Method for prognosis of bladder cancer
The PROSIBLAD multigene signature addresses the inadequacies in NMIBC staging by predicting disease progression, enhancing treatment decision-making and reducing the risk of MIBC through personalized management.
Patent Information
- Application Number
- PCT/EP2025/071967
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-07-31
- Filing Date
- 2025-07-30
- Publication Date
- 2026-02-05
AI Technical Summary
Current staging criteria for nonmuscle invasive bladder cancer (NMIBC) are inadequate, leading to incorrect staging and inadequate treatment, with a high risk of progression to muscle-invasive BCa (MIBC), and there is a lack of effective biomarkers for predicting disease progression and treatment response.
A multigene molecular signature, PROSIBLAD, is developed to predict the progression of bladder cancer by determining the expression levels of specific genes, providing a prognostic tool for NMIBC patients, guiding personalized treatment decisions.
The PROSIBLAD signature accurately stratifies NMIBC patients at risk of progressing to MIBC, enabling personalized management and improving treatment outcomes.
Smart Images

Figure IMGF000026_0001 
Figure IMGF000027_0001 
Figure IMGF000028_0001
Abstract
Description
[0001] METHOD FOR PROGNOSIS OF BLADDER CANCER
[0002] FIELD OF THE INVENTION
[0003] The present invention relates to the field of methods to predict the progression of a disease. In particular, it is related to a method of prognosis of a subject affected by bladder cancer, by determining the expression level of a set of genes in an isolated sample from said subject.
[0004] BACKGROUND OF THE INVENTION
[0005] Bladder cancer (BCa) ranks among the most common neoplasms in industrialized countries1. Most BCa manifest as urothelial carcinomas, originating from the transitional epithelium lining the inner surface of the bladder2-4. Clinical staging of these tumors depends on the extent of invasion into the bladder wall and their grade of cellular differentiation2 4. Tumors that have penetrated the superficial layers, infiltrating the detrusor muscle and beyond, are classified as muscle-invasive BCa (MIBC), and constitute -25% of all BCa. Despite aggressive treatments, such as radical cystectomy and adjuvant platinum-based chemotherapy, MIBC has an overall poor prognosis, characterized by a high metastatic potential and a 5-year overall survival of -50%. The aggressive treatments are also associated with high morbidity, severe side effects and a diminished quality of life4-6.
[0006] Conversely, tumors confined to the inner lining of the bladder are classified as nonmuscle invasive BCa (NMIBC), representing -75% of newly diagnosed BCa cases2 7. NMIBCs are highly heterogeneous, comprising tumors of different stage and grade: i) Ta papillary tumors, confined to the mucosa and typically low-grade / well- differentiated; ii) T1 tumors with submucosal invasion, representing a heterogeneous group that can present as either low- or high-grade / poorly differentiated lesions; and iii) carcinoma in situ (CIS; Tis in the TNM classification), typically presenting as flat and high-grade dysplasia lesions4. Although 5-year survival rates for NMIBC are favorable (>90%), a significant proportion of patients experience disease recurrence (-50-70%) and progression to MIBC disease (~20-30%)8. Notably, NMIBC patients who progress to MIBC often face a worse prognosis compared to patients with primary MIBC9. This, coupled with the lack of improvement in MIBC mortality rates, makes the transition from NMIBC to MIBC a life-threatening event. Therefore, high-risk NMIBC patients must undergo lifelong cystoscopic surveillance with bladder-sparing transurethral resection (TUR), often followed by adjuvant intravesical instillations of Bacillus Calmette-Guerin (BCG) or bladder perfusion chemotherapy to eradicate residual disease and reduce the frequency of recurrence and progression4’6 10. This treatment regimen makes BCa the most expensive cancer to treat11.
[0007] A deeper understanding of the biology underlying the NMIBC to MIBC transition is essential for an improved personalized management of NMIBC patients3’8’10’13.
[0008] The considerable heterogeneity of NMIBC presents challenges in its clinical management, exacerbated by the inadequacy of current staging criteria which heavily rely on clinicopathological characteristics. Incorrect staging can lead to understaging and subsequent undertreatment, negatively affecting survival, or overtreatment with early cystectomy, associated with significant morbidity8. Moreover, despite the numerous molecular alterations described for this disease, targeted therapies to prevent disease progression are currently lacking2’12'15.
[0009] The optimal management of NMIBC patients demands more accurate predictive biomarkers of recurrence and muscle-invasion progression to guide personalized clinical decision between life-saving earlier cystectomy, which has a heavy impact on quality of life, vs. quality-of-life-preserving conservative treatments, which however necessitate lifelong active surveillance with repeated cystoscopy and multiple resections over many years, with a huge financial impact on health care systems. Also, there is clinical evidence that NMIBC patients who have progressed to MIBC tend to have an even worse prognosis compared with patients with primary MIBC disease.
[0010] Consequently, there is a need for biomarkers of bladder cancer progression to guide clinical decision-making, particularly regarding the choice between conservative vs. aggressive treatments. More in particular, there is a need for biomarkers able to identify subjects with NMIBC who are likely to progress to MIBC.
[0011] SUMMARY OF THE INVENTION
[0012] Inventors identified a multigene molecular signature selected from a group of about 64 genes, herein defined also as PROSIBLAD (PRecision Oncology Signature for BLADder Cancer), upregulated as a consequence of the dysfunction of the tumor suppressor NUMB in bladder carcinogenesis, by the integration of multiomics and functional in vitro and in vivo studies leveraging mouse models, human established cell lines and real-life human bladder cancer samples. Of the utmost relevance to its clinical transferability, in the retrospective analysis of a large consecutive cohort of >400 NMIBC patients with complete longitudinal clinico- pathological follow-up, this signature, herein defined also as PROSIBLAD (PRecision Oncology Signature for Bladder Cancer) behaves as a predictive biomarker of adverse disease course, correctly stratifying NMIBC patients who have progressed to MIBC, independently of routine clinic-pathological parameters, arguing for its potential as an additional biomarker for MIBC risk prediction for personalized NMIBC patients’ management, beyond currently available standard clinical parameters.
[0013] Use of PROSIBLAD can be advantageous in the early selection of the most appropriate treatment course for high-grade NMIBCs.
[0014] The present invention therefore provides a genetic signature which can be easily and effectively used as a prognostic procedure for subjects affected by bladder cancer.
[0015] It is an object of the invention an in vitro method of screening a subject suffering from a bladder cancer for predicting prognosis of the disease comprising at least the step a) of determining the expression level of at least five genes in an isolated biological tissue sample from said subject, wherein said five genes are selected from the group consisting of GJC1 , NEDD9, INHBA, IL1A, CXCL1 , ATP1 B1 , GPR137B, BIRC6, ANKRD1 , CCN1 , CTNNA1 , CTSF, EFEMP1 , ERBB4, FAT4, FN1 , HSPE1 , MTMR2, PAPSS2, SPG21 , SPINK5, UTRN, CD34, MPDZ, STK39, PAK3, CXCL2, COL4A1 , COL4A2, APLN, SDC2, PPIC, SPARC, PGLYRP1 , DPYSL3, CXCL3, GKAP1 , DSEL, SORBS2, TMEM176B, INPP4B, TCEAL8, HDGFL3, GXYLT2, HSPB8, JAM2, RHOBTB3, LTBP1 , RBMS3, PTPRK, CCL2, SOX4, ALDH1A1 , PXDN, ZFP37, NIPSNAP3B, TMEM64, EIF5A2, GPR161 , FERMT1 , IGFBP7, VIM, TNC, ADCY9.
[0016] Said bladder cancer can be selected from muscle-invasive BCa (MIBC) and nonmuscle invasive BCa (NMIBC), preferably it is non-muscle invasive BCa (NMIBC).
[0017] In an embodiment, said method comprises determining the expression level of at least 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19 or 20 or more genes from the above list. In an embodiment, the expression level of at least 32 genes is determined.
[0018] In an embodiment, the expression level of all said genes, i.e. of 64 genes, or of at least all said genes is determined. Expression level of further genes may also be determined.
[0019] In a preferred embodiment, said at least five genes selected from the group consisting of GJC1 , NEDD9, INHBA, IL1A, CXCL1 , ATP1 B1 , GPR137B, BIRC6, ANKRD1 , CCN1 , CTNNA1 , CTSF, EFEMP1 , ERBB4, FAT4, FN1 , HSPE1 , MTMR2, PAPSS2, SPG21 , SPINK5, UTRN, CD34, MPDZ, STK39, PAK3, CXCL2, C0L4A1 , COL4A2, APLN, SDC2, PPIC, SPARC, PGLYRP1 , DPYSL3, CXCL3, GKAP1 , DSEL, S0RBS2, TMEM176B, INPP4B, TCEAL8, HDGFL3, GXYLT2, HSPB8, JAM2, RH0BTB3, LTBP1 , RBMS3, PTPRK, CCL2, S0X4, ALDH1A1 , PXDN, ZFP37, NIPSNAP3B, TMEM64, EIF5A2, GPR161 , FERMT1 , IGFBP7, VIM, TNC, ADCY9 comprise any of: INHBA, NEDD9, CXCL1 , GJC1 , GPR137B, ATP1 B1 , IL1 A, BIRC6.
[0020] In a preferred embodiment, said at least five genes are selected from the group consisting of: INHBA, NEDD9, CXCL1 , GJC1 , GPR137B, ATP1 B1 , IL1 A, BIRC6.
[0021] In a further preferred embodiment said at least five genes consist of INHBA, NEDD9, CXCL1 , GJC1 and BIRC6.
[0022] The method of the invention preferably comprises a further step b) wherein the expression level of the at least five genes as above defined is compared with the expression level of one or more reference genes, or their protein translation products, preferably wherein the expression level of the one or more reference gene or their protein translation product is measured in a tissue sample obtained from a subject not affected by bladder cancer or in a tissue sample of a tumor displaying Numb-proficient expression, relative to the normal tissue counterpart. Preferably, the method further comprises a step c) of determining a prognosis by means of said comparison.
[0023] In an embodiment, determining a prognosis includes classifying said subject in one of at least two classes corresponding to levels of progression of the disease. Said classes may be better prognosis, intermediate prognosis and worse prognosis.
[0024] In an embodiment, determining a prognosis comprises stratifying the subject as a subject who is or is not likely to progress from NMIBC to MIBC. Said subject can be classified as high risk or low risk.
[0025] It is an object of the invention an in vitro method of screening a subject suffering from a bladder cancer or having suffered from a bladder cancer for predicting risk of recurrence or progression of the disease comprising at least the step of determining the expression level of at five genes in an isolated biological sample from said subject, wherein said gene is selected from the group consisting of GJC1 , NEDD9, INHBA, IL1A, CXCL1 , ATP1 B1 , GPR137B, BIRC6, ANKRD1 , CCN1 , CTNNA1 , CTSF, EFEMP1 , ERBB4, FAT4, FN1 , HSPE1 , MTMR2, PAPSS2, SPG21 , SPINK5, UTRN, CD34, MPDZ, STK39, PAK3, CXCL2, COL4A1 , COL4A2, APLN, SDC2, PPIC, SPARC, PGLYRP1 , DPYSL3, CXCL3, GKAP1 , DSEL, S0RBS2, TMEM176B, INPP4B, TCEAL8, HDGFL3, GXYLT2, HSPB8, JAM2, RH0BTB3, LTBP1 , RBMS3, PTPRK, CCL2, S0X4, ALDH1A1 , PXDN, ZFP37, NIPSNAP3B, TMEM64, EIF5A2, GPR161 , FERMT1 , IGFBP7, VIM, TNC, ADCY9, preferably the expression level of at least 8 or of at least 32 or of all said genes or of at least all said genes is determined. Expression level of further genes may also be determined.
[0026] A further object of the invention is an in vitro method of screening a subject suffering from a bladder cancer for predicting response to an anti-cancer treatment preferably directed to the RhoA / ROCK / YAP pathway comprising at least the step of determining the expression level of at least five genes in an isolated biological sample from said subject, wherein said at least five genes are selected from the group consisting of GJC1 , NEDD9, INHBA, IL1 A, CXCL1 , ATP1 B1 , GPR137B, BIRC6, ANKRD1 , CCN1 , CTNNA1 , CTSF, EFEMP1 , ERBB4, FAT4, FN1 , HSPE1 , MTMR2, PAPSS2, SPG21 , SPINK5, UTRN, CD34, MPDZ, STK39, PAK3, CXCL2, COL4A1 , COL4A2, APLN, SDC2, PPIC, SPARC, PGLYRP1 , DPYSL3, CXCL3, GKAP1 , DSEL, SORBS2, TMEM176B, INPP4B, TCEAL8, HDGFL3, GXYLT2, HSPB8, JAM2, RHOBTB3, LTBP1 , RBMS3, PTPRK, CCL2, SOX4, ALDH1A1 , PXDN, ZFP37, NIPSNAP3B, TMEM64, EIF5A2, GPR161 , FERMT1 , IGFBP7, VIM, TNC, ADCY9, preferably the expression level of at least 8 or of at least 32 or of all said genes or of at least all said genes is determined. Expression level of further genes may also be determined.
[0027] In a preferred embodiment the method of screening a subject suffering from a bladder cancer for predicting prognosis of the disease or for predicting risk of recurrence of the disease or for predicting response to an anti-cancer treatment directed to the RhoA / ROCK / YAP pathway, comprises the step a) of determining the expression level of at least five genes selected from the group consisting of CCN1 , CTSF, ERBB4, FAT4, FN1 , MTMR2, SPINK5, UTRN, MPDZ, STK39, INHBA, SDC2, DPYSL3, SORBS2, NEDD9.TCEAL8, CXCL1 , HDGFL3, GJC1 , RHOBTB3, GPR137B, LTBP1 , PTPRK, CCL2, ATP1 B1 , ALDH1A1 , TMEM64, GPR161 , IL1A, FERMT1. VIM, BIRC6, preferably the expression level of at least eight genes or of at least all of the above genes is determined.
[0028] In a further preferred embodiment, said method comprises the step a) of determining the expression level of at least five genes selected from the group consisting of: INHBA, NEDD9, CXCL1 , GJC1 , GPR137B, ATP1 B1 , IL1A, BIRC6, preferably the expression level of all of the above genes is determined.
[0029] In a further preferred embodiment, said method comprises the step a) of determining the expression level of at least the following five genes: INHBA, NEDD9, CXCL1 , GJC1 and BIRC6.
[0030] A kit for performing the method of the invention is a further object of the invention, said kit comprising at least means for determining in an isolated biological sample from a subject the expression level of at least five genes as above defined. Said kit preferably further comprises means to compare the expression level of the genes with the expression level of one or more reference gene, or their protein translation products, preferably wherein the expression level of the one or more reference gene or their protein translation product is measured in a tissue sample obtained from a subject not affected by bladder cancer or in a tissue sample of a tumor displaying Numb-proficient expression, and optionally means for providing prognostic information.
[0031] The method of the invention can be implemented in a data processing device, such as a computer. Any suitable data processing device can be used for implementing the method of the invention.
[0032] A computer program comprising instructions which, when the program is executed by a computer, cause the computer to carry out the method of the invention is a further object of the invention.
[0033] A data processing device comprising means adapted for carrying out the method of the invention is a further object of the invention. Said data processing device preferably comprises: i) means for receiving data representing the expression level of at least five genes, or their protein translation products, as above defined in an isolated biological sample from a subject; ii) means for receiving data representing at least one reference gene expression levels; and iii) means for providing a prognosis of the disease, and / or for predicting risk of recurrence of the disease and / or for predicting response to an anti-cancer treatment preferably directed to the RhoA / ROCK / YAP pathway.
[0034] It is a further object of the invention method for determining a bladder cancer treatment for a subject affected by bladder cancer comprising the steps of: a) determining the expression level of the at least five genes as above defined in an isolated biological sample from said subject, wherein said at least five genes are selected from the group consisting of GJC1 , NEDD9, INHBA, IL1 A, CXCL1 , ATP1 B1 , GPR137B, BIRC6, ANKRD1 , CCN1 , CTNNA1 , CTSF, EFEMP1 , ERBB4, FAT4, FN1 , HSPE1 , MTMR2, PAPSS2, SPG21 , SPINK5, UTRN, CD34, MPDZ, STK39, PAK3, CXCL2, COL4A1 , COL4A2, APLN, SDC2, PPIC, SPARC, PGLYRP1 , DPYSL3, CXCL3, GKAP1 , DSEL, SORBS2, TMEM176B, INPP4B, TCEAL8, HDGFL3, GXYLT2, HSPB8, JAM2, RHOBTB3, LTBP1 , RBMS3, PTPRK, CCL2, SOX4, ALDH1A1 , PXDN, ZFP37, NIPSNAP3B, TMEM64, EIF5A2, GPR161 , FERMT1 , IGFBP7, VIM, TNC, ADCY9; preferably the at least five genes are selected from the group consisting of CCN1 , CTSF, ERBB4, FAT4, FN1 , MTMR2, SPINK5, UTRN, MPDZ, STK39, INHBA, SDC2, DPYSL3, SORBS2, NEDD9.TCEAL8, CXCL1 , HDGFL3, GJC1 , RHOBTB3, GPR137B, LTBP1 , PTPRK, CCL2, ATP1 B1 , ALDH1 A1 , TMEM64, GPR161 , IL1A, FERMT1 , VIM, BIRC6; still preferably the at least five genes are selected from the group consisting of: INHBA, NEDD9, CXCL1 , GJC1 , GPR137B, ATP1 B1 , IL1 A, BIRC6; still preferably the at least five genes are INHBA, NEDD9, CXCL1 , GJC1 and BIRC6; b) comparing the expression level of the at least five genes, with the expression level of one or more reference genes, or their protein translation products; c) determining a prognosis of said subject based on said comparison and d) determining a bladder cancer treatment for said subject based on said prognosis, preferably said bladder cancer treatment comprising surgery, radiation and / or an anticancer or chemotherapeutic agent, wherein said anti-cancer agent is directed against the RhoA / ROCK / YAP pathway and is preferably selected from Fasudil, Belumosudil, Ripasudil, Fasudil, Y27632, Netarsudil, Verteporfin, VT-3989, IK-930 or combination thereof; and / or wherein said anti-cancer is the Bacillus Calmette-Guerin; and / or wherein said anti-cancer or chemotherapeutic agent is a Focal Adhesion Kinase (FAK) inhibitor selected from defactinib, GSK2256098, IN10018 and others; and / or wherein said anti-cancer or chemotherapeutic agent is a dual ROCK / AKT inhibitor selected from AT13148 and others; and / or wherein said anti-cancer or chemotherapeutic agent is selected from anthracycline agents, alkylating agents, nucleoside analogs, platinum agents, vinca agents, anti-estrogen drugs, aromatase inhibitors, ovarian suppression agents, endocrine / hormonal agents, bisphophonate therapy agents and targeted biological therapy agents (e.g., antibodies), preferably said agent being selected from cyclophosphamide, fluorouracil (or 5-fluorouracil or 5-FU), methotrexate, thiotepa, carboplatin, cisplatin, gemcitabine, anthracycline, taxanes, paclitaxel, protein-bound paclitaxel, doxorubicin, docetaxel, vinorelbine, tamoxifen, raloxifene, toremifene, fulvestrant, irinotecan, ixabepilone, temozolmide, topotecan, vincristine, vinblastine, eribulin, mutamycin, capecitabine, capecitabine, anastrozole, exemestane, letrozole, leuprolide, abarelix, buserlin, goserelin, megestrol acetate, risedronate, pamidronate, ibandronate, alendronate, denosumab, zoledronate, trastuzumab, tykerb, bevacizumab, inhibitors of protein kinases, immunotherapy, immune checkpoint inhibitors, and combinations thereof.
[0035] DETAILED DESCRIPTION OF THE INVENTION
[0036] Figures
[0037] Figure 1. Numb loss is prognostic in human BCs and correlates with NMIBC progression and YAP activation. a. Representative IHC image of an area of Numb-deficient MIBC (left arrowhead) bordering the normal urothelium expressing Numb (right arrowhead). Bar, 400 pm. b. Overall survival of post-cystectomy MIBC patients (n=258) stratified by Numb expression (NumbHighvs. NumbLow) determined by IHC (see also Fig. 8a and 8b for cohort description and multivariable analysis). HR, hazard ratio (95% confidence interval); p, Log Rank test p-value; n, patient number; in this and all other relevant panels. c. Top, Representative IHC images of Numb expression in high-grade NumbHighand NumbLowNMIBC. Boxed areas are magnified (Mag.) on the right. Bars, 1 mm; Mag. 100 pm. Bottom, progression-free survival of NMIBC patients (n=77) stratified by Numb expression (see also Fig. 8c and 8d for cohort description and multivariable analysis). d. Immunoblot of Numb expression in MIBC NumbLowcell lines (HT1376, CLS439, 5637) and NMIBC NumbHighcell lines (KK47, RT4, RT112). Actin, loading control. e. Immunoblot of Numb expression in RT4, RT112 and KK47 NIMBC cells knocked down for Numb by siRNA (Numb-KD) or mock siRNA in controls (Ctr-KD). Vinculin (Vine.), loading control. f. The Venn diagram shows the number of activated transcriptional regulators and their intersection identified by the independent comparison of the RT4, RT112 and KK47 NIMBC cells, Numb-KD vs. Ctr-KD. The 4 common YAP / TAZ transcriptional regulators (MRTFA / B, YAP and TEAD3) appearing in the Venn diagram intersection on the left were among the 52 activated transcriptional regulators identified in the integrative transcriptomic analysis of the NumbLowvs. NumbHighcell lines, as indicated in the internal circle (see Fig. 9a for the complete list of regulators). g. GSEA showing enrichment of an active YAP / TAZ (top panels) and EMT (bottom panels) gene signature in the set of common differentially expressed genes across the 3 NUMBLowvs. 3 NumbHighcell lines (left) and between the Numb-KD vs. CTR-KD condition in each of the indicated NumbHighcell lines (right), n = 2 for each condition of each cell line; ES, Enrichment Score; NES, Normalized Enrichment Score; p, permutation test p-value. h. Progression-free survival of NMIBC patients of the UROMOL cohort (n=535) stratified with the NumbLESSsignature into NumbLESS-Like (n=254) or NUMBLESS-Not- Like (n=281 ) groups, corresponding to a Numb-deficient or Numb-proficient status, respectively (see also Fig. 9d for multivariable analysis). i. NMIBC patients of the UROMOL cohort stratified with the NumbLESSsignature into NumbLESS-Like or NUMBLESS-Not-Like groups (as shown in h) were further classified as YAP / TAZ active (ON) or inactive (OFF) based on the expression of the 22-gene YAP / TAZ signature (as in g) (see also Fig. 9e and Methods). ****, p<0.0001 , by Fisher’s exact test. j. Left, Immunofluorescence analysis of YAP expression (red) and DAPI nuclear stain (blue) in high-grade NumbHighvs. NumbLowNMIBC tumors. Boxed areas in the upper panels are magnified (Mag.) in the lower panels. Bars, 1 mm in upper panels; Mag., 50 pm. Right, quantification of the % of YAP-positive cells expressed as mean ± SEM of 4 NumbHighand 5 NumbLowNIMBC. *, p=0.038, by Welch’s t-test. k. Left. Progression-free survival of NMIBC patients of the UROMOL cohort (n=535) stratified with the NumbLESS15-UP signature (i.e. ADCY9, ANKRD1 , CCN1 , CTNNA1 , CTSF, EFEMP1 , ERBB4, FAT4, FN1 , HSPE1 , MTMR2, PAPSS2, SPG21 , SPINK5, UTRN). HR, hazard ratio (95% confidence interval); p, Log Rank test p-value. Right. Multivariable progression-free survival (PFS) analysis of the association between the indicated factors and good (HR<1 ) or poor (HR>1 ) prognosis in 535 NMIBC patients from the UROMOL cohort, by Cox proportional hazards model. Significant associations are marked in red. HR, multivariable hazard ratios; 95% confidence intervals (Cl); p, Wald-test p-value.
