HBG1 / 2-sarna compositions and methods of use

Abstract

The disclosure relates to saRNAs useful in upregulating the expression of a target gene and therapeutic compositions comprising the saRNAs, wherein the target gene is HBG1 and / or HBG2. Methods of using the saRNAs and the pharmaceutical compositions thereof are also provided.

Description

HBG1 / 2-SARNA COMPOSITIONS AND METHODS OF USECROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to US Provisional Application No. 63 / 678,902, filed August 2, 2024, entitled “HBGl / 2-saRNA Compositions and Methods of Use” and US Provisional Application No. 63 / 728,965, filed December 6, 2024, entitled “HBGl / 2-saRNA Compositions and Methods of Use” the contents of each of which are herein incorporated by reference in their entirety.REFERENCE TO SEQUENCE LISTING

[0002] The present application is being filed along with a Sequence Listing in electronic format. The sequence listing filed, entitled 1053USPRO_SL.xml, was created on August 1, 2024, and is 1,680,031 bytes in size. The information in electronic format of the Sequence Listing is incorporated herein by reference in its entirety.BACKGROUND

[0003] Recently it has been discovered that small duplex RNAs increased gene expression by targeting ncRNAs that overlap gene promoters (Janowski et al., Nature Chemical Biology, vol.3: 166-173 (2007), the contents of which are incorporated herein by reference in their entirety). Any short RNA which leads to up-regulation of the expression of a target gene by any mechanism is termed a short activating RNA or small activating RNA (saRNA).

[0004] The gamma globin genes (hemoglobin subunit gamma 1 (HBG1) and hemoglobin subunit gamma 2 (HBG2)) are normally expressed in the fetal liver, spleen and bone marrow. These genes express two gamma chains, which, together with two alpha chains, constitute fetal hemoglobin (HbF). The reactivation of HbF is a promising means to treat hemoglobinopathies including sickle cell disorders and beta-thalassemia. There remains a need for compositions and methods for the targeted modulation of the HBG1 and / or HBG2 gene with saRNAs.SUMMARY OF THE DISCLOSURE

[0005] The present disclosure provides synthetic isolated small activating RNAs (saRNAs) which up-regulate the expression of at least one target gene, wherein the at least one target gene is HBG1 and / or HBG2. In some embodiments, the saRNA comprises a guide strand (antisense strand or sense strand) that is at least 80% complement to a region on a targeted sequence of the target gene. In some embodiments, the targeted sequence is located in the transcription start site (TSS) core of the target gene, wherein the TSS core has a sequence of SEQ ID NO: 1 or 2. In some embodiments, the guide strand (antisense strand or sense strand) has 14-30 nucleotides. In some embodiments, the saRNA comprises a guide strand (an antisense strand or a sense strand)that is at least 80% complement to a region on a targeted sequence of the target gene, wherein the targeted sequence is selected from the group consisting of SEQ ID NO: 3-70, and wherein the guide strand has 14-30 nucleotides. In some embodiments, the saRNA may be any saRNA in Table 3 or Table 4. Pharmaceutical compositions, kits, and devices comprising such saRNAs are also provided.

[0006] The present disclosure also provides methods of upregulating the expression of at least one target gene in a subject, wherein the target gene is HBG1 and / or HBG2.

[0007] The details of various embodiments of the disclosure are set forth in the description below. Other features, objects, and advantages of the disclosure will be apparent from the description and the drawings, and from the claims.BRIEF DESCRIPTION OF THE DRAWINGS

[0008] The foregoing and other objects, features and advantages will be apparent from the following description of particular embodiments of the disclosure, as illustrated in the accompanying drawings in which like reference characters refer to the same parts throughout the different views. The drawings are not necessarily to scale, emphasis instead being placed upon illustrating the principles of various embodiments of the disclosure.

[0009] FIG. 1 A and FIG. IB show gamma and beta globin levels in cells treated with HBG2- S8354S-IS.

[0010] FIG. 2 shows % HbF levels of cells from three independent donors treated with either HU or HBG2-S8354S-IS.

[0011] FIG. 3 shows pancellular HbF levels in ErPs cells from six independent donors after treatment with HU or HBG2-S8354S-IS.DETAILED DESCRIPTION

[0012] The present disclosure provides compositions, methods, and kits for modulating target gene expression and / or function for therapeutic purposes. These compositions, methods and kits comprise at least one saRNA that upregulates the expression of the target gene.I. Design and Synthesis of saRNA

[0013] One aspect of the present disclosure provides a method to design and synthesize saRNA.

[0014] The terms “small activating RNA”, “short activating RNA”, or “saRNA” in the context of the present disclosure means a single-stranded or double-stranded RNA that upregulates or has a positive effect on the expression of a specific gene. The saRNA may be single-stranded of 14 to 30 nucleotides, such as 19, 20, 21, 22, or 23 nucleotides. The saRNA may also be double-stranded, each strand comprising 14 to 30 nucleotides, such as 19, 20, 21,22, or 23 nucleotides. The gene is called the target gene of the saRNA. As used herein, the target gene is a double-stranded DNA comprising a coding strand and a template strand. For example, an saRNA that upregulates the expression of the HBG1 gene is called a “HBG1 -saRNA” and the HBG1 gene is the target gene of the HBG1 -saRNA. An saRNA that upregulates the expression of the HBG2 gene is called a “HBG2-saRNA” and the HBG2 gene is the target gene of the HBG2-saRNA. A target gene may be any gene of interest. In some embodiments, a target gene has a promoter region on the template strand.

[0015] By “upregulation,” “up-regulating,” or “activation” of a gene is meant an increase in the level of expression of a gene, or levels of the polypeptide(s) encoded by a gene or the activity thereof, or levels of the RNA transcript(s) (such as mRNA) transcribed from the template strand of a gene above that observed in the absence of the saRNA of the present disclosure. The saRNA of the present disclosure may have a direct upregulating effect on the expression of the target gene.

[0016] The saRNAs of the present disclosure may have an indirect upregulating effect on the RNA transcript(s) transcribed from the template strand of the target gene and / or the polypeptide(s) encoded by the target gene or mRNA. The RNA transcript transcribed from the target gene is referred to thereafter as the target transcript. The target transcript may be an mRNA of the target gene. The target transcript may exist in the mitochondria. The saRNAs of the present disclosure may have a downstream effect on a biological process or activity. In such embodiments, a saRNA targeting a first transcript may have an effect (either upregulating or downregulating) on a second, non-target transcript.Targeted Sequence

[0017] In some embodiments, the saRNA comprises a guide strand (an antisense strand or sense strand) that is at least 80% complementary to a region on the template strand of the target gene or the corresponding region on the coding strand of the target gene. This region on the template strand or the coding strand, where the strand of the saRNA hybridizes or binds to, is referred to as the “targeted sequence” or “target site”.

[0018] The term “complementary to” in the context means being able to hybridize under stringent conditions. It is to be understood that thymidine of the DNA is replaced by uridine in RNA and that this difference does not alter the understanding of the term “complementarity”.

[0019] The guide strand (antisense strand or sense strand) of the saRNA (whether single- or double-stranded) may be at least 80%, 90%, 95%, 98%, 99% or 100% identical with the reverse complement of the targeted sequence. Thus, the reverse complement of the guide strand of the saRNA has a high degree of sequence identity with the targeted sequence. The targeted sequencemay have the same length, i.e., the same number of nucleotides, as the saRNA and / or the reverse complement of the saRNA.

[0020] In some embodiments, the targeted sequence comprises at least 14 and less than 30 nucleotides.

[0021] In some embodiments, the targeted sequence has 19, 20, 21, 22, or 23 nucleotides.

[0022] In some embodiments, the location of the targeted sequence is situated within a promoter area of the template strand or coding strand.

[0023] In some embodiments, the targeted sequence is located within a TSS (transcription start site) core of the template stand or the coding strand. A “TSS core” or “TSS core sequence” as used herein, refers to a region between 4000 nucleotides upstream and 2000 nucleotides downstream of the TSS (transcription start site). Therefore, the TSS core comprises 6001 nucleotides and the TSS is located at position 4001 from the 5’ end of the TSS core sequence. The term “transcription start site” (TSS) as used herein means a nucleotide on the template strand or the coding strand of a gene corresponding to or marking the location of the start of transcription. The TSS may be located within the promoter region on the template strand or the coding strand of the gene.

[0024] In some embodiments, the targeted sequence is located between 6000 nucleotides upstream and 4000 nucleotides upstream of the TSS. In some embodiments, the targeted sequence is located between 4000 nucleotides upstream and 2000 nucleotides upstream of the TSS. In some embodiments, the targeted sequence is located between 2000 nucleotides upstream and 1000 nucleotides upstream of the TSS. In some embodiments, the targeted sequence is located between 1500 nucleotides upstream and 500 nucleotides upstream of the TSS. In some embodiments, the targeted sequence is located between 1000 nucleotides upstream and 500 nucleotides upstream of the TSS.

[0025] In some embodiments, the targeted sequence is located between 1500 nucleotides upstream and 1000 nucleotides upstream of the TSS. In some embodiments, the targeted sequence is located between 1500 nucleotides upstream and 800 nucleotides upstream of the TSS.

[0026] In some embodiments, the targeted sequence is located between 1000 nucleotides upstream and 1000 nucleotides downstream of the TSS.

[0027] In some embodiments, the targeted sequence is located between 500 nucleotides upstream and 500 nucleotides downstream of the TSS.

[0028] In some embodiments, the targeted sequence is located between 250 nucleotides upstream and 250 nucleotides downstream of the TSS.

[0029] In some embodiments, the targeted sequence is located between 100 nucleotides upstream and 100 nucleotides downstream of the TSS.

