :2000 dilution, Cell Signaling Technology, cat#3814) which recognizes residues surrounding Gly82 of human Bak. As loading controls, global protein levels were monitored by ponceau S staining. Horseradishperoxidase (HRP)-conjugated donkey anti rabbit IgG (1 :1000 dilution, Cytiva) was used as secondary antibody. Image J was used to quantity the protein bands and ratios of dormant, MCL1 -bound and total BAK were calculated.Estimation of relative protein levels for MCL-1 and BAK in purified mitochondria

[0169] To estimate the levels of BAK and MCL-1 , dilutions of untreated mitochondria preparations were analyzed by immunoblot against dilutions of recombinant cBAK82 and recombinant MBP-MCL-1 (described above). BAK was detected with rabbit polyclonal anti-BAK antibody (1 :2000 dilution, Cell Signaling Technology, 3814) and MCL1 with rabbit anti-MCL1 (1 :1000 dilution, ProteinTech, 16225-1 -AP) which recognizes the core BCL-2 region of the human, mouse, and rat proteins. As loading controls, global protein levels were monitored by ponceau S staining. Horseradish peroxidase (HRP) conjugated-donkey anti rabbit IgG (1 :1000 dilution, Cytiva) was used as secondary antibody. Image J was used to quantify the protein bands to estimate the relative levels of mitochondrial BAK and MCL-1 based on serial dilutions of the recombinant proteins.Fluorescence resonance energy transfer

[0170] BCL2allKO HCT116 cells expressing constitutive Cer-MCL-1 and Dox-inducible mC-BAK described above were passaged in a T25 cell culture flask (Greiner Bio-One) before plating for imaging on a 22 mmx22 mm coverslip (Corning, No. 1 .5) added into a Fisher Scientific 35 mm Petri dish. 80 pL of cell suspension was added followed by 2 mL of growth medium. Cultured cells were allowed to attach and recover for 24h before treatment with 3 pM qVD + 125 ng / mL Doxcycline (Dox) (-AMG) or 3 pM qVD + 125 ng / mL Dox + 2 pM AMG176 (+AMG). After treatment, cells were further incubated for 16h before acquiring the FRET images.

[0171] The live-cell fluorescence resonance energy transfer imaging (FRET) imaging was performed on an inverted microscope (Olympus IX 81 ) equipped with a high numerical aperture oil objective (Olympus UPLAPO100XOHR, NA=1.5) and an electron multiplying charge coupled device (EMCCD) camera (Andor Technology, iXon+ Ultra897 BVF). A 405 nm laser (Coherent, Obis) of 5mW was introduced into the sample to excite the donor, Cerulean, through the back focal plane to the objective usinga dichroic mirror (Chroma, AT455DC). The laser was shifted laterally toward the edge of the objective by a mechanical translational stage so that the emerging light reached the sample at incidence angles slightly smaller than the critical angle of the glass-water interface. Fluorescence emissions from both the donor and acceptor (mCherry) were collected by the same objective, and the laser background was rejected by a long-pass filter (Chroma, AT465lp). A home-built multi-channel imager was used to split and acquire the fluorescence images of donor and acceptor. Inside the imager, a long-pass dichroic mirror (Chroma, ET61 Olp) was used to split the fluorescence emission between the donor and acceptor. Additional bandpass filters (Donor: Semrock, FF01 -525 / 50-25; Acceptor: Semrock, FF01 -630 / 69-25) were inserted to minimize the crosstalk between channels. Images were recorded with a frame rate of 33.3 frames per second (fps). Image J was used to analyze the images.Example 1 - MCL-1 inhibits BAK-mediated liposome permeabilization

[0172] To reconstitute the MCL-1 inhibition of BAK-mediated membrane poration using purified proteins, albeit lacking the transmembrane domains and the disordered N-terminus of MCL-1 , a well-established membrane permeabilization assay monitoring dye release from liposomes of lipid composition resembling the outer mitochondrial membrane and supplemented with a his-tag binding lipid to recruit the his- tagged BAK and MCL-1 proteins was used. In this assay, BAK alone induced spontaneous dye release in a concentration dependent manner, which we refer to as autoactivation, with undetectable permeabilization below 25 nM (FIG. 1A, FIG. 2A). Liposome permeabilization was enhanced by direct BAK activation using a human NOXA BH3 peptide known to activate BAK, or the small molecule J19 in a ligand concentration dependent manner (FIG. 1A-1B, FIG. 2A-2B). Characterization of J19 as a more soluble analog of the previously described SJ572946 BAK activator will be presented elsewhere. Controls experiments indicated that NOXA BH3 and J19 alone are inert in liposome permeabilization. Liposome permeabilization was inhibited when BAK was mixed at levels that sustain its autoactivation with equimolar or sub-stoichiometric levels of MCL-1 even in the presence of 400-fold excess J19 BAK activator suggesting that J19 cannotneutralize inhibitory MCL-1 :BAK complex (FIG. 10, FIG. 2C). The NOXA BH3 peptide, an MCL-1 selective inhibitor, promoted neutralization of inhibitory MCL-1 :BAK complex to restore BAK-dependent liposome permeabilization (FIG. 1D, FIG. 2D). The in vitro data faithfully recapitulate the pore-forming activity of BAK, its inhibition by MCL-1 , and derepression of the MCL-1 : BAK complex by NOXA.

[0173] The MCL-1 : BAK complex forms in the presence of detergents that activate BAK and is expected to mimic the endogenous MCL-1 :BAK complex, both thought to implicate MCL-1 binding to the exposed BH3 helix a2 of BAK. In detergents BAK also forms dimers. To prevent competing BAK homodimerization when investigating BAK heterodimerization with MCL-1 we used the mutant BAK G126R. This mutant is severely impaired in autoactivation and direct activation by BIM BH3 and NOXA BH3, but it can be activated by J19 albeit exhibiting diminished liposome permeabilization activity requiring much higher protein doses compared to WT BAK (FIGs. 2H-2I). The side chain of R126 in the BH1 region likely blocks symmetric BAK dimerization in detergents through steric clashes in the hydrophobic groove as suggested by the crystal structure of G126R BAK which shows the side chain occluding this groove (FIG. 2E-2F, Table 1). In size exclusion chromatography coupled to multi-angle light scattering (SEC-MALS) experiments in the presence of dodecylmaltoside (DDM) detergent G126R BAK was monomeric, and WT BAK was dimeric (FIG. 1 E, FIG. 2G). In DDM BAK G126R formed a 1 :1 complex with MCL-1 (FIG. 1E, FIG. 2G).