[0038] Figure 2. Numb loss drives spontaneous malignant transformation of the normal urothelium and accelerates carcinogen-induced bladder tumorigenesis. a. Representative IHC images showing endogenous Numb expression in the urothelium of untreated adult WT (WT) and Numb-KO (KO) mice. Bars, 100 pm. b. Left, Representative H&E images of the normal WT urothelium, and preneoplastic (Hyperplasia) and neoplastic (carcinoma in situ, CIS; invasive cancer, IC) urothelial lesions from Numb-KO mice. The black arrowhead indicates IC. Bars, 100 pm. Right, quantification of the incidence (%) of histological phenotypes in the urothelium of untreated, aged-matched 4- to 12-month old WT (n=28) and Numb-KO (n=23) mice. ****, p=0.00002 by Pearson's Chi-squared test. Odds ratio (OR) with 95% Cl and associated p-value by Fisher’s exact test is shown. c. Aged-matched 8- to 16-week-old WT (n=39) and Numb-KO (n=37) mice were exposed to 0.05% BBN in the drinking water for 16 weeks followed by a 2-week washout period (see Fig. 10d). Bladder tissues were harvested and examined for histological changes (H&E) and Numb expression (IHC). Left, Representative images of a preneoplastic (Hyperplasia) lesion from BBN-WT mice and neoplastic (CIS and IC) lesions from BBN-Numb-KO mice. Right, quantification of the incidence (%) of histological phenotypes in WT vs. KO mice at the end of treatment. Bars, 100 pm. *, p=0.025 by Pearson's Chi-squared test; OR (95% Cl) with associated p-value by Fisher’s exact test is shown. d. Kaplan-Meier plot showing the disease-specific survival (%) of aged-matched 8- to 16-week-old WT (n=14) and Numb-KO (n=13) mice treated for 20 weeks with BBN before switching to regular drinking water. Mice were sacrificed according to endpoints (see Fig. 10d and Methods). Dashed-line, WT (n=10) and Numb-KO (n=10) untreated mice. HR, (95% Cl) with p-value by Log Rank test are shown. e. MIBC lesions excised from BBN-WT mice (n=13) were compared to the normal urothelium of untreated WT mice (n=8) for Numb expression by IHC. Shown are three MIBC lesions, one NumbHigh(WT1 ) and two NumbLow(WT2, WT3), and the normal NumbHighurothelium of untreated mice. Bars, 100 pm. f. Quantification of the experiment in ‘e’ showing the incidence (%) of NumbLowvs. NumbHighMIBC tumors induced by BBN treatment in WT mice. *, p=0.018 by Fisher’s exact test. g. Volcano plot of differentially expressed genes identified between tumor cells isolated from BBN-induced bladder cancer in Numb-KO and Numb-WT mice. The dark grey dots denote the top 50 upregulated protein-coding genes. h. Left. Progression-free survival of NMIBC patients of the UROMOL cohort (n=535) stratified with the BBN-KO 50-UP signature. HR, hazard ratio (95% confidence interval); p, Log Rank test p-value. Right. Multivariable progression-free survival (PFS) analysis of the association between the indicated factors and good (HR<1) or poor (HR>1 ) prognosis in 535 NMIBC patients from the UROMOL cohort, by Cox proportional hazards model. Significant associations are marked in red. HR, multivariable hazard ratios; 95% confidence intervals (Cl); p, Wald-test p-value. i. Venn diagram showing the overlap between the genes in the NumbLESS15-UP signature and in the BBN-KO 50-UP signature. ANKRD1 is the only common gene between the two gene sets. j. Left. Progression-free survival of NMIBC patients of the UROMOL cohort (n=535) stratified with a 65-gene signature derived from the sum of the average scores of the NumbLESS15-UP and BBN-KO 50-UP signatures. HR, hazard ratio (95% confidence interval); p, Log Rank test p-value. Right. Multivariable progression-free survival (PFS) analysis of the association between the indicated factors and good (HR<1) or poor (HR>1 ) prognosis in 535 NMIBC patients from the UROMOL cohort, by Cox proportional hazards model. HR, multivariable hazard ratios; 95% confidence intervals (Cl); p, Wald-test p-value.
[0039] Figure 3. Numb loss induces invasive phenotypes and YAP signaling activation in normal and tumor urothelial cells. a. Left, Representative confocal IF images of endogenous YAP expression in FFPE sections of WT and Numb-KO mouse bladder organoids (MBOs) grown in 3D-Matrigel. Nuclei are stained with DAPI. Bars, 100 pm; Mag., 50 pm. The % of YAP-positive cells (middle) and the mean nuclear YAP intensity (arbitrary units, A.U.) (right) are expressed as mean ± SEM, n=4 fields / condition from one experiment, representative of two independent experiments. *, p<0.05 vs. WT by Welch’s t-test. b. Representative images of WT- and Numb-KO MBOs grown in 3D-Matrigel in the presence of vehicle (Veh) or 25 nM Verteporfin (VP) for 10 days. Bar, 100 pm. c. Analysis of morphometric parameters (Area, Circularity, Roughness, and Shape Complexity) of WT vs. Numb-KO MBOs treated as in ‘b’. Area (pm2) is reported as the mean ± SEM. Other parameters are reported, in this and other relevant panels in the figure, as boxplots delimited by 25th and 75th percentiles and showing the median (horizontal line) and the mean (X). The whiskers span from the smallest and largest data values within a 1.5 interquartile range. Data were obtained from three independent experiments. ****, p<0.0001 ; ***, p<0.001 ; **, p<0.01 ; *, p<0.05; ns, not significant relative to matching condition by FDR-adjusted pairwise Welch’s t-test. d. Cells dissociated from BBN-induced bladder tumors in WT and Numb-KO mice (BBN-WT and BBN-KO) were grown as MBOs (BBN-MBO) in 3D-Matrigel in the presence of 25 nM VP or vehicle for 7 days. Morphometric parameters were assessed and reported as in ‘c’. Data were obtained from three independent experiments. e. Representative images of BBN-WT and BBN-KO tumor MBOs grown as in ‘d’. Bar, 100 pm. f. Transwell Matrigel invasion assay of BBN-WT and BBN-KO cells treated with VP (100 nM for 18 h) or vehicle. Graph shows the number of invading cel Is / field expressed as the mean ± SEM of 8 microscope fields covering the entire migratory area, from two independent experiments. ****, p<0.0001 ; ns, not significant by FDR-adjusted pairwise Welch’s t-test. g. RT-qPCR analysis for the indicated YAP transcriptional targets in BBN-WT vs. BBN- KO cells treated with VP (100 nM for 12 h) or vehicle. Graphs show the relative mean fold expression ± SEM from three independent experiments. ***, p<0.001 ; **, p<0.01 ; *, p<0.05 vs. matching condition, by FDR-adjusted unpaired one-sample t-test (vs. reference sample) or two-sample Welch’s t-test (VP- vs. vehicle-treated BBN-KO samples).
[0040] Figure 4. Rho-A / ROCK-dependent actin remodeling is involved in YAP hyperactivation downstream of Numb loss. a. BBN-WT and BBN-KO tumor cells were treated with the actin polymerization inhibitor LatA (500 nM for 6 h), Rho-A inhibitor C3 transferase (3 pg / ml for 6 h), ROCK inhibitor Y-27632 (ROCKi, 10 pM for 12 h), Rac1 inhibitor NSC-23766 (RACi, 10 pM for 12 h) or vehicle and co-stained for YAP, Numb and DAPI. Quantification of YAP nuclear / cytoplasmic ratio is shown. Graphs show the mean / field ± SEM, n=11 fields / condition, from two independent experiments. ****, p<0.0001 ; ***, p<0.001 ; ns, not significant, relative to matching controls by Tukey’s HSD test. Representative confocal images are shown in Fig. 14. b. Immunoblot analysis of the expression levels and phosphorylation status of Hippo pathway components (MST, LATS, YAP) in BBN-WT vs. BBN-KO cells, treated with C3 transferase (3 pg / ml, 6 h) or vehicle. Numb expression was verified. Actin, loading control. Blots shown are representative of two independent experiments. c. RT-qPCR for the indicated YAP transcriptional targets in BBN-WT vs. BBN-KO cells treated as in ‘b’. Graphs show the relative mean fold expression ± SEM from three independent experiments. **, p<0.01 ; *, p<0.05; ns, not significant vs. matching condition, by FDR-adjusted unpaired one-sample t-test (vs. reference sample) or two- sample Welch’s t-test (C3- vs. vehicle-treated BBN-KO samples). d. Pull-down assay of activated RhoA in BBN-WT vs. BBN- KO cells. The amount of RhoA-GTP protein bound to beads and total RhoA in cell lysates was measured by immunoblot using an anti-RhoA antibody. Blots are representative of two independent experiments. e. Representative confocal fluorescence images of BBN-WT and BBN-KO tumor cells transduced with a lentiviral vector encoding dominant negative RhoA (RhoA-DN) or empty vector (EV) and co-stained for RhoA, YAP and DAPI. Bars, 50 pm. Dashed line delineates a cluster of RhoA / DN overexpressing cells in BBN-KO cells. f. Quantification of YAP nuclear / cytoplasmic ratio in BBN-WT- and BBN-KO cells treated as in ‘e’. Graphs show the mean / field ± SEM, n=20 fields / condition, from two independent experiments. ****, p<0.0001 ; ns, not significant, relative to matching controls by Tukey’s HSD test. g. Morphometric analysis of tumor BBN-MBOs generated from cells described in ‘e’ (see legend to Fig. 3c for the quantification of morphometric parameters). Data were obtained from three independent experiments. ****, p<0.0001 ; ns, not significant, relative to matching condition by FDR-adjusted pairwise Welch’s t-test. h. Transwell Matrigel invasion assay of BBN-WT and BBN-KO cells treated with C3 transferase (3 pg / mL, 18h) or vehicle. Graph shows the number of invading cells / field expressed as the mean ± SEM of 8 microscope fields covering the migration area, from two independent experiments. ****, p<0.0001 ; ns, not significant, relative to matching controls by FDR-adjusted pairwise Welch’s t-test.
[0041] Figure 5. ROCK inhibition prevents YAP hyperactivation induced by loss of Numb. a. Immunoblot analysis of total and phosphorylated levels of cofilin and YAP in BBN- WT vs. BBN-KO cells. Actin, loading control. Data are representative of two independent experiments. b. Representative confocal images of BBN-WT and BBN-KO cells treated with vehicle or ROCK inhibitor Y-27632 (10 pM, 12 h) and co-stained for the phosphorylated form of MLC2 (pMLC2) and DAPI. Bar, 50 pm. c. Quantification of the experiment in ‘b’. Graphs show the relative intensity of pMLC2 in BBN-KO vs. BBN-WT cells expressed as the mean / field ± SEM, n=18 random fields / condition from two independent experiments. ****, p<0.0001 ; ns, not significant, relative to matching controls by Tukey’s HSD test. d. RT-qPCR of the indicated YAP transcriptional targets in BBN-KO vs. BBN-WT cells treated with ROCKi Y-27632 (10 pM, 8 h) or vehicle. Graphs show the relative mean fold expression ± SEM from three independent experiments. ****, p<0.0001 ; ***, p<0.001 ; **, p<0.01 ; *, p<0.05; ns, not significant, vs. matching condition by FDR- adjusted unpaired one-sample t-test (vs. reference sample) or two-sample Welch’s t- test (ROCKi vs. vehicle BBN-KO samples). e. Representative images of tumor BBN-MBOs generated from BBN-WT and BBN-KO cells treated with ROCKi (Y-27632, 10 pM). Bars, 100 pm. f. Morphometric analysis of the indicated parameters in BBN-MBOs derived from cells described in ‘e’ (see also legend to Fig. 3c). Data were obtained from three independent experiments. ****, p<0.0001 ; *, p<0.05; ns, not significant, relative to matching condition by FDR-adjusted pairwise Welch’s t-test. g. Transwell Matrigel invasion assay of BBN-WT and BBN-KO cells treated with ROCKi Y-27632 (10 pM, 18 h) or vehicle. Graph shows the number of invading cells / field expressed as the mean ± SEM of 8 random microscope fields covering the entire migration area, from two independent experiments. ****, p<0.0001 ; ns, not significant, relative to matching controls by FDR-adjusted pairwise Welch’s t-test.
[0042] Figure 6. Loss of Numb triggers RhoA / ROCK-dependent YAP hyperactivation in human RT4 BC cells. a. Immunoblot analysis of Numb and Hippo pathway components (MST, LATS, YAP) in control- (Ctr-KD) and Numb-silenced (Numb-KD) RT4 cells. Grp94, loading control. Data are representative of two independent experiments. b. Ctr-KD and Numb-KD RT4 cells were treated with actin polymerization inhibitor Latrunculin-A (LatA, 500 nM for 6 h), Rho-A inhibitor C3 transferase (C3, 3 pg / ml for 6 h), ROCK inhibitor Y-27632 (ROCKi, 10 pM for 12 h), Rac1 inhibitor NSC-23766 (RACi, 10 pM for 12 h) or vehicle and co-stained for endogenous YAP and DAPI. Representative confocal images are shown in Fig. 16a. Quantification of YAP nuclear / cytoplasmic ratio is shown as the mean / field ± SEM, n=8 fields / condition, from two independent experiments. ****, p<0.0001 ; ns, not significant, relative to matching controls by Tukey’s HSD test. c. Immunoblot analysis of Numb, and total and phosphorylated YAP and MST 1 in Ctr- KD vs. Numb-KD RT4 cells treated with vehicle orC3 transferase (3 pg / mL, 6 h). Actin, loading control. Data are representative of two independent experiments. d. Immunoblot analysis of Numb, total and phosphorylated cofilin, and phosphorylated MLC2 (p-MLC2), in Ctr-KD vs. Numb-KD RT4 cells. Actin, loading control. Blots are representative of two independent experiments. e. RT-qPCR of the indicated YAP transcriptional targets in Numb-KD vs. Ctr-KD RT4 cells treated with C3 (3 pg / ml, 6 h) (left) or ROCKi Y-27632 (50 pM, 8 h) (right), or vehicle. Graphs show the relative mean fold expression ± SEM from three independent experiments. ***, p<0.001 ; **, p<0.01 ; *, p<0.05; ns, not significant, vs. matching condition by FDR-adjusted unpaired one-sample t-test (vs. reference sample) or two- sample Welch’s t-test (drug vs. vehicle Numb-KD samples). f. Analysis of morphometric parameters in 3D-Matrigel organoids derived from Ctr-KD and Numb-KD RT4 cells treated with vehicle (Veh), Verteporfin (VP, 25 nM) or ROCKi Y-27632 (10 pM). Area (pm2) is reported as mean ± SEM. Other parameters are reported as boxplots delimited by 25thand 75thpercentiles and showing the median (horizontal line) and the mean (X). The whiskers span from the smallest and largest data values within a 1 .5 interquartile range. Data were obtained from two independent experiments. ****, p<0.0001 ; ***, p<0.001 ; *, p<0.05; ns, not significant, relative to matching condition by FDR-adjusted pairwise Welch’s t-test. g. Representative images of organoids derived from Ctr-KD vs. Numb-KD RT4 cells treated as in ‘f . Red arrows point to invasive protrusions in Numb-KD RT4 cells. Bar, 100 pm. h. Transwell Matrigel invasion assay of Ctr-KD and Numb-KD RT4 cells treated with vehicle, VP (100 nM), C3 (3 pg / mL) and ROCKi Y-27632 (10 pM) for 48 h. Graph shows the number of invading cells / field expressed as the mean ± SEM of 8 microscope fields from two independent experiments. **, p<0.01 ; *, p<0.05; ns, not significant vs. matching condition by FDR-adjusted pairwise Welch’s t-test.
[0043] Figure 7. Loss of Numb expression correlates with increased p-cofilin levels in NMIBC patients. a. Representative IHC staining of phosphorylated cofilin (p-Cofilin) and Numb in NumbHighand NumbLowhigh-grade NMIBC TUR specimens. Magnifications (Mag.) of the boxed areas are shown in the lower panels. Bars, 500 pm; Mag, 100 pm. b. Quantification of the % of p-cofilin positive cells in 6 NumbHighvs. 5 NumbLowhighgrade NMIBC TUR specimens. **, p=0.0019 by Welch’s t-test. c. Schematic representation of the molecular events influencing YAP activation state in the bladder urothelium in Numb proficient or deficient conditions. In Numb proficient conditions (Numb proficiency), the presence of Numb keeps in check RhoA / ROCK signaling to the actin machinery, leading to activation of the Hippo pathway, which phosphorylates YAP resulting in its cytoplasmic retention and inactivation (YAP signaling OFF). In Numb deficient conditions (Numb deficiency), the absence of Numb leads to activation of RhoA / ROCK signaling to the actin machinery, which in turn suppresses the Hippo pathway, resulting in nuclear translocation of unphosphorylated YAP and transcription of its target genes via interaction with TEAD (YAP signaling ON). These transcriptional changes, likely through the induction of an EMT program, promote the acquisition of proliferative and invasive / migratory phenotypes underlying the biological aggressiveness of Numb-deficient bladder tumors.
[0044] Figure 8. Numb is a prognostic biomarker of unfavorable disease course in real- life MIBC and NMIBC patients. a. Association between clinicopathological variables and Numb IHC status (High vs. Low) in the retrospective longitudinal cohort of 356 post-cystectomy MIBC patients. OR (95% Cl), Odds Ratio (95% Confidence Interval), in this and other relevant panels in the figure; p, Fisher’s exact test p-value. b. Multivariable survival analysis of the association between the indicated factors and good (HR<1 ) or poor (HR>1 ) prognosis in 258 patients with available follow-up from the MIBC cohort in ‘a’, by Cox proportional hazards model. Significant associations are marked in red. HR, multivariable hazard ratios, in this and other relevant panels in the figure; p, Wald-test p-value. c. Association between clinicopathological variables and Numb IHC status (High vs. Low) in a retrospective longitudinal cohort of 77 NMIBC patients; p, Fisher’s exact test p-value for categorical variables and Welch’s t-test for Age. d. Multivariable progression-free survival (PFS) analysis of the association between the indicated factors and good (HR<1 ) or poor (HR>1 ) prognosis in the 77 NMIBC patient cohort from ‘c’, by Cox proportional hazards model; p, Wald-test p-value.
[0045] Figure 9. Validation of a multigene signature informative of a Numb-deficient condition in preclinical human BCa cell models and in real-life NMIBC patients. a. Transcriptional regulators predicted to be activated in MIBC NumbLow(HT1376, CLS439, 5637) vs. NMIBC NumbHighBCa (KK47, RT4, RT112) cell lines (top) and in RT4, RT112 and KK47 Numb-KD vs. Ctr-KD cells (bottom), p-value of overlap <0.05 by Fisher’s exact test. Activation z-score>1 .5. b. Hierarchical unsupervised clustering of NumbHighand NumbLow, and Numb-KD and Ctr-KD BCa cell lines as described in ‘a’, based on the expression levels of 27 genes consistently upregulated (+) or downregulated (-) (FDR adjusted p-value<0.01 , Log2FC >1 or <-1 ) in Numb-KD vs. Ctr-KD KK47, RT4, RT1 12 cells (NumbLESSsignature). The color code scale indicates the z-score of log-normalized transcript abundance (ranging from -4 to 4), in this and other relevant panels in the figure. Genes are shown on the right, cell lines and conditions are indicated on the top and bottom, and direction of gene regulation on the left. Groups are indicated on the top. c. Heatmap showing the unsupervised clustering of 535 NMIBC patients from the UROMOL cohort, stratified by the NumbLESSsignature (NumbLESS-Like vs. -Not-Like). Upregulated (+) or downregulated (-) genes comprised in the NumbLESSsignature are indicated on the right, together with color codes for YAP / T AZ activation status, stage, grade and sex. Groups are indicated on the top (NumbLESS-Like and -Not-Like) and left (groups 1 and 2, indicating clusters of genes with consistent and coordinated up- or down-modulation in NumbLESS-Like and -Not-Like groups). d. Multivariable progression-free survival (PFS) analysis of the association between the indicated factors and good (HR<1) or poor (HR>1 ) prognosis in 535 NMIBC patients from the UROMOL cohort, by Cox proportional hazards model. Significant associations are marked in red. HR, multivariable hazard ratios; 95% confidence intervals (Cl); p, Wald-test p-value. e. Heatmap showing the unsupervised clustering of 535 NMIBC tumors from the UROMOL cohort, classified as YAP / TAZ active (ON) or inactive (OFF), based on the expression levels of 22 genes of the YAP / TAZ signature.
[0046] Figure 10. Characterization of the pro-tumorigenic role of Numb loss in the Numb-KO mouse model. a. Representative IHC images of the expression of endogenous Numb in the normal human urothelium, showing its association with the basal layer. CK5 is a marker for the basal / myoepithelial layer (black arrowheads); CK20 is a marker for superficial cells (red arrowheads). Bars, 50 pm. b. Representative confocal fluorescence images of FFPE sections of murine bladder. Upper panels show co-staining for endogenous Numb (white), the CK14 basal / myoepithelial layer marker (green) and DAPI (blue). White arrowheads indicate the basal layer. Lower panels show co-staining for Numb (white), the intermediate layer marker CK7 (green), and the superficial / umbrella cell marker CK20 (yellow arrowheads). The dashed line delineates the superficial layer of the urothelium. Bars, 50 pm. c. Upper panels, representative IHC images of CK5 expression in bladder tissue from Numb-KO and WT mice showing expansion of basal cells (CK5+) in Numb-KO lesions (CIS and infiltrating cancer) compared with WT. Boxed areas are magnified (Mag.) in the lower panels. Bars, 100 pm; Mag., 50 p.m. d. BBN treatment protocols for WT vs. Numb-KO mice.
[0047] Figure 11. Numb loss is associated with increased nuclear accumulation of YAP in the normal, preneoplastic and overtly neoplastic urothelium. a. Representative IHC images showing the expression pattern of YAP in the normal human and murine urothelium. The black arrowheads point to the basal layer. Bars, 50 pm. b. Top, Representative images of bladder tissues obtained from treatment-naive adult WT (n=2; WT1 , WT2) and Numb-KO (n=3; KO1 , KO2, KO3) mice, examined by IHC for Numb expression and co-stained for YAP (red) and DAPI (blue) by immunofluorescence (IF). Merged images of YAP and DAPI staining and magnifications (Mag.) are shown. Bars, 100 pm. Bottom, Quantification of the % of YAP-positive cells and mean nuclear YAP intensity expressed as mean ± SEM, n=6 fields for each condition. ****, p<0.0001 ; ***, p<0.001 ; ns, not significant, vs. WT1 , by Tukey's HSD test. c. Top, Bladder tissues from 16-week old BBN-treated WT and Numb-KO mice were examined by IHC for Numb and co-stained for YAP (red) and DAPI (blue) by IF. Shown are representative images of normal urothelium (N), hyperplasia (H) and carcinoma in situ (CIS) detected in a WT bladder, and of hyperplasia (H) and CIS detected in a Numb-KO bladder. Bars, 50 pm. Bottom, Quantification of the % of YAP-positive cells and mean nuclear YAP intensity expressed as mean ± SEM, n=6 fields for each condition. ****, p<0.0001 ; *, p<0.05; ns, not significant, by Tukey's HSD test. d. Primary infiltrating cancers induced by 20 weeks of BBN treatment in WT and Numb-KO mice as in ‘c’ were excised and transplanted into NGS mice. Then, secondary WT and Numb-KO BBN-tumor transplants (BBN-WT and BBN-KO) were excised and examined by IHC for Numb and co-stained for YAP (red) and DAPI (blue) by IF. Bars, 50 pm. e. Quantification of the experiment in ‘d’. Graphs show the % of YAP-positive cells and mean nuclear YAP intensity expressed as mean ± SEM, n=4 fields for each condition. **, p < 0.01 ; by Welch’s t-test vs. WT.