[0030] In some embodiments, the targeted sequence is located upstream of the TSS in the TSS core. The targeted sequence may be less than 4000, 3000, 2000, less than 1000, less than 500, less than 250, or less than 100 nucleotides upstream of the TSS.

[0031] In some embodiments, the targeted sequence is located downstream of the TSS in the TSS core. The targeted sequence may be less than 2000, less than 1000, less than 500, less than 250, or less than 100 nucleotides downstream of the TSS.

[0032] In some embodiments, the targeted sequence is located + / - 50 nucleotides surrounding the TSS of the TSS core. In some embodiments, the targeted sequence substantially overlaps the TSS of the TSS core. In some embodiments, the targeted sequence begins or ends at the TSS of the TSS core. In some embodiments, the targeted sequence overlaps the TSS of the TSS core by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 or 19 nucleotides in either the upstream or downstream direction.

[0033] The location of the targeted sequence on the template strand or coding strand is defined by the location of the 5’ end of the targeted sequence. The 5’ end of the targeted sequence may be at any position of the TSS core and the targeted sequence may start at any position selected from position 1 to position 4001 of the TSS core. For reference herein, when the 5’ end of the targeted sequence from position 1 to position 2000 of the TSS core, the targeted sequence is considered upstream of the TSS and when the 5’ end of the targeted sequence is from position 2002 to 4001, the targeted sequence is considered downstream of the TSS. When the 5’ end of the targeted sequence is at nucleotide 2001, the targeted sequence is considered to be a TSS centric sequence and is neither upstream nor downstream of the TSS.

[0034] For further reference, for example, when the 5’ end of the targeted sequence is at position 1600 of the TSS core, i.e., it is the 1600thnucleotide of the TSS core, the targeted sequence starts at position 1600 of the TSS core and is considered to be upstream of the TSS. saRNA Designs

[0035] In one embodiment, the saRNA of the present disclosure is a single-stranded saRNA. The single-stranded saRNA may be at least 14, or at least 18, e.g., 19, 20, 21, 22 or 23 nucleotides in length since oligonucleotide duplex exceeding this length may have an increased risk of inducing the interferon response. Preferably, the length of the single-stranded saRNA is less than 30 nucleotides. In some embodiments, the length of the single-stranded saRNA is 19 to 25 nucleotides. In one embodiment, the single-stranded saRNA may be exactly 19 nucleotides in length. In another embodiment, the single-stranded saRNA may be exactly 20 nucleotides inlength. In another embodiment, the single-stranded saRNA may be exactly 21 nucleotides in length. In another embodiment, the single-stranded saRNA may be exactly 22 nucleotides in length. In another embodiment, the single-stranded saRNA may be exactly 23 nucleotides in length. In some embodiments, the single-stranded saRNA of the present disclosure comprises a sequence of at least 14 nucleotides and less than 30 nucleotides, which has at least 80%, 90%, 95%, 98%, 99% or 100% complementarity to the targeted sequence. In one embodiment, the sequence which has at least 80%, 90%, 95%, 98%, 99% or 100% complementarity to the targeted sequence is at least 15, 16, 17, 18 or 19 nucleotides in length, or 18 to 22, or 19 to 21, or exactly 19.

[0036] In another embodiment, the saRNA of the present disclosure has two strands that form a duplex, one strand being a guide strand. The saRNA duplex is also called a double-stranded saRNA. A double-stranded saRNA or saRNA duplex, as used herein, is a saRNA that includes more than one, and preferably, two, strands in which interstrand hybridization can form a region of duplex structure. The two strands of a double-stranded saRNA are referred to as an antisense strand, and a sense strand.

[0037] Each strand of the duplex may be at least 14, or at least 18, e.g., 19, 20, 21 or 22 nucleotides in length. The duplex may be hybridized over a length of at least 12, or at least 15, or at least 17, or at least 19 nucleotides. Each strand may be exactly 19, 20, 21, 22, or 23 nucleotides in length. Preferably, the length of each strand of the saRNA is less than 30 nucleotides since oligonucleotide duplex exceeding this length may have an increased risk of inducing the interferon response. In one embodiment, the length of each strand of the saRNA is 19 to 25 nucleotides. The strands forming the saRNA duplex may be of equal or unequal lengths.

[0038] In one embodiment, the guide strand (antisense strand or sense strand) of the saRNA of the present disclosure comprises a sequence of at least 14 nucleotides and less than 30 nucleotides, such as exactly 19, 20, 21, 22, or 23 nucleotides in length, which has at least 80%, 90%, 95%, 98%, 99% or 100% complementarity to the targeted sequence. In one embodiment, the sequence which has at least 80%, 90%, 95%, 98%, 99% or 100% complementarity to the targeted sequence is at least 15, 16, 17, 18 or 19 nucleotides in length, or 18 to 22, or 19 to 21, or exactly 19.

[0039] The guide strand (antisense strand or sense strand) may have no more than 5, or no more than 4 or 3, or no more than 2, or no more than 1, or no mismatches with the targeted sequence on the template strand or coding strand. Therefore, the guide strand (antisense strand or sense strand) has a high degree of complementarity to the targeted sequence on the templatestrand or coding strand. The passenger strand of the saRNA duplex has a high degree of sequence identity with the targeted sequence on the template strand or coding strand.

[0040] A “strand” in the context of the present disclosure means a contiguous sequence of nucleotides, including naturally occuring, non-naturally occurring or modified nucleotides. Two or more strands may be, or each form a part of, separate molecules, or they may be connected covalently, e.g., by a linker such as a polyethyleneglycol linker. The target gene of the present disclosure resides on a double-strand DNA region. One of the strands of the DNA is the template strand and the other one is the coding strand. At least one strand of a saRNA may comprise a region that is complementary to a region on one strand of the target gene (targeted sequence) and has sequence identity with corresponding region of the other strand of the target gene. Such a strand is called a guide strand of the saRNA duplex and can be the sense or antisense strand of the saRNA duplex. A second strand of a saRNA that comprises a region complementary to the non-targeted strand of the gene (non-targeted sequence) is called a passenger strand and can be the sense or antisense strand of the saRNA duplex.

[0041] A saRNA duplex may also be formed from a single molecule that is at least partly self-complementary forming a hairpin structure, including a duplex region. In such case, the term “strand” refers to one of the regions of the saRNA that is complementary to another internal region of the saRNA. The guide strand of the saRNA will have no more than 5, or no more than 4 or 3, or no more than 2, or no more than 1, or no mismatches with the sequence within the region on the template strand or coding strand of the target gene (targeted sequence).

[0042] In some embodiments, the passenger strand of a saRNA may comprise at least one nucleotide that is not complementary to the corresponding nucleotide on the guide strand, called a mismatch with the guide strand. The mismatch with the guide strand may encourage preferential loading of the guide strand (Wu et al., PLoS ONE, vol.6 (12):e28580 (2011), the contents of which are incorporated herein by reference in their entirety). In one embodiment, the at least one mismatch with the guide strand may be at 3’ end of the passenger strand. In one embodiment, the 3’ end of the passenger strand may comprise 1-5 mismatches with the guide strand. In one embodiment, the 3’ end of the passenger strand may comprise 2-3 mismatches with the guide strand. In one embodiment, the 3’ end of the passenger strand may comprise 6-10 mismatches with the guide strand.

[0043] A saRNA duplex may have siRNA-like complementarity to the targeted sequence on the template strand or coding strand; that is, 100% complementarity between nucleotides 2-6 from the 5' end of the guide strand in the saRNA duplex and a region on the targeted sequence. Other nucleotides of the saRNA may, in addition, have at least 80%, 90%, 95%, 98%, 99% or100% complementarity to a region of the targeted sequence. For example, nucleotides 7 (counted from the 5' end) until the 3' end of the saRNA may have least 80%, 90%, 95%, 98%, 99% or 100% complementarity to a region of the targeted sequence.

[0044] The terms “small interfering RNA” or “siRNA” in the context mean a doublestranded RNA typically 20-25 nucleotides long involved in the RNA interference (RNAi) pathway and interfering with or inhibiting the expression of a specific gene. The gene is the target gene of the siRNA. A siRNA is usually about 21 nucleotides long, with 3' overhangs (e.g., 2 nucleotides) at each end of the two strands.

[0045] In some embodiments, the saRNA may comprise a number of unpaired nucleotides at the 3' end of each strand forming 3' overhangs or tails. The number of unpaired nucleotides forming the 3' overhang of each strand may be in the range of 1 to 5 nucleotides, or 1 to 3 nucleotides, or 2 nucleotides.

[0046] Thus, in some embodiments, the saRNA of the present disclosure may be singlestranded and consists of (i) a sequence having at least 80% complementarity to a targeted sequence on the template strand or coding strand of the target gene; and (ii) a 3' tail (overhang) of 1 -5 nucleotides, which may comprise uracil residues, such as UU, UUU, or mUmU (m strands for 2’-0Me modification). In some embodiments, the saRNA of the present disclosure may be double-stranded and consists of a first strand comprising (i) a first sequence having at least 80% complementarity to a targeted sequence on the template strand or coding strand of the target gene; and (ii) a 3' overhang of 1 -5 nucleotides; and a second strand comprising (i) a second sequence that forms a duplex with the first sequence and (ii) a 3’ overhang of 1-5 nucleotides. Such a 3’ tail (overhang) shall not be regarded as mismatches with regard to determine complementarity between the saRNA guide strand (antisense strand or sense strand) and the targeted sequence. The saRNA of the present disclosure may have complementarity to the targeted sequence over its whole length, except for the 3' tail (overhang), if present.Target Genes and saRNAs

[0047] As discussed above, the guide strand of the saRNA that can be the sense strand or the antisense strand of the saRNA has a high degree of sequence identity with the reverse complement of the targeted sequence. Instead of “complementary to the targeted sequence,” the guide strand (antisense strand or sense strand) of the saRNA of the present disclosure may also be defined as having “identity” to a region on the template strand or coding strand of the target gene. Therefore, the genomic sequence of the target gene may be used to design saRNAs.