[0174] To determine the dissociation constant (KD) for the interaction between MCL-1 and WT or G126R BAK in DDM we developed a new binding assay based on microscale thermophoresis (MST). MBP-MCL-1 labeled with amine-targeted Alexa FluorTM 647 was titrated with unlabeled WT or G126R BAK. Interestingly and surprisingly the KD for MCL-1 binding to the monomeric G126R BAK mutant (38.0±19.2 nM) was more than 60-fold lower than that for MCL-1 binding the WT BAK (2.5±0.9 pM) suggesting that BAK dimerization significantly lowers the ability of MCL-1 to sequester it whereas monomeric BAK is readily sequestered by MCL-1 (FIG. 1F). The KD for direct binding of MCL-1 and BAK BH3 peptide determined by MST (51.9±4.6 nM) is similar to that of G126R BAK and previously reported values (FIG. 2F).

[0175] Together, the data support the generation of a high-affinity 1 :1 complex between monomeric BAK and MCL-1 in detergent, which was sought to elucidated at atomic resolution using an integrated structural biology approach.Table 1 : Data collection and refinement statistics for X-ray crystal structures.Statistics for the highest-resolution shell are shown in parenthesesExample 2 - NMR reveals similar structures of MCL-1 bound to BAK and BAK BH3

[0176] To examine the MCL-1 AK complex in DDM detergent by NMR, complexes in which one of the binding partners was invisible in NMR while the other complex was visible was produced. The NMR visible binding partner was labeled with 15N, 13C, 2D (ncd) and the NMR invisible binding partner with 14N, 12C, 2D (d), purified them separately, and mixed them in micellar deuterated DDM (dDDM) NMR invisible buffer to form complexes. The invisible MCL-1 :visible BAK complex in DDM (dMCL-1 DDM: ncdWT BAK) exhibited a collapsed 15N-1 H two dimensional (2D) spectrum indicative of largely intrinsic disordered character missing more than one hundred resonances expected for the ncdBAK construct (residue 23-186, FIG. 3A, 0 hr). Remarkably, over time this sample progressed to exhibit a new 15N-1 H 2D spectrum measured at 144 hr, which had better dispersion and more resonances compared to 0 hr spectrum suggesting the presence of a folded BAK conformation along with original features of intrinsic disordered (FIG. 3B, FIG. 4A). The new spectrum overlapped very well with that of ncdWT BAK in DDM (FIG. 3A-3C) which is a BAK dimer according toSEC-MALS (FIG. 1E). These data suggested that WT BAK in complex with MCL-1 is highly dynamic and intrinsically disordered and over time it falls off MCL-1 forming a BAK dimer that likely does not interact with MCL-1 .

[0177] To stabilize a 1 :1 MCL-1 : BAK complex in the absence of competing BAK homodimerization for NMR analysis we used the monomeric mutant G126R BAK, which formed a stable heterodimer with MCL-1 over the course of the NMR experiment enabling data acquisition on the complex. The 2D and 3D NMR analyses on BAK visible NMR samples ncdG126R BAK:dMCL-1 DDM suggested that BAK adopts a highly dynamic conformation in the complex involving a partial intrinsic disordered region (IDR) attributed to the N-terminal region previously shown to be disordered. Besides the N- terminal IDR, BAK exhibited low intensity broad NMR signals precluding backbone assignment in 3D NMR (data not shown).

[0178] In contrast, 2D and 3D analyses of NMR visible MCL-1 in the ncdMCL-1 :dG126R BAK complex enabled full amide backbone assignments in micellar dDDM buffer (FIG. 4B). The 2D NMR spectrum of ncdMCL-1 :dG126R BAK DDM overlapped closely that of ncMCL-1 : BAK BH3 complex in the absence of DDM (FIG. 4C), suggesting similar conformations of MCL-1 in the two complexes (FIG. 4C). Chemical shift perturbation analysis comparing MCL-1 amide backbone resonances of these complexes indicated significant changes mapped mostly within the hydrophobic groove of MCL-1 suggesting that the full-length BAK and the BAK BH3 peptide bind similarly and exclusively to this groove (FIG. 3E-3F).

[0179] The combined NMR data suggest that MCL-1 binds exclusively to the BAK BH3 region whereas the rest of BAK is in a dynamic conformation characterized by an N-terminal IDR. Next, it was sought to elucidate the structural basis of BAK sequestration by MCL-1 using cryo-EM and X-ray crystallography.Example 3 - Cryo-EM analysis reveals the structural basis of BAK sequestration by MCL-1

[0180] To determine the structure of BAK:MCL-1 complex by cryo-EM fiducial marks were used to enable visualization and alignment as follows (FIG. 5A): i) toincrease the size of the complex we fused MBP at the N-terminus of MCL-1 , inspired by structures of MBP-MCL-1 designed to enable crystallization of drug-bound complexes; ii) the size of the complex with an antibody fragment (Sabi 1 M) targeted to MBP which forms a rigid complex was further increased; iii) the GS linker between MBP and MCL-1 was rationally rigidified through mutagenesis to II, based on published crystal structures of MBP-MCL-1 and crystal structure of MBP-MCL-1 bound to BAK BH3 peptides described below; iv) and the mutation G126R BAK to prevent the dissociation of the complex to the BAK homodimer was installed (see above). The final complex, Fab:MBP-MCL-1 :G126R BAK, was produced from the purified components using 1.5* excess molar equivalents of Fab and G126R BAK and this complex was purified further using SEC (FIG. 5B).