[0048] Figure 12. Aberrant morphogenesis and invasiveness of BBN-KO tumor cells are dependent on YAP. a. GSEA enrichment plot of the YAP / TAZ and EMT gene signatures in RNA-seq data from BBN-KO vs. BBN-WT tumor cells (left, n=3 for each condition) and BBN-KO cells treated with VP vs. vehicle (right, n=1 for each condition). ES, Enrichment Score; NES, Normalized Enrichment Score; p, permutation test p-value. b. BBN-WT and BBN-KO cells were lentivirally transduced with a shRNA targeting luciferase as a control (Ctr-KD) or YAP (YAP-KD). Immunoblot analysis of YAP silencing efficiency is shown. Actin, loading control. Results are representative of two independent experiments. c. BBN-WT and BBN-KO cells transduced as in ‘b’ were cultured as 3D-organoids (BBN-WT and BBN-KO MBO) in Matrigel. Ctr-KD BBN-WT and BBN-KO cells were also treated with vehicle or 25 nM Verteporfin (VP) as indicated. Graphs show the quantitation of the indicated morphometric parameters. Area (pm2) is reported as mean ± SEM. Other parameters are reported as boxplots delimited by 25th and 75th percentiles and showing the median (horizontal line) and the mean (X). The whiskers span from the smallest and largest data values within a 1 .5 interquartile range. Data were obtained from two independent experiments. ****, p<0.0001 ; **, p<0.01 ; ns, not significant vs. matching condition, by FDR-adjusted pairwise Welch's t-test. d. Representative bright field images of BBN-MBO from the experiment in ‘c’. Bar, 100 pm. The red arrowhead indicates invading protrusions. e. Transwell Matrigel invasion assay of BBN-WT and BBN-KO cells, control-silenced (Ctr-KD) or YAP-silenced (YAP-KD). Graph shows the number of invading cells / field 24 h after seeding, expressed as the mean ± SEM of 8 fields from two independent experiments. **, p<0.01 ; ns, not significant, vs. matching controls by FDR-adjusted pairwise Welch's t-test.
[0049] Figure 13. Restoration of Numb expression in BBN-KO tumors reverses YAP nuclear accumulation and invasive phenotypes. a. Representative confocal images of BBN-KO tumor cells stably infected with a Numb-GFP lentiviral vector (Numb-GFP) or an empty vector (EV) and co-stained for endogenous YAP by IF (red) and DAPI (blue). Bar, 25 pm. b. Quantification of YAP nuclear / cytoplasmic ratio in cells described in ‘a’. Results are reported as the mean ratio / field ± SEM, n=12 fields for each condition from three independent experiments. ****, p<0.0001 by Welch’s t-test vs. EV. c. RT-qPCR analysis of the indicated YAP transcriptional targets in BBN-KO tumor cells transduced with Numb-GFP as in ‘a’. Graphs show the relative mean fold expression ± SEM from three independent experiments. **, p<0.01 by one-sample t- test. d. Representative bright field images and quantitation of morphometric parameters of 3D-Matrigel MBO generated by BBN-KO tumor cells (BBN-Numb KO MBO), transduced as in ‘a’. EV, n=79; Numb-GFP, n=123, from three independent experiments. Area (pm2) is reported as mean ± SEM. Other parameters are reported as boxplots delimited by 25thand 75thpercentiles and showing the median (horizontal line) and the mean (X). The whiskers span from the smallest and largest data values within a 1 .5 interquartile range. ***, p<0.001 ; **, p<0.01 ; *, p<0.05, relative to matching condition, by FDR-adjusted pairwise Welch's t-test vs. EV. e. Immunoblot analysis of the total and phosphorylated levels of the indicated Hippo pathway components (MST1 / 2, LATS, YAP) in BBN-WT vs. BBN-KO cells. Numb levels are shown. Actin, loading control. Blot is representative of three independent experiments.
[0050] Figure 14. Effects of RhoA, Rac1, ROCK and actin remodeling inhibition on YAP nuclear translocation in BBN-WT and BBN-KO tumor cells. Representative confocal fluorescence images of BBN-WT and BBN-KO tumor cells treated with the indicated inhibitors (see also Legend to Fig. 4a) and co-stained for endogenous YAP (red), Numb (green) and DAPI (blue). A magnification (Mag.) for each condition is shown. Bars, 50 pm.
[0051] Figure 15. Rac1 inhibition does not affect YAP hyperactivation induced by loss of Numb. a. Representative confocal images of BBN-WT and BBN-KO tumor cells transduced with a lentiviral vector encoding a dominant negative Rac1 mutant (RAC1-DN) or empty vector (EV) and co-stained for endogenous Rac1 (red), YAP (green) and DAPI (blue). Bar, 50 pm. b. Quantification of YAP nuclear / cytoplasmic ratio in cells described in ‘a’. Graphs show the mean ± SEM, n=14 fields, from two independent experiments. ****, p<0.0001 ; ns, not significant, vs. matching controls by Tukey's HSD test. c. Immunoblot analysis of Numb and total and phosphorylated YAP in BBN-WT and BBN-KO cells treated with the Rac1 inhibitor NSC-23766 (RACi, 10 pM for 12 h). Actin, loading control. Blots shown are representative of two independent experiments. d. Analysis of morphometric parameters of BBN-MBO derived from cells treated as described in ‘a’. Area (pm2) is reported as mean ± SEM. Other parameters are reported as boxplots delimited by 25thand 75thpercentiles and showing the median (horizontal line) and the mean (X). The whiskers span from the smallest and largest data values within a 1.5 interquartile range. Data were obtained from two independent experiments. ****, p<0.0001 ; ns, not significant, relative to matching condition by FDR- adjusted pairwise Welch's t-test. e. Transwell Matrigel invasion assay of BBN-WT and BBN-KO cells treated with the Rac1 inhibitor, NSC-23766 (RACi, 250 nM for 24 h). Graph shows the average number of invading cells / field calculated 24 h after seeding, expressed as the mean ± SEM of 8 fields from two independent experiments. **, p<0.01 ; ns, not significant, vs. matching controls, by FDR-adjusted pairwise Welch's t-test.
[0052] Figure 16. Numb silencing induces increased RhoA / ROCK activity and YAP hyperactivation in human RT4 BCa cells. a. Representative confocal images of Ctr-KD and Numb-KD RT4 cells treated with the indicated inhibitors (see Legend to Fig. 6b) and co-stained for endogenous YAP (red) and DAPI (blue). Bar, 50 pm. b. Representative confocal images of Ctr-KD and Numb-KD RT4 cells co-stained for endogenous phosphorylated cofilin (p-Cofilin, red), phosphorylated MLC2 (p-MLC2, green) and DAPI (blue). Bar, 50 pm. c. Quantification of the experiment in ‘b’ showing the relative intensity of p-MLC2 (left) and p-Cofilin (right) in each condition. Values are the mean / field ± SEM, n=6 fields / condition from one experiment, representative of two independent experiments. ****, p<0.0001 by Welch’s t-test vs. Ctr-KD. d. Representative RT-qPCR analysis for the indicated YAP transcriptional targets in Numb-KD and Ctr-KD RT4 cells treated with Verteporfin (VP, 3 pM for 8 h) or vehicle- treated. Results are reported as the relative mean fold expression from one experiment run in triplicate.
[0053] Figure 17. Numb silencing induces RhoA / ROCK-dependent YAP hyperactivation in human RT112 BCa cells. a. Immunoblot analysis of Numb and of the total and phosphorylated levels of the indicated Hippo pathway components (MST1 / 2, LATS and YAP) in Ctr-KD and Numb- KD RT112 cells. Actin, loading control. Blots are representative of two independent experiments. b. Representative confocal images of Ctr-KD and Numb-KD RT112 cells treated with the actin polymerization inhibitor Latrunculin-A (LatA, 500 nM for 6 h), RhoA inhibitor C3 transferase (C3, 3 pg / ml for 6 h), ROCK inhibitor Y-27632 (ROCKi, 10 pM for 12 h), Rac1 inhibitor, NSC-23766 (RACi, 10 pM for 12 h), or vehicle, and co-stained for endogenous YAP (red), Numb (green) and DAPI (blue). Bar, 50 pm. c. Quantification of the experiment in ‘b’ showing YAP nuclear / cytoplasmic ratio in the different conditions. Values are the mean / field ± SEM, n=5 fields / condition from one experiment, representative of two independent experiments. ****, p<0.0001 ; **, p<0.01 ; ns, not significant, relative to matching controls by Tukey’s HSD test. d. Representative RT-qPCR analysis for the indicated YAP transcriptional targets in Ctr-KD vs. Numb-KD RT112 cells treated with C3 (3 pg / ml for 6 h) (left), ROCKi (50 pM for 8 h) (middle), Verteporfin (VP, 3 pM for 8 h) (right), or vehicle-treated. Graphs show the relative mean fold expression ± SEM from three independent experiments. ***, p<0.001 ; **, p<0.01 ; *, p<0.05; ns, not significant, vs. matching condition, by FDR- adjusted unpaired one-sample t-test (vs. reference sample) or two-sample Welch’s t- test (treated vs. vehicle Numb-KD samples). e. Analysis of morphometric parameters in 3D-Matrigel organoids derived from Ctr-KD and Numb-KD RT112 cells treated with VP (25 nM) or vehicle. Area (pm2) is reported as mean ± SEM. Other parameters are reported as boxplots delimited by 25thand 75thpercentiles and showing the median (horizontal line) and the mean (X). The whiskers span from the smallest and largest data values within a 1.5 interquartile range. Data were obtained from two independent experiments. ****, p<0.0001 ; **, p<0.001 ; ns, not significant, relative to matching condition by FDR-adjusted pairwise Welch's t-test. f. Representative bright field images of Numb-KD vs. Ctr-KD RT112 organoids treated as in ‘e’. Red arrowheads point to invasive protrusions. Bar, 50 pm. g. Transwell Matrigel invasion assay of Ctr-KD and Numb-KD RT112 cells treated for 24 h with VP (100 nM), C3 (3 pg / mL), Y-27632 (10 pM) or vehicle. Graph shows the average number of invading cells / field in each condition expressed as the mean ± SEM of 8 fields from two independent experiments. ****p<0.0001 , ***, p<0.001 ; *, p<0.05; ns, not significant, relative to matching controls by FDR-adjusted pairwise Welch's t- test.
[0054] Figure 18. Stability selection of gene features using the Meinshausen & Buhlmann algorithm.
[0055] Mean selection frequency for each gene over 100 permutations. Highly stable genes, genes meeting a per-com parison error rate (PCER) threshold of 20% (false-positive control); stable genes, genes selected with PCER = 1 ; unstable genes, genes not selected by the algorithm.
[0056] Figure 19. Model performance over 500 cross-validation runs. a. Area under the ROC curve (AUC) at different follow-up times, calculated separately on training and test data. Lines trace the mean AUC at each time point, shaded areas around the mean lines denote the 95% confidence intervals estimated over 500 runs (125 repeats per 4-fold cross-validation). b. Integrated Brier score (left) and Harrell’s concordance index (right) calculated on training and test data across the same 500 repeated cross-validation runs. The dot indicates the mean score; error bars span over 95% confidence intervals.
[0057] Figure 20. Mean Kaplan-Meier survival curves for test-set across 500 cross- validation runs.
[0058] Lines indicate the average survival probability over time for the high-risk and low-risk groups, as predicted on test data in each of the 500 cross-validation runs. Shaded areas around each curve denote the 95% confidence intervals of the 500 runs.
[0059] High and low risk patients are defined by a progression probability above or below 5% at 5 years, respectively.
[0060] Figure 21. Five-year progression risk versus Prosiblad Risk Score a. 5-year predicted risk of progression as a continous function of the Prosiblad Risk Score. Shaded area indicates 95% confidence intervals. Rug plot denotes the proportion of individual patients stratified as high, intermediate or low risk based on the standard clinical EAU (European Association of Urology) parameters. b. Proportion of patients in each EAU risk group classified as low- or high-risk by the Prosiblad model. High and low-risk patients are defined by a progression probability above or below 5% at 5 years, respectively.
[0061] Figure 22. Calibration plots of observed vs predicted 5-year progression rate. a. Points indicate the observed 5-year event rate against the mean predicted probability for clinically relevant risk intervals (0-2%, 2-5%, 5-10%, 10-30%, 30-70%, 70-100%). Vertical error bars indicate the 95% confidence intervals around the observed rates. b. Continuous line indicates the calibration line estimated with the flexible adaptive hazard regression approach. Dashed line denotes ideal calibration. Histograms display the distribution of predicted progression probabilities for each outcome group at 5 years.
[0062] Figure 23. Apparent performance of the Prosiblad model in the UROMOL cohort. Kaplan-Meier progression-free survival curves in the UROMOL patients stratified into low- and high-risk groups based on a 5-year progression probability cutoff of 5%. HR (95% Cl), Hazard Ratio with 95% Confidence Intervals, p = log-rank test p-value. Definitions
[0063] In the context of the present invention, for “bladder cancer” is intended any kind of cancer with an origin from the urothelial layer affecting any part of the bladder.
[0064] In the context of the present invention, for “prognosis” is intended the likely or expected development of the disease, in particular the more or less histological and / or clinical aggressiveness of the disease.
[0065] In the context of the present invention, "predicting prognosis" and "determining a prognosis" and “providing a prognosis” are used as synonyms.
[0066] In the context of the present invention, "gene" refers to a nucleic acid that is transcribed. In certain aspects, the gene includes regulatory sequences involved in transcription or message production. In particular embodiments, a gene comprises transcribed sequences that encode for a protein, polypeptide or peptide. As will be understood by those in the art, this functional term "gene" includes genomic sequences, RNA or cDNA sequences or smaller engineered nucleic acid segments, including nucleic acid segments of a non-transcribed part of a gene, including but not limited to the non-transcribed promoter or enhancer regions of a gene. Smaller engineered nucleic acid segments may express, or may be adapted to express proteins, polypeptides, polypeptide domains, peptides, fusion proteins, mutant polypeptides and / or the like.
[0067] The genes herein mentioned are preferably characterized by the sequences described by the following NCBI Gene ID (NCBI Database release version December 15, 2023):
[0068] The biological sample is preferably a tissue sample. Preferably it is a tumoral tissue sample, i.e. a sample obtained by tumoral tissue, in particular by the bladder tumoral tissue. Said tissue sample comprises at least one cancerous cell. The sample can be for example a tissue sample previously obtained by surgery, e.g. biopsy, from the subject. Methods for collecting biological samples, in particular tumor biological samples, are well known in the field. The sample can then be prepared for preservation and examination, for example using fixative solutions, according to common general knowledge. In an embodiment, the biological sample is a formalin-fixed paraffin- embedded (FFPE) sample.
[0069] In an exemplary embodiment of the invention, the sample is previously isolated from a subject affected by bladder cancer, preferably non-muscle invasive bladder cancer (NMIBC). Bladder cancer can be of any kind or form. The subject may be at any stage of the disease, such as early stage or late stage.
[0070] For “non-muscle invasive bladder cancer” (NMIBC) is intended tumors confined to the inner lining of the bladder, which comprise tumors of different stage and grade: i) Ta papillary tumors, confined to the mucosa and typically low-grade / well-differentiated; ii) T1 tumors with submucosal invasion, representing a heterogeneous group that can present as either low- or high-grade / poorly differentiated lesions; and iii) carcinoma in situ (CIS; Tis in the TNM classification), typically presenting as flat and high-grade dysplasia lesions.
[0071] For “muscle invasive bladder cancer” is intended tumors that have penetrated beyond the superficial layers and invaded the detrusor muscle, which comprise: T2 tumors that have invaded the muscle layer either superficially (T2a) or deeply (T2b), T3 tumors that have spread beyond the muscolaris propria into the perivesical fat, and T4 tumors that have spread to surrounding organs, such as the prostate, bowel, vagina, or uterus.
[0072] The bladder cancer can be primary or metastatic.
[0073] The subject can be a subject diagnosed with bladder cancer or a subject presenting with one or more symptoms of bladder cancer or a subject having undiagnosed bladder cancer. Preferably, is a subject diagnosed with bladder cancer.
[0074] The sample may be prepared for subsequent RNA extraction, as known in the field. Gene expression in the sample can be determined using any method known in the art. For example, the amount in the sample of gene expression products, such as RNA transcripts, mRNAs or proteins may be measured.
[0075] For example a PCR-based method, an array based method or a RNA sequencingbased method might be used. All such methods are known in the art and can be carried out according to the common general knowledge in the field. Exemplary techniques to determine gene expression are analysis of single strand conformation polymorphism, capillary electrophoresis, denaturing high performance liquid chromatography, digital molecular barcoding technology, e.g., Nanostring's nCounter® system, direct sequencing, DNA mismatch-binding protein assays, dynamic allele-specific hybridization, Fluorescent in situ hybridization (FISH), high-density oligonucleotide SNP arrays, high- resolution melting analysis, microarray, next generation sequencing (NGS), e.g., using the Illumina Genome Analyzer, ABI Solid instrument, Roche 454 instrument, Heliscope instrument, Northern blot analysis, nuclease protection analysis, oligonucleotide ligase assays, polymerase chain reaction (PCR), primer extension assays, Quantigene analysis, quantitative nuclease- protection assay (qNPA), reporter gene detection, restriction fragment length polymorphism (RFLP) assays, reverse transcription and real-time quantitative polymerase chain reaction (RT- qPCR), reverse transcription-polymerase chain reaction (RT-PCR), RNA sequencing (RNA-seq), Serial analysis of gene expression (SAGE), Single Molecule Real Time (SMRT) DNA sequencing technology, SNPLex, Southern blot analysis, Sybr Green chemistry, TaqMan-based assays, temperature gradient gel electrophoresis (TGGE), Tiling array, Western blot analysis, and immunohistochemistry or immunofluorescence. In any of the above aspects or embodiments, gene expression may be determined using reverse transcription and real-time quantitative polymerase chain reaction (RT-qPCR) with primers and / or probes (e.g., TaqMan® probes) specific for each of said at least three genes. Alternately, the gene expression may be determined using microarray analysis with probes specific for an expression product of each gene.
[0076] In an embodiment, the level of RNA transcripts of the herein defined genes is measured in the sample using a RNA sequencing method, such as RNAseq. Methods of extracting RNA and determining the level of RNA transcripts of a particular gene in a sample are well-known to those skilled in the art.
[0077] Gene expression is typically normalized to the expression of at least one reference gene, such as a housekeeping gene, or to a standard. Housekeeping genes are well known in the field, reference can be made to Joshi, C.J., et al., PLoS Comput Biol, 2022. 18(7): p. e1010295. The standard may comprise, for example, a relative expression level compared to a control gene. The standard may also comprise the expression level in a standard cell line or in a control group.
[0078] According to a preferred embodiment, the method of the invention comprises a further step b) wherein the expression level of the at least one gene is compared with the expression level of one or more reference genes, or their protein translation products. Translation products, i.e. proteins, can be assessed by single or multiplexed immunohistochemistry or immunofluorescence imaging techniques. Said imaging techniques include spatial imaging which refers to visualization and quantification of molecular or cellular features within a biological tissue while preserving their spatial context. In the context of tumor topological analysis, spatial imaging allows for the mapping of gene or protein expression, cellular phenotypes, and tissue architecture in situ, thereby enabling the assessment of spatial relationships, cellular interactions, and microenvironmental organization within the tumor. Such techniques include, but are not limited to, multiplex immunofluorescence, spatial transcriptomics, imaging mass cytometry, and high-resolution microscopy. In an embodiment of the invention the expression level of the one or more reference gene or their protein translation product is measured in a tissue sample obtained from a subject not affected by bladder cancer or in a tissue sample of a tumor displaying Numb-proficient expression.
[0079] In preferred embodiments of the invention, the size of the change in the expression level of the genes in comparison to normal or standard expression levels is indicative of the prognosis of the disease. For “normal or standard expression levels” is intended expression levels in a subject not affected by the disease or in a subject affected by a tumor displaying Numb-proficient expression. For “tumor displaying Numb-proficient expression” is intended a tumor with Numb expression comparable to or higher than the corresponding normal tissue.
[0080] In some embodiments, expression of five or more of the herein disclosed genes, is increased in subjects affected by bladder cancer characterized by a worse prognosis. Preferably, it is increased in subjects affected by NMIBC which progress to MIBC. In this embodiment, such genes may be five or more of the following genes: GJC1 , NEDD9, INHBA, IL1A, CXCL1 , ATP1 B1 , GPR137B, BIRC6, ANKRD1 , CCN1 , CTNNA1 , CTSF, EFEMP1 , ERBB4, FAT4, FN1 , HSPE1 , MTMR2, PAPSS2, SPG21 , SPINK5, UTRN, CD34, MPDZ, STK39, PAK3, CXCL2, COL4A1 , COL4A2, APLN, SDC2, PPIC, SPARC, PGLYRP1 , DPYSL3, CXCL3, GKAP1 , DSEL, SORBS2, TMEM176B, INPP4B, TCEAL8, HDGFL3, GXYLT2, HSPB8, JAM2, RHOBTB3, LTBP1 , RBMS3, PTPRK, CCL2, SOX4, ALDH1A1 , PXDN, ZFP37, NIPSNAP3B, TMEM64, EIF5A2, GPR161 , FERMT1 , IGFBP7, VIM, TNC, ADCY9.
[0081] In an embodiment, the increased expression of at least five of the following genes: INHBA, NEDD9, CXCL1 , GJC1 , GPR137B, ATP1 B1 , IL1 A, BIRC6, or of at least all of said genes, is correlated with a worse prognosis of the disease and / or with a progression of a subject with NMIBC to a subject with MIBC.
[0082] In the context of the present invention, the prognostic outcome of a subject affected by bladder cancer or for the progression from NMIBC to MIBC is classified into one of three categories based on the predicted likelihood of progression to muscle-invasive bladder cancer (MIBC), i.e. worse prognosis, intermediate prognosis and better prognosis.
[0083] For “worse prognosis” is intended an aggressive likely or expected development of the disease. The term refers to a clinical condition wherein the subject exhibits a high probability of progression from NMIBC to MIBC, also referred herein as “high risk”. All such terms are well known in the field and herein have the meanings currently used in the field.
[0084] Stratification and classification are herein used as synonyms.
[0085] It is also an object of the invention an in vitro method of screening a subject suffering from a bladder cancer or having suffered from bladder cancer for predicting risk of recurrence of the disease comprising at least the step of determining the expression level of at least five genes in an isolated biological sample from said subject, wherein said gene are selected from the group consisting of GJC1 , NEDD9, INHBA, IL1 A, CXCL1 , ATP1 B1 , GPR137B, BIRC6, ANKRD1 , CCN1 , CTNNA1 , CTSF, EFEMP1 , ERBB4, FAT4, FN1 , HSPE1 , MTMR2, PAPSS2, SPG21 , SPINK5, UTRN, CD34, MPDZ, STK39, PAK3, CXCL2, COL4A1 , COL4A2, APLN, SDC2, PPIC, SPARC, PGLYRP1 , DPYSL3, CXCL3, GKAP1 , DSEL, SORBS2, TMEM176B, INPP4B, TCEAL8, HDGFL3, GXYLT2, HSPB8, JAM2, RHOBTB3, LTBP1 , RBMS3, PTPRK, CCL2, SOX4, ALDH1A1 , PXDN, ZFP37, NIPSNAP3B, TMEM64, EIF5A2, GPR161 , FERMT1 , IGFBP7, VIM, TNC, ADCY9.
[0086] For "predicting risk of recurrence" is intended: 1) recurrence of a NMIBC without MIBC progression (in patients previously subjected to a transurethral resection of a superficial NMIBC, who recur with a superficial NMIBC): 2) recurrence of a NMIBC with MIBC progression (in patients previously subjected to a transurethral resection for a NMIBC, who recur with a muscle-invasive MIBC; 3) progression (disease recurrence in patients previously subjected to radical cystectomy, radiotherapy, or systemic chemotherapy); or 4) bladder cancer-related death beyond 90 days of diagnosis. Progression was defined as receipt of radical cystectomy, radiotherapy, systemic chemotherapy, or bladder cancer-related death beyond 90 days of diagnosis. In some embodiments, the method of the invention can be advantageously used in combination with any other prognostic method, including standard clinic-pathological parameters such as standard methods for staging T1 vs T2, useful in the prognosis and / or in the classification of a subject affected by bladder cancer.
[0087] A further object of the invention is an in vitro method of screening a subject suffering from a bladder cancer for predicting response to an anti-cancer treatment directed to the RhoA / ROCK / YAP pathway comprising at least the step of determining the expression level of at least five genes in an isolated biological sample from said subject, wherein said genes are selected from the group consisting of GJC1 , NEDD9, INHBA, IL1 A, CXCL1 , ATP1 B1 , GPR137B, BIRC6, ANKRD1 , CCN1 , CTNNA1 , CTSF, EFEMP1 , ERBB4, FAT4, FN1 , HSPE1 , MTMR2, PAPSS2, SPG21 , SPINK5, UTRN, CD34, MPDZ, STK39, PAK3, CXCL2, COL4A1 , COL4A2, APLN, SDC2, PPIC, SPARC, PGLYRP1 , DPYSL3, CXCL3, GKAP1 , DSEL, SORBS2, TMEM176B, INPP4B, TCEAL8, HDGFL3, GXYLT2, HSPB8, JAM2, RHOBTB3, LTBP1 , RBMS3, PTPRK, CCL2, SOX4, ALDH1A1 , PXDN, ZFP37, NIPSNAP3B, TMEM64, EIF5A2, GPR161 , FERMT1 , IGFBP7, VIM, TNC, ADCY9.