[0048] In some embodiments, the target gene of the saRNAs of the present disclosure is HBG1 and / or HBG2. saRNAs may be designed to upregulate any variant of the HBG1 and / orHBG2 gene. Sequences of the target gene, protein and mRNA encoded by the target genes, andTSS cores of the target gene are provided in Table 1.Table 1 Sequences of the target gene and protein and mRNA encoded by the target geneHBG1 TSS genomic location: hg38 chrl 1:5,249,857 minus strand HBG1 TSS core (TSS core 1): chrl 1:5247857-5253857 (SEQ ID NO:1) ttgctacacctgactaaaccttgaattcctaaagcttggaacactttcccttccttaagaaccatccttgctactcagctgcaatcaatccagcccccaggtcttcactgaa ccttttcccatctcttccaaaacatctgtttctgagaagtcctgtcctatagaggtctttcttcccaccggatttctcctacaccatttactcccacttgcagaactcccgtgta caagtgtctttactgcttttatttgctcatcaaaatgcacatctcatataaaaataaatgaggagcatgcacacaccacaaacacaaacaggcatgcagaaatacacata cacacttccctcaatataaaccctttgtggctcatatatttaaaaagatgtaaaaaaaagagctgaagaaaatcatgtgtgatctctcagcagaatagatttattatttgtatt gcttgcagaataaagcctatccttgaaagctctgaatcatgggcagtgagctcagtggtatctggaggacagggcactggccactgcagtcaccatcttctgccagg aagcctgcacctcaggggtgaattctttgccgaaatggattgccaaaacggtcaccagcacatttcccaggagctgttgagatgaaaggagacaataaagatgaac ccatagtgagctgagagctccagcctggcctccagataactacacaccaagcttccacccagaatcaagcctatgttaacttccctcaaagcctgagattttgccttcc cattaaatgcaggtagttgttccccttcaagcactagtcactggccataatttaaatcttgctatcttcttgccaccatgaaccctgtatgttgtaggctgaagacgttaaaa gaaacacacgctgacacacacacacacacgcgcgcgcgcacacacacacacacacacagagctgactttcaaaatctactccagcccaaatgtttcaattgttcct cacccctggacatactttgcccccatctggaattaaaggatataagtttgtaatgaagcattagcagcattttatatgtgtccagctgatataggaatagccttagcaatgt atgtttggccaccaaagttccccactttgactgagccaatatatgccttctgcctgcatctttttaacgaccatacttgtcctgcctccagatagatgttttaaaacaacaaa aatgagggaaagatgaaagttctttctactggaatctaataaagaaaagtcattttcctcatttccacctctcttttctcaaagtcaaaattgtccatctagatttttagaggc actccttaggccctaaaacattaccactgggtctcagcccagttagtcctctgcagtttcttcacccccaaccccagtatcttcaaacagctcacaccctgctgtgctca gatcaatactccgttgtctaagttgcctcgagactaaaggcaacagggctgaaacatctcctggactcaccttgaagttctcaggatccacatgcagcttgtcacagtg cagttcactcagctgggcaaaggtgcccttgagatcatccaggtgctttgtggcatctcccaaggaagtcagcaccttcttgccatgtgccttgactttggggttgccc atgatggcagaggcagaggacaggttgccaaagctgtcaaagaacctctgggtccatgggtagacaaccaggagcctgtgagattgacaagaacagtttgacagt cagaaggtgccacaaatcctgagaagcgacctggacttttgccaggcacagggtccttccttccctcccttgtcctggtcaccagagcctaccttcccagggtttctcc tccagcatcttccacattcaccttgccccacaggcttgtgatagtagccttgtcctcctctgtgaaatgacccatggcgtctggactaggagcttattgataacctcagac gttccagaagcgagtgtgtggaactgctgaagggtgcttccttttattcttcatccctagccagccgccggcccctggcctcactggatactctaagactattggtcaag tttgccttgtcaaggctattggtcaaggcaaggctggccaacccatgggtggagtttagccagggaccgtttcagacagatatttgcattgagatagtgtggggaagg ggcccccaagaggatactgctaattttttttatagcctttgccttgttccgattcagtcattccagtttttctctaatttattcttccctttagctagtttccttctcccatcatagag gataccaggacttcttttgtcagccgttttttaccttcttgtctctagctccagtgaggcctgtagtttaaagctaaagcatgtaccaatttttgaaaagttcagggattgtga aatgtgttttaggcataggtccaggatttttgacgggacaaatcttagtctctttcagttagcagtggtttctaaggaaaaagtgctatacttctttttgaatatactctttgtga cttttgccattatctcttaatttctcaatagtgcagtgaaaacaatttctataaagccacagtttcagcgcagtaatagattagtgttacataatataagacctaatgcttacct caatatctacttatccgtacctatttgaaataaatcatgactgtttcatcttagaaaaatatttgattccatattcaggtatgtatgtatacaccagatgatgtgtatttaccact ggataagtgtgtgtgctggctgatgacccagggttttggcgtagctcttctatgctcagtaaagatgatggtagaatgttctttggcaggtactgtggattagaattaatta tcttgtataaatgctaggttcacttctcagggaatcttactctaagacataagatgtgcgtgtacatggaaaacaactctaaagaggcaagggttgtttttattgactaata gtccacacactattataactcgaatattagtgtactttagacagctttatttctaacacagtgctgtttctgacatattggaccattaacagggtaggaagtatttatggtggt tttttggttctgttttgcttttggttagtttgtttttgtttttctctgaaagtgatccatgatctctaaccttgctagattataatgccagaagctctggaattctggcttatcggagg caagctgtatcttcaaattagtttatcccctaagctatcaggttgattgaaattattataatattggtgaaattctttcatccttcatgatcctgtgtaaagcttatatctgctcatt gatacagatggctaaaaggccagaaagacacacatttacccatgtaacaagcctgcacatcctgcacatgtaccttcgaaattaaaatgaaatgaaataaaattaaaa ggaaaaaaatgccatggcaacatcaggaagttatcttttatggtctaaaaatgggcagcataaataatctaccccttgtttagcatactattgaaaaataacaataaaaat cggcaaccagtagcccttgcgtctactctgcctatgaagtagccattcatttattccttcaattttttataaacttgttttactaaaaaaaaaaaggacaaagaaagaaagt gcgaattgtgaaatggtagtgagtgatggcatttgaagtgggtcctttatgatttgatggagccaggcagaagacgtttggagaaagaagttcctgaaagtaggaagg gcatgtggaaaactctgaggctgaggaaaaaaaagaaagaaagaaatataaagaaagaacttgacatttcactgtatataaacacattacaagcctaaagtacgttg aagaaaaaatagaattcaaagttagacagaagggctcaggcttactatttgcatcttacagatgagagtagtagagttggtattttattctgaaacacagaggacaagt ggagatttgtaaacctgagataaacatggtttctaatccactgaacaccgaagcttatttttttctctttcttcatctgccttacttagtgcaaggtgctataacaaaatagcat agactgggtgacttcaacaacaggattttttctcacttttctgctggttcctggtcagggctctcttcctgggttgcaggtggctgacttcccactgtgtcctcaccagaag gaagagaaatggctaatctctctgcttctgatgaggaaaataattctatgatggggatctgctctcatgagctcctctaaacctgattacttttccaaagcctcccccaca aatggagccaattgggagttggggattcagcatgtgaattttctggagacacaagcgttaagttcataacaccatcacattaaactaaactcttgcttattaacgtgcatt aactttcaattatataagaactccagtgaatctgccttctcaattaatgttatacaaattcttcacactatattttcatctgaccgtgctgttctgctgctgagacatgacacgc tgatgctgacttgtgagcttctgctggctcatttccttcacctaagtccccacctccctagaagcttacaatgaggtctcctccttgaaatgctgtgaccagtctgtagactt aagggtatgggattaatttcacctctttaggcatgcgtcaacacttaaaatgaaaagttccttagtaaagtaaggatcacttcattgtagttaccgtggaaagaaaaacct gtttcctgctctgatctctaacacctcaacctccctgtagagcctcacaagggctgagaaaagccagatgccgttggaaatagtattgcccctaataaaatagaatggc

[0049] Table 2 describes the saRNAs’ targeted sequences, the genomic location of the targeted sequences, and the relative location of saRNAs with no 3’ overhang. In Table 2, the targeted sequence is defined as a region on the coding or template strand of the target gene. The relative location is the distance from the 5’ end of the targeted sequence to the TSS. A negative number represents a location upstream of the TSS and a positive number represents a location downstream of the TSS. For saRNAs that target both HBG1 and HBG2, the location relative to the HBG2 TSS is shown.Table 2 Targeted Sequences of saRNAs

[0050] The saRNAs may be single-stranded and comprise 14-30 nucleotides. The sequence of a single-stranded saRNA may have at least 60%, 70%, 80% or 90% identity with a sequence selected from the sequences of the antisense strands in Table 3. In one embodiment, the singlestranded saRNA comprises a sequence selected from the sequences of the antisense strands in Table 3. In one embodiment, the single-stranded saRNA may have a 3’ tail (overhang). The sequence of a single-stranded saRNA with a 3’ tail (overhang) may have at least 60%, 70%, 80% or 90% identity with a sequence selected from the sequences of the antisense strands in Table 4. In one embodiment, the single-stranded saRNA comprises a sequence selected from the sequences of the antisense strands in Table 4. The sequence of a single-stranded saRNA may have at least 60%, 70%, 80% or 90% identity with a sequence selected from the sequences of the sense strands in Table 3. In one embodiment, the single-stranded saRNA comprises a sequence selected from the sequences of the sense strands in Table 3. In one embodiment, the singlestranded saRNA may have a 3’ tail (overhang). The sequence of a single-stranded saRNA with a 3’ tail (overhang) may have at least 60%, 70%, 80% or 90% identity with a sequence selected from the sequences of the sense strands in Table 4. In one embodiment, the single-stranded saRNA comprises a sequence selected from the sequences of the sense strands in Table 4.