[0181] Screening was performed vitrified grids of the highest concentration fraction from SEC prepared with the Vitrobot, Leica, and Chameleon vitrification instruments and selected the Chameleon grids for the cryo-EM data collection on the Titan Krios with Selectris filter. More than 34000 micrographs were acquired over two days to generate close to 2.8 million particles classified into 4 distinct 2D classes in cryoSPARC (FIG. 6). The second most predominant class (I) generated a successful Ab- initio 3D reconstruction from -150,000 particles refined to 2.94-A, whereas classes ll-IV exhibited preferred orientation precluding 3D reconstruction (FIG. 6). Class I was further refined through 3D variability, non-uniform and 3D flex analyses using -40,000 particles at 3.34-A resolution, which exhibited better quality in the region corresponding to the MCL-1 :G126R BAK complex (FIG. 6, FIG. 7A-7F).

[0182] The model of the Fab:MBP-MCL-1 :G126R BAK complex was built and refined aided by the published Fab:MBP-MCL-1 crystal structure and the unpublished MBP-MCL-1 : BAK BH3 crystal structure (FIG. 5C-5D, FIG. 7A, Table 2). The linker region between MBP and MCL-1 is well defined revealing a C-terminal helix of MBP bending at the linker into the N-terminal helix of MCL-1 supporting the rigidification of this conformation (FIG. 5D, FIG. 7B). In contrast, the crystal structures of MBP-MCL-1 containing the GS linker exhibit multiple different relative orientations of MBP and MCL-1 suggesting its flexibility (FIG. 7B). It was noted that the analysis of a similar complex lacking a rigidified MBP-MCL-1 linker generated a low-resolution reconstructionexhibiting major heterogeneity in the register of MCL-1 relative to MBP. Remarkably, the MCL-1 :BAK domains of the Fab:MBP-MCL-1 :G126R BAK complex did not exhibit any discernible volume beyond that observed in the MCL-1 : BAK BH3 domains of the crystal structure of MBP-MCL-1 :BAK BH3 (FIG. 5C-5D, FIG. 7A, FIG. 7C). Specifically, any protein volume at the N-terminus of the BAK BH3 or any micelle-associated protein volume at the C-terminus of BAK BH3 in the Fab:MBP-MCL-1 :G126R BAK complex was not observed.

[0183] Therefore, the disclosed cryo-EM data supports the NMR results suggesting that the BAK BH3 is the sole region of the BAK globular domain sequestered by MCL-1. Additionally, the cryo-EM data revealed that BAK adopts a dynamic conformation with an invisible putative micelle-associated C-terminal region, suggesting that the secondary structure corresponding to the helix a3 of apo-BAK immediately following the BH3 helix a2 is no longer helical in the MCL-1 :BAK complex.Table 2: Statistics of cryo-EM structure of Sab11M:MBP-MCL-1 :G126R BAK.Example 4 - Canonical BH3-in-groove interactions stabilize the MCL-1 :BAK complex

[0184] It was determined the crystal structure of MBP-MCL-1 :BAK BH3 complex at 2.0-A resolution (Table 1). The MCL-1 :BAK BH3 portion of this structure overlaps well with that obtained by cryo-EM (FIG. 5D-5F). The side chains of the residues that participate in the BH3-groove interactions are clearly defined in the electron density map (FIG. 8B). The side chain rotamers are slightly different at the complex interface in the crystal and cryo-EM structures including a poorly defined salt bridge for the R263 MCL-1 :D83 BAK interaction in the cryo-EM structure (FIG. 5D-5F), which may explain the differences at this interface predicted from the NMR CSP analysis (FIG. 3A-3F). The MCL-1 :BAK complex is stabilized by binding of six hydrophobic residues from BAK BH3 (labeled 0-5) to corresponding pockets in the hydrophobic groove of MCL-1 and the R263 MCL-1 :D83 BAK salt bridge which is conserved in most BH3-bound complexes of globular BCL-2 family proteins (FIG. 9A).

[0185] Using BAK BH3 peptides it was tested the contribution of various BAK residues to binding MCL-1 in a competitive fluorescence polarization (FP) assay measuring displacement (represented as IC50 value) of a stabilized alpha helix of BID BH3 peptide derivatized with C-terminal fluorescein, BID SAHB-FAM, which binds to MCL-1 with high affinity (KD ~ 1 nM). Alanine mutagenesis revealed major contributions to binding by L78(2) and D83(s), whose substitutions incapacitated the ability of BAK BH3 to displace BID SAHB-FAM, and established a rank order of other residues with substantial contributions to binding as I85>Y89>V74>M71 (FIG. 9A-9C, FIG. 8A).Cysteine mutagenesis of select residues showed a similar trend as the alanine mutagenesis corroborating the rank order contributions to binding by I85>Y89>M71. G82C which introduces a clash preventing the close register of BAK BH3 to the BH1 region of MCL-1 in the vicinity of G82 was also tested (FIG. 9A-9C). In contrast, the substitution T70C had only minor effects on the ability of BAK BH3 to compete in the FP assays supporting a peripheral role of this solvent exposed residue (FIG. 9A-9C). The structural analyses and rational mutagenesis data supports the combined contributions of the hydrophobic interactions and of the conserved salt bridge to high affinity sequestration of BAK BH3 by MCL-1 .

[0186] It was previously shown that the V74A mutant did not considerably affect the ability of BAK to autoactivate and porate membranes. Given its diminished affinity for MCL-1 suggested by more than 10-fold higher IC50-value for V74A BAK BH3 compared to WT BAK BH3 in the competitive FP assay, we tested its effect on the MCL- 1 :BAK complex formation in the context of full-length BAK reasoning that we could use this mutant to probe MCL-1 inhibition of BAK-mediate membrane poration. Using MST and the G126R BAK mutant that remains monomeric in micellar DDM, we showed that V74A G126R BAK binds MCL-1 with a KD of 942 ± 347 nM exhibiting 25-fold lower affinity than G126R BAK (KD of 36.7 ± 19.7 nM, FIG. 9D). It was determined the high-resolution crystal structure of V74A BAK BH3:MCL-1 complex, which revealed an identical mode of binding as the WT BAK BH3 in the MCL-1 complex (FIG. 9E, FIG. 7B-7C). Combined, the disclosed data suggested a potent contribution to the affinity of BAK for MCL-1 from binding of the V74 side chain of BAK BH3 to hydrophobic pocket 1 in the groove of MCL- 1 which we exploit functionally next.Example 5 - Neutralization of MCL-1: BAK complex by BH3 peptides correlates with their affinity for MCL-1 and BAK activation potential