[0088] For “RhoA / ROCK / YAP pathway” is intended a signalling circuitry where the small GTPase RhoA and its effector kinase ROCK operate as upstream activators of YAP / TAZ signalling. In particular, said anti-cancer treatment directed against the RhoA / ROCK / YAP pathway can be an anti-cancer treatment directed against RhoA and / or directed against ROCK and / or directed against YAP, as exemplified by the ROCK inhibitor, Fasudil, orthe YAP-TEAD interaction inhibitor, Verteporfin. Preferably said anti-cancer treatment can also be selected from Belumosudil, Ripasudil, Fasudil, Y27632, Netarsudil, VT-3989, IK-930.
[0089] For RhoA is intended the protein Ras homolog family member A, as identified for example in NCBI (human RHOA, gene ID 387; mouse RhoA, gene ID 11848).
[0090] For ROCK is intended the rho-associated, coiled-coil-containing protein kinase, as identified for example in NCBI (human ROCK1 , gene ID 6093; mouse Rockl , gene ID 19877).
[0091] For YAP is intended the yes-associated transcriptional regulator, as identified for example in NCBI (human YAP1 , gene ID 10413; mouse Yap1 , gene ID 22601).
[0092] For NUMB is intended NUMB Endocytic Adaptor Protein, i.e. the gene encoding the playing a role in the determination of cell fates during development (Gene ID: 8650). Kits for carrying out the method of the invention are also objects of the invention. In particular, said kit may comprise means for determining in an isolated biological sample the expression level of at least one gene as above defined, such as probes and / or primers for binding an expression gene product, such as a RNA transcript or a protein, of one or more genes disclosed herein or primers for polymerase chain reaction of one or more RNA transcripts of above mentioned genes. Such probes and primers can be synthetized according to common general knowledge in the field. The kit may further comprise instructions or a computer readable media to carry out the comparison of the detected expression level of the genes with the expression level of one or more reference gene, or their protein translation products, and for providing prognostic information. For example, mathematical algorithms to estimate or quantify prognostic or predictive information, for example as above described, are properly potential components of the kit. These mathematical methods are well known in the field.
[0093] The method of the invention is also a method for stratifying subjects affected by bladder cancer based on the predicted prognosis of the disease.
[0094] The method of the invention can also advantageously help in stratifying subjects affected by bladder cancer for cancer treatments.
[0095] It is an object of the invention a method for determining a bladder cancer treatment for a subject affected by bladder cancer comprising the steps of a) determining the expression level of at least five genes, or their protein translation products, in an isolated biological sample from said subject, wherein said genes are selected from the group consisting of GJC1 , NEDD9, INHBA, IL1A, CXCL1 , ATP1 B1 , GPR137B, BIRC6, ANKRD1 , CCN1 , CTNNA1 , CTSF, EFEMP1 , ERBB4, FAT4, FN1 , HSPE1 , MTMR2, PAPSS2, SPG21 , SPINK5, UTRN, CD34, MPDZ, STK39, PAK3, CXCL2, COL4A1 , COL4A2, APLN, SDC2, PPIC, SPARC, PGLYRP1 , DPYSL3, CXCL3, GKAP1 , DSEL, SORBS2, TMEM176B, INPP4B, TCEAL8, HDGFL3, GXYLT2, HSPB8, JAM2, RHOBTB3, LTBP1 , RBMS3, PTPRK, CCL2, SOX4, ALDH1A1 , PXDN, ZFP37, NIPSNAP3B, TMEM64, EIF5A2, GPR161 , FERMT1 , IGFBP7, VIM, TNC, ADCY9 or any combination of said genes; b) comparing the expression level of the at least one gene with the expression level of one or more reference genes, or their protein translation products; c) determining a prognosis of said subject based on said comparison and d) determining a bladder cancer treatment for said subject based on said prognosis. In an embodiment, the expression level of all said genes or at least all said genes is determined. Expression level of further genes may also be determined.
[0096] In an embodiment, said method comprises determining the expression level of at least 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20 or more genes from the above list. In an embodiment said method comprises determining the expression level of at least 32 genes.
[0097] Said steps b) and c) may be carried out as above described.
[0098] Said bladder cancer treatment may comprise surgery, radiation and / or any anti-cancer or chemotherapeutic agent. Said anti-cancer or chemotherapeutic agent may be selected from anthracycline agents, alkylating agents, nucleoside analogs, platinum agents, vinca agents, anti-estrogen drugs, aromatase inhibitors, ovarian suppression agents, endocrine / hormonal agents, bisphophonate therapy agents and targeted biological therapy agents (e.g., antibodies). Preferably said agent includes cyclophosphamide, fluorouracil (or 5-fluorouracil or 5-FU), methotrexate, thiotepa, carboplatin, cisplatin, gemcitabine, anthracycline, taxanes, paclitaxel, protein-bound paclitaxel, doxorubicin, docetaxel, vinorelbine, tamoxifen, raloxifene, toremifene, fulvestrant, irinotecan, ixabepilone, temozolmide, topotecan, vincristine, vinblastine, eribulin, mutamycin, capecitabine, capecitabine, anastrozole, exemestane, letrozole, leuprolide, abarelix, buserlin, goserelin, megestrol acetate, risedronate, pamidronate, ibandronate, alendronate, denosumab, zoledronate, trastuzumab, tykerb or bevacizumab, inhibitors of EGFR, inhibitors of CXCL8, inhibitors of CXCR1 , inhibitors of CXCR2, inhibitors of protein kinases, immunotherapy (including but not restricted to, for instance, Bacillus Calmette-Guerin), immune checkpoint inhibitors, and combinations thereof.
[0099] In a preferred embodiment, said anti-cancer treatment is directed against the RhoA / ROCK / YAP pathway and is preferably selected from Fasudil, Belumosudil, Ripasudil, Fasudil, Y27632, Netarsudil, Verteporfin, VT-3989, IK-930 or combination thereof.
[0100] In a further preferred embodiment said anti-cancer treatment is the Bacillus Calmette- Guerin.
[0101] In a further preferred embodiment said anti-cancer or chemotherapeutic agent is a Focal Adhesion Kinase (FAK) inhibitor selected from defactinib, GSK2256098, IN10018 and others. In a further preferred embodiment said anti-cancer or chemotherapeutic agent is a dual ROCK / AKT inhibitor selected from AT13148 and others.
[0102] The skilled person knows how to select one or more suitable cancer treatments based on the obtained prognosis of the disease.
[0103] It is also an object of the invention a method for treating a subject affected by bladder cancer comprising a) determining the expression level of at least five genes, or their protein translation products, in an isolated biological sample from said subject, wherein said genes are selected from the group consisting GJC1 , NEDD9, INHBA, IL1A, CXCL1 , ATP1 B1 , GPR137B, BIRC6, ANKRD1 , CCN1 , CTNNA1 , CTSF, EFEMP1 , ERBB4, FAT4, FN1 , HSPE1 , MTMR2, PAPSS2, SPG21 , SPINK5, UTRN, CD34, MPDZ, STK39, PAK3, CXCL2, COL4A1 , COL4A2, APLN, SDC2, PPIC, SPARC, PGLYRP1 , DPYSL3, CXCL3, GKAP1 , DSEL, SORBS2, TMEM176B, INPP4B, TCEAL8, HDGFL3, GXYLT2, HSPB8, JAM2, RHOBTB3, LTBP1 , RBMS3, PTPRK, CCL2, SOX4, ALDH1A1 , PXDN, ZFP37, NIPSNAP3B, TMEM64, EIF5A2, GPR161 , FERMT1 , IGFBP7, VIM, TNC, ADCY9; b) comparing the expression level of the at least one gene with the expression level of one or more reference genes, or their protein translation products; c) determining a prognosis of said subject based on said comparison and d) administering to the subject a bladder cancer treatment based on said prognosis.
[0104] In some embodiments, the subject classified as a subject with a worse prognosis may be provided with a cancer treatment that is more aggressive than the cancer treatment provided to the subject classified as a subject with a better or intermediate prognosis. For example, a "more aggressive" cancer treatment may comprise a higher dose of an anti-cancer or chemotherapeutic agent and / or more frequent dosing of an anticancer or chemotherapeutic agent and / or a more potent anti-cancer or chemotherapeutic agent and / or a plurality of anti-cancer or chemotherapeutic agents or of treatment modalities, e.g., anti-cancer or chemotherapeutic agents along with surgical intervention, anti-cancer or chemotherapeutic agents along with radiation, radiation along with surgical intervention, and anti-cancer or chemotherapeutic agents, surgical intervention, and radiation.
[0105] Said anti-cancer or chemotherapeutic agent for use for the treatment of a subject affected by bladder cancer, wherein said subject has been stratified according to the method of the invention, is also an object of the invention. EXAMPLES
[0106] MATERIALS AND METHODS
[0107] Materials
[0108] Antibodies were obtained from the following sources: anti-Numb mouse monoclonal antibody (clone Ab21 , 1 :1000 for IB) (#MABN2311 from Sigma Aldrich); anti-Numb rabbit monoclonal (clone C29G11 ) (#2756 from Cell Signaling T echnologies, 1 :500 for IF, 1 :150 for IHC); anti-phospho MST1 (Thr183) / MST2(Thr180) (#49332 from Cell Signaling Technology, 1 :1000 for IB); anti-MST1 (#3682 from Cell Signaling Technology, 1 :1000 for IB); anti-phospho LATS1 (Thr1079) (#PA5-105442 from Invitrogen, 1 :1000 for IB); anti-LATS1 (#3477 from Cell Signaling Technology, 1 :1000 for I B); anti-phospho YAP (Seri 27) (#4911 from Cell Signaling T echnology, 1 : 1000 for IB); anti-YAP1 (63.7) (#sc-101199 from Santa Cruz, 1 :1000 for IB, 1 :200 for IF); anti- YAP (D8H1X) (#14074 from Cell Signaling Technology, 1 :200 for IF); anti-active YAP (EPR19812) (#ab205270 from Abeam, 1 :500 for IF); anti-phospho Myosin Light Chain 2 (Ser19) (pMLC2) (#3671 from Cell Signaling Technology, 1 :1000 for IB; 1 :200 for IF); anti-phospho Cofilin-1 (Ser3) (F-11) (#sc-365882 from Santa Cruz, 1 :1000 for IB, 1 :300 for IF); anti-Cofilin (D3F9) (#5175 from Cell Signaling Technology, 1 :1000 for IB); anti-RAC1 clone 102 / Rac1 (RUO) from BD Biosciences, 1 :350 for IF; anti-RhoA (26C4) (#sc-418 from Santa Cruz, 1 :400 for IF); anti-RhoA (#ARH03 from Cytoskeleton, 1 :2000 for IB); anti-actin (A4700 from Merck Life Sciences, 1 :10000 for IB); anti-Vinculin (#V9131 from Merck Life Sciences, 1 :10000 for IB); anti-CK5 (EP1601Y) (ab52635 from Abeam, 1 :2000 for mice IHC, 1 :200 for human IHC); anti- CK14 (LL002) (ab7800 from Abeam, 1 :1000 for IF); anti-CK7 (RCK105) (ab9021 from Abeam, 1 :500 for IF); anti-CK20 (ab118574 from Abeam, 1 :200 for IF and IHC); Bond Polymer Refine Detection Kit (#DC9800; Leica Biosystems); Bond Primary Ab Diluent (#AR9352; Leica Biosystems); goat anti-rabbit IgG (H+L)-HRP conjugate (#1706515 Bio-Rad, 1 :2500 for IB); goat anti-mouse (H+L)-HRP conjugate (#1706516 Bio-Rad, 1 :2500 for IB); Alexa Cy3- and 488-conjugated secondary antibodies from Jackson ImmunoResearch (#715-165-150 and #715-545-152, respectively; 1 :500 for IF); Alexa Fluor 555 donkey anti-mouse IgG (1 :400 for IF) and Alexa Fluor 488 donkey anti-rabbit IgG (1 :500 for IF) secondary antibodies were obtained from ThermoFisher; Mowiol- Dabco solution mounting medium (#81381 and #D27802 from Sigma-Aldrich Merck); DAPI (#32670 from Sigma-Aldrich Merck); Dispase was from Stemcell Technologies; Advanced-DMEM / F-12 was from ThermoFisher; McCoy's 5A, RPMI and MEM mediums were from EuroClone; FGF10 (#100-26) and FGF7 (#100-19) from Peprotech; A83-01 from Sigma-Aldrich Merck; B27 from Invitrogen; Tryple Express from Gibco; Matrigel growth factor-reduced basement membrane matrix (#356231) from Corning; fetal bovine serum (FBS) from Euroclone; ROCK inhibitor Y-27632 was purchased from Selleckchem; Cell Permeable Rho Inhibitor (C3 Transferase) from Cytoskeleton Tebu-Bio; Rac1 inhibitor (NSC23766), Cell-permeable marine toxin Latrunculin A, Verteporfi and / V-butyl- / V-(4-hydroxybutyl) nitrosamine (BBN) (B8061), from Merck Life Sciences Sri.
[0109] Genetically engineered mouse models
[0110] Mice were housed in pathogen-free certified animal facilities at the Cogentech Mouse Facility located at IFOM (The AIRC Institute of Molecular Oncology, Milan, Italy). All mice have been maintained in a controlled environment, at 18-23 °C, 40-60% humidity, and with 12-h dark / 12-h light cycles. All animal studies were conducted with the approval of Italian Minister of Health (AUT. N. 125 / 2019-PR) and were performed in accordance with the Italian law (D.lgs. 26 / 2014), which enforces Dir. 2010 / 63 / EU (Directive 2010 / 63 / EU of the European Parliament and of the Council of 22 September 2010 on the protection of animals used for scientific purposes) and EU 86 / 609 directive and under the control of the institutional organism for animal welfare and ethical approach to animals in experimental procedures (Cogentech OPBA). The Numb-KO mouse model was generated as previously described22. Briefly, mice were generated by crossing Numblox / Ioxmice7374with CK5-Cre mice75. Targeted deletion of the Numb allele was confirmed by PCR genotyping, as described previously7375.
[0111] Expression of the Cre-Recombinase allele was confirmed by PCR genotyping, using the following forward and reverse primers: CRE-FW: AACATGCTTCATCGTCGG; CRE-REV: TTCGGATCATCAGCTACACC. Male animals were used for the experiments.
[0112] BBN-induced mouse model of bladder cancer and mouse pathology
[0113] Aged-matched 8- to 16-week-old mice were given tap water containing 0.05% BBN for 16 or 20 weeks and afterward switched to regular drinking water until the end of the experiment. The control group received tap water throughout the entire experiment. Mice treated for 16 weeks were sacrificed 2 weeks after the end of the BBN treatment (Fig. 2c and Fig. 10d). Mice treated for 20 weeks were sacrificed upon reaching any of the predefined endpoints for high disease burden, including abdominal distension that impeded movement, loss of >15% of body weight, labored breathing, abnormal posture, hematuria (Fig. 2d and Fig. 10d). At sacrifice, bladders were removed and stored in 4% paraformaldehyde for subsequent paraffin embedding and histological examination. The group assignment of bladder tissue sections was blinded to a board-certified pathologist for the objective histological evaluation and staging of BBN-induced lesions in the mouse urothelium. Carcinoma in situ (CIS) was defined as a flat tumor lesion confined to the superficial urothelial layer, with malignant urothelial cells displaying loss of cell polarity, cellular atypia, increased number of mitotic figures, and large irregular nuclei with a high nuclear / cytoplasmic ratio, according to standard pathology criteria.
[0114] Post-cystectomy MIBC patient cohort
[0115] Archival FFPE tissue specimens were collected from a retrospective consecutive cohort of 383 patients who underwent cystectomy for bladder cancer at the European Institute of Oncology (IEO, Milan) between 1999 and 2016, following approval by the Institutional Ethical Board. The clinicopathological characteristics of this cohort are reported in Fig. 8a. Numb IHC staining was performed on whole FFPE sections from 356 tumor blocks with sufficient material. Staining intensity was scored on a scale from 0 to 3 (0, undetectable expression; 1 , intermediate expression; 2-3, expression comparable to normal urothelial basal cells). The percentage of Numb-positive cells was estimated in increments of 5% over the entire tumor area within the tissue section. Tumors were classified as Numb-low if a tumor area larger than 70% exhibited an intensity score <1 ; otherwise, they were categorized as Numb-high.
[0116] Survival analysis was conducted using univariable and multivariable Cox proportional hazard models, with multivariable analysis adjusted for clinically relevant variables (age, gender, pT, pN, and vascular invasion). Of the 338 patients with available followup data, eighty patients with a pathological tumor stage of pT4 were excluded from the survival analysis to minimize the confounding effects linked to their generally very poor 5-year survival rate76.
[0117] NMIBC patient cohorts
[0118] Archival FFPE transurethral resection (TUR) specimens were collected from a longitudinal series of patients diagnosed with NMIBC at the European Institute of Oncology (Milan), following standard operating procedures approved by the Institutional Ethical Board. Patients with the first available high-grade NMIBC lesion were selected for the analyses, excluding those patients with a synchronous muscle- invasive disease. The primary outcome was time-to-progression to Ml BC in a 4-month minimum follow-up period by TUR. Patients who did not progress were right-censored at the last recorded NMIBC lesion, cystectomy, or negative cystoscopy. Complete clinicopathological information of this NMIBC cohort, including age, gender, and tumor stage, are described in detail in Fig. 8c. Whole FFPE TUR sections from a total of 77 patients were IHC stained for Numb. Assessment of Numb status and univariable and multivariable analysis were performed as described above for the post-cystectomy MIBC cohort.
[0119] Cells and culture procedures
[0120] RT4 and CLS439 cells were cultured in McCoy's 5A medium supplemented with 10% heat-inactivated fetal bovine serum (FBS), 2mM L-Glutamine and 1 % penicillin / streptomycin (P / S). RT112, KK47 and 5637 cells were cultured in RPMI medium supplemented with 10% heat-inactivated FBS, 2mM L-Glutamine and 1 % P / S. HT1376 cells were cultured in MEM medium supplemented with 10% heat- inactivated FBS, 2mM L-Glutamine, 1 % P / S and 0.1 mM of Non-Essential Amino Acids (NEAA). Primary murine cells were grown in advanced-DMEM / F-12 supplemented with 100 ng / mL FGF10, 25 ng / mL FGF7, 500 nM A83-01 , and 2% B27. BBN-induced tumor cells were maintained in 1 :1 mixture of DMEM and Ham’s F12 medium, supplemented with 2 mM L-Glutamine, 5 pg / ml insulin, 0.5 pg / ml hydrocortisone, 2% B27, 20 ng / ml EGF and bFGF, and 4 pg / ml heparin. To establish mouse bladder organoids (MBOs), mouse bladder tissues were mechanically and enzymatically dissociated with 5 U / mL Dispase for 30 minutes in 5% CO2 humidified atmosphere at 37°C and the resulting cell suspension was dissociated to single cells with Tryple Express. Cells were then plated at a density of 2000 cells / mL for primary normal murine cells and 1000 cells / mL for BBN-induced tumor cells and human bladder cancer cell lines, and allowed to generate 3D-organoids in a drop of 50 pL of pure Matrigel in a 24-well plate for 7-10 days after seeding in a total volume of 1 mL of culture medium. Organoid cultures were incubated at 37°C in a humidified 5% CO2 atmosphere, with fresh medium changed every 7 days. Drug treatments started 3 days after seeding. The resulting 3D-organotypic structures were observed and photographed using an inverted phase-contrast microscope equipped with a digital camera.
[0121] Expression, hairpin constructs and engineering of vectors
[0122] Numb knockdown in human bladder cancer cells was performed either by small interfering RNA (siRNA) or by lentiviral-driven expression of small hairpin RNA (shRNA). The efficiency of Numb silencing was assessed by Western Blotting analysis. For siRNA experiments, cells were transfected with 5 nM of control siRNA (siCTRL) or Numb siRNA (siNUMB) using Lipofectamine RNAiMAX transfection reagent (Thermo Fisher Scientific) according to the manufacturer’s instructions. A second round of transfection was performed 48 hours after the first transfection, and cells were processed for the appropriate assay 48 hours after the second transfection. The targeted sequences used were as follows: Numb siRNA,
[0123] CAGCCACUGAACAAGCAGA (SEQ ID NO. 1); scrambled siRNA,
[0124] AGACGAACAAGUCACCGAC17(SEQ ID NO. 2). pLKO.1-Numb shRNA were purchased from GE Dharmacon (oligo identification: TRCN0000007226); a hairpin against Luciferase was used as control (TRCN0000072243). pLKO.1 -Yap shRNA was obtained from Addgene (#166486) and used to knockdown YAP expression in BBN- induced cancer cells. To express ectopic Numb, a pLVX-Numb-GFP construct was engineered by subcloning the Numb-GFP fragment from a pEGFP-N1 / Numb construct (already available in the lab), into the EcoRI-Smal sites of the pLVX-Puro vector (Clontech).
[0125] DNA encoding full length hRac1-DN (Rac1-T17N) was amplified by PCR from pRK5- myc / Rac1-N17 (#15904, Addgene) using the following primers: RAC1_T17N FW: TTTTTCTCGAGACGCGTATCGATTGAATTGGCCACC (SEQ ID NO. 3); RAC1_T17N RV: CTGCAGGAATTCTTACAACAGCAGGC (SEQ ID NO. 4); DNA encoding full-length hRhoA-DN (RhoA-T19N) was amplified by PCR from pSLIK / RhoA-T19N (# 84646, Addgene) using the following primers: RhoA_T19N, FW: TTTTTCTCGAGACGCGTATGGAGCAGAAGCTGATCTCCGAGG (SEQ ID NO. 5); RhoA_T19N, RV: GGATATCTGCAGAATTCACCGC (SEQ ID NO. 6). The resulting DNA fragments were inserted into the Xhol-EcoRI sites of pLVX-Puro. All constructs were sequence-verified. HEK293T were used for viral supernatants production and infection.
[0126] Quantitative real-time PCR Total RNA was extracted with QIAzol™ Reagent and then purified using the RNeasy kit (Qiagen). RNA reverse transcription (1 pg) was performed by TaqMan Gene Expression Assay or SYBR Green methodology using the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher) or iScript™ Reverse Transcription Supermix (BIO-RAD), according to the manufacturer’s instructions. For BBN Numb- WT and Numb-KO mouse BC cells, RT-qPCR was performed using the TaqMan™ Fast Advanced Cells-to-CT™ Kit (Thermo Fisher). For human bladder cancer cell lines, RT-qPCR was performed using the iQ™ SYBR® Green Supermix (BIO-RAD). The ACt method was used to calculate the mRNA levels of each target gene normalized against different genes. The 2-AACtmethod was used to compare the mRNA levels of each target gene and the relative amplification value was plotted in the graph. TaqMan Gene Expression Assay IDs were as follow: Numb (Hs01105433_m1), ANKRD1 (Hs00173317_m1 ; Hs00923602_g1)
[0127] (Mm00496512_m1), CTGF (Hs00170014_m1 ; Mm01192933_g1), CYR61 (Hs00998500_g1 ; Mm00487498_m1), ACTB (Hs01060665_g1); GAPDH
[0128] (Mm99999915_g1). The following primer sequences were used for SYBR Green methodology: GAPDH FW: 5’-GTGGAAGGGCTCATGACCA-3’ (SEQ ID NO. 7), RV: 5’-GGATGCAGGGATGATGTTCT-3’ (SEQ ID NO. 8); CTGF ( / V.7) FW: 5’- ACCTGTGGGATGGGCATCT-3’ (SEQ ID NO. 9), RV: 5’- CAGGCGGCTCTGCTTCTCTA-3’ (SEQ ID NO. 10); CTGF (A / .2) FW: 5’- CCAATGACAACGCCTCCTG-3’ (SEQ ID NO. 11), RV: 5’- TGGTGCAGCCAGAAAGCTC-3’ (SEQ ID NO. 12); Cyr61 (N1) FW: 5’- AAATCCCCCGAACCAGTC-3’ (SEQ ID NO. 13), RV: 5’- GGGCCGGTATTTCTTCACACT-3’ (SEQ ID NO. 14); Cyr61 (A / 2) FW: 5’- AGCCTCGCATCCTATACAACC-3’ (SEQ ID NO. 15), RV: 5’-
[0129] TTCTTTCACAAGGCGGCACTC-3’ (SEQ ID NO. 16); ANKRD1 (N1) FW: 5’- CGTGGAGGAAACCTGGATGTT-3’ (SEQ ID NO. 17), RV: 5’-
[0130] GTGCTGAGCAACTTATCTCGG-3’ (SEQ ID NO. 18); ANKRD1 (A / 2) FW: 5’- AGCGCCCGAGATAAGTTGCT-3’ (SEQ ID NO. 19), RV: 5’-
[0131] CACCAGATCCATCGGCGTCT-3’ (SEQ ID NO. 20).