[0051] The saRNAs may be double-stranded. The two strands form a duplex and each strand comprises 14-30 nucleotides. The first strand of a double-stranded saRNA may have at least 60%, 70%, 80% or 90% identity with a sequence selected from the sequences of the antisense strands in Table 3. In one embodiment, the first strand of the double-stranded saRNA comprises a sequence selected from the sequences of the antisense strands in Table 3. The second strand of a double-stranded saRNA may have at least 60%, 70%, 80% or 90% identity with a sequenceselected from the sequences of the sense strands in Table 3. In one embodiment, the second strand of the double-stranded saRNA comprises a sequence selected from the sequences of the sense strands in Table 3. In one embodiment, the double-stranded saRNA may have a 3’ overhang on each strand. The first strand of a double-stranded saRNA may have at least 60%, 70%, 80% or 90% identity with a sequence selected from the sequences of the antisense strands in Table 4. In one embodiment, the first strand of the double-stranded saRNA comprises a sequence selected from the sequences of the antisense strands in Table 4. The second strand of a double-stranded saRNA may have at least 60%, 70%, 80% or 90% identity with a sequence selected from the sequences of the sense strands in Table 4. In one embodiment, the second strand of the double-stranded saRNA comprises a sequence selected from the sequences of the sense strands in Table 4.

[0052] The saRNAs may be modified or unmodified.Table 3 Sequences of the saRNAs (with no chemical modification or overhangs)Table 4 Sequences of saRNAs (with chemical modifications and / or overhangs)-[mN], mN: 2'-0Me modified N (N=A, C, G or U)- [2flN] , fN: 2'-F modified N (N=A, C, G or U)- *: ps bond- The 3 ’ overhang, [mU] [mU], in the sequences may be replaced with any other 3 ’ overhang, such as UU (unmodified uracils) or UUU. 5’ overhangs such as dT, ddT, or invAb can also be added to the 5’ position.

[0053] The method disclosed in US 2013 / 0164846 filed June 23, 2011 (saRNA algorithm), the contents of which are incorporated herein by reference in their entirety, may also be used to design saRNA. The design of saRNA is also disclosed in US Pat. No. 8,324,181 and US Pat. No. 7,709,566 to Corey et al., US Pat. Pub. No. 2010 / 0210707 to Li et al., and Voutila et al., Mol Ther Nucleic Acids, vol. 1, e35 (2012), the contents of each of which are incorporated herein by reference in their entirety.

[0054] The saRNA of the present disclosure may be produced by any suitable method, for example synthetically or by expression in cells using standard molecular biology techniques which are well-known to a person of ordinary skill in the art. For example, the saRNA of the present disclosure may be chemically synthesized or recombinantly produced using methods known in the art.Chemical Modi fications o f saRNA

[0055] Herein, in saRNA, the terms “modification” or, as appropriate, “modified” refer to structural and / or chemical modifications with respect to A, G, U or C ribonucleotides.Nucleotides in the saRNAs of the present disclosure may comprise non-standard nucleotides, such as non-naturally occurring nucleotides or chemically synthesized nucleotides or deoxynucleotides. The saRNA of the present disclosure may include any useful modification, such as to the sugar, the nucleobase, or the intemucleoside linkage (e.g. to a linking phosphate / to a phosphodiester linkage / to the phosphodiester backbone). One or more atoms of a pyrimidine nucleobase may be replaced or substituted with optionally substituted amino, optionally substituted thiol, optionally substituted alkyl (e.g., methyl or ethyl), or halo (e.g.,chloro or fluoro). In certain embodiments, modifications (e.g., one or more modifications) are present in each of the sugar and the internucleoside linkage. Modifications according to the present disclosure may be modifications of ribonucleic acids (RNAs) to deoxyribonucleic acids (DNAs), threose nucleic acids (TNAs), glycol nucleic acids (GNAs), peptide nucleic acids (PNAs), locked nucleic acids (LNAs) or hybrids thereof. In a non-limiting example, the 2’ -OH of U is substituted with 2’-0Me.

[0056] In one embodiment, the saRNAs of the present disclosure may comprise at least one modification described herein.

[0057] In another embodiment, the saRNA is an saRNA duplex and the sense strand and antisense sequence may independently comprise at least one modification. As a non-limiting example, the sense sequence may comprise a modification and the antisense strand may be unmodified. As another non-limiting example, the antisense sequence may comprise a modification and the sense strand may be unmodified. As yet another non-limiting example, the sense sequence may comprise more than one modification and the antisense strand may comprise one modification. As a non-limiting example, the antisense sequence may comprise more than one modification and the sense strand may comprise one modification.

[0058] The saRNA of the present disclosure can include a combination of modifications to the sugar, the nucleobase, and / or the intemucleoside linkage. These combinations can include any one or more modifications described herein or in International Application Publication WO2013 / 052523 filed October 3, 2012, in particular Formulas (Ia)-(Ia-5), (Ib)-(If), (Ila)-(IIp), (IIb-1), (IIb-2), (IIc-l)-(IIc-2), (IIn-1), (IIn-2), (IVa)-(IVl), and (IXa)-(IXr)), the contents of which are incorporated herein by reference in their entirety.

[0059] The saRNA of the present disclosure may or may not be uniformly modified along the entire length of the molecule. For example, one or more or all types of nucleotide (e.g., purine or pyrimidine, or any one or more or all of A, G, U, C) may or may not be uniformly modified in the saRNA of the disclosure. In some embodiments, all nucleotides X in an saRNA of the disclosure are modified, wherein X may be any one of nucleotides A, G, U, C, or any one of the combinations A+G, A+U, A+C, G+U, G+C, U+C, A+G+U, A+G+C, G+U+C or A+G+C.

[0060] Different sugar modifications, nucleotide modifications, and / or intemucleoside linkages (e.g., backbone structures) may exist at various positions in an saRNA. One of ordinary skill in the art will appreciate that the nucleotide analogs or other modification(s) may be located at any position(s) of an saRNA such that the function of saRNA is not substantially decreased. The saRNA of the present disclosure may contain from about 1% to about 100% modified nucleotides (either in relation to overall nucleotide content, or in relation to one or more types ofnucleotide, i.e. any one or more of A, G, U or C) or any intervening percentage (e.g., from 1% to 20%, from 1% to 25%, from 1% to 50%, from 1% to 60%, from 1% to 70%, from 1% to 80%, from 1% to 90%, from 1% to 95%, from 10% to 20%, from 10% to 25%, from 10% to 50%, from 10% to 60%, from 10% to 70%, from 10% to 80%, from 10% to 90%, from 10% to 95%, from 10% to 100%, from 20% to 25%, from 20% to 50%, from 20% to 60%, from 20% to 70%, from 20% to 80%, from 20% to 90%, from 20% to 95%, from 20% to 100%, from 50% to 60%, from 50% to 70%, from 50% to 80%, from 50% to 90%, from 50% to 95%, from 50% to 100%, from 70% to 80%, from 70% to 90%, from 70% to 95%, from 70% to 100%, from 80% to 90%, from 80% to 95%, from 80% to 100%, from 90% to 95%, from 90% to 100%, and from 95% to100%).

[0061] In some embodiments, the saRNA of the present disclosure may be modified to be a circular nucleic acid. The terminals of the saRNA of the present disclosure may be linked by chemical reagents or enzymes, producing circular saRNA that has no free ends. Circular saRNA is expected to be more stable than its linear counterpart and to be resistant to digestion with RNase R exonuclease. Circular saRNA may further comprise other structural and / or chemical modifications with respect to A, G, U or C ribonucleotides.

[0062] The saRNA of the present disclosure may be modified with any modifications of an oligonucleotide or polynucleotide disclosed in pages 136 to 247 of PCT Publication WO2013 / 151666 published Oct. 10, 2013, the contents of which are incorporated herein by reference in their entirety.

[0063] The saRNA of the present disclosure may comprise a combination of modifications. The saRNA may comprise at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 modifications for each strand.

[0064] In some embodiments, the saRNA is at least 50% modified, e.g., at least 50% of the nucleotides are modified. In some embodiments, the saRNA is at least 75% modified, e.g., at least 75% of the nucleotides are modified. In some embodiments, both strands of the saRNA may be modified across the whole length (100% modified). It is to be understood that since a nucleotide (sugar, base and phosphate moiety, e.g., linker) may each be modified, any modification to any portion of a nucleotide, or nucleoside, will constitute a modification.

[0065] In some embodiments, the saRNA is at least 10% modified in only one component of the nucleotide, with such component being selected from the nucleobase, sugar or linkage between nucleosides. For example, modifications of an saRNA may be made to at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% of the nucleobases, sugars or linkages of said saRNA.

[0066] In some embodiments, the saRNA comprises at least one sugar modification.Nonlimiting examples of the sugar modification may include the following:

[0067] In some embodiments, at least one of the 2' positions_of the sugar (OH in RNA or H in DNA) of a nucleotide of the saRNA is substituted with -OMe, referred to as 2’-OMe.