[0187] To test the functions of BAK and MCL-1 in a minimalist reconstituted in vitro system liposomes were used and the BH3 peptides from BID, NOXA, and BIM which have previously been shown to activate BAK and have low, intermediate, and high affinity for MCL-1 . These peptides are expected to compete with BAK for the hydrophobicgroove of MCL-1 to neutralize the MCL-1 :BAK complex or to sensitize the system by occupying the groove of apo MCL-1. In the competitive FP assay measuring the displacement of BID SAHB-FAM from MBP-MCL-1 it was observed a similar rank order in BH3 potency as the published results (FIG. 10A, FIG. 11 A). Moreover, direct binding of these BH3 peptides to MCL-1 using the MST assays showed similar trends in KD values as published results (FIG. 10B). Using these BH3 peptides, it was tested their ability to displace G126R BAK from MBP-MCL-1 in DDM detergent in MST assays which revealed the rank order by potency BIM>NOXA>BID (FIG. 10C). As control, it was showed that the KD for direct binding of BH3 peptides from BIM and NOXA to MBP-MCL- 1 was slightly but insignificantly increased in buffer containing micellar DDM detergent compared to detergent-free buffer (FIG. 10B), but that in DDM detergent BID BH3 exhibited undetectable activity suggesting it incompatibility in this assay.

[0188] Direct BAK activation by BH3 peptides was tested, MCL-1 inhibition of BAK-mediated membrane poration, and MCL-1 :BAK de-repression by BH3 peptides in liposomes using combinations of WT or V74A BAK, MCL-1 and the BH3 peptides from BID, BIM and NOXA (FIG. 10D). In this assay, BIM BH3 and BID BH3 are better activators of WT and V74A BAK than NOXA BH3 (FIG. 10E). On the other hand, only BIM BH3 neutralized the MCL-1 :BAK complex at equimolar levels of MCL-1 and BAK and more potently activated V74A vs WT BAK (FIG. 10E). In contrast, NOXA BH3 and BID BH3 were capable of activating V74A or WT BAK only at sub-stoichiometric levels of MCL-1 relative to BAK (FIG. 10F-10G). At the lowest peptide dose tested (62.5 nM) BIM BH3 is better at neutralizing MCL-1 :V74A BAK than MCL-1 :WT BAK (FIG. 10F-10G). The data support the lower affinity of MCL-1 for V74A BAK compared to WT BAK, which enabled de-repression of the former complex at lower BH3 peptide doses than required for neutralizing the latter complex. Additionally, the ability of BID BH3 peptide to activate BAK contributes overall to more efficient permeabilization, although de-repression by this peptide is worse among the tested BH3 peptides, supporting the combined contribution of direct BAK activation and MCL-1 : BAK de-repression to BAK-mediated poration as well as further validating the BH3-in-groove structure of the MCL-1 : BAK complex.Example 6 - Co-expression of BAK and MCL-1 in BCL2allKO HCT116 reveals inadequate activities of MCL-1 inhibitors in neutralizing MCL-1 :BAK complexes

[0189] Next, the MCL-1 :BAK complex was investigated pharmacologically in minimalist systems testing its neutralization with selective MCL-1 inhibitors. First, KD values were determined by MST for binding to MCL-1 of the BH3 mimetics S63845 (S6), AMG-176 (AMG) and AZD5991 (AZD) in the presence or absence of micellar DDM. In this assay, AZD had the highest affinity for MCL-1 among the three BH3 mimetics exhibiting the most pronounced difference in KD values the absence (21.6±3.4 nM) and presence of DDM (86.1 ±14.7 nM), followed by AMG with intermediate KD values (-DDM 191.7±26.3 nM; +DDM 181.3±39.4 nM) and S6 with the lowest KD values (-DDM 495.5±77.1 nM; +DDM 414.3±31.0 nM) (FIG. 12A, FIG. 13B). Derepression of the MCL- 1 :BAK complex was tested in competitive MST assays by the BH3 mimetics which exhibited rather poor performance by the lack of MST fluorescent signal saturation at pM doses (FIG. 12B). Although the MST half maximal changes in competitive MST assays cannot be interpreted as IC50 values it was summarized as 98.1 nM (AZD), 742.6 nM (AMG), and 5288 nM (S6) to help with ranking their potential in neutralizing MCL-1 : BAK (FIG. 12B)

[0190] To test neutralization of the MCL-1 :BAK complex at the level of mitochondria, mitochondria were purified from stable BCL2allKO HCT116 cell lines expressing Cerulean-FL MCL-1 (Cer-MCL-1 ) constitutively and mCherry-FL BAK (mC- BAK) based on the Tet-On doxycycline (Dox)-inducible strategy (FIG. 12C). Immunoblotting shows Cer-MCL-1 and mC-BAK expression (FIG. 13B). Mitochondria purified from these cells after overnight treatment with Dox (125 ng / mL) had slightly higher levels of MCL-1 compared to BAK (~2-fold, FIG. 13E). These mitochondria released cyt c when challenged with the BH3 peptides from BIM, NOXA or BID at or above 5 nM, 50 nM and 50 nM, respectively (FIG. 12C). Among the MCL-1 inhibitors only AZD released cyt c at a dose lower than BIM BH3, whereas S6 and AMG were both equally or less potent than BIM BH3 (FIG. 12C). As control, we tested the BH3 peptides or MCL-1 inhibitors in the mitochondria purified from the same cells not treated with Dox and did not observe cyt c release for any of the conditions (FIG. 13F).