[0132] SDS-PAGE analysis
[0133] Cells were lysed in ice-cold RIPA buffer containing 20 mM Tris-HCI (pH 7.5), 150 mM NaCI, 1 mM Na2EDTA, 1 mM EGTA, 1 % NP-40, 1 % sodium deoxycholate, 2.5 mM sodium pyrophosphate, 1 mM beta-glycerophosphate, 1 mM NasVO4, 1 pg / mL leupeptin (#9806, Cell Signaling Technology) supplemented with Halt™ Protease and Phosphatase Inhibitor Cocktail (#78440, Thermo Fisher Scientific). Samples were clarified by centrifugation and protein content was measured using the BCA protein assay kit (Thermo Scientific). Proteins (10-15 pg) were resolved on 4-15% SDS-PAGE gels and transferred onto nitrocellulose membranes (Bio-Rad Laboratories). Membranes were blocked in Tris-buffered saline (TBS) containing 5% non-fat dry milk and 0.1 % Tween 20 (TBS-T), prior to incubation with primary antibodies overnight at 4°C. The membranes were then washed with TBS-T followed by exposure to the appropriate horseradish peroxidase-conjugated secondary antibody for 1 hr at room temperature and visualized on X-ray film using the enhanced chemiluminescence (ECL) detection system (Bio-Rad Laboratories) or with ChemiDoc Imager followed by acquisition with Image Lab Software (Version 5.2.1).
[0134] Rho GTPase pull-down activation assay
[0135] Activated GTP-bound RhoA was measured using the RhoA / Rac1 / Cdc42 Activation Assay Combo Biochem Kit™ (#BK030, Cytoskeleton, Inc, Tebu Bio Sri), following the manufacturer’s recommendations. Briefly, confluent cells were lysed in Cell Lysis Buffer (50 mM Tris pH 7.5, 10 mM MgCI2, 0.5 M NaCI and 2% Igepal) supplemented with Protease Inhibitor Cocktail (62 pg / mL Leupeptin, 62 pg / mL Pepstatin A, 14 mg / mL Benzamidine and 12 mg / mL tosyl-arginine methyl-ester) and incubated on ice for 20 minutes. Next, cell lysates were centrifuged at 13,000 rpm for 15 minutes at 4°C and supernatants were collected. For pull-down assay, 400 pg of protein lysate were added to a predetermined amount of rhotekin-RBD beads (25 pg). Twenty pg of cell lysate were used for the evaluation of total RhoA protein levels, detected using an antibody against RhoA.
[0136] Morphometric analysis of organoids and quantitation of invasive phenotypes in 3D-Matrigel
[0137] Phase-contrast images of organoids grown in Matrigel were acquired with EVOS FL Digital Inverted Fluorescence Microscope (Invitrogen, Massachusetts) at 4x magnification after 7-12 days. Images were then imported in Fiji software77(Version 2.14.0) and manually segmented to obtain regions of interest (ROI) for each organoid. Organoids smaller than 70 pm in diameter or touching the image border, and cells adherent to the well plate were excluded from the analysis. For each ROI, the analysis of organoid morphology and invasive phenotype was performed by the extraction and quantitation of the following shape descriptors: area (pm2), a parameter that correlates with the overall organoid size, indicative of cellular proliferation rate; roughness (perimeter / convex perimeter), a parameter that describes the irregularity of the organoid boundary, indicative of cell invasiveness and migratory ability; circularity (4TT*area / perimeter2), a general measure positively correlated with organoid maturation and inversely correlated with invasiveness; shape complexity (number of endpoint-pixels of the skeletonized shape), a measure of the complexity of the organoid shape, indicative of aberrant growth and correlated with the number of cells protruding from the edge32.
[0138] Immunofluorescence studies
[0139] For immunofluorescence (IF) staining of formalin-fixed paraffin-embedded (FFPE) samples (tissues and 3D-organoids), three pm-thick sections were deparaffinated with 100% xylene, rinsed in ethanol and re-hydrated in distilled water; antigen retrieval was performed by heating sections for 50 minutes at 95°C in pH 6.0 citrate buffer solution; tissue sections were then washed in TBS-T for 5 minutes and permeabilized with 0,3% Triton X-100 diluted in PBS for 30 minutes at room temperature (RT). Next, slides were blocked with 5% BSA diluted in PBS with 0,1 % Triton X-100 for 1 hour at RT. Finally, slides were incubated overnight at 4°C with primary antibody appropriately diluted in blocking solution. The next day, sections were incubated with the proper secondary antibody and DAPI to counterstain the nuclei for 1 hour at room temperature before mounting using Mowiol solution. For the analysis of 3D-organoids, representative ROIs were acquired with a Leica SP5 Confocal Microscope. For human NMIBC TUR specimens, the whole slide was acquired with a NanoZoomer S60 Digital slide scanner (Hamamatsu Photonics K.K.) with a 20X / 0.75 NA dry objective.
[0140] For the analysis of YAP on adherent cells (Fig. 4a, e, 6b, 13b, 15a, b, 16a, 17b, c), cells were co-stained for YAP and DAPI, along with any additional control markers of interest for the specific experiment and analyzed by Fiji image analysis software. The nucleus of each cell was segmented based on the DAPI channel and the mean YAP intensity was measured in an area comprising the nucleus itself and a 1 pm-thick cytoplasmic band surrounding the nucleus. The nucleus-to-cytoplasmic ratio was then computed for each cell and averaged across the different fields analyzed. For the analysis of YAP in mouse FFPE samples (Fig. 3a, 11 b-d), sections were co-stained for active (non-phosphorylated) YAP and DAPI. The nucleus of each cell was segmented based on the DAPI channel in Fiji followed by quantification of the mean active-YAP nuclear intensity. Cells with a nuclear intensity higher than 50 (arbitrary unit) were classified as YAP-positive.
[0141] For the analysis of YAP in FFPE human NMIBC TUR samples (Fig. 1 j), FFPE sections were co-stained for active YAP and DAPI and analyzed by QuPath (v. 0.4.4)78. Nuclei were automatically segmented on the DAPI channel using the deep-learning Stardist algorithm, based on an in-house trained model. The cytoplasmic cell area was represented as a 3 pm-thick band around the nucleus. Intensity of active YAP staining was measured in both nuclear and cytoplasmic cell compartments. For each patient, three independent representative regions of tumor tissue, each of average area equal to 1 mm2, were manually selected and analyzed for the distribution of cells with negative (nuclear intensity comparable to background cytoplasmic intensity) or positive (nuclear intensity 1 .5-fold superior to background cytoplasmic intensity) active YAP nuclear expression. Detection measurements relative to each region were exported in R Studio (v. 2023.06.2). Filters were applied on the exported database to exclude non-reliable cell detections (objects with size lower than 15 pm2and intensity lower than a custom threshold in the DAPI channel were discarded). The number of active YAP-positive cells was then normalized to the total number of cells per each region and aggregated per patient to extract the mean percentage of positive cells.
[0142] The quantitative analysis of pMLC2 and pCofilin staining (Fig. 5b, 16b,c) was conducted in Fiji by computing the mean fluorescence intensity over the entire area of the field of view occupied by cells. The segmentation of this area was achieved by generating an image from the maximum intensity projection of all channels, following automatic brightness and contrast adjustment to scale the signals. A custom threshold was then established on this image to delineate the cell-occupied regions for intensity measurement.
[0143] Immunohistochemistry
[0144] Three-pm thick sections were prepared from FFPE tissue blocks, dried at 37°C O / N and then processed with Bond-RX fully automated Stainer system (Leica Biosystems) according to the following protocol. For phospho-Cofilin and Numb staining, antigen retrieval was performed by heating sections in a microwave oven for 10 minutes on high power (-900 watt) in citrate buffer solution pH 6.0 at 100°C for 40 min. After the washing steps, peroxidase blocking was performed for 10 min using the Bond Polymer Refine Detection Kit (#DC9800, Leica Biosystems). Tissues were incubated for 30 min with the appropriate Ab diluted in Bond Primary Ab Diluent (#AR9352). Subsequently, tissues were incubated with post primary and polymer for 16 min, developed with DAB- chromogen for 10 min and counterstained with hematoxylin for 5 min. Slides were digitally scanned with the Aperio ScanScope. Digital images were processed with Adobe Photoshop CS3 (Adobe Inc.).
[0145] Transwell Invasion assay
[0146] Transwell migration / invasion assays were performed using PET membrane inserts (BRAND® 24-well Cell Culture Insert, PET-membrane, #BR782711 , Merck) covered with 20 pL of Matrigel:PBS (1 :2), as described in the manufacturer’s protocol. Briefly, 1 x105cells were seeded in growth factor- or serum-free medium, depending on the cell lines, in the upper chamber of the transwell insert, and treated, when necessary, with the appropriate pharmacological inhibitors (added in the upper and lower chamber of the transwell). Complete medium supplemented with HGF (25 ng / mL) was added to the lower part of the transwell. After an appropriate incubation period (18 hrfor BBN- induced mouse tumor cells, 24 hr for RT112 cells, 48 hr for RT4 cells), the transwell inserts were removed and the cells were fixed in the transwell insert with 4% PFA for 15 minutes. Cells were then washed with water to remove the formaldehyde. Then, using a sterile cotton swap, cells which had not migrated through the membrane were scraped off the top of the transwell insert and stained by using DAPI+0.1 % Triton X- 100 in PBS for 30 minutes. Images corresponding to the entire area of the transwell were collected with the Nikon Ti-2 microscope using a 10x / 0.3 NA dry objective and the number of invaded cells was analyzed using the Fiji software.
[0147] RNA sequencing
[0148] Libraries were prepared using the TruSeq Stranded Total RNA Gold kit (Illumina) according to the manufacturer’s protocol. Sequencing was performed on an Illumina NovaSeq 6000 platform with paired-end reads of 50 bp. Sequenced raw reads were processed with NF-CORE RNASeq pipeline (https: / / github.com / nf-core / rnaseq, version 3.8.1)79, using the human GRCh38 and mouse GRCm39 as reference genomes. Transcript abundances were quantified using the Salmon pseudo-aligner80. Genes abundance normalization and differential expression testing were performed with the DESeq2 R package (version 1.34)81. Log2 fold changes obtained were shrunken using the "apeglm" method82to improve the stability of the estimates in the presence of a limited number of replicates. In the absence of replicates for the BBN- KO sample treated with verteporfin vs. vehicle, Log2 fold changes were calculated by directly subtracting Iog1 p(normalized counts) of each condition, considering only genes with an average normalized count >20. All samples for each condition tested were analyzed with principal component analysis and projected. When the batch effect was associated with a principal component that explained more than 20% of the variance, the batch of the experiment was added as a covariate in the statistical model. Genes with a Benjamini-Hochberg adjusted p-value <0.05 and an absolute Iog2 fold change >0.5 were uploaded to the Ingenuity Pathway Analysis (IPA) software (Qiagen). IPA was used to infer upstream regulators from the RNAseq data by applying the "Upstream Regulator Analysis" tool83. Transcription regulators with an activation Z-score >1.5 or <-1.5 and an overlap p-value <0.05 were considered as significantly activated or inhibited, respectively. The association between gene expression modifications and changes in pathways and biological states was assessed with a Gene Set Enrichment Analysis (GSEA)6. The analysis was performed with the “fgsea” method implemented in the ClusterProfiler R package (version 4.2 ,2)84and the MSigDB “Hallmarks”85set was used as annotation. Genes were ranked based on their Iog2 fold change values. Genes with low counts or high dispersion that did not pass the DESeq2 independent filtering were not considered for the analysis. For the evaluation of the activity of YAP / TAZ pathway (not included in the “Hallmarks” set), a signature composed of 22 direct '■( 'I KZ transcriptional targets16was additionally used as annotation for the GSEA.
[0149] Definition of the NUMBLESSsignature and clinical validation of its prognostic relevance to NMIBC
[0150] We established a gene signature reflective of Numb deficiency in human bladder cancer by identifying 15 consistently upregulated genes (Log2FC >1 , padj <0.01) and 12 consistently downregulated genes (Log2FC <-1 , padj <0.01 ) following Numb knockdown in all three Numb-proficient bladder cancer cell lines (RTT4, RT112, KK47). Raw gene abundances from bladder cancer cell lines with high and low endogenous Numb expression, alongside abundances from Numb-KD experiments, were normalized using DESeq2. Normalized abundances were then converted to a log scale with the variance stabilizing transformations (implemented in DESeq2), before z-score computation. Using the expression levels of these 27 signature genes, we conducted unsupervised clustering of the samples with the Hierarchical Clustering algorithm from the complexHeatmap R library (version 2.13.4), employing a 1- Pearson's correlation as the distance metric. We then utilized this 27-gene signature to cluster patients from the 535 NMIBC patients of the UROMOL cohort20. Raw gene abundances were normalized, transformed, and scaled as mentioned above. We then applied the Partitioning Around Medoids (PAM) algorithm for clustering, using the 1- Pearson’s correlation coefficient as the distance metric. The silhouette method used to determine the optimal number of clusters identified two distinct NMIBC tumor subtypes. The 27 genes in the signature were hierarchically clustered to confirm the consistent and coordinated modulation of genes upregulated and downregulated in clusters predicted as NUMBLESS“like” and “not-like”. The 22-gene YAP / TAZ transcriptional target signature was used to classify the NMIBC samples into YAP- active and YAP-inactive groups. The PAM algorithm was reapplied for clustering with the 1-Pearson’s distance metric. The differential propensity for MIBC progression among the two NMIBC subtypes, as defined by the NUMBLESSsignature, was assessed using a univariable and multivariable Cox proportional hazards model. Multivariable analyses were adjusted for clinically relevant variables (age, gender, tumor grade, pT, history of intravesical therapy).
[0151] Statistical analysis and reproducibility
[0152] PCR experiments were performed in biological triplicates with the exception of the control PCR experiments of Fig. 16d in a single replicate. All the other experiments were repeated a minimum of two times. The number (n) of cells, animals, fields, patients, and independent experiments is reported in figures or in accompanying figure legends. Data are represented as mean ± standard error (SEM) in all cases except for Fig. 3a, and Circularity, Roughness, and Shape Complexity measures in Fig. 3c-d, 4g, 5f, 6f, 12c, 13d, 15d, 17e which were represented as boxplots. The boxplot is depicted with a box covering the interquartile range (IQR) from the 25th to the 75th percentile, the whiskers extend from the ends of the box to the smallest and largest data values within a 1.5 IQR. The horizontal line indicates the median, and the “X” indicates the mean. Means were compared using two sample Welch’s t-test, except for comparisons with the reference sample in RT-qPCR experiments (Fig. 3g, 4c, 5d, 6e, 13c, 17d), where one-sample t-test was performed. When multiple conditions were present we performed a FDR adjusted pairwise Welch’s t-test following a significant Welch’s ANOVA except for Fig. 4a, f, 5c, 6b, 11 b,c, 15b, 17c which were analyzed with Tukey HSD test following a significant ANOVA. Data distribution was assumed to be normal although not formally tested. The Benjamini-Hochberg method was employed for FDR corrections in multiple comparison testing. When performing multiple comparisons, only comparisons of biological interest are shown in the graphs; complete results are available in the source data.
[0153] Differences in proportions were tested with Fisher’s exact t-test in all 2x2 tables (Fig. 1 i, 8a, c) and with Pearson’s Chi-squared test in in larger contingency tables. (Fig. 2b, c). Odds ratio and relative confidence intervals were calculated with Small Sample- Adjusted Unrestricted Maximum Likelihood Estimation and Normal Approximation (Wald) for Fig. 2b, c and with the Median-Unbiased Estimate and Mid-P Exact Confidence Intervals for Fig. 8a, c. For survival analysis, the Cox proportional hazards model was employed as implemented in the 'coxph' function of the survival R package (version 3.5) to compute hazard ratios (HR) and confidence intervals (Cl) in both univariable and multivariable analyses. Global significance was tested using the logrank test, while the significance of each variable was determined using the Wald test. Statistical tests were two-sided with significance set at p < 0.05. Significance in figures is indicated as: *, p < 0.05; “, p < 0.01 ; ***, p < 0.001 ; ****, p < 0.0001 ; ns, not significant. Exact p-values are reported in source data. All statistical analyses were performed using the R software (version 4.1.2). Details of each test are provided in the figure legends.
[0154] Data availability
[0155] The raw and processed RNA sequencing data generated in this study have been deposited in the GEO database. Human and mouse gene set annotations for pathway analysis were retrieved from MSigDB [https: / / www.gsea-msigdb.org / gsea / msigdb / ] with the msigdbr package (version 7.4.1) in R. Human GRCh38 and mouse GRCm39 reference genomes (primary genome assembly) used for the alignment of RNA sequencing data are available on GENCODE [https: / / www.gencodegenes.org / ],
[0156] RESULTS
[0157] Example 1
[0158] Numb loss is a hallmark of aggressive disease in human BCa patients A preliminary immunohistochemistry (IHC) analysis of formalin-fixed paraffin- embedded (FFPE) BCa samples obtained from patients who underwent radical cystectomy, revealed that Numb expression is frequently downregulated in the tumor lesion compared to the adjacent normal urothelium (Fig. 1a). This observation prompted the investigation of the relevance of Numb loss to the natural history of the human BCa. We first surveyed a retrospective consecutive cohort of 356 MIBC patients subjected to radical cystectomy, assessing Numb status by IHC on whole FFPE tumor sections. Complete clinicopathological follow-up (median, 5.73 years) was available for 258 patients. Approximately 80% of patients were categorized as NumbHighand -20% as NumbLow. Notably, a NumbLowstatus significantly correlated with clinical parameters of aggressive disease (e.g., tumor extension and vascular invasion) and positive lymph node status, and also predicted a higher rate of mortality, independently of standard clinicopathological risk factors (NumbLowvs. NumbHigh, HR=1.64, Cl=1.1-2.4, p=0.0098) (Fig. 1 b and Fig. 8a, b).
[0159] To investigate whether Numb expression also has clinical value in NMIBC, we analyzed a cohort of 77 high-grade NMIBC patients who progressed or not to MIBC in a 4-month minimum follow-up period, as assessed by TUR (median follow-up 1.94 years; see Fig. 8c for clinicopathological characteristics). Strikingly, in this cohort, a NumbLowstatus predicted a worse progression-free survival with a higher rate of MIBC progression compared to NumbHighpatients (HR=4.65, Cl=2 - 10.8, p<0.0001) (Fig. 1c). These retrospective clinical studies clearly indicate that a Numb-deficient status is a hallmark of aggressive disease and poor prognosis in BCa. In NMIBC patients, Numb status behaves as a predictive biomarker of risk of muscle-invasion progression independently of other clinical parameters (Fig. 8d). Thus, Numb status could guide clinical decision-making between conservative vs. more aggressive therapies.
[0160] Example 2
[0161] Numb loss results in pathological regulation of YAP transcriptional activity in BCa
[0162] To investigate transcriptional programs associated with Numb loss in human BCa, we conducted a comparative analysis of the transcriptomes (obtained by bulk RNA-seq) of paired Numb-deficient and Numb-proficient BCa model systems. Specifically, we compared three MIBC NumbLowcell lines (CLS439, 5637 and HT1376) with three NMIBC NumbHighcell lines (RT4, RT112 and KK47) (Fig. 1d). Additionally, for an isogeneic comparison, we examined the three NMIBC NumbHighcell lines silenced or not for Numb (Numb-KD vs. Ctr-KD) (Fig. 1e). Integrative analysis of transcriptomic data using the IPA ‘Upstream Regulator Analysis’, led to the identification of common transcriptional regulators that are upregulated in the Numb-deficient condition relative to the Numb-proficient condition (i.e., in NUMBLow / Numb-KD vs. NUMBHigh / Ctr-KD, respectively). The most distinctive molecular traits associated with the Numb-deficient condition were activation of upstream regulators of the YAP / TAZ pathway (e.g., MRTFA / B, TEAD3 and YAP) and the EMT / phenotypic plasticity pathways (e.g., CTNNB1 , KLF4, TWIST1 , SOX4, SNAI, ZEB1) (Fig. 1f and Fig. 9a, Tables 1-4). In line with these results, GSEA analysis of the set of differentially expressed genes between the paired Numb-deficient vs. Numb-proficient cell model systems revealed the enrichment of a YAP / TAZ signature, composed of 22 transcriptional targets of the pathway16, and an EMT signature (“Cancer Hallmarks”, see Materials and Methods), in the Numb-deficient condition (Fig. 1g).
[0163] Example 3
[0164] Derivation of a clinically relevant gene signature characteristic of the Numb- deficient state
[0165] Previous studies in breast cancer have shown that, beyond the overall decrease in total Numb protein levels17, other molecular events, such as Numb isoform-specific transcriptional regulation and post-translational modifications, may underlie a deficient Numb status and correlate with clinical aggressiveness18 19. Considering the possibility of a similar scenario in BCa, we reasoned that a gene signature representative of the pattern of molecular alterations associated with a Numb-deficient state could be a more precise tool, compared to the direct assessment of total Numb IHC levels, to identify patients that will progress from NMIBC to MIBC. With this idea in mind, we performed an integrative comparative analysis of the transcriptomes of Numb-KD vs. Ctr-KD RT4, RT112 and KK47 NMIBC cell lines to identify the most significantly deregulated genes (absolute Log2 fold-change>1 , FDR adjusted p<0.01 ) displaying a consistent direction of regulation (up or down) relative to Numb status across the three paired analyses. This analysis led to the identification of a minimal signature composed of 27 genes up- or down-regulated consequent to Numb-KD in the three NMIBC cell lines, characteristic of the Numb defective condition (referred to hereafter as the “NumbLESSsignature”). In an unsupervised clustering analysis, this signature correctly stratified the NumbHigh(RT4, RT112 and KK47) and NumbLow(CLS439, 1537 and HT1376) BCa cell lines into two distinct groups (Fig. 9b).
[0166] To test the clinical value of the NumbLESSsignature in NMIBC patients, we interrogated the transcriptomes of 535 NMIBC patients, with complete long-term clinicopathological follow-up (median follow-up, 5.12 months), who were included in the UROMOL study20. The unsupervised clustering analysis of this cohort using the NumbLESSsignature identified two distinct groups of NMIBC patients who were classified as NumbLESS-like (corresponding to a Numb-deficient status) or NumbLESS-not-like (corresponding to a Numb-proficient status) (Fig. 9c). NumbLESS-like NMIBC patients displayed a significantly higher risk of MIBC progression and shorter progression-free survival compared to NumbLESS-not-like patients (HR=2.07, Cl=1 .2-3.5, p=0.0057) (Fig. 1 h). Remarkably, the ability of the NumbLESSsignature to predict risk of MIBC progression was maintained in a multivariable analysis adjusted for other clinicopathological factors (Fig. 9d). This finding, together with the results from the retrospective analysis of the NIMBC cohort by Numb IHC (see Fig. 1c), strongly argue for the clinical value of assessing Numb status in NMIBC patients to predict the risk of MIBC progression, beyond currently available staging parameters. It is also worthy of note that, in keeping with our initial hypothesis, the NumbLESS27-gene signature appears to have a superior stratification power, compared to IHC, for the identification of high-risk Numb-deficient NMIBC patients (-50% NumbLESS-like vs. 20% IHC NumbLow), likely due to its ability to capture a dysfunctional Numb status associated with heterogeneous molecular events18 19, other than the Numb protein hyperdegradation initially described in breast cancer17.