[0068] In some embodiments, at least one of the 2' positions_of the sugar (OH in RNA or H in DNA) of a nucleotide of the saRNA is substituted with -F, referred to as 2’-F.

[0069] In some embodiments, the saRNA comprises at least one phosphorothioate linkage or methylphosphonate linkage between nucleotides.

[0070] In some embodiments, the saRNA comprises 3’ and / or 5’ capping or overhang. In some embodiments, the saRNA of the present disclosure may comprise at least one inverted deoxyribonucleoside or dideoxyribonucleoside overhang (e.g., dT or ddT). The inverted overhang, e.g., dT, may be at the 5’ terminus or 3’ terminus of the passenger strand. In some embodiments, the saRNA of the present disclosure may comprise inverted abasic (invAb) modifications on the passenger strand. The at least one inverted abasic modification may be on 5’ end, or 3’ end, or both ends of the passenger strand. The inverted abasic modification may encourage preferential loading of the guide strand.

[0071] In some embodiments, the saRNA comprises at least one 5’-(E)-vinylphosphonate (5’- -VP) modification.

[0072] In some embodiments, the saRNA comprises at least one glycol nucleic acid (GNA), an acyclic nucleic acid analogue, as a modification.saRNA Conjugates and Combinations

[0073] Conjugation may result in increased stability and / or half-life and may be particularly useful in targeting the saRNA of the present disclosure to specific sites in the cell, tissue or organism. The saRNA of the present disclosure can be designed to be conjugated to other polynucleotides, dyes, intercalating agents (e.g. acridines), cross-linkers (e.g. psoralene, mitomycin C), porphyrins (TPPC4, texaphyrin, Sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g. EDTA), alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (e.g. biotin), transport / absorption facilitators (e.g., aspirin, vitamin E, folic acid), synthetic ribonucleases, proteins, e.g., glycoproteins, or peptides, e.g., molecules having a specific affinity for a co-ligand, or antibodies e.g., an antibody, that binds to a specified cell type such as a cancer cell, endothelial cell, or bone cell, hormones and hormone receptors, non-peptidic species, such as lipids, lectins, carbohydrates, vitamins, cofactors, or a drug. Suitable conjugates for nucleic acid molecules are disclosed in International Publication WO 2013 / 090648 filed December 14, 2012, the contents of which are incorporated herein by reference in their entirety.

[0074] According to the present disclosure, saRNA of the present disclosure may be administered with, or further include one or more of RNAi agents, small interfering RNAs (siRNAs), small hairpin RNAs (shRNAs), long non-coding RNAs (IncRNAs), enhancer RNAs, enhancer-derived RNAs or enhancer-driven RNAs (eRNAs), microRNAs (miRNAs), miRNA binding sites, antisense RNAs, ribozymes, catalytic DNA, tRNA, RNAs that induce triple helix formation, aptamers or vectors, and the like to achieve different functions. The one or moreRNAi agents, small interfering RNAs (siRNAs), small hairpin RNAs (shRNAs), long noncoding RNAs (IncRNA), microRNAs (miRNAs), miRNA binding sites, antisense RNAs, ribozymes, catalytic DNA, tRNA, RNAs that induce triple helix formation, aptamers or vectors may comprise at least one modification or substitution.

[0075] In some embodiments, the modification is selected from a chemical substitution of the nucleic acid at a sugar position, a chemical substitution at a phosphate position and a chemical substitution at a base position. In other embodiments, the chemical modification is selected from incorporation of a modified nucleotide; 3' capping; conjugation to a high molecular weight, non- immunogenic compound; conjugation to a lipophilic compound; and incorporation of phosphorothioate into the phosphate backbone. In one embodiment, the high molecular weight, non-immunogenic compound is polyalkylene glycol, or polyethylene glycol (PEG).

[0076] In one embodiment, saRNA of the present disclosure may be attached to a transgene so it can be co-expressed from an RNA polymerase II promoter. In a non-limiting example, saRNA of the present disclosure is attached to green fluorescent protein gene (GFP).

[0077] In one embodiment, saRNA of the present disclosure may be attached to a DNA or RNA aptamer, thereby producing saRNA-aptamer conjugate. Aptamers are oligonucleotides or peptides with high selectivity, affinity and stability. They assume specific and stable three- dimensional shapes, thereby providing highly specific, tight binding to target molecules. An aptamer may be a nucleic acid species that has been engineered through repeated rounds of in vitro selection or equivalently, SELEX (systematic evolution of ligands by exponential enrichment) to bind to various molecular targets such as small molecules, proteins, nucleic acids, and even cells, tissues and organisms. Nucleic acid aptamers have specific binding affinity to molecules through interactions other than classic Watson-Crick base pairing. Nucleic acid aptamers, like peptides generated by phage display or monoclonal antibodies (mAbs), are capable of specifically binding to selected targets and, through binding, block their targets’ ability to function. In some cases, aptamers may also be peptide aptamers. For any specific molecular target, nucleic acid aptamers can be identified from combinatorial libraries of nucleic acids, e.g., by SELEX. Peptide aptamers may be identified using a yeast two hybrid system. A skilled person is therefore able to design suitable aptamers for delivering the saRNAs or cells of the present disclosure to target cells such as liver cells. DNA aptamers, RNA aptamers and peptide aptamers are contemplated. Administration of saRNA of the present disclosure to the liver using liver-specific aptamers is preferred.

[0078] As used herein, a typical nucleic acid aptamer is approximately 10-15 kDa in size (20- 45 nucleotides), binds its target with at least nanomolar affinity, and discriminates againstclosely related targets. Nucleic acid aptamers may be ribonucleic acid, deoxyribonucleic acid, or mixed ribonucleic acid and deoxyribonucleic acid. Aptamers may be single-stranded ribonucleic acid, deoxyribonucleic acid or mixed ribonucleic acid and deoxyribonucleic acid. Aptamers may comprise at least one chemical modification.

[0079] A suitable nucleotide length for an aptamer ranges from about 15 to about 100 nucleotides (nt), and in various other embodiments, 15-30 nt, 20-25 nt, 30-100 nt, 30-60 nt, 25- 70 nt, 25-60 nt, 40-60 nt, 25-40 nt, 30-40 nt, any of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 nt or 40-70 nt in length. However, the sequence can be designed with sufficient flexibility such that it can accommodate interactions of aptamers with two targets at the distances described herein. Aptamers may be further modified to provide protection from nuclease and other enzymatic activities. The aptamer sequence can be modified by any suitable methods known in the art.

[0080] The saRNA-aptamer conjugate may be formed using any known method for linking two moieties, such as direct chemical bond formation, linkage via a linker such as streptavidin and so on.

[0081] In one embodiment, saRNA of the present disclosure may be attached to an antibody. Methods of generating antibodies against a target cell surface receptor are well known. The saRNAs of the disclosure may be attached to such antibodies with known methods, for example using RNA carrier proteins. The resulting complex may then be administered to a subject and taken up by the target cells via receptor-mediated endocytosis.

[0082] In one embodiment, saRNA of the present disclosure may be conjugated with lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acid. Sci. USA, 1989, 86: 6553-6556), cholic acid (Manoharan et al., Biorg. Med. Chem. Let., 1994, 4: 1053-1060), a thioether, e.g., beryl-5-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660:306-309; Manoharan et al., Biorg. Med. Chem. Let., 1993, 3:2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20:533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10: 1111-1118; Kabanov et al., FEBS Lett., 1990, 259:327-330; Svinarchuk et al., Biochimie, 1993, 75:49-54), a phospholipid, e.g., di- hexadecyl-rac-glycerol or triethyl-ammonium l,2-di-O-hexadecyl-rac-glycero-3-Hphosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654; Shea et al., Nucl. Acids Res., 1990,18:3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229-237), or an octadecylamine or hexylamino-carbonyloxycholesterol moiety (Crooke etal., J. Pharmacol. Exp. Ther., 1996, 277:923-937), the content of each of which is herein incorporated by reference in its entirety.

[0083] In one embodiment, the saRNA of the present disclosure is conjugated with a ligand. In one non-limiting example, the ligand may be any ligand disclosed in US 20130184328 to Manoharan et al., the contents of which are incorporated herein by reference in their entirety. The conjugate has a formula of Ligand-[linker]0ptionai-[tether]0ptionai-oligonucleotide agent. The oligonucleotide agent may comprise a subunit having formulae (I) disclosed by US 20130184328 to Manoharan et al., the contents of which are incorporated herein by reference in their entirety. In another non-limiting example, the ligand may be any ligand disclosed in US 20130317081 to Akinc et al., the contents of which are incorporated herein by reference in their entirety, such as a lipid, a protein, a hormone, or a carbohydrate ligand of Formula II-XXVI. The ligand may be coupled with the saRNA with a bivalent or trivalent branched linker in Formula XXXI-XXXV disclosed in Akinc.

[0084] Representative U.S. patents that teach the preparation of such nucleic acid / lipid conjugates include, but are not limited to, U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941, the content of each of which is herein incorporated by reference in its entirety.

[0085] The saRNA of the present disclosure may be provided in combination with other active ingredients known to have an effect in the particular method being considered. The other active ingredients may be administered simultaneously, separately, or sequentially with the saRNA of the present disclosure. In one embodiment, saRNA of the present disclosure is administered with saRNA modulating a different target gene.