[0191] Finally, to test the apoptotic functions of BAK and MCL-1 in a minimalist reconstituted cellular system BCL2allKO HCT 116 cells expressing Tet-On mC- BAK and constitutive Cer-MCL-1 was challenged with DOX ± BH3 mimetics S6, AMG and AZD. Late apoptosis was monitored by uptake of the cell impermeable DNA-binding dye SYTOX Green whose counts represent dead cells. These cells were mostly resistant to Dox titration indicated by residual cell-death at high Dox suggesting that MCL-1 was not overexpressed and that it blocked BAK-mediated mitochondrial apoptosis initiation. These cells underwent robust dose-dependent cell death in the presence of the MCL-1 inhibitors based on SYTOX Green staining (FIG. 12D-12E, FIG. 12F, FIG. 13H, FIG. 131). Regardless of MCL-1 inhibitor addition with Dox (i.e. , sensitization) or 12h after Dox (i.e. , neutralization), S6 and AZD exhibited much higher EC50 values (>1 pM) compared to their mitochondrial poration activity (~50 nM and ~0.5 nM, respectively) suggesting poor bioavailability in cells, while AMG exhibited EC50 values (<200 nM) more closely resembling its mitochondrial poration activity (~50 nM). All MCL-1 inhibitors showed lower EC50 values in neutralization versus sensitization experiments, yet they exhibited ~8h delay in onset of cell death after inhibitor addition in the neutralization experiments suggesting issues with their bioavailability (FIG. 131). Apoptosis was confirmed in caspase-glo 3 / 7 assays and pharmacologically using the caspase inhibitor qVD (FIGs. 12F-12G, FIGs. 13G-13J). It is noted that non-apoptotic cell death may ensue downstream of MOMP in the presence of qVD46, which may explain residual SYTOX Green staining in the presence of qVD.

[0192] To detect and quantify the endogenous MCL-1 :BAK complex in the minimalist systems, purified mitochondria was subjected to previously published limited proteolysis and cross-linking assays. It was observed the expected correlation between a lack of cyt c release in unstimulated mitochondria and an open BAK conformation sequestered by MCL-1 for 24% of total BAK detectable in calpain limited proteolysis, which generates a stable 20 kDa fragment (F2, FIG. 12H). Dormant BAK released from the mC-BAK fusion as a 25 kDa fragment (F1 , 17% of total BAK) was detected in unstimulated mitochondria (FIG. 12H). Upon stimulation of mitochondria with MCL-1 inhibitors or BH3 peptides we detected >50% of total BAK in the open conformation(fragment F2) and digestion of dormant BAK, suggesting BAK activation. Importantly, cysteine-targeted cross-linking with bismaleimidohexane (BMH) confirms BAK oligomerization only in stimulated mitochondria suggesting its sequestration by MCL-1 in unstimulated mitochondria (FIG. 12H). Finally, to further demonstrate formation and neutralization of endogenous MCL-1 : BAK complex by MCL-1 inhibitors we monitored livecell fluorescence resonance energy transfer (FRET) between Cer-MCL-1 donor and mC- BAK acceptor to detect a higher FRET signal in the presence of Dox and FRET signal collapse in the presence of MCL-1 inhibitor AMG (FIG. 121). Importantly, AMG addition considerably increased Cer-MCL-1 intensity in these cells, supporting the published observation that MCL-1 inhibitors stabilize MCL-1 increasing its levels, yet the FRET signal was significantly diminished suggesting efficient neutralization of the Mode II MCL- 1 :BAK complex (FIG. 121).Example 7 - Time Resolved Fluorescence Resonance Energy Transfer (TR-FRET) of MBP-MCL-1 :GST-BAK complex

[0193] TR-FRET assay was developed that measures the interaction between Terbium (Tb)-tagged GST-BAK and Alexa Fluor 647 (AF 647) labeled MBP- MCL-1 . Protein -protein interaction causes resonance energy transfer between Tb and AF647 at 650 nm wavelength. This assay was performed in a final volume of 20 pL Master mix (50 mM Tris, 50 mM KCI, 0.1 mg / ml BSA and 2 mM DTT) at room temperature (RT) in black Coming 384-well low-volume plates. In a typical assay sample, a 2x working solution of fluorescently labeled MBP-MCL-1 was prepared in the master mix, serially diluted with concentration ranging from 5 pM to 0.15 nM. Likewise, 2x working solution of 20 nM GST-BAK with 20 nM Tb-anti-GST was prepared in the Master mix to which 3.4 mM dodecyl maltoside DDM detergent (20x critical micellar concentration CMC) was also added with. As control, a 2x working solution with Tb-anti-GST alone was also prepared in Master mix with 3.4 mM DDM. Once the solution was ready, binding reaction was set by dispensing 10 pL of MBP-MCL-1 solution and 10 pL of GST-BAK + Tb solution, and the control sample was prepared by dispensing 10 pL of MBP-MCL-1 and10 pL of Tb- anti-GST alone. The assay components were mixed by shaking for 5 min at 600 rmp using an Eppendorf Thermomixer at RT and the plates were briefly centrifuged at 1000rpm for 2 min. The assay was incubated for 60 min and then readings were taken using a ClarioSTAR plate reader (BMG Labtech) to measure the fluorescence emission of each well at 660 nm and 620 nm, using a 340-nm excitation filter, 100 us delay, and a 200 us integration time. Raw data was exported and using Microsoft excel fluorescence emission ratio (10,000*660 nm / 620 nm) was calculated. Then, the control sample data was subtracted from the main sample data and the curve of normalized fluorescence emission ratio was plotted against concentration of labeled MBP-MCL-1 using GraphPad Prism version 10.2.3 and [Agonist] vs response three parameter binding curve equation was used to obtain the EC50 values. Representative experiments for the MBP-MCL-1 binding to GST-BAK G126R are shown in FIG. 14 and they mimic the values obtained by MST. This assay will be used to assess potency of compounds that neutralize the MCL-1 :BAK complex.Summary of the Examples