[0167] With the idea in mind to distillate from the NumbLESS27-gene signature a genomic predictor of risk of MIBC progression to be used in the clinical practice, the inventors reasoned that the cluster of commonly and concordantly overexpressed genes in Numb-KD vs. Ctr-KD RT4, RT112 and KK47 NMIBC cell lines afforded a higher likelihood to discern a Numb-deficient condition in TUR biopsy samples, with respect to underexpressed genes. The inventors therefore tested whether the cluster of 15 overexpressed genes comprised in the NumbLESS27-gene signature (ADCY9, ANKRD1 , CCN1 , CTNNA1 , CTSF, EFEMP1 , ERBB4, FAT4, FN1 , HSPE1 , MTMR2, PAPSS2, SPG21 , SPINK5, UTRN, henceforth “NumbLESS15-UP”) could recapitulate the prognostic predictive value of the entire NumbLESS27-gene signature in an unsupervised clustering analysis of the UROMOL cohort. Results from this analysis showed that the NumbLESS15-UP signature is superior to the entire NumbLESSsignature in predicting risk of MIBC progression and shorter progression-free survival (NumbLESS15-UP signature, HR=2.46, 01=1.4-4.2, p=0.00077; NumbLESS27-gene signature, HR=2.07, 01=1.2-3.5, p=0.0057) in a multivariable analysis adjusted for other clinicopathological factors (Fig. 1 k).
[0168] Example 4
[0169] Relevance of YAP / TAZ pathway activation in BCa patients
[0170] Having established a link between Numb loss and YAP / TAZ pathway activation in mouse and human BCa cell models, we extended our investigation to examine the relevance of this signaling pathway to NMIBC patients. Notably, in the UROMOL cohort, we observed a significant enrichment of a 22-gene YAP / TAZ signature16in the transcriptomic profiles of NumbLESS-like tumors, compared with NumbLESS-not-like tumors (Fig. 11 and Fig. 9e). Consistently, by immunofluorescence (IF) analysis of high-grade NMIBC TUR samples, we observed a direct correlation between low expression of Numb protein and increased nuclear accumulation of YAP, indicative of activated YAP signaling21(Fig. 1 j). These results argue that the association between a Numb-deficient status and YAP / TAZ pathway activation observed in cell lines might be pathogenetically relevant to NMIBC patients.
[0171] Example 5
[0172] Numb deficiency drives malignant transformation of the mouse urothelium and accelerates carcinogen-induced bladder tumorigenesis
[0173] To investigate the impact of Numb dysfunction on homeostasis of the urothelium, we used a Numb knockout (Numb-KO) mouse model bearing targeted deletion of the Numb gene in the basal CK5+ layer (Fig. 2a). The Numb-KO mouse was generated by crossing the Cre-loxP conditional Numb-KO mouse (Numblox / Stop / Iox) with the CK5- Cre mouse as previously described22’23. The rationale of this experimental strategy was based on evidence that, in both the mouse and human normal urothelium, Numb is more highly expressed in basal (CK5+ / CK14+) cells compared to suprabasal intermediate (CK7+) cells and superficial umbrella (CK20+) cells (Fig. 10a, b). We also reasoned that this model could have the potential to highlight key features of disease progression, considering previous evidence implicating basal, but not suprabasal, cells as the population-of-origin of aggressive BCa24-26. Comparative histology of the Numb-KO vs. WT bladder mucosa revealed that the absence of Numb in the urothelium leads to its early hyperplastic thickening, characterized by expansion of the basal layer, and appearance of in situ (CIS) and overtly infiltrating neoplastic lesions (Fig. 2b and Fig. 10c). These results suggest a direct involvement of Numb loss in initiating early morphological alterations in the urothelium, occurring prior to the emergence of preneoplastic lesions with a marked propensity to progress to advanced tumor stages.
[0174] To investigate the potential cooperative effect of Numb loss in bladder tumorigenesis, beyond its primary role, we examined the susceptibility of Numb-KO vs. WT mice to prolonged exposure to the chemical carcinogen, N-butyl-N-(4-hydroxybutyl) nitrosamine (BBN) (Fig. 10d). Of note, the BBN-induced BCa mouse model faithfully reproduces the histological features and genetic alterations observed in human BCa, including the progression from NMIBC to MIBC25’27 28. Numb-KO mice displayed increased susceptibility to BBN, evidenced by a dramatically increased incidence and accelerated rate of formation of invasive carcinoma, compared to WT mice (OR=5.1 , Cl=1 .2-44.8, p=0.013) (Fig. 2c), and a significant reduction in survival rate (HR=4.30, Cl=1 .7-11 .1 , p=0.0012) (Fig. 2d). Remarkably, we also noted that -50% of BBN- induced invasive tumors that developed in WT mice exhibited spontaneous loss of Numb expression (Fig. 2e,f).
[0175] Together, these results highlight the potent pro-tumorigenic effects of Numb loss in the urothelium: not only is Numb loss perse sufficient to induce bladder tumorigenesis, it also expedites invasive tumorigenesis driven by other oncogenic insults. Additionally, it is a frequently selected event during the neoplastic transformation of the urothelium, presumably as a means to alleviate its tumor suppressor function.
[0176] Collectively, the above results highlight the pathophysiological relevance of the BBN- induced mouse tumor model to investigate the underlying biology of Numb loss in bladder carcinogenesis. Therefore, in an approach similar to the comparison of the NUMBLow / Numb-KD vs. NUMBHigh / Ctr-KD human cell lines described in EXAMPLE 2 (see also Fig. 1 d-f), the inventors set out to perform global transcriptom ic profiling of BBN-Numb-KO vs. BBN-WT tumor MBOs. From the entire set of genes significantly up- or down-regulated (absolute Log2 fold-change>1 , FDR adjusted p<0.01) in BBN- Numb-KO vs. BBN-WT tumor MBOs (Fig. 2g), the inventors selected the top 50 upregulated genes (CD34, MPDZ, STK39, PAK3, CXCL2, INHBA, COL4A1 , COL4A2, APLN, SDC2, PPIC, SPARC, PGLYRP1 , DPYSL3, CXCL3, GKAP1 , DSEL, S0RBS2, ANKRD1 , TMEM176B, NEDD9, INPP4B, TCEAL8, CXCL1 , HDGFL3, GXYLT2, HSPB8, JAM2, GJC1 , RH0BTB3, GPR137B, LTBP1 , RBMS3, PTPRK, CCL2, ATP1 B1 , S0X4, ALDH1A1 , PXDN, ZFP37, NIPSNAP3B, TMEM64, EIF5A2, GPR161 , IL1A, FERMT1 , IGFBP7, VIM, TNC, BIRC6, labeled in dark grey in Fig. 2g), which were used to perform unsupervised clustering analysis the transcriptomes of the UROMOL patient cohort, following an approach similar to that described for the NumbLESS15-UP signature (see Fig. 1 k). Remarkably, this BBN-Numb-KO 50-UP signature significantly stratified NMIBC patients for risk of MIBC progression (HR=2.53, Cl=1 .5-4.2, p=0.00015) (Fig. 2h), showing a prognostic value similar to that of the NumbLESS15-UP signature (see also Fig. 1 k). This finding further argues for the relevance of the BBN-Numb-KO model to the naturally occurring human bladder cancer disease.
[0177] The inventors noted that only one gene, ANKRD1 , a YAP signaling transcriptional target, was in common between the human NumbLESS15-UP and the mouse BBN- Numb-KO 50-UP signature (Fig. 2i), likely due to the fact that these two models capture different evolutionary traits inherent to the Numb-deficient bladder tumorigenesis: i) the progressive worsening of biological tumor phenotypes due to secondary Numb loss in a primarily Numb-proficient tumor (as recapitulated by genetic Numb ablation in the Numb-proficient NMIBC human cell lines); ii) the ab initio high intrinsic aggressiveness of bladder tumors developed in a primarily Numb-defective genetic background (modeled in the response to BBN in the Numb-KO vs. WT mouse bladder). By combining the genes comprised in the two signatures, we derived a 65- gene signature that outperformed the individual NumbLESS15-UP and BBN-Numb-KO 50-UP signatures for prediction of NMIBC-to-MIBC risk progression and progression- free survival in the UROMOL patient cohort (HR=2.70, Cl = 1 .6-4.4, p= 0.00004.1 ) (Fig.
[0178] 2I)
[0179] Example 6
[0180] Loss of Numb induces aggressive biological phenotypes in BCa cells through YAP transcriptional hyperactivation
[0181] Based on the above results, we reasoned that the paired WT vs. Numb-KO and BBN- WT vs. BBN-Numb-KO mouse models were the ideal preclinical setting to elucidate the molecular mechanisms underlying the aggressive biological behavior of Numb- deficient BCa. We focused our attention on the link between deficient Numb expression and YAP / TAZ pathway hyperactivation, given evidence of this interaction in human BCa cell lines and the enrichment in YAP / TAZ transcriptional targets observed in the prognostic NumbLESS-signature.
[0182] IHC analysis of endogenous YAP expression in the normal human and murine urothelium showed higher levels of YAP in the basal layer, with an evident nuclear staining (Fig. 11a). Further analysis comparing the urothelium of WT vs. Numb-KO mice by in situ IF with an antibody specific to active YAP revealed that, while nuclear active YAP expression is confined to basal layer cells in the WT normal urothelium, the hypertrophic urothelium of Numb-KO mice shows a diffuse distribution of cells with average YAP expression level significantly higher than that detected in WT basal urothelial cells (Fig. 11b). Significantly higher active YAP expression was also detected in the side-by-side comparison of both early preneoplastic / hyperplastic and not-infiltrating CIS lesions of BBN-treated Numb-KO vs. WT mice (Fig. 11c). This increase in nuclear YAP levels was maintained in the comparison of BBN-Numb-KO vs. BBN-WT secondary tumors generated by retransplantation of primary BBN- induced infiltrating tumors (Fig. 11d). Collectively, these findings argue that the aberrant engagement of YAP / TAZ signaling is an early driving event in the stepwise process of Numb loss-directed spontaneous or carcinogen-induced urothelial transformation. Besides representing further evidence of the association between Numb loss and YAP hyperactivation found in human BCa cell line models, these findings underscore the suitability of the paired Numb-KO vs. WT and BBN-Numb-KO vs. BBN-WT murine models to dissect the functional contribution of YAP hyperactivation to the biology of Numb-deficient BCa. To this end, we took advantage of the ability of normal and tumor mouse bladder urothelial cells to originate ex vivo in a reconstituted extracellular matrix (Matrigel) self-organized 3D organotypic structures (referred to hereafter as mouse bladder organoids, MBOs), amenable to molecular and functional studies29. This approach enabled us to investigate in a highly tractable and pathophysiologically relevant experimental setting the phenotypic alterations linked to Numb loss / YAP hyperactivation both in the normal urothelium (comparing WT vs. Numb-KO MBOs) and in bladder tumors (comparing BBN-WT vs. BBN-Numb- KO tumor MBOs). An initial IF analysis of active YAP expression in MBOs generated from aged-matched 16-week-old Numb-KO and WT mice revealed that the absence of Numb was associated with a diffuse distribution of cells with high YAP intranuclear levels across the entire organoid population (Fig. 3a), mirroring the findings from the in situ analysis of the Numb-KO vs. WT bladder mucosa (Fig. 11 b). In addition, gross morphological differences appeared evident between the two MBO cultures. WT-MBOs showed a typical round-shaped morphology and a smooth surface deprived of invasive protrusions (Fig. 3b). In contrast, Numb-KO MBOs appeared as rapidly growing, irregular, multilobular structures with numerous budding protrusions infiltrating the surrounding matrix, indicative of an invasive phenotype (Fig. 3b). To quantify these morphological differences, we assessed well-defined physical parameters which are informative of key biological processes that determine the final organoid morphology30-32(see also Materials and Methods): i) overall surface area - cell growth and proliferation potential, / / ) circularity / roundness - degree of differentiation / maturation and strength of cell-cell contacts, / / / ) roughness and shape complexity - cell invasion potential. From these analyses, we concluded that the absence of Numb is associated with an aberrant morphogenetic program, characterized by hyperplasia (increased area), aberrant differentiation and loss of cell-to-cell cohesion (decreased circularity / roundness), and emergence of an invasive phenotype (increased roughness / shape complexity) (Fig. 3c).
[0183] To investigate the relevance of YAP activity to the aggressive morphological traits of Numb-KO MBOs, we employed verteporfin (VP), a clinically approved inhibitor of YAP transcriptional activity that works by preventing the YAP-TEAD interaction33. VP strongly inhibited the hyperplastic and invasive phenotypes of Numb-KO MBOs, resulting in smaller, more regularly shaped organoids (Fig. 3b, c).
[0184] Analogous results were obtained in the morphological comparison of MBOs generated by cells dissociated from BBN-WT and BBN-Numb-KO tumors (see also Fig. 11d,e). The absence of Numb associated with remarkably more aggressive tumor phenotypes, reflected in a superior ability of BBN-Numb-KO MBOs to grow and locally infiltrate the surrounding matrix with cellular protrusion and migratory cells outside their exterior borders, which was reversed upon treatment with VP (Fig. 3d,e). Moreover, in the transwell Matrigel invasion assay, VP strongly inhibited the invasive / migratory potential of BBN-Numb-KO cells, reducing the number of invading cells to that of BBN- WT cells (Fig. 3f). RT-qPCR analysis of selected YAP targets genes, Ankrdl, Ctgfand Cyr61, confirmed the constitutively higher YAP transcriptional activity in BBN-Numb- KO vs. BBN-WT MBOs, which was reverted by VP treatment (Fig. 3g). These findings were recapitulated in the GSEA of the global transcriptomic profiles of BBN-Numb-KO vs. BBN-WT MBOs using a YAP / TAZ transcriptional target signature16(Fig. 12a, Table 5). Remarkably, in line with results obtained in human BCa cell lines, GSEA analysis revealed a significant enrichment of an EMT signature (from Cancer “Hallmarks”) in BBN-Numb-KO vs. BBN-WT MBOs (Fig. 12a, Table 5), which was also sensitive to VP treatment (Fig. 12a, Table 6). This was an unexpected finding indicating that the acquisition of plasticity / EMT traits in Numb-deficient BCa cells, likely involved in their aggressive invasive phenotypes, is a downstream consequence of YAP hyperactivation.
[0185] It was then investigated whether genetic silencing of YAP phenocopies the inhibitory effects of VP treatment on the aggressive morphological traits of BBN-Numb-KO tumor MBOs. Stable KD of YAP using a lentiviral shRNA vector inhibited the hyperproliferative and invasive / migratory phenotype of BBN-Numb KO cells, similarly to VP, but had no effect on BBN-WT MBOs (Fig. 12b-e). Moreover, to provide definitive evidence of the dependency of the molecular and functional phenotypes of BBN-Numb-KO MBO cells on Numb loss, it was restored Numb expression in these cells using a lentiviral Numb-GFP vector. Ectopic Numb expression inhibited YAP nuclear translocation, with evident YAP cytoplasmic retention (Fig. 13a,b), and impaired YAP transcriptional activity (Fig. 13c). These molecular changes were accompanied by a significant reversion of the aberrant morphological traits of BBN- Numb-KO MBOs, resulting in BBN-WT-like morphological structures (Fig. 13d).
[0186] Together, these data demonstrate that, through a molecular mechanism requiring hyperactivation of YAP signaling, loss of Numb drives an aberrant morphological program in the normal urothelium that precedes its overt malignant transformation, while conferring a higher degree of biological aggressiveness in already transformed BCa tumor cells by enhancing their proliferative and invasive / migratory potential, likely through the induction of a YAP-dependent EMT program.
[0187] The increased nuclear localization and transcriptional activity of YAP observed in cells lacking Numb, prompted us to investigate the status of Hippo signaling cascade. Core components of this pathway are the serine / threonine kinases, MST 1 and LATS, whose sequential activation leads to the phosphorylation and subsequent cytoplasmic sequestration of YAP, ultimately repressing its nuclear translocation and transcriptional activity21 34. We therefore hypothesized that Hippo signaling could be repressed in Numb-deficient BCs. By immunoblotting of cellular lysates from BBN- Numb-KO vs. BBN-WT MBOs, we detected markedly reduced levels of the phosphorylated active forms of MST1 and LATS in BBN-Numb-KO cells compared with BBN-WT cells, despite having similar levels of total protein (Fig. 13e). This reduction in the phosphorylated Hippo pathway kinases was in line with the observed reduction in inactive phosphorylated YAP in BBN-Numb-KO vs. BBN-WT cells (Fig.
[0188] 13e)
[0189] These results demonstrate that hyperactivation of the YAP / TAZ pathway subsequent to Numb loss is mechanistically linked to the downregulation of the upstream canonical Hippo signaling cascade.
[0190] Example 7
[0191] YAP hyperactivation downstream of Numb loss is dependent on RhoA / ROCK signaling
[0192] The Hippo-YAP signaling pathway operates as a nexus that, in response to microenvironmental cues, controls multiple cellular and context-specific responses essential for tissue homeostasis, including proliferation, differentiation, cell plasticity and sternness34’35. A wide range of architectural and mechanical cues, transmitted through cell-cell junctions and cell-matrix adhesions, as well as multiple extracellular ligands / growth factors and downstream signaling pathways, can control this pathway through complex canonical and non-canonical arms36'38. In this context, both upstream and downstream events linked to actin dynamics and cytoskeletal organization, play a pivotal role in the regulation of Hippo-YAP signaling34’35’38 39. This is clearly demonstrated by the ability of the F-actin disrupting agent, Lantruculin, to impede YAP / TAZ activation in the context of both canonical or non-canonical arms of Hippo- YAP signaling regulation36’40 41. On these bases, to gain a deeper understanding of the mechanism driving YAP hyperactivation following Numb loss, we leveraged the BBN Numb-KO vs. WT MBO model to perform an immunofluorescence-based phenotypic screening using pharmacological inhibitors of key regulators of actin dynamics and cytoskeleton organization. In particular, we focused on the small GTPases, RhoA and Rac1 , guided by previous evidence indicating that loss of Numb control over their activity results in alterations in actin dynamics and induces different types of cell motility phenotypes42-44. In this analysis, we monitored YAP intranuclear translocation vs. cytoplasmic retention in BBN Numb-KO vs. BBN WT cells treated with an inhibitor of RhoA (bacterial exoenzyme C3 transferase), Rac1 (RACi, NSC23766), Rho-associated protein kinase (ROCKi, Y-27632), and actin polymerization (Latrunculin A: LatA)36. While Rac1 inhibition had no effect on YAP nuclear translocation in BBN Numb-KO cells, the inhibition of RhoA and its downstream effector ROCK reduced nuclear YAP levels similarly to LatA (Fig. 4a and Fig. 14). In contrast, no significant effects were observed in BBN WT (Fig. 4a and Fig. 14). These results point to the involvement of the RhoA / ROCK actin regulatory pathway in the control of YAP signaling by Numb.
[0193] Further investigation of the role of RhoA revealed that its inhibition with C3 transferase induced reactivation of the YAP-inhibitory Hippo pathway selectively in BBN Numb- KO vs. BBN WT cells, as evidenced by the increased phosphorylation levels of MST 1 , LATS and YAP (Fig. 4b). In addition, C3 transferase reduced the expression of YAP transcriptional targets (Fig. 4c). Thus, it appears that active RhoA is required for YAP hyperactivation in the Numb-KO condition. In line with this idea, we showed that BBN Numb-KO cells display higher levels of the active GTP-bound form of RhoA compared with BBN-WT cells (Fig. 4d). Moreover, expression of a dominant-negative RhoA mutant (TN19-RhoA) in BBN Numb-KO tumor cells inhibited YAP nuclear translocation (Fig. 4e,f) and reversed the phenotypes associated with biological aggressiveness, as witnessed in the morphological analysis of MBOs (Fig. 4g). In contrast, no effects of dominant-negative RhoA were observed in BBN-WT tumor cells (Fig. 4e-g). RhoA inhibition with C3 transferase also reduced the invasive / migratory potential of BBN Numb-KO tumor cells in the transwell Matrigel invasion assay, to levels similar to BBN- WT cells (Fig. 4h). Notably, none of the above phenotypes were affected by pharmacological (RACi, NSC-23766 inhibitor) or genetic (T17N dominant-negative mutant) inhibition of Rac1 activity (Fig. 15a-e).
[0194] Next, we examined in more detail the involvement of the RhoA downstream effector, ROCK, which signals to the actin cytoskeleton and contractile machinery by regulating the phosphorylation status of two proteins: cofilin, a protein that in its phosphorylated form becomes inactive and loses its function in actin filament disassembly45; myosin light chain 2 (MLC2), a direct phosphorylation target of ROCK involved in the regulation of actomyosin contractility and stress fiber assembly / contraction4647. We found increased levels of phosphorylated cofilin and MLC2 in BBN Numb-KO vs. BBN WT, indicating that loss of Numb is associated with higher basal ROCK activity (Fig. 5a-c). Using the ROCK inhibitor (ROCKi, Y-27632), we verified that the high levels of phosphorylated MLC2 (pMLC2) in BBN Numb-KO cells were dependent on ROCK activity (Fig. 5b, c).
[0195] Finally, we demonstrated that ROCK has a key role in YAP signaling regulation downstream of Numb, as evidenced by the reduction of YAP transcriptional activity in BBN Numb-KO MBOs treated with Y-27632 (Fig. 5d). In addition, ROCK inhibition reversed the aggressive phenotypes of BBN-Numb-KO tumor cells, as witnessed in the analysis of morphological parameters measuring MBO growth and invasive / migratory potential (Fig. 5e-g).
[0196] Together, these results point to the selective dependency of the aggressive invasive / migratory phenotype of BBN Numb-KO tumor cells on the aberrant activation of a RhoA / ROCK axis signaling to the actin cytoskeleton. Therapeutic targeting of this circuitry could therefore serve as a strategy to treat aggressive Numb-deficient BCa.
[0197] Example 8
[0198] Dysregulation of RhoA / ROCK / YAP signaling underlies the invasive phenotype of Numb-deficient human BCa cells
[0199] To investigate the relevance of RhoA / ROCK / YAP signaling to Numb-deficient human BCa, we initially employed the human RT4 cell line, which represents a model of low aggressive, well-differentiated non-invasive luminal BCa48'50. The comparison of Numb-KD vs. CTR-KD RT4 BCa cell lines confirmed the results obtained in the BBN Numb-KO vs. BBN WT mouse model, showing that the absence of Numb leads to YAP hyperactivation through the downregulation of the canonical Hippo pathway, as witnessed by the reduced phosphorylation levels of MST1 , LATS, and YAP in Numb- KD vs. CTR-KD RT4 cells (Fig. 6a). Moreover, several lines of evidence support the finding that activation of RhoA / ROCK signaling is upstream of YAP hyperactivation in Numb-deficient RT4 cells. Indeed, pharmacological inhibition of RhoA and ROCK, but not Rac1 , reduced the nuclear / cytoplasmic YAP ratio selectively in Numb-KD RT4 cells, mimicking the effect of the actin polymerization inhibitor LatA (Fig. 6b and Fig. 16a). The increased cytoplasmic retention of YAP correlated with increased levels of inactive phosphorylated YAP, seemingly due to restoration of the Hippo pathway activity, indicated by increased p-MST1 / 2 levels, thus mirroring the results observed in Numb-KD RT4 cells treated with the RhoA inhibitor C3 transferase (Fig. 6c). In addition, Numb-KD vs. CTR-KD RT4 cells displayed higher constitutive levels of activated ROCK, as witnessed by the higher levels of the phosphorylated forms of its downstream effectors, cofilin and MLC2 (Fig. 6d and Fig. 16b, c). Treatment with RhoA and ROCK inhibitors (C3 transferase and Y-27632, respectively) also strongly inhibited the transcription of the YAP target genes, ANKRD1, CTGF and CYR6 (Fig. 6e), similarly to the YAP transcriptional inhibitor VP (Fig. 16d). Therefore, it appears that the same molecular circuitry involving Rho / ROCK, actin remodeling and Hippo signaling is required for the regulation of YAP by Numb in both mouse and human BCa cells.
[0200] Next, we verified whether this mechanism could be relevant to biological phenotypes induced by Numb loss in human BCa, analyzing the effects of the different pathway inhibitors on the morphology and invasion / migration potential of 3D-Matrigel organoids generated by Numb-KD vs. CTR-KD RT4 cells. Similarly to the BBN tumor model, we found that the absence of Numb exacerbates the biological aggressiveness of RT4 cells, as evidenced in the comparison of Numb-KD vs. CTR-KD RT4 organoids by the increase in organoid size (area), propensity to form invading protrusions (Fig. 6f,g), and increased invasive / migratory potential in the transwell Matrigel invasion assay (Fig. 6h). All these phenotypes were reversed selectively in Numb-KD RT4 cells by pharmacological inhibition of YAP (VP) and RhoA / ROCK (C3 / Y-27632) signaling (Fig. 6f-h).