[0086] In one embodiment, the saRNA is conjugated with a carbohydrate ligand, such as any carbohydrate ligand disclosed in US Pat No. 8106022 and 8828956 to Manoharan et al. (Alnylam Pharmaceuticals), the contents of which are incorporated herein by reference in their entirety. For example, the carbohydrate ligand may be monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide, or polysaccharide. These carbohydrate- conjugated RNA agents may target the parenchymal cells of the liver. In one embodiment, thesaRNA is conjugated with more than one carbohydrate ligand, preferably two or three. In one embodiment, the saRNA is conjugated with one or more galactose moiety. In another embodiment, the saRNA is conjugated at least one (e.g., two or three or more) lactose molecules (lactose is a glucose coupled to a galactose). In another embodiment, the saRNA is conjugated with at least one (e.g., two or three or more) N-Acetyl-Galactosamine (GalNAc), N-Ac- Glucosamine (GluNAc), or mannose (e.g., mannose-6-phosphate). In one embodiment, the saRNA is conjugated with at least one mannose ligand, and the conjugated saRNA targets macrophages.

[0087] In one embodiment, saRNA of the present disclosure is administered with a small interfering RNA or siRNA that inhibits the expression of a gene.

[0088] In one embodiment, saRNA of the present disclosure is administered with one or more drugs for therapeutic purposes.II. Composition of the disclosure

[0089] One aspect of the present disclosure provides pharmaceutical compositions comprising a small activating RNA (saRNA) that upregulates a target gene, and at least one pharmaceutically acceptable carrier.

[0090] In some embodiments, pharmaceutical compositions comprising saRNAs of the present disclosure and liposomes such as but not limited to NOV340 SMARTICLES® / (Marina Biotech, Bothell, WA) are provided. These liposomes comprise components including 1- palmitoyl-2-oleoyl-sn-glycero-3 -phosphocholine (POPC), l,2-dioleoyl-sn-glycero-3- phosphoethanolamine (DOPE), Cholesteryl hemisuccinate (CHEMS), and Cholesteryl-4-[[2-(4- morpholinyl)ethyl]amino]-4-oxobutanoate (MOCHOL). The molar ratio of the components is 6:24:23:47. These compositions can be prepared with any suitable method known in the art, such as but not limited to the method disclosed in Example 17 of WO2016 / 170,349, the contents of which are incorporated herein by reference in their entirety.Formulation, Delivery, Administration, and Dosing

[0091] Pharmaceutical formulations may additionally comprise a pharmaceutically acceptable excipient, which, as used herein, includes, but is not limited to, any and all solvents, dispersion media, diluents, or other liquid vehicles, dispersion or suspension aids, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, and the like, as suited to the particular dosage form desired. Various excipients for formulating pharmaceutical compositions and techniques for preparing the composition are known in the art (see Remington: The Science and Practice of Pharmacy, 21stEdition, A. R. Gennaro, Lippincott, Williams & Wilkins, Baltimore, MD, 2006; incorporated herein by reference in its entirety). The use of aconventional excipient medium may be contemplated within the scope of the present disclosure, except insofar as any conventional excipient medium may be incompatible with a substance or its derivatives, such as by producing any undesirable biological effect or otherwise interacting in a deleterious manner with any other component(s) of the pharmaceutical composition.

[0092] In some embodiments, compositions are administered to humans, human patients or subjects. For the purposes of the present disclosure, the phrase “active ingredient” generally refers to saRNA to be delivered as described herein.

[0093] Although the descriptions of pharmaceutical compositions provided herein are principally directed to pharmaceutical compositions which are suitable for administration to humans, it will be understood by the skilled artisan that such compositions are generally suitable for administration to any other animal, e.g., to non-human animals, e.g. non-human mammals. Modification of pharmaceutical compositions suitable for administration to humans in order to render the compositions suitable for administration to various animals is well understood, and the ordinarily skilled veterinary pharmacologist can design and / or perform such modification with merely ordinary, if any, experimentation. Subjects to which administration of the pharmaceutical compositions is contemplated include, but are not limited to, humans and / or other primates; mammals, including commercially relevant mammals such as cattle, pigs, horses, sheep, cats, dogs, mice, and / or rats; and / or birds, including commercially relevant birds such as poultry, chickens, ducks, geese, and / or turkeys.

[0094] Formulations of the pharmaceutical compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparatory methods include the step of bringing the active ingredient into association with an excipient and / or one or more other accessory ingredients, and then, if necessary and / or desirable, dividing, shaping and / or packaging the product into a desired single- or multi-dose unit.

[0095] A pharmaceutical composition in accordance with the disclosure may be prepared, packaged, and / or sold in bulk, as a single unit dose, and / or as a plurality of single unit doses. As used herein, a “unit dose” is discrete amount of the pharmaceutical composition comprising a predetermined amount of the active ingredient. The amount of the active ingredient is generally equal to the dosage of the active ingredient which would be administered to a subject and / or a convenient fraction of such a dosage such as, for example, one-half or one-third of such a dosage.

[0096] Relative amounts of the active ingredient, the pharmaceutically acceptable excipient, and / or any additional ingredients in a pharmaceutical composition in accordance with the disclosure will vary, depending upon the identity, size, and / or condition of the subject treatedand further depending upon the route by which the composition is to be administered. By way of example, the composition may comprise between 0.1% and 100%, e.g., between .5 and 50%, between 1-30%, between 5-80%, at least 80% (w / w) active ingredient.

[0097] In some embodiments, the formulations described herein may contain at least one saRNA. As a non-limiting example, the formulations may contain 1, 2, 3, 4 or 5 saRNAs with different sequences. In one embodiment, the formulation contains at least three saRNAs with different sequences. In one embodiment, the formulation contains at least five saRNAs with different sequences.

[0098] The saRNA of the present disclosure can be formulated using one or more excipients to: (1) increase stability; (2) increase cell transfection; (3) permit the sustained or delayed release (e.g., from a depot formulation of the saRNA); (4) alter the biodistribution (e.g., target the saRNA to specific tissues or cell types); (5) increase the translation of encoded protein in vivo; and / or (6) alter the release profile of encoded protein in vivo.