[0194] Structural elucidation of BCL-2 family protein -protein interactions is essential in understanding the regulation of apoptosis initiation and its targeting in disease including cancer (FIG. 15A). Despite hundreds of structures determined to date since 1996 and 1997 when the first structures of a BCL-2 family protein and its complex were solved for apo BCL-xL and the BCL-xL:BAK BH3 complex, respectively, the structure of the MCL-1 :BAK complex has not been determined previously although this complex is one of the key targets for proapoptotic cancer drugs. Cryo-EM, X-ray crystallography and NMR spectroscopy were integrated to comprehensively characterize the structure of the MCL-1 AK mode II complex. All previous BCL-2 family complexes have been based on reductionist approaches using truncated proteins focused largely on the BH3 peptides bound to a core domain, or the core domains of BAK and BAX comprised of helices a2- a5 and a2-a8 which homodimerize and heterodimerize. The reduction approaches casted doubt on the extent of protein-protein interactions of BCL-2 family complexes made by the full-length effectors, which are globular folded domains when dormant and change conformation upon activation adopting open states recognized by the guardians as well as dormant effectors. Could additional protein-protein interactions beyond those at theBH3-in-groove interface help effector sequestration in Mode II complexes, possibly explaining the inefficiency of MCL-1 inhibitors designed to bind the groove and sensitize, derepress Mode I complexes, and neutralize Mode II complexes? This study is important in answering this outstanding question, reporting the first cryo-EM structure for a BCL-2 family protein and complex and the first study of a BCL-2 family heterodimeric protein complex between two full-length globular domains. The structural analyses disclosed herein converged to support the BH3-in-groove heterodimerization, in line with previous knowledge, wherein the BAK BH3 helix occupies the hydrophobic groove of MCL-1 as the sole contributor to the prosurvival Mode II sequestration mechanism (FIG. 15A-15C).

[0195] This study reports a cryo-EM structure for a BCL-2 family protein and complex and the first study of a BCL-2 family heterodimeric protein complex between two full-length core domains. The structural analyses converged to support the BH3-in-groove heterodimerization, wherein the BAK BH3 helix occupies the hydrophobic groove of MCL- 1 , as the sole contributor to the prosurvival sequestration mechanism. The NMR analyses suggest that full-length BAK and BAK BH3 peptide bind to MCL-1 in a similar manner with their binding site mapped at the hydrophobic groove of MCL-1 based on the MCL-1 2D NMR spectral CSP analysis. The cryo-EM structure of the 40-kDa MCL-1 :BAK complex, determined using the fiducial mark Sab11 M:MBP (ref) to bulk up the complex for cryo- EM particle imaging, supports the BH3-in-groove heterodimerization and revealed that outside its BH3, BAK is a highly dynamic protein invisible by cryo-EM which is also inferred from our preliminary NMR analysis of BAK in this complex. The crystal structure of the MCL-1 :BAK BH3 complex corroborates the cryo-EM structure and provides a high- resolution snapshot for probing the complex biochemically and pharmacologically.

[0196] To probe the apoptotic functions of the high-affinity MCL-1 : BAK mode II complex in unprecedented ways using minimalist systems defined only by the two protein components, this complex was reconstituted in micellar detergent, liposomes, purified mitochondria, and cells. It was biochemically demonstrated that the MCL-1 :BAK complex is efficiently neutralized by the BH3 peptide of the promiscuous BH3-only protein BIM which exhibits high affinity for MCL-1. BIM BH3 is also one of the most potent BAK activators. Its concerted activities in BAK activation and MCL-1 inhibition make it a potentinducer of BAK-mediated membrane poration in liposomes and mitochondria. In contrast, NOXA BH3 which exhibits intermediate affinity for MCL-1 and is not a potent activator of BAK compared to BIM BH3 induced BAK-mediated membrane poration poorly in liposomes and mitochondria. Nonetheless, NOXA BH3 triggered V74A BAK-mediated liposome poration much better for the lower affinity mode 2 MCL-1 :V74A BAK complex than MCL-1 :WT BAK complex suggesting a considerable role for neutralization given that NOXA BH3 activates WT and V74A BAK similarly. On the other hand, the BH3 peptide of another promiscuous BH3-only protein BID, which is one of the most potent BAK activators with a relatively low affinity for MCL-1 compared to BIM BH3 and NOXA BH3, is a more potent inducer of BAK-mediated membrane permeabilization in the context of mode II complex than NOXA BH3 in mitochondria, although in liposomes BID BH3 is only better than NOXA BH3 in neutralizing the low affinity mode II MCL-1 :V74A BAK complex. The biochemical data support well the model for the mutual roles of BH3-only proteins in direct BAK activation and mode II neutralization leading to efficient BAK-mediated membrane poration.

[0197] MCL-1 is one of the most amplified genes in human cancer resulting in its overexpression and apoptosis resistance. For example, in multiple myeloma, its amplification is responsible for >40% of new cases and >70% of relapsed, refractory cases. Therefore, MCL-1 has been a sough after drug target. Before our study, it was not clear why mode II complexes are difficult to neutralize with supposedly highly potent, selective guardian inhibitors. In light of the BH3-in-groove sequestration mechanism reported here, one of the discovery in the study is that the selective MCL-1 inhibitors S6, AZD, and AMG are not potent in neutralizing Mode II MCL-1 :BAK complex formed in micellar detergents, with AZD MCL-1 inhibitors showing the best activity (double digit nM), while they all exhibit lower affinity for MCL-1 determined by MST than published. In purified mitochondria S6 and AMG exhibited similar or worse activity than BIM BH3, while AZD was better than BIM BH3 in neutralizing Mode II MCL-1 :BAK complex to release cyt c. In context of Mode II MCL-1 :BAK complex in BCL2allKO HCT116 cells these compounds induced on-target dose-dependent apoptosis at high doses poorly corelated with their on-target in vitro activity raising concerns with their bioavailability. New MCL-1inhibitors must be designed to have better potency and bioavailability in neutralizing Mode II MCL-1 :BAK complex. It is speculated that inadequate activities of existing MCL-1 inhibitors may lead to apoptosis resistance mechanisms that have been discovered to manifest through proteasomal degradation of Mode II MCL-1 :BAK complex as well as to possible cardiotoxicity suggested for MCL-1 inhibitors. Though, the mechanisms of cardiotoxicity induced by MCL-1 inhibitors is not fully understood, yet they have been shown to exhibit off-target effects including dysregulation of mitochondrial dynamics in cardiomyocytes leading to loss of viability. Additionally, on-target cardiotoxicity was suggested from cardiomyocyte conditional mcl-1 knockout studies in mice that promoted BAK- and BAX-mediated apoptosis which was attenuated on effector-null background.