[0201] This set of molecular and functional findings obtained in the RT4 BCa cell line was entirely recapitulated following Numb silencing in another model of low aggressive, moderately differentiated non-invasive human BCa, the RT112 cell line48-50(Fig. 17a- g). Together, these data, obtained in two independent human NMIBC cell line models with proficient Numb expression and low degree of aggressiveness, further support the notion that loss of Numb results in the acquisition of biological phenotypes associated with aggressive BCa, establishing its relevance to the human BCa disease. Mechanistically, these data are further evidence that the aggressive biology of Numb- defcient BCa cells depends on the aberrant activation of RhoA / ROCK signaling to the actin cytoskeleton, downstream of Numb loss, which leads to suppression of the YAP- inhibitory Hippo pathway and consequently YAP hyperactivation. Remarkably, this molecular circuitry, functionally validated in the above human NMIBC cell lines, appears to be relevant to real-life NMIBC patients, since we detected significantly higher levels of phosphorylated cofilin, indicative of increased ROCK activity, in NumbLowNMIBC TUR samples, compared with NumbHigh(Fig. 7a, b). This finding is also in keeping with the increased nuclear accumulation and transcriptional activity of YAP that we observed in NMIBC patients with deficient Numb status (see Fig. 1 h-j). Together, these findings point to the RhoA / ROCK / YAP signaling pathway as a potential actionable vulnerability for therapeutic intervention in Numb-deficient NIMBCs.
[0202] Example 9.
[0203] Derivation of the model risk starting from the signature of 64 genes
[0204] A prognostic model to stratify bladder cancer patients at risk of progression from non- muscle-invasive to muscle-invasive disease (NMIBC-to-MIBC progression) was derived using RNA-seq data and clinical metadata of 530 patients from the UROMOL cohort21. The initial set of genes used to derive the risk model was represented by the 64-gene signature, comprising 15 genes derived from human established cell line models and 50 mouse-derived genes, which share one gene in common. Gene counts were normalized using size factors estimated from the training set using the “median of ratios” method (Anders, Simon, and Wolfgang Huber. Differential Expression Analysis for Sequence Count Data. 2010). Normalized genes were log transformed with the addition of a pseudo-count of 1 , and then scaled into z-scores.
[0205] To minimize dropout risk in sub-optimally sequenced samples, only genes with consistently high expression were retained, which resulted in the elimination of 12 genes with mean expression below 100. The model stability was maximized by selecting a subset of stable genes using the Meinshausen & Biihlmann algorithm as implemented in 'stabs' and 'c060' R packages (Meinshausen, Nicolai, and Peter Biihlmann. “Stability Selection.” Journal of the Royal Statistical Society Series B: Statistical Methodology, vol. 72, no. 4, Sep. 2010, pp. 417-73; Hofner, Benjamin et al. “Controlling false discoveries in high-dimensional situations: boosting with stability selection.” BMC bioinformatics vol. 16 144. 6 May. 2015, doi:10.1186 / s12859-015- 0575-3; Sill, Martin, et al. “C060 : Extended Inference with Lasso and Elastic-Net Regularized Cox and Generalized Linear Models.” Journal of Statistical Software, vol. 62, no. 5, 2014). Using a selection probability threshold (TT) of 0.8, we identified a subset of 32 stable genes, of which 8 were classified as highly stable under a controlled per-comparison error rate (PCER = 0.2) (Fig. 18).
[0206] Model development was carried out within the 'tidymodels' framework (Kuhn M, Wickham H (2020). Tidymodels: a collection of packages for modeling and machine learning using tidyverse principles) in R (version 4.5), using elastic-net penalized Cox regression with hyperparameter tuning via 4 repeated 3-fold cross-validation. The best hyperparameters were selected based on integrated Brier score performance. Expected model performances were evaluated using repeated nested cross-validation (outer folds: 125 repeats, 4 folds). The outer folds (test sets) were used only for generalization performance assessment. The model achieved stable performances between 1-6 years, with a mean AUC of 0.85 and 0.78 in the training and test sets at 5 years, respectively. All the values across all the timepoints are indicated in Fig. 19A. The mean integrated Brier score was 0.068 (95% Cl: 0.061-0.075) in the training sets and 0.076 (95% Cl: 0.065-0.089) in the test sets. The mean C-index was 0.81 (95% Cl: 0.76-0.85) in the training sets and 0.075 (95% Cl: 0.65-0.084) in the test sets (Fig. 19B). Fig. 20 illustrates the mean progression-free survival curves for patients in the test sets of the 500 folds stratified by an exemplificative risk of progression of 5% at 5 years.
[0207] After having established good generalization performances, the final model was trained on the full dataset, following the international TRIPOD (Transparent Reporting of a multivariable prediction model for Individual Prognosis Or Diagnosis) study design 1 b (Collins, Gary S., et al. “Transparent Reporting of a Multivariable Prediction Model for Individual Prognosis or Diagnosis (TRIPOD): The TRIPOD Statement.” BMC Medicine, vol. 13, no. 1 , 2015, p. 1. DOI.org, https: / / doi.org / 10.1186 / s12916-014- 0241 -z), including the k-fold cross-validation resampling method adopted.
[0208] Beta-coefficients of each gene are reported in the table below.
[0209] Beta coefficients represent the estimated effect of each gene's expression level on the predicted risk of disease progression within a statistical model. A positive betacoefficient indicates that higher expression of the gene is associated with an increased risk, suggesting a potential risk factor. Conversely, a negative beta-coefficient implies that higher expression is associated with a decreased risk, indicating a potential protective role. These coefficients are derived from the penalized Cox regressionbased models and reflect both the direction and magnitude of the association between gene expression and clinical outcome.
[0210] The model is capable of predicting the probability of progression to MIBC for each patient used as a continuous variable (Fig. 21A). Fig. 21A also shows an illustrative example in which a clinically relevant 5% risk threshold is used to define in the continuous PROSIBLAD model a cut-off value for dichotomizing NIMBC patients into high- and low-risk groups (top); the distribution in the two different high / low PROSIBLAD risk groups of high, intermediate or low risk, as classified in the clinical routine using the European Association of Urology (EAU) criteria is also shown (bottom). Fig. 21 B shows that some 40.3% of NMIBC patients clinically deemed at low risk according to EAU risk classification criteria are identified as high risk (i.e. >5% rate of risk progression to MIBC) by our PROSIBLAD model. This proportion increases to 58.1 % in the EAU intermediate-risk group and 78.9% in the EAU high-risk group.
[0211] Calibration of the final model was assessed by comparing observed 5-year event rate against the mean predicted probability for clinically relevant risk intervals (0-2%, 2-5%, 5-10%, 10-30%, 30-70%, 70-100%). Continuous calibration line was also estimated with the flexible adaptive hazard regression approach (Kooperberg, C, and D B Clarkson. “Hazard regression with interval-censored data.” Biometrics vol. 53,4 (1997): 1485-94). The good calibration of the model supports its use as a continuous risk predictor, enabling clinicians and patients to set personalized risk thresholds based on individual decision-making (Fig. 22, 23).
[0212] DISCUSSION The present invention demonstrates that loss of the tumor suppressor Numb is a hallmark of aggressive disease course in real-life BCa patients and identified key mechanisms causal to th e biological aggressiveness of Numb-deficient bladder tumorigenesis, highlighting the potential of Numb loss as a prognostic and therapeutic biomarker for personalized, risk-adjusted treatment of BCa patients, in particular NMIBC patients.
[0213] Numb is an evolutionarily conserved cell fate determinant and endocytic adaptor protein51that has emerged in recent years as a tumor suppressor protein with prognostic and pathogenetic relevance in various cancers, such as breast, prostate, brain, lung, and colon cancer17'19’22’44’52'56. The tumor suppressor function of Numb has been extensively characterized in breast cancer, where its loss of function leads to the emergence and uncontrolled expansion of cancer stem cells through inhibition of the tumor suppressor p53 and increased activity of the oncogene Notch17'19’22’52’53. In the present invention, using a range of experimental systems, including established human BCa cell lines, in vivo mouse models, primary organoid cultures and patient cohorts, it has been established that Numb is a clinically relevant tumor suppressor protein in the bladder. Retrospective studies of MIBC and NMIBC patient cohorts demonstrated that low Numb expression in the tumor predicts worse overall survival and increased risk of progression to MIBC, respectively. Moreover, using genetically engineered mouse models, we uncovered that Numb loss is causal in bladder tumorigenesis, confirming its role as a potent tumor suppressor. Indeed, transgenic deletion of the Numb gene in the CK5-expressing basal layer of the urothelium was alone sufficient to induce the formation of preneoplastic lesions, non-invasive tumors and muscle-invasive tumors. This finding aligns with the emerging view that intrinsically aggressive BCa with a propensity for muscle invasion originate from basal, rather than suprabasal, cells24'26 57. The development of a genetically engineered mouse model recapitulating the non-invasive to invasive bladder cancer transition holds particular significance in the field of bladder cancer, considering the relative paucity of in vivo models amenable to study the underlying biology of NMIBC to MIBC progression, which still remains largely unexplored58. Related to this point, the progressive range of lesions observed in our Numb-KO mouse model supports the idea that NMIBC and MIBC represent different stages along a disease continuum. This finding is in keeping with recent experimental studies in the mouse26and with evidence of a high degree of similarity between genetic alterations in NMIBC and MIBC patients14, which have challenged the historical view of NMIBC and MIBC as ab initio distinct pathobiological entities15.
[0214] In addition to Numb loss-of-function being alone sufficient to drive spontaneous tumorigenesis, it can also cooperate with other oncogenic insults to accelerate tumor progression and fatal outcome, as clearly demonstrated in Numb-KO mice exposed to the chemical carcinogen, BBN. This compound induces bladder tumorigenesis in mice, mirroring the progression of naturally occurring human BCa disease25’27 28. By comparing the effects of BBN on WT and Numb-KO mice, we could formally prove that the absence of Numb exacerbates the biological aggressiveness of BCa cells by conferring a highly proliferative and invasive / migratory phenotype, as evidenced in the morphological comparison of BBN-Numb-KO vs. BBN-WT tumor organoids and the transwell invasion / migratory assay. These findings were entirely replicated in preclinical models of superficial non-invasive human BCa, the RT4 and RT112 cell lines48'50, which switched to an overtly invasive phenotype following silencing of Numb expression. Together, these results point to Numb loss as a molecular hallmark of biological aggressiveness in human BCa, strongly supporting our clinical evidence of Numb loss as a biomarker of clinically aggressive disease course in real-life BCa patients.
[0215] At the mechanistic level, the invention demonstrates that the aggressive biological phenotypes conferred by Numb loss are dependent on a RhoA / ROCK / Hippo molecular circuitry leading to hyperactivation of YAP (Fig. 7c). In the presence of functional Numb, RhoA / ROCK signaling to the actin cytoskeleton is restrained, allowing an active Hippo pathway to inhibit the activity of YAP through its phosphorylation and cytoplasmic retention (Fig. 7c). In contrast, in the absence of Numb, RhoA / ROCK signaling is upregulated, leading to suppression of the Hippo pathway via actin cytoskeleton remodeling and consequently nuclear translocation of YAP and activation of YAP / TAZ transcriptional activity (Fig. 7c). These findings are in line with a recent report showing that Numb-mediated inhibition of RhoA / ROCK activity is implicated in the regulation of migration and proliferation in colon cancer cells44. Therefore, the dysfunction of the Numb-RhoA / ROCK / YAP axis identified in this study may have far-reaching implications in cancer biology beyond BCa. One open question from our study is how Numb regulates RhoA / ROCK signaling. We previously showed that the endocytic / sorting function of Numb is involved in the regulation of another small GTPase, Rac1. Numb loss results in Rac1 activation, promoting the formation of specialized actin-based lamellipodia protrusions and cell motility phenotypes42 43. These events are associated with the relocalization of Rac1 to the plasma membrane through an EFA6B-ARF6-dependent endocytic recycling route, which is negatively regulated by the direct interaction of Numb with the guanine nucleotide exchange factor (GEF) EFA6B43. Therefore, Numb might control RhoA subcellular localization and activation state by interacting with positive (GEFs) or negative (GAPs: GTPase-activating proteins; GDIs: guanine nucleotide dissociation inhibitors) regulators of RhoA activity. This hypothesis is in keeping with previous reports linking RhoA activation to its increased plasma membrane localization and decreased cytosolic distribution59 60.
[0216] Furthermore, our results showing that a RhoA-dependent / Rad -independent mechanism is involved in Hippo pathway inactivation / YAP activation in Numb-deficient BCa, point to actin cytoskeleton remodeling events selectively controlled by RhoA / ROCK, such as actomyosin contractility and stress fiber formation4561. This hypothesis, supported by our evidence of increased phosphorylation of MLC2 and cofilin in Numb-deficient BCa cells, is consistent with reports that RhoA-induced stress fibers can suppress the Hippo pathway and activate YAP62 63. It has been proposed that stress fibers likely act as a scaffold for several Hippo pathway components, such as AMOT and MST1 / 264-67, and that MST1 / 2 is activated upon F-actin depolymerization67.
[0217] On the other hand, Numb has been reported to directly or indirectly interact with other actin cytoskeleton regulators, such as a-catenin, -catenin, NF2 / Merlin, AMOT and SPTAN1 , which can influence the Hippo pathway’s MST1 / 2-LATS kinase cascade to inhibit YAP / TAZ activity666869. Whether such mechanisms are at play in Numb- deficient BCa and how they are integrated with the Numb / RhoA / ROCK axis remain to be elucidated. However, it is apparent that Numb loss has the potential to influence multiple networks involved in actin cytoskeleton remodeling and cell geometry regulation, including tight junctions, adherens junctions and cell polarity complexes, as well as extracellular diffusible signals3436-40, which could all contribute to the aggressive invasive phenotypes through RhoA / ROCK signaling activation. The object if the invention has important clinical implications.
[0218] First, the invention identified through integrative global transcriptomic profiling of human and mouse bladder cancer models, molecular signature(s) indicative of a Numb-deficient condition, which were validated in the retrospective analysis of real- world bladder cancer patients as clinically actionable genomic predictor(s) of risk of NMIBC to MIBC progression. Once translated into the clinical practice, these novel genomic tools aid personalized decision-making, in particular in NMIBC patients, between more conservative treatments, such as active surveillance and therapy descalation, vs. more aggressive treatments, such as earlier cystectomy and escalating chemotherapy.
[0219] Second, the functional characterization of a RhoA / ROCK / YAP circuitry responsible for the aggressive biology of Numb-deficient BCa opens up opportunities for the development of targeted therapies, in particular for the treatment of NMIBC patients at high risk of MIBC progression. Indeed, the present invention, involving the use of pharmacological inhibitors or genetic inhibition, highlights the RhoA / ROCK / YAP axis as an actionable vulnerability which can be exploited to restrain the aggressiveness of Numb-deficient BCa (Fig. 7c). Notably, several drugs that can interfere with this circuitry are currently under investigation as potential anti-cancer treatments. Some of these drugs are already in clinical use, such as the YAP transcriptional activity inhibitor, VP33, which is employed in a broad range of ophthalmology conditions7071, or the ROCK inhibitor, Fasudil, currently in clinical trials for different types of vascular and neurodegenerative disorders72. However, predictive biomarkers are still needed to expand their clinical indications and minimize their systemic toxicity. In the case of NMIBC, the translation of Numb status into the clinical practice would not only provide a novel biomarker of aggressive disease course; but also allow the identification of patients who might benefit from RhoA / ROCK / YAP targeted treatments.
[0220] Tables
[0221] Table 1. Significantly enriched “Cancer Hallmark” gene signatures in RNAseq of MIBC NumbLow(HT1376, CLS439, 5637) vs. NMIBC NumbHish(KK47, RT4, RT112) human BCa cell lines by GSEA. NES, Normalized Enriched Score.
[0222] Table 2. Significantly enriched “Cancer Hallmark” gene signatures in RNAseq of Numb-KD vs. Ctr-KD RT4 cell lines by GSEA. NES, Normalized Enriched Score.
[0223] Table 3. Significantly enriched “Cancer Hallmark” gene signatures in RNAseq of Numb-KD vs. Ctr-KD RT112 cell lines by GSEA. NES, Normalized Enriched Score. Table 4. Significantly enriched “Cancer Hallmark” gene signatures in RNAseq of Numb-KD vs. Ctr-KD KK47 cell lines by GSEA. NES, Normalized Enriched Score.
[0224] Table 5. Significantly enriched “Cancer Hallmark” gene signatures in RNAseq of BBN- KO vs. BBN-WT tumor cells by GSEA. NES, Normalized Enriched Score. Table 6. Significantly enriched “Cancer Hallmark” gene signatures in RNAseq of BBN- KO tumor cells treated with Verteporfin vs. vehicle by GSEA. NES, Normalized
[0225] Enriched Score. REFERENCES
[0226] 1 Siegel, R. L., Miller, K. D., Fuchs, H. E. & Jemal, A. Cancer Statistics, 2021 . CA Cancer J Clin 71 , 7-33 (2021). https: / / doi.org: 10.3322 / caac.21654
[0227] 2 Kaufman, D. S., Shipley, W. U. & Feldman, A. S. Bladder cancer. Lancet 374, 239-249 (2009). https: / / doi.org: 10.1016 / S0140-6736(09)60491 -8 3 Robertson, A. G. et al. Comprehensive Molecular Characterization of Muscle-
[0228] Invasive Bladder Cancer. Cell 174, 1033 (2018). https: / / doi.org: 10.1016 / j.cell.2O18.07.036
[0229] 4 Kamat, A. M. et al. Bladder cancer. Lancet 388, 2796-2810 (2016). https: / / doi.org: 10.1016 / S0140-6736(16)30512-8 5 Witjes, J. A. et al. European Association of Urology Guidelines on Muscle- invasive and Metastatic Bladder Cancer: Summary of the 2020 Guidelines. Eur Urol 79, 82-104 (2021). https: / / doi.org: 10.1016 / j.eururo.2020.03.055 Powles, T. et al. Bladder cancer: ESMO Clinical Practice Guideline for diagnosis, treatment and follow-up. Ann Oncol 33, 244-258 (2022). https: / / doi. org: 10.1016 / j.annonc.2021.11.012
[0230] 7 Dinney, C. P. et al. Focus on bladder cancer. Cancer Cell 6, 111-116 (2004). https: / / doi.org: 10.1016 / j.ccr.2004.08.002
[0231] 8 van den Bosch, S. & Alfred Witjes, J. Long-term cancer-specific survival in patients with high-risk, non-muscle-invasive bladder cancer and tumour progression: a systematic review. Eur Urol 60, 493-500 (2011). https: / / doi. org: 10.1016 / j.eururo.2011.05.045
[0232] 9 Schrier, B. P., Hollander, M. P., van Rhijn, B. W., Kiemeney, L. A. & Witjes, J. A. Prognosis of muscle-invasive bladder cancer: difference between primary and progressive tumours and implications for therapy. Eur Urol 45, 292-296 (2004). https: / / doi.org: 10.1016 / j.eururo.2003.10.006
[0233] 10 Babjuk, M. etal. EAU Guidelines on Non-Muscle-invasive Urothelial Carcinoma of the Bladder: Update 2016. Eur Urol 71 , 447-461 (2017). https: / / doi.org: 10.1016 / j.eururo.2016.05.041
[0234] 11 Svatek, R. S. et al. The economics of bladder cancer: costs and considerations of caring for this disease. Eur Urol 66, 253-262 (2014). https: / / doi.org: 10.1016 / j.eururo.2014.01.006
[0235] 12 Goebell, P. J. & Knowles, M. A. Bladder cancer or bladder cancers? Genetically distinct malignant conditions of the urothelium. Urol Oncol 28, 409-428 (2010). https: / / doi.org: 10.1016 / j.urolonc.2010.04.003
[0236] 13 Hedegaard, J. et al. Comprehensive Transcriptional Analysis of Early-Stage
[0237] Urothelial Carcinoma. Cancer Cell 30, 27-42 (2016). https: / / doi.org: 10.1016 / j.ccell.2O16.05.004
[0238] 14 Pietzak, E. J. etal. Next-generation Sequencing of Nonmuscle Invasive Bladder Cancer Reveals Potential Biomarkers and Rational Therapeutic Targets. Eur Urol 72, 952-959 (2017). https: / / doi.org: 10.1016 / j.eururo.2017.05.032
[0239] 15 Wu, X. R. Urothelial tumorigenesis: a tale of divergent pathways. Nat Rev Cancer 5, 713-725 (2005). https: / / doi.org: 10.1038 / nrc1697 16 Wang, Y. et al. Comprehensive Molecular Characterization of the Hippo Signaling Pathway in Cancer. Cell Rep 25, 1304-1317 e1305 (2018). https: / / doi.org:10.1016 / j.celrep.2018.10.001
[0240] 17 Pece, S. et al. Loss of negative regulation by Numb over Notch is relevant to human breast carcinogenesis. J Cell Biol 167, 215-221 (2004). https: / / doi.org: 10.1083 / jcb.200406140
[0241] 18 Colaluca, I. N. et al. A Numb-Mdm2 fuzzy complex reveals an isoform-specific involvement of Numb in breast cancer. J Cell Biol 217, 745-762 (2018). https: / / doi.org: 10.1083 / jcb.201709092
[0242] 19 Filippone, M. G. et al. Aberrant phosphorylation inactivates Numb in breast cancer causing expansion of the stem cell pool. J Cell Biol 221 (2022). https: / / doi.org: 10.1083 / jcb.202112001
[0243] 20 Lindskrog, S. V. et al. An integrated multi-omics analysis identifies prognostic molecular subtypes of non-muscle-invasive bladder cancer. Nat Commun 12, 2301 (2021 ). https: / / doi.org: 10.1038 / S41467-021 -22465-w
[0244] 21 Zanconato, F., Cordenonsi, M. & Piccolo, S. YAP / TAZ at the Roots of Cancer. Cancer Cell 29, 783-803 (2016). https: / / doi.org: 10.1016 / j.ccell.2O16.05.005
[0245] 22 Tosoni, D. et al. The Numb / p53 circuitry couples replicative self-renewal and tumor suppression in mammary epithelial cells. J Cell Biol 211 , 845-862 (2015). https: / / doi.org: 10.1083 / jcb.201505037
[0246] 23 Filippone, M. G. et al. CDK12 promotes tumorigenesis but induces vulnerability to therapies inhibiting folate one-carbon metabolism in breast cancer. Nat Commun 13, 2642 (2022). https: / / doi.org: 10.1038 / s41467-022-30375-8
[0247] 24 Shin, K. et al. Cellular origin of bladder neoplasia and tissue dynamics of its progression to invasive carcinoma. Nat Cell Biol 16, 469-478 (2014). https: / / doi.org: 10.1038 / ncb2956
[0248] 25 Van Batavia, J. et al. Bladder cancers arise from distinct urothelial subpopulations. Nat Cell Biol 16, 982-991 , 981-985 (2014). https: / / doi.org: 10.1038 / ncb3038
[0249] 26 Park, S. et al. Novel Mouse Models of Bladder Cancer Identify a Prognostic Signature Associated with Risk of Disease Progression. Cancer Res 81 , 5161- 5175 (2021 ). https: / / doi.org: 10.1158 / 0008-5472. CAN-21 -1254 27 Nagao, M., Suzuki, E., Yasuo, K., Yahagi, T. & Seino, Y. Mutagenicity of N- butyl-N-(4-hydroxybutyl)nitrosamine, a bladder carcinogen, and related compounds. Cancer Res 37, 399-407 (1977).