[0099] In addition to traditional excipients such as any and all solvents, dispersion media, diluents, or other liquid vehicles, dispersion or suspension aids, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, excipients of the present disclosure can include, without limitation, lipidoids, liposomes, lipid nanoparticles, polymers, lipoplexes, coreshell nanoparticles, peptides, proteins, cells transfected with saRNA (e.g., for transplantation into a subject), hyaluronidase, nanoparticle mimics and combinations thereof. Accordingly, the formulations of the disclosure can include one or more excipients, each in an amount that together increases the stability of the saRNA and / or increases cell transfection by the saRNA. Further, the saRNA of the present disclosure may be formulated using self-assembled nucleic acid nanoparticles. Pharmaceutically acceptable carriers, excipients, and delivery agents for nucleic acids that may be used in the formulation with the saRNA of the present disclosure are disclosed in International Publication WO 2013 / 090648 filed December 14, 2012, the contents of which are incorporated herein by reference in their entirety.[000100] In one embodiment, the saRNA of the present disclosure comprises two single RNA strands that are 21 nucleotides in length each that are annealed to form a double-stranded saRNA as the active ingredient. The composition further comprises a salt buffer composed of 50mM Tris-HCl, pH 8.0, lOOmM NaCl and 5mM EDTA.[000101] In another embodiment, the saRNA of the present disclosure may be delivered with dendrimers. Dendrimers are highly branched macromolecules. In one embodiment, the saRNA of the present disclosure is complexed with structurally flexible poly(amidoamine) (PAMAM) dendrimers for targeted in vivo delivery. The complex is called saRNA-dendrimers. Dendrimershave a high degree of molecular uniformity, narrow molecular weight distribution, specific size and shape characteristics, and a highly-functionalized terminal surface. The manufacturing process is a series of repetitive steps starting with a central initiator core. Each subsequent growth step represents a new generation of polymers with a larger molecular diameter and molecular weight, and more reactive surface sites than the preceding generation.[000102] PAMAM dendrimers are efficient nucleotide delivery systems that bear primary amine groups on their surface and also a tertiary amine group inside of the structure. The primary amine group participates in nucleotide binding and promotes their cellular uptake, while the buried tertiary amino groups act as a proton sponge in endosomes and enhance the release of nucleic acid into the cytoplasm. These dendrimers protect the saRNA carried by them from ribonuclease degradation and achieves substantial release of saRNA over an extended period of time via endocytosis for efficient gene targeting. The in vivo efficacy of these nanoparticles have previously been evaluated where biodistribution studies show that the dendrimers preferentially accumulate in peripheral blood mononuclear cells and live with no discernible toxicity (see Zhou et al., Molecular Ther. 2011 Vol. 19, 2228-2238, the contents of which are incorporated herein by reference in their entirety). PAMAM dendrimers may comprise a triethanolamine (TEA) core, a diaminobutane (DAB) core, a cystamine core, a diaminohexane (HEX) core, a diamonododecane (DODE) core, or an ethylenediamine (EDA) core. In one embodiment, PAMAM dendrimers comprise a TEA core or a DAB core.Lipidoids[000103] The synthesis of lipidoids has been extensively described and formulations containing these compounds are particularly suited for delivery of oligonucleotides or nucleic acids (see Mahon et al., Bioconjug Chem. 2010 21 : 1448-1454; Schroeder et al., J Intern Med. 2010 267:9- 21; Akinc et al., Nat Biotechnol. 2008 26:561-569; Love et al., Proc Natl Acad Sci U S A. 2010 107: 1864-1869; Siegwart et al., Proc Natl Acad Sci U S A. 2011 108: 12996-3001; all of which are incorporated herein in their entireties).[000104] While these lipidoids have been used to effectively deliver double-stranded small interfering RNA molecules in rodents and non-human primates (see Akinc et al., Nat Biotechnol. 2008 26:561-569; Frank-Kamenetsky et al., Proc Natl Acad Sci U S A. 2008 105: 11915-11920; Akinc et al., Mol Ther. 2009 17:872-879; Love et al., Proc Natl Acad Sci U S A. 2010 107: 1864-1869; Leuschner et al., Nat Biotechnol. 2011 29: 1005-1010; all of which is incorporated herein in their entirety), the present disclosure contemplates their formulation and use in delivering saRNA. Complexes, micelles, liposomes or particles can be prepared containing these lipidoids and therefore, can result in an effective delivery of the saRNAfollowing the injection of a lipidoid formulation via localized and / or systemic routes of administration. Lipidoid complexes of saRNA can be administered by various means including, but not limited to, intravenous, intramuscular, or subcutaneous routes.[000105] In vivo delivery of nucleic acids may be affected by many parameters, including, but not limited to, the formulation composition, nature of particle PEGylation, degree of loading, oligonucleotide to lipid ratio, and biophysical parameters such as, but not limited to, particle size (Akinc et al., Mol Ther. 2009 17:872-879; the contents of which are herein incorporated by reference in its entirety). As an example, small changes in the anchor chain length of poly(ethylene glycol) (PEG) lipids may result in significant effects on in vivo efficacy. Formulations with the different lipidoids, including, but not limited to penta[3-(l- laurylaminopropionyl)]-triethylenetetramine hydrochloride (TETA-5LAP; aka 98N12-5, see Murugaiah et al., Analytical Biochemistry, 401 :61 (2010); the contents of which are herein incorporated by reference in its entirety), Cl 2-200 (including derivatives and variants), and MD1, can be tested for in vivo activity.[000106] The lipidoid referred to herein as “98N12-5” is disclosed by Akinc et al., Mol Ther. 2009 17:872-879 and the contents of which is incorporated by reference in its entirety.[000107] The lipidoid referred to herein as “C12-200” is disclosed by Love et al., Proc Natl Acad Sci U S A. 2010 107: 1864-1869 and Liu and Huang, Molecular Therapy. 2010 669-670; the contents of both of which are herein incorporated by reference in their entirety. The lipidoid formulations can include particles comprising either 3 or 4 or more components in addition to the saRNA. As an example, formulations with certain lipidoids, include, but are not limited to, 98N12-5 and may contain 42% lipidoid, 48% cholesterol and 10% PEG (Cl 4 alkyl chain length). As another example, formulations with certain lipidoids, include, but are not limited to, C12-200 and may contain 50% lipidoid, 10% disteroylphosphatidyl choline, 38.5% cholesterol, and 1.5% PEG-DMG.[000108] In one embodiment, a saRNA formulated with a lipidoid for systemic intravenous administration can target the liver. For example, a final optimized intravenous formulation using saRNA and comprising a lipid molar composition of 42% 98N12-5, 48% cholesterol, and 10% PEG-lipid with a final weight ratio of about 7.5 to 1 total lipid to saRNA and a C14 alkyl chain length on the PEG lipid, with a mean particle size of roughly 50-60 nm, can result in the distribution of the formulation to be greater than 90% to the liver, (see, Akinc et al., Mol Ther. 2009 17:872-879; the contents of which are herein incorporated by reference in its entirety). In another example, an intravenous formulation using a C12-200 (see published international application W02010129709, the contents of which is herein incorporated by reference in theirentirety) lipidoid may have a molar ratio of 50 / 10 / 38.5 / 1.5 of C12-200 / disteroylphosphatidyl choline / cholesterol / PEG-DMG, with a weight ratio of 7 to 1 total lipid to nucleic acid and a mean particle size of 80 nm may be effective to deliver saRNA (see, Love et al., Proc Natl Acad Sci U S A. 2010 107: 1864-1869, the contents of which are herein incorporated by reference in its entirety).[000109] In another embodiment, an MD1 lipidoid-containing formulation may be used to effectively deliver saRNA to hepatocytes in vivo. The characteristics of optimized lipidoid formulations for intramuscular or subcutaneous routes may vary significantly depending on the target cell type and the ability of formulations to diffuse through the extracellular matrix into the blood stream. While a particle size of less than 150 nm may be desired for effective hepatocyte delivery due to the size of the endothelial fenestrae (see, Akinc et al., Mol Ther. 2009 17:872- 879, the contents of which are herein incorporated by reference in its entirety), use of a lipidoid- formulated saRNA to deliver the formulation to other cells types including, but not limited to, endothelial cells, myeloid cells, and muscle cells may not be similarly size-limited.[000110] Use of lipidoid formulations to deliver siRNA in vivo to other non-hepatocyte cells such as myeloid cells and endothelium has been reported (see Akinc et al., Nat Biotechnol. 2008 26:561-569; Leuschner et al., Nat Biotechnol. 2011 29: 1005-1010; Cho et al. Adv. Funct. Mater. 2009 19:3112-3118; 8thInternational Judah Folkman Conference, Cambridge, MA October 8-9, 2010; the contents of each of which is herein incorporated by reference in its entirety). Effective delivery to myeloid cells, such as monocytes, lipidoid formulations may have a similar component molar ratio. Different ratios of lipidoids and other components including, but not limited to, disteroylphosphatidyl choline, cholesterol and PEG-DMG, may be used to optimize the formulation of saRNA for delivery to different cell types including, but not limited to, hepatocytes, myeloid cells, muscle cells, etc. For example, the component molar ratio may include, but is not limited to, 50% C12-200, 10% disteroylphosphatidyl choline, 38.5% cholesterol, and %1.5 PEG-DMG (see Leuschner et al., Nat Biotechnol 2011 29: 1005-1010; the contents of which are herein incorporated by reference in its entirety). The use of lipidoid formulations for the localized delivery of nucleic acids to cells (such as, but not limited to, adipose cells and muscle cells) via either subcutaneous or intramuscular delivery, may not require all of the formulation components desired for systemic delivery, and as such may comprise only the lipidoid and saRNA.Liposomes, Lipoplexes, and Lipid Nanoparticles[000111] The saRNA of the disclosure can be formulated using one or more liposomes, lipoplexes, or lipid nanoparticles. In one embodiment, pharmaceutical compositions of saRNAinclude liposomes. Liposomes are artificially-prepared vesicles which may primarily be composed of a lipid bilayer and may be used as a delivery vehicle for the administration of nutrients and pharmaceutical formulations. Liposomes can be of different sizes such as, but not limited to, a multilamellar vesicle (MLV) which may be hundreds of nanometers in diameter and may contain a series of concentric bilayers separated by narrow aqueous compartments, a small unicellular vesicle (SUV) which may be smaller than 50 nm in diameter, and a large unilamellar vesicle (LUV) which may be between 50 and 500 nm in diameter. Liposome design may include, but is not limited to, opsonins or ligands in order to improve the attachment of liposomes to unhealthy tissue or to activate events such as, but not limited to, endocytosis. Liposomes may contain a low or a high pH in order to improve the delivery of the pharmaceutical formulations.