[0198] A caveat to our structural analysis is that the N- and C-terminal regions of MCL-1 and BAK, which are intrinsically disordered and highly hydrophobic precluding efficient protein expressions and purification, respectively, have been purposely excluded. In addition to anchoring the BCL-2 family proteins to the target membrane, the C-terminal putative transmembrane targeting tails (TMs) have been shown to interact in membrane with TMs of binding partners and outside membrane with the globular domains of binding partners. The study has not investigated the contributions of the TMs to Mode II MCL-1 : BAK sequestration. Nonetheless, the mitochondrial and cellbased evaluation done on the full-length MCL-1 : BAK mode II complex have corroborated the liposome and detergent experiments with the truncated core domains of MCL-1 and BAK suggesting that the excluded regions do not contribute to membrane permeabilization significantly. Moreover, it was previously showed that the N-terminus of MCL-1 , predicted to be intrinsically disordered in AlphaFold, prevents access of BH3 peptides to the hydrophobic groove as indicated by a lower affinity of these peptides in FL-MCL-1 compared to the MCL-1 constructs truncated at the N-terminus (ref). It cannot be excluded that the N-terminal IDR of MCL-1 as well as the dynamic conformation of BAK in the context of mode II MCL-1 :BAK complex contribute to stabilization of the complex at mitochondrial membranes, but the de-repression analysis and previous mutagenesis studies supports that the defining contributor to mode II inhibition is largely attributed to BAK BH3. Given the similarity of the core domains of the prosurvial guardiansBCL-2, BCL-xL, BCL-w and A1 with MCL-1 , they were expected to have their full-length mode II complexes to have very similar sequestration mechanisms governed primarily by BH3-in-groove heterodimerization. Similarly, it was expected that in trans autoactivated dormant BAK / BAX: activate BAK complexes will exhibit similar conformation as the MCL- 1 :BAK complex. It is noted that regions in the immediate vicinity of the BH3 regions of BAX may form additional interactions with the core domains of prosurvival binding partners as reported for the BCL-2: BAX BH3 complex. Therefore, the mechanistic study has far reaching implications for the inhibition of mitochondrial apoptosis initiation in the context of mode 2 guardian:PFP complexes, autoactivated BAK complexes, as well as their pharmacologic targeting in disease.

[0199] In summary, disclosed herein is the mechanisms of inhibition of mitochondrial apoptosis by Mode II guardian: effector complexes and autoactivated BAK and BAX complexes, as well as their pharmacologic targeting in disease. The systems disclosed herein may be used for identification of modulators of MCL-1 .Sequences

Claims

CLAIMSWhat is claimed is:1 . A method of identifying a modulator of BCL2 antagon ist / kil ler (BAK) binding of Myeloid cell leukemia-1 (MCL-1 ) comprising: contacting a test compound with an assay system, wherein the assay system comprises: a) a fluorescently labelled maltose binding protein (MBP) linked to MCL-1 polypeptide b) a BAK polypeptide; and c) a solid substrate; and monitoring fluorescence, wherein the test compound is identified as a modulator when a difference in the fluorescence is determined in the presence of the test compound compared to the fluorescence determined in absence of the test compound.

2. The method of claim 1 , wherein the fluorescence is determined in the presence of a detergent.

3. The method of claim 2, wherein the detergent is dodecylmaltoside (DDM).

4. The method of claim 1 , wherein the fluorescence label is a dye, chromogen, or fluorophore.

5. The method of claim 4, wherein the fluorescence label is a fluorophore Alexa Fluor™.

6. The method of claim 5, wherein the fluorescence is monitored using Microscale thermophoresis.

7. The method of claim 5, wherein the fluorescence is monitored using Time Resolved Fluorescence Resonance Energy Transfer (TR-FRET).

8. The method of claim 7, wherein the BAK polypeptide is further labeled with a fluorescence label.

9. The method of claim 8, wherein the label comprises Terbium.

10. A method of identifying a modulator of BAK binding of MCL-1 comprising: contacting a test compound with an assay system, wherein the assay system comprises: a) an MCL-1 polypeptide linked to an MBP; b) a fluorescently labelled alpha helix of BH3 interacting-domain death agonist (BID) polypeptide; and c) a solid substrate; and monitoring fluorescence, wherein the test compound is identified as a modulator when a difference in the fluorescence is determined in the presence of the test compound compared to the fluorescence determined in absence of the test compound.

11. The method of claim 10, wherein the fluorescence label is a dye, chromogen, or fluorophore.

12. The method of claim 11 , wherein the fluorescence label is Fluorescein (FAM).

13. The method of claim 12, wherein the fluorescence is monitored using fluorescence polarization.

14. The method of any one of claims 1 or 10, wherein the MCL-1 polypeptide linked to the MBP through a GS linker.

15. The method of claim 14, wherein the MCL-1 polypeptide comprises an amino acid sequence of any one of SEQ ID NOs: 15-16.

16. The method of any one of claims 1 or 10, wherein the MBP comprises an amino acid sequence of SEQ ID NO: 14.

17. The method of any one of claims 1 or 10, wherein the MCL-1 polypeptide linked to the MBP comprises an amino acid sequence of any one of SEQ ID NOs: 19-20.

18. The method of any one of claims 1 or 10, wherein the solid substrate is a multiwell plate, microarray, a microsphere, or a capillary.

19. The method of any one of claims 1 or 10, further comprising contacting the assay system with an isolated BAK polypeptide.

20. The method of claim 19, wherein the isolated BAK polypeptide of the assay system comprises an amino acid sequence of SEQ ID NO: 1 .

21. The method of claim 20, wherein the BAK polypeptide comprises an amino acid sequence of any one of SEQ ID NO: 1-12, or 17-18.

22. The method of claim 10, wherein the BID polypeptide comprises the amino acid sequence of SEQ ID NO: 13.

23. An assay system for use with the method of any one of claims 1 or 10.

24. A cell expressing one or more polypeptides of the assay system of claim 23.

25. A liposome encapsulating one or more polypeptides of the assay system of claim 23.

26. An isolated mitochondria expressing one or more polypeptides of the assay system of claim 23.

27. An assay system comprising: a cell expressing a labeled MCL-1 polypeptide, a labeled BAK polypeptide, and a solid substrate.