[0250] 28 Fantini, D. et al. A Carcinogen-induced mouse model recapitulates the molecular alterations of human muscle invasive bladder cancer. Oncogene 37, 1911-1925 (2018). https: / / doi.org: 10.1038 / S41388-017-0099-6
[0251] 29 Mullenders, J. et al. Mouse and human urothelial cancer organoids: A tool for bladder cancer research. Proc Natl Acad Sci U S A 116, 4567-4574 (2019). https: / / doi.org: 10.1073 / pnas.1803595116
[0252] 30 Moriconi, C. etal. INSIDIA: A FIJI Macro Delivering High-Throughput and High- Content Spheroid Invasion Analysis. Biotechnol J 12 (2017). https: / / doi.org: 10.1002 / biot.201700140
[0253] 31 Alinezhad, S. et al. Validation of Novel Biomarkers for Prostate Cancer
[0254] Progression by the Combination of Bioinformatics, Clinical and Functional Studies. PLoS One 11 , eO155901 (2016). https: / / doi.org: 10.1371 / journal. pone.0155901
[0255] 32 Harma, V. et al. Quantification of dynamic morphological drug responses in 3D organotypic cell cultures by automated image analysis. PLoS One 9, e96426 (2014). https: / / doi.org: 10.1371 / journal. pone.0096426
[0256] 33 Liu-Chittenden, Y. et al. Genetic and pharmacological disruption of the TEAD- YAP complex suppresses the oncogenic activity of YAP. Genes Dev 26, 1300- 1305 (2012). https: / / doi.org: 10.1101 / gad.192856.112
[0257] 34 Piccolo, S., Dupont, S. & Cordenonsi, M. The biology of YAP / TAZ: hippo signaling and beyond. Physiol Rev 94, 1287-1312 (2014). https: / / doi.org: 10.1152 / physrev.00005.2014
[0258] 35 Totaro, A., Panciera, T. & Piccolo, S. YAP / TAZ upstream signals and downstream responses. Nat Cell Biol 20, 888-899 (2018). https: / / doi.org: 10.1038 / s41556-018-0142-z
[0259] 36 Dupont, S. et al. Role of YAP / TAZ in mechanotransduction. Nature 474, 179- 183 (2011). https: / / doi.org: 10.1038 / naturel 0137
[0260] 37 Meng, Z., Moroishi, T. & Guan, K. L. Mechanisms of Hippo pathway regulation. Genes Dev 30, 1-17 (2016). https: / / doi.org: 10.1101 / gad.274027.115 38 Panciera, T., Azzolin, L., Cordenonsi, M. & Piccolo, S. Mechanobiology of YAP and TAZ in physiology and disease. Nat Rev Mol Cell Biol 8, 758-770 (2017). https: / / doi.org: 10.1038 / nrm.2017.87
[0261] 39 Dupont, S. Role of YAP / TAZ in cell-matrix adhesion-mediated signalling and mechanotransduction. Exp Cell Res 343, 42-53 (2016). https: / / doi.org: 10.1016 / j.yexcr.2O15.10.034
[0262] 40 Yu, F. X. et al. Regulation of the Hippo-YAP pathway by G-protein-coupled receptor signaling. Cell 150, 780-791 (2012). https: / / doi.org: 10.1016 / j.cell.2O12.06.037
[0263] 41 Aragona, M. et al. A mechanical checkpoint controls multicellular growth through YAP / TAZ regulation by actin-processing factors. Cell 154, 1047-1059 (2013). https: / / doi.org: 10.1016 / j. cell.2013.07.042
[0264] 42 Lau, K. M. & McGIade, C. J. Numb is a negative regulator of HGF dependent cell scattering and Rac1 activation. Exp Cell Res 317, 539-551 (2011). https: / / doi.org:10.1016 / j.yexcr.2010.12.005
[0265] 43 Zobel, M. et al. A NUMB-EFA6B-ARF6 recycling route controls apically restricted cell protrusions and mesenchymal motility. J Cell Biol 217, 3161 -3182 (2018). https: / / doi.org: 10.1083 / jcb.201802023
[0266] 44 Yang, Y. et al. Numb inhibits migration and promotes proliferation of colon cancer cells via RhoA / ROCK signaling pathway repression. Exp Cell Res 411 , 113004 (2022). https: / / doi.org: 10.1016 / j.yexcr.2O21.113004
[0267] 45 Ridley, A. J. Life at the leading edge. Cell 145, 1012-1022 (2011). https: / / doi. org:10.1016 / j. cell.2011.06.010
[0268] 46 Kimura, K. etal. Regulation of myosin phosphatase by Rho and Rho-associated kinase (Rho-kinase). Science 273, 245-248 (1996). https: / / doi.org: 10.1126 / science.273.5272.245
[0269] 47 Kureishi, Y. et al. Rho-associated kinase directly induces smooth muscle contraction through myosin light chain phosphorylation. J Biol Chem 272, 12257-12260 (1997). https: / / doi.org: 10.1074 / jbc.272.19.12257
[0270] 48 Masters, J. R. et al. Tissue culture model of transitional cell carcinoma: characterization of twenty-two human urothelial cell lines. Cancer Res 46, 3630-3636 (1986). 49 Davies, G., Jiang, W. G. & Mason, M. D. Cell-cell adhesion molecules and their associated proteins in bladder cancer cells and their role in mitogen induced cell-cell dissociation and invasion. Anticancer Res 19, 547-552 (1999).
[0271] 50 Warrick, J. I. et al. FOXA1 , GAT A3 and PPARy Cooperate to Drive Luminal Subtype in Bladder Cancer: A Molecular Analysis of Established Human Cell Lines. Sci Rep Q, 38531 (2016). https: / / doi.org: 10.1038 / srep38531
[0272] 51 Pece, S., Confalonieri, S., P, R. R. & Di Fiore, P. P. NUMB-ing down cancer by more than just a NOTCH. Biochim Biophys Acta 1815, 26-43 (2011). https: / / doi. org: 10.1016 / j.bbcan.2010.10.001
[0273] 52 Colaluca, I. N. et al. NUMB controls p53 tumour suppressor activity. Nature 451 , 76-80 (2008). https: / / doi.org: 10.1038 / nature06412
[0274] 53 Tosoni, D. et al. Pre-clinical validation of a selective anti-cancer stem cell therapy for Numb-deficient human breast cancers. EMBO Mol Med 9, 655-671 (2017). https: / / doi.org: 10.15252 / emmm.201606940
[0275] 54 Shu, Y. et al. Loss of Numb promotes hepatic progenitor expansion and intrahepatic cholangiocarcinoma by enhancing Notch signaling. Cell Death Dis 12, 966 (2021). https: / / doi.org: 10.1038 / S41419-021 -04263-w
[0276] 55 Xie, C. et al. Numb downregulation suppresses cell growth and is associated with a poor prognosis of human hepatocellular carcinoma. Int J Mol Med 36, 653-660 (2015). https: / / doi.org: 10.3892 / ijmm.2015.2279
[0277] 56 Belle, V. A., McDermott, N., Meunier, A. & Marignol, L. NUMB inhibition of NOTCH signalling as a therapeutic target in prostate cancer. Nat Rev Urol 'll , 499-507 (2014). https: / / doi.org: 10.1038 / nrurol.2014.195
[0278] 57 Papafotiou, G. et al. KRT14 marks a subpopulation of bladder basal cells with pivotal role in regeneration and tumorigenesis. Nat Commun 7, 11914 (2016). https: / / doi.org: 10.1038 / ncomms11914
[0279] 58 Kobayashi, T., Owczarek, T. B., McKiernan, J. M. & Abate-Shen, C. Modelling bladder cancer in mice: opportunities and challenges. Nat Rev Cancer 15, 42- 54 (2015). https: / / doi.org: 10.1038 / nrc3858
[0280] 59 Laufs, U. & Liao, J. K. Post-transcriptional regulation of endothelial nitric oxide synthase mRNA stability by Rho GTPase. J Biol Chem 273, 24266-24271 (1998). https: / / doi.org: 10.1074 / jbc.273.37.24266 Fujihara, H. et al. Inhibition of RhoA translocation and calcium sensitization by in vivo ADP-ribosylation with the chimeric toxin DC3B. Mol Biol Cell 8, 2437- 2447 (1997). https: / / doi.org:10.1091 / mbc.8.12.2437 Ridley, A. J. & Hall, A. The small GTP-binding protein rho regulates the assembly of focal adhesions and actin stress fibers in response to growth factors. Cell 70, 389-399 (1992). https: / / doi.org: 10.1016 / 0092-8674(92)90163- 7 Zhao, B. et al. Cell detachment activates the Hippo pathway via cytoskeleton reorganization to induce anoikis. Genes Dev 26, 54-68 (2012). https: / / doi.org: 10.1101 / gad.173435.111 Feng, X. et al. Hippo-independent activation of YAP by the GNAQ uveal melanoma oncogene through a trio-regulated rho GTPase signaling circuitry. Cancer Cell 25, 831-845 (2014). https: / / doi.org: 10.1016 / j.ccr.2O14.04.016 Ernkvist, M. et al. p130-angiomotin associates to actin and controls endothelial cell shape. FEBS J 273, 2000-2011 (2006). https: / / doi.org: 10.1111 / j.1742- 4658.2006.05216.x Gagne, V. et al. Human angiomotin-like 1 associates with an angiomotin protein complex through its coiled-coil domain and induces the remodeling of the actin cytoskeleton. Cell Motil Cytoskeleton 66, 754-768 (2009). https: / / doi.org: 10.1002 / cm.20405 Mana-Capelli, S., Paramasivam, M., Dutta, S. & McCollum, D. Angiomotins link F-actin architecture to Hippo pathway signaling. Mol Biol Cell 25, 1676-1685 (2014). https: / / doi.org: 10.1091 / mbc. E13-11 -0701 Densham, R. M. et al. MST kinases monitor actin cytoskeletal integrity and signal via c-Jun N-terminal kinase stress-activated kinase to regulate p21Waf1 / Cip1 stability. Mol Cell Biol 29, 6380-6390 (2009). https: / / doi.org: 10.1128 / MCB.00116-09 Murrell, M., Oakes, P. W., Lenz, M. & Gardel, M. L. Forcing cells into shape: the mechanics of actomyosin contractility. Nat Rev Mol Cell Biol 16, 486-498 (2015). https: / / doi.org: 10.1038 / nrm4012 Su, D. et al. SPTAN1 / NUMB axis senses cell density to restrain cell growth and oncogenesis through Hippo signaling. J Clin Invest 133 (2023). https: / / doi.org: 10.1172 / JC1168888 70 Huggett, M. T. et al. Phase l / ll study of verteporfin photodynamic therapy in locally advanced pancreatic cancer. Br J Cancer 110, 1698-1704 (2014). https: / / doi.org: 10.1038 / bjc.2014.95
[0281] 71 Banerjee, S. M. et al. Combination of verteporfin-photodynamic therapy with 5- aza-2'-deoxycytidine enhances the anti-tumour immune response in triple negative breast cancer. Front Immunol 14, 1188087 (2023). https: / / doi.org: 10.3389 / fimmu.2023.1188087
[0282] 72 Barcelo, J., Samain, R. & Sanz-Moreno, V. Preclinical to clinical utility of ROCK inhibitors in cancer. Trends Cancer 9, 250-263 (2023). https: / / doi.org:10.1016 / j.trecan.2022.12.001
[0283] 73 Zilian, O. et al. Multiple roles of mouse Numb in tuning developmental cell fates. CurrBiol , 494-501 (2001). https: / / doi.org: 10.1016 / s0960-9822(01)00149-x
[0284] 74 Wilson, A. et al. Normal hemopoiesis and lymphopoiesis in the combined absence of numb and numblike. J Immunol 178, 6746-6751 (2007). https: / / doi.org: 10.4049 / jimmunol.178.11 .6746
[0285] 75 Ramirez, A. et al. A keratin K5Cre transgenic line appropriate for tissue-specific or generalized Cre-mediated recombination. Genesis 39, 52-57 (2004). https: / / doi.org: 10.1002 / gene.20025
[0286] 76 Stein, J. P. et al. Radical Cystectomy in the Treatment of Invasive Bladder Cancer: Long-Term Results in 1 ,054 Patients. J Clin Oncol 41 , 3772-3781 (2023). https: / / doi.org: 10.1200 / JC0.22.02762
[0287] 77 Schindelin, J. et al. Fiji: an open-source platform for biological-image analysis. Nat Methods 9, 676-682 (2012). https: / / doi.org: 10.1038 / nmeth.2019
[0288] 78 Bankhead, P. et al. QuPath: Open source software for digital pathology image analysis. Sci Rep 7, 16878 (2017). https: / / doi.org: 10.1038 / s41598-017-17204- 5
[0289] 79 Ewels, P. A. et al. The nf-core framework for community-curated bioinformatics pipelines. Nat Biotechnol 38, 276-278 (2020). https: / / doi.org: 10.1038 / s41587- 020-0439-x
[0290] 80 Patro, R., Duggal, G., Love, M. I., Irizarry, R. A. & Kingsford, C. Salmon provides fast and bias-aware quantification of transcript expression. Nat Methods 14, 417-419 (2017). https: / / doi.org: 10.1038 / nmeth.4197 81 Love, M. I., Huber, W. & Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 15, 550 (2014). https: / / doi.org: 10.1186 / s13059-014-0550-8
[0291] 82 Zhu, A., Ibrahim, J. G. & Love, M. I. Heavy-tailed prior distributions for sequence count data: removing the noise and preserving large differences. Bioinformatics
[0292] 35, 2084-2092 (2019). https: / / doi.org: 10.1093 / bioinformatics / bty895
[0293] 83 Kramer, A., Green, J., Pollard, J., Jr. & Tugendreich, S. Causal analysis approaches in Ingenuity Pathway Analysis. Bioinformatics 30, 523-530 (2014). https: / / doi.org: 10.1093 / bioinformatics / btt703 84 Wu, T. et al. clusterProfiler 4.0: A universal enrichment tool for interpreting omics data. Innovation (Camb) 2, 100141 (2021). https: / / doi. org: 10.1016 / j.xinn.2021.100141
[0294] 85 Liberzon, A. et al. The Molecular Signatures Database (MSigDB) hallmark gene set collection. Cell Syst 1 , 417-425 (2015). https: / / doi.org:10.1016 / j.cels.2015.12.004
Claims
CLAIMS1. An in vitro method of screening a subject suffering from a bladder cancer for predicting prognosis of the disease comprising at least a step a) of determining the expression level of at least five genes in an isolated biological sample from said subject, wherein said genes are selected from the group consisting of GJC1 , NEDD9, INHBA, IL1A, CXCL1 , ATP1 B1 , GPR137B, BIRC6, ANKRD1 , CCN1 , CTNNA1 , CTSF, EFEMP1 , ERBB4, FAT4, FN1 , HSPE1 , MTMR2, PAPSS2, SPG21 , SPINK5, UTRN, CD34, MPDZ, STK39, PAK3, CXCL2, COL4A1 , COL4A2, APLN, SDC2, PPIC, SPARC, PGLYRP1 , DPYSL3, CXCL3, GKAP1 , DSEL, SORBS2, TMEM176B, INPP4B, TCEAL8, HDGFL3, GXYLT2, HSPB8, JAM2, RHOBTB3, LTBP1 , RBMS3, PTPRK, CCL2, SOX4, ALDH1A1 , PXDN, ZFP37, NIPSNAP3B, TMEM64, EIF5A2, GPR161 , FERMT1 , IGFBP7, VIM, TNC, ADCY9, preferably the expression level of all said genes or of at least all said genes is determined.
2. An in vitro method of screening a subject suffering from a bladder cancer or having suffered from a bladder cancer for predicting risk of recurrence of the disease comprising at least a step a) of determining the expression level of at least five genes in an isolated biological sample from said subject, wherein said genes are selected from the group consisting of GJC1 , NEDD9, INHBA, IL1 A, CXCL1 , ATP1 B1 , GPR137B, BIRC6, ANKRD1 , CCN1 , CTNNA1 , CTSF, EFEMP1 , ERBB4, FAT4, FN1 , HSPE1 , MTMR2, PAPSS2, SPG21 , SPINK5, UTRN, CD34, MPDZ, STK39, PAK3, CXCL2, COL4A1 , COL4A2, APLN, SDC2, PPIC, SPARC, PGLYRP1 , DPYSL3, CXCL3, GKAP1 , DSEL, SORBS2, TMEM176B, INPP4B, TCEAL8, HDGFL3, GXYLT2, HSPB8, JAM2, RHOBTB3, LTBP1 , RBMS3, PTPRK, CCL2, SOX4, ALDH1A1 , PXDN, ZFP37, NIPSNAP3B, TMEM64, EIF5A2, GPR161 , FERMT1 , IGFBP7, VIM, TNC, ADCY9, preferably the expression level of all said genes or of at least all said genes is determined.
3. An in vitro method of screening a subject suffering from a bladder cancer for predicting response to an anti-cancer treatment directed to the RhoA / ROCK / YAP pathway comprising at least a step a) of determining the expression level of at least five genes in an isolated biological sample from saidsubject, wherein said genes are selected from the group consisting of GJC1 , NEDD9, INHBA, IL1A, CXCL1 , ATP1 B1 , GPR137B, BIRC6.ANKRD1 , CCN1 , CTNNA1 , CTSF, EFEMP1 , ERBB4, FAT4, FN1 , HSPE1 , MTMR2, PAPSS2, SPG21 , SPINK5, UTRN, CD34, MPDZ, STK39, PAK3, CXCL2, COL4A1 , COL4A2, APLN, SDC2, PPIC, SPARC, PGLYRP1 , DPYSL3, CXCL3, GKAP1 , DSEL, SORBS2, TMEM176B, INPP4B, TCEAL8, HDGFL3, GXYLT2, HSPB8, JAM2, RHOBTB3, LTBP1 , RBMS3, PTPRK, CCL2, SOX4, ALDH1A1 , PXDN, ZFP37, NIPSNAP3B, TMEM64, EIF5A2, GPR161 , FERMT1 , IGFBP7, VIM, TNC, ADCY9, preferably the expression level of all said genes or of at least all said genes is determined.
4. The method according to any one of claims 1-3 wherein said method comprises the step a) of determining the expression level of at least five genes selected from the group consisting of CCN1 , CTSF, ERBB4, FAT4, FN1 , MTMR2, SPINK5, UTRN, MPDZ, STK39, INHBA, SDC2, DPYSL3, SORBS2, NEDD9.TCEAL8, CXCL1 , HDGFL3, GJC1 , RHOBTB3, GPR137B, LTBP1 , PTPRK, CCL2, ATP1 B1 , ALDH1A1 , TMEM64, GPR161 , IL1 A, FERMT1 , VIM, BIRC6, preferably the expression level of at least eight genes or of at least all of the above genes is determined.
5. The method according to any one of previous claims wherein said method comprises the step a) of determining the expression level of at least five genes selected from the group consisting of: INHBA, NEDD9, CXCL1 , GJC1 , GPR137B, ATP1 B1 , IL1 A, BIRC6, preferably the expression level of all of the above genes is determined.
6. The method according to any one of previous claims wherein said method comprises the step a) of determining the expression level of at least the following five genes: INHBA, NEDD9, CXCL1 , GJC1 and BIRC6.
7. The method according to any one of the preceding claims wherein it further comprises a step b) wherein the expression level of the genes determined in step a) is compared with the expression level of one or more reference genes, or their protein translation products, preferably wherein the expression level of the one or more reference gene or their protein translation product is measuredin a tissue sample obtained from a subject not affected by bladder cancer or in a tissue sample of a tumor displaying Numb-proficient expression.
8. The method according to claim 7 further comprising a step c) of determining a prognosis by means of said comparison, preferably determining a prognosis includes classifying said subject in one of at least two classes corresponding to levels of progression of the disease, such as better prognosis, intermediate prognosis and worse prognosis.
9. The method according to claim 8 wherein determining a prognosis comprises stratifying the subject as a subject who is likely or is not likely to progress to muscle invasive bladder cancer (MIBC).
10. The method according to any one of the preceding claims wherein said bladder cancer is selected from muscle-invasive bladder cancer (MIBC) and nonmuscle invasive bladder cancer (NMIBC), preferably it is non-muscle invasive bladder cancer (NMIBC).
11. The method according to anyone of the preceding claims wherein said biological sample is a tumoral tissue sample and / or wherein determining the gene expression in the sample comprises determining the amount of respective RNA transcript, mRNA or protein translation products in the sample.
12. A kit for performing the method of anyone of claims 1-11 , said kit comprising at least means for determining in an isolated biological sample from a subject the expression level of the genes as defined in any one of claims 1-7, said kit preferably further comprising means for providing prognostic information.
13. The method according to any one of claims 1-11 or the kit according to claim 12 which is used in combination with a further prognostic method useful in the prognosis and / or in the classification of a subject affected by bladder cancer.
14. A computer program comprising instructions which, when the program is executed by a computer, cause the computer to carry out the method of anyone of claims 1-11 or a data processing device comprising means adapted for carrying out the method of anyone of claims 1-11 , said device preferably comprising:i) means for receiving data representing the expression level of the at least five genes as defined in claims 1-6 in an isolated biological sample from a subject; ii) means for receiving data representing at least one reference gene expression levels; and iii) means for providing a prognosis of the disease and / or for predicting risk of recurrence of the disease and / or for predicting response to an anti-cancer treatment.
15. A method for determining a bladder cancer treatment for a subject affected by bladder cancer comprising the steps of a) determining the expression level of the genes as defined in any one of claims 1 to 6, in an isolated biological sample from said subject, wherein said genes are selected from the group consisting of GJC1 , NEDD9, INHBA, IL1A, CXCL1 , ATP1 B1 , GPR137B, BIRC6, ANKRD1 , CCN1 , CTNNA1 , CTSF, EFEMP1 , ERBB4, FAT4, FN1 , HSPE1 , MTMR2, PAPSS2, SPG21 , SPINK5, UTRN, CD34, MPDZ, STK39, PAK3, CXCL2, COL4A1 , COL4A2, APLN, SDC2, PPIC, SPARC, PGLYRP1 , DPYSL3, CXCL3, GKAP1 , DSEL, SORBS2, TMEM176B, INPP4B, TCEAL8, HDGFL3, GXYLT2, HSPB8, JAM2, RHOBTB3, LTBP1 , RBMS3, PTPRK, CCL2, SOX4, ALDH1A1 , PXDN, ZFP37, NIPSNAP3B, TMEM64, EIF5A2, GPR161 , FERMT1 , IGFBP7, VIM, TNC, ADCY9; b) comparing the expression level of the genes of step a) with the expression level of one or more reference genes, or their protein translation products; c) determining a prognosis of said subject based on said comparison and d) determining a bladder cancer treatment for said subject based on said prognosis, preferably said bladder cancer treatment comprising surgery, radiation and / or an anti-cancer or chemotherapeutic agent, wherein said anti-cancer agent is directed against the RhoA / ROCK / YAP pathway and is preferably selected from Fasudil, Belumosudil, Ripasudil, Fasudil, Y27632, Netarsudil, Verteporfin, VT-3989, IK-930 or combination thereof; and / or wherein said anti-cancer is the Bacillus Calmette-Guerin; and / or wherein said anti-cancer or chemotherapeutic agent is a Focal Adhesion Kinase (FAK) inhibitor selected from defactinib, GSK2256098, IN10018 and others; and / or wherein said anti-cancer or chemotherapeutic agent is a dualROCK / AKT inhibitor selected from AT13148 and others; and / or wherein said anti-cancer or chemotherapeutic agent is selected from anthracycline agents, alkylating agents, nucleoside analogs, platinum agents, vinca agents, antiestrogen drugs, aromatase inhibitors, ovarian suppression agents, endocrine / hormonal agents, bisphophonate therapy agents and targeted biological therapy agents (e.g., antibodies), preferably said agent being selected from cyclophosphamide, fluorouracil (or 5-fluorouracil or 5-FU), methotrexate, thiotepa, carboplatin, cisplatin, gemcitabine, anthracycline, taxanes, paclitaxel, protein-bound paclitaxel, doxorubicin, docetaxel, vinorelbine, tamoxifen, raloxifene, toremifene, fulvestrant, irinotecan, ixabepilone, temozolmide, topotecan, vincristine, vinblastine, eribulin, mutamycin, capecitabine, capecitabine, anastrozole, exemestane, letrozole, leuprolide, abarelix, buserlin, goserelin, megestrol acetate, risedronate, pamidronate, ibandronate, alendronate, denosumab, zoledronate, trastuzumab, tykerb, bevacizumab, inhibitors of protein kinases, immunotherapy, immune checkpoint inhibitors, and combinations thereof.
Citation Information
Patent Citations
Methods of diagnosis of bladder cancer, compositions and methods of screening for modulators of bladder cancer
US20040076955A1
Method for the prediction of progression of bladder cancer
US20180230545A1