28. The assay system of claim 27, wherein the cell constitutively expresses labeled MCL-1 polypeptide.

29. The assay system of claim 28, wherein the labelled MCL-1 polypeptide is cerulean labeled MCL-1 polypeptide.

30. The assay system of claim 29, wherein the MCL-1 polypeptide comprises an amino acid sequence of any one of SEQ ID NOs: 15-16.

31. The assay system of claim 30, wherein the cerulean labeled MCL-1 polypeptide comprises an amino acid sequence of SEQ ID NO: 22.

32. The assay system of claim 27, wherein the labeled BAK polypeptide is a mCherry labeled BAK polypeptide.

33. The assay system of claim 32, wherein the expression of labeled BAK polypeptide is inducible.

34. The assay system of claim 33, wherein the expression of labeled BAK polypeptide is inducible by tetracycline (Tc) or doxycycline (Dox).

35. The assay system of claim 34, the BAK polypeptide comprises an amino acid sequence of any one of SEQ ID NOs: 1 -12, or 17-18.

36. The assay system of claim 34, wherein the mCherry labeled BAK polypeptide comprises the sequence of SEQ ID NO: 21.

37. The assay system of claim 27, wherein the cell does not express endogenous BCL2 proteins.

38. The assay system of claim 37, wherein the cell is a BCL2allKO HCT 116 cell.

39. A method of identifying a modulator of BAK binding of MCL-1 comprising: contacting a test compound with the assay system of claim 27; and monitoring cell death and / or mitochondrial membrane permeabilization, wherein the test compound is identified as a modulator of BAK binding of MCL-1 when a difference in cell death and / or mitochondrial membrane permeabilization is determined in the presence of the test compound compared to the cell death and / or mitochondrial membrane permeabilization determined in absence of the test compound.

40. The method of claim 39, wherein the cell death is determined using a dye release or by measuring caspase-3 / 7 activities.41 . The method of claim 40, wherein the dye is SYTOX Green.

42. The method of claim 39, wherein the mitochondrial membrane permeabilization is monitored by determining the presence of cytochrome c by immunoblotting.

43. A method of identifying a modulator of BAK binding of MCL-1 comprising: contacting a test compound with the assay system of claim 27; and monitoring the formation or neutralization of MCL-1 :BAK complex using livecell fluorescence resonance energy transfer (FRET).

44. A mitochondrion isolated from the cell of the assay system of claim 38.

45. A method of identifying a modulator of BAK binding of MCL-1 comprising: contacting a test compound with the mitochondrion of claim 44; and monitoring mitochondrial membrane permeabilization, wherein the test compound is identified as a modulator of BAK binding of MCL-1 when a difference in mitochondrial membrane permeabilization is determined in the presence of thetest compound compared to the mitochondrial membrane permeabilization determined in absence of the test compound.

46. The method of claim 45, wherein the mitochondrial membrane permeabilization is monitored by determining the presence of cytochrome c by immunoblotting.

47. A method of identifying a modulator of BAK binding of MCL-1 comprising: contacting a test compound with the mitochondrion of claim 44; and monitoring a conformational change of the BAK and MCL-1 complex using proteolysis by calpain, wherein the test compound is identified as a modulator of BAK binding of MCL-1 by determining the presence of one or more cleaved fragments in the presence of the test compound compared to the cleaved fragments determined in absence of the test compound.

48. The method of claim 47, wherein the cleaved fragments are determined using immunoblotting.

49. The method of claim 47, further comprising contacting the mitochondrion with a cysteine-directed crosslinking agent.

50. The method of claim 49, wherein the test compound is identified as a modulator of BAK binding of MCL-1 by determining the presence of one or more monomers or oligomers in the presence of the test compound compared to the monomers or oligomers determined in absence of the test compound.

51. The method of claim 49, wherein the one or more monomers or oligomers are determined using immunoblotting.

52. The method of claim 49, wherein the cysteine-directed crosslinking is performed using bismaleimidohexane (BMH).

53. A protein complex comprising MCL-1 polypeptide linked to a maltose binding protein (MBP) and a BAK polypeptide, wherein a linker between the MCL-1polypeptide and the MBP is a rigidified linker with C-terminal helix of MBP bend at the linker into the N-terminal helix of MCL-1 .

54. The protein complex of claim 53, wherein the rigidified linker comprises an amino acid sequence of II.

55. The protein complex of claim 53, wherein the BAK polypeptide has a G126R mutation.

56. The protein complex of claim 53, wherein the MBP is linked to the N-terminus of the MCL-1.

57. The protein complex of claim 53, wherein the complex further comprises an antibody, or a fragment thereof, that binds to MBP.

58. The protein complex of claim 57, wherein the antibody is a Fab fragment.

59. The protein complex of claim 58, wherein the antibody is a human Anti-E. coli MBP Recombinant Antibody Clone sAB11 M.

60. The protein complex of claim 53, wherein the BAK polypeptide in the complex forms a helix a2.61 . The protein complex of claim 53, wherein the BAK polypeptide in the complex does not include a helix ot3.

62. The protein complex of claim 53, wherein the BAK polypeptide comprises an amino acid sequence of any one of SEQ ID NOs: 1 -12 or 17-18.

63. The protein complex of claim 53, wherein the MBP comprises an amino acid sequence of SEQ ID NO: 14.

64. The protein complex of claim 53, wherein the MCL-1 polypeptide comprises an amino acid sequence of any one of SEQ ID NOs: 15-16.

65. The protein complex of claim 53, wherein the MCL-1 polypeptide linked to the MBP comprises an amino acid sequence of SEQ ID NO: 20.

66. The protein complex of claim 53, wherein the BAK polypeptide binds to hydrophobic groove of MCL-1 at one or more residues T70, M71 , V74, L78, G82, D83, I85, or Y89 of WT BAK.

67. A method of identifying a identifying a modulator of BAK binding of MCL-1 comprising: contacting a test compound with the protein complex of claim 53.

Images