[000112] The formation of liposomes may depend on the physicochemical characteristics such as, but not limited to, the pharmaceutical formulation entrapped and the liposomal ingredients, the nature of the medium in which the lipid vesicles are dispersed, the effective concentration of the entrapped substance and its potential toxicity, any additional processes involved during the application and / or delivery of the vesicles, the optimization size, poly dispersity and the shelf-life of the vesicles for the intended application, and the batch-to-batch reproducibility and possibility of large-scale production of safe and efficient liposomal products.[000113] In one embodiment, pharmaceutical compositions described herein may include, without limitation, liposomes such as those formed from 1, 2-di oleyloxy -N,N- dimethylaminopropane (DODMA) liposomes, DiLa2 liposomes from Marina Biotech (Bothell, WA), l,2-dilinoleyloxy-3 -dimethylaminopropane (DLin-DMA), 2,2-dilinoleyl-4-(2- dimethylaminoethyl)-[l,3]-dioxolane (DLin-KC2-DMA), and MC3 (US20100324120; the contents of which are herein incorporated by reference in its entirety) and liposomes which may deliver small molecule drugs such as, but not limited to, DOXIL® from Janssen Biotech, Inc. (Horsham, PA).[000114] In one embodiment, pharmaceutical compositions described herein may include, without limitation, liposomes such as those formed from the synthesis of stabilized plasmid-lipid particles (SPLP) or stabilized nucleic acid lipid particle (SNALP) that have been previously described and shown to be suitable for oligonucleotide delivery in vitro and in vivo (see Wheeler et al. Gene Therapy. 1999 6:271-281; Zhang et al. Gene Therapy. 1999 6: 1438-1447; Jeffs et al. Pharm Res. 2005 22:362-372; Morrissey et al., Nat Biotechnol. 2005 2: 1002-1007;Zimmermann et al., Nature. 2006 441 : 111-114; Heyes et al. J Contr Rel. 2005 107:276-287; Semple et al. Nature Biotech. 2010 28: 172-176; Judge et al. J Clin Invest. 2009 119:661-673;deFougerolles Hum Gene Ther. 2008 19: 125-132; the contents of each of which are incorporated herein in their entireties). The original manufacture method by Wheeler et al. was a detergent dialysis method, which was later improved by Jeffs et al. and is referred to as the spontaneous vesicle formation method. The liposome formulations may be composed of 3 to 4 lipid components in addition to the saRNA. As an example a liposome can contain, but is not limited to, 55% cholesterol, 20% disteroylphosphatidyl choline (DSPC), 10% PEG-S-DSG, and 15% 1,2-di oleyloxy -N, A -di methyl ami nopropane (DODMA), as described by Jeffs et al. In another example, certain liposome formulations may contain, but are not limited to, 48% cholesterol, 20% DSPC, 2% PEG-c-DMA, and 30% cationic lipid, where the cationic lipid can be 1,2- distearloxy-A' A'-dimethylarninopropane (DSDMA), DODMA, DLin-DMA, or 1,2- dilinolenyloxy-3-dimethylaminopropane (DLenDMA), as described by Heyes et al. In another example, the nucleic acid-lipid particle may comprise a cationic lipid comprising from about 50 mol % to about 85 mol % of the total lipid present in the particle; a non-cationic lipid comprising from about 13 mol % to about 49.5 mol % of the total lipid present in the particle; and a conjugated lipid that inhibits aggregation of particles comprising from about 0.5 mol % to about 2 mol % of the total lipid present in the particle as described in W02009127060 to Maclachlan et al, the contents of which are incorporated herein by reference in their entirety. In another example, the nucleic acid-lipid particle may be any nucleic acid-lipid particle disclosed in US2006008910 to Maclachlan et al., the contents of which are incorporated herein by reference in their entirety. As a non-limiting example, the nucleic acid-lipid particle may comprise a cationic lipid of Formula I, a non-cationic lipid, and a conjugated lipid that inhibits aggregation of particles.[000115] In one embodiment, the saRNA of the present disclosure may be formulated in a lipid vesicle which may have crosslinks between functionalized lipid bilayers.[000116] In one embodiment, the liposome may contain a sugar-modified lipid disclosed in US5595756 to Bally et al., the contents of which are incorporated herein by reference in their entirety. The lipid may be a ganglioside and cerebroside in an amount of about 10 mol percent. [000117] In one embodiment, the saRNA of the present disclosure may be formulated in a liposome comprising a cationic lipid. The liposome may have a molar ratio of nitrogen atoms in the cationic lipid to the phosphates in the saRNA (N:P ratio) of between 1 : 1 and 20: 1 as described in International Publication No. W02013006825, the contents of which are herein incorporated by reference in its entirety. In another embodiment, the liposome may have a N:P ratio of greater than 20: 1 or less than 1 : 1.[000118] In one embodiment, the saRNA of the present disclosure may be formulated in a lipid-polycation complex. The formation of the lipid-polycation complex may be accomplished by methods known in the art and / or as described in U.S. Pub. No. 20120178702, the contents of which are herein incorporated by reference in its entirety. As a non-limiting example, the polycation may include a cationic peptide or a polypeptide such as, but not limited to, polylysine, polyornithine and / or polyarginine and the cationic peptides described in International Pub. No. WO2012013326; herein incorporated by reference in its entirety. In another embodiment, the saRNA may be formulated in a lipid-polycation complex which may further include a neutral lipid such as, but not limited to, cholesterol or dioleoyl phosphatidylethanolamine (DOPE).[000119] The liposome formulation may be influenced by, but not limited to, the selection of the cationic lipid component, the degree of cationic lipid saturation, the nature of the PEGylation, ratio of all components and biophysical parameters such as size. In one example by Semple et al. (Semple et al. Nature Biotech. 2010 28: 172-176; the contents of which are herein incorporated by reference in its entirety), the liposome formulation was composed of 57.1 % cationic lipid, 7.1% dipalmitoylphosphatidylcholine, 34.3 % cholesterol, and 1.4% PEG-c- DMA.[000120] In some embodiments, the ratio of PEG in the lipid nanoparticle (LNP) formulations may be increased or decreased and / or the carbon chain length of the PEG lipid may be modified from C14 to C18 to alter the pharmacokinetics and / or biodistribution of the LNP formulations. As a non-limiting example, LNP formulations may contain 1-5% of the lipid molar ratio of PEG-c-DOMG as compared to the cationic lipid, DSPC and cholesterol. In another embodiment the PEG-c-DOMG may be replaced with a PEG lipid such as, but not limited to, PEG-DSG (1,2- Distearoyl-sn-glycerol, methoxypolyethylene glycol) or PEG-DPG (1,2-Dipalmitoyl-sn- glycerol, methoxypolyethylene glycol). The cationic lipid may be selected from any lipid known in the art such as, but not limited to, DLin-MC3-DMA, DLin-DMA, Cl 2-200 and DLin-KC2- DMA.[000121] In one embodiment, the saRNA of the present disclosure may be formulated in a lipid nanoparticle such as the lipid nanoparticles described in International Publication No. W02012170930, the contents of which are herein incorporated by reference in its entirety. [000122] In one embodiment, the cationic lipid which may be used in formulations of the present disclosure may be selected from, but not limited to, a cationic lipid described in International Publication Nos. W02012040184, WO2011153120, WO2011149733, WO201 1090965, WO2011043913, WO2011022460, WO2012061259, WO2012054365,WO2012044638, W02010080724, W0201021865 and W02008103276, US Patent Nos. 7,893,302, 7,404,969 and 8,283,333 and US Patent Publication No. US20100036115 and US20120202871; the contents of each of which is herein incorporated by reference in their entirety. In another embodiment, the cationic lipid may be selected from, but not limited to, formula A described in International Publication Nos. W02012040184, WO2011153120, WO201 1149733, WO2011090965, WO2011043913, WO2011022460, WO2012061259, WO2012054365 and WO2012044638; the contents of each of which is herein incorporated by reference in their entirety. In yet another embodiment, the cationic lipid may be selected from, but not limited to, formula CLI-CLXXIX of International Publication No. W02008103276, formula CLI-CLXXIX of US Patent No. 7,893,302, formula CLLCLXXXXII of US Patent No. 7,404,969 and formula I- VI of US Patent Publication No. US20100036115; the contents of each of which are herein incorporated by reference in their entirety. In yet another embodiment, the cationic lipid may be a multivalent cationic lipid such as the cationic lipid disclosed in US Patent No. 7223887 to Gaucheron et al., the contents of which are incorporated herein by reference in their entirety. The cationic lipid may have a positively-charged head group including two quaternary amine groups and a hydrophobic portion including four hydrocarbon chains as described in US Patent No. 7223887 to Gaucheron et al., the contents of which are incorporated herein by reference in their entirety. In yet another embodiment, the cationic lipid may be biodegradable as the biodegradable lipids disclosed in US20130195920 to Maier et al., the contents of which are incorporated herein by reference in their entirety. The cationic lipid may have one or more biodegradable groups located in a lipidic moiety of the cationic lipid as described in formula I-IV in US 20130195920 to Maier et al., the contents of which are incorporated herein by reference in their entirety.[000123] As a non-limiting example, the cationic lipid may be selected from (20Z,23Z)-N,N- dimethylnonacosa-20,23-dien-10-amine, (17Z,20Z)-N,N-dimemylhexacosa-17,20-dien-9-amine, (lZ,19Z)-N5N-dimethylpentacosa-l 6, 19-dien-8-amine, (13Z,16Z)-N,N-dimethyldocosa-13,16- dien-5-amine, ( 12Z, 15Z)-N,N-dimethylhenicosa- 12, 15-dien-4-amine, ( 14Z, 17Z)-N,N- dimethyltricosa-14, 17-dien-6-amine, (15Z, 18Z)-N,N-dimethyltetracosa-l 5, 18-dien-7-amine, (18Z,21Z)-N,N-dimethylheptacosa-18,21-dien-10-amine, (15Z,18Z)-N,N-dimethyltetracosa- 15,18-dien-5-amine, (14Z,17Z)-N,N-dimethyltricosa-14,17-dien-4-amine, (19Z,22Z)-N,N- dimeihyloctacosa-19,22-dien-9-amine, (18Z,21 Z)-N,N-dimethylheptacosa- 18 ,21 -dien-8 - amine, (17Z,20Z)-N,N-dimethylhexacosa- 17,20-dien-7-amine, (16Z,19Z)-N,N- dimethylpentacosa-16,19-dien-6-amine, (22Z,25Z)-N,N-dimethylhentriaconta-22,25-dien-10- amine, (21 Z ,24Z)-N,N-dimethyltriaconta-21,24-dien-9-amine, (18Z)-N,N-dimetylheptacos-18-en-10-amine, (17Z)-N,N-dimethylhexacos-17-en-9-amine, (19Z,22Z)-N,N-dimethyloctacosa-19.22-dien-7-amine, N,N-dimethylheptacosan-10-amine, (20Z,23Z)-N-ethyl-N-methylnonacosa-20.23 -di en-10-amine, 1-[(1 lZ,14Z)-l-nonylicosa-l 1,14-dien-l-yl] pyrrolidine, (20Z)-N,N- dimethylheptacos-20-en-l 0-amine, (15Z)-N,N-dimethyl eptacos-15-en-l 0-amine, (14Z)-N,N- dimethylnonacos-14-en-10-amine, (17Z)-N,N-dimethylnonacos-17-en-10-amine, (24Z)-N,N- dimethyltritriacont-24-en-10-amine, (20Z)-N,N-dimethylnonacos-20-en-l 0-amine, (22Z)-N,N- dimethylhentriacont-22-en-10-amine, (16Z)-N,N-dimethylpentacos-16-en-8-amine, (12Z,15Z)- N,N-dimethyl-2-nonylhenicosa-12,15-dien-l-amine, (13Z,16Z)-N,N-dimethyl-3-nonyldocosa- 13,16-dien-l-amine, N,N-dimethyl-l-[(lS,2R)-2-octylcyclopropyl] eptadecan-8-amine, 1-[(1 S,2R)-2-hexylcyclopropyl]-N,N-dimethylnonadecan-10-amine, N,N-dimethyl-l-[(l S ,2R)-2- octylcyclopropyl]nonadecan-l 0-amine, N,N-dimethyl-21-[(lS,2R)-2- octylcyclopropyl]henicosan-10-amine,N,N-dimethyl-l-[(lS,2S)-2-{[(lR,2R)-2- pentylcycIopropyl]methyl}cyclopropyl]nonadecan-10-amine,N,N-dimethyl-l-[(lS,2R)-2- octylcyclopropyl]hexadecan-8-amine, N,N-dimethyl-[(lR,2S)-2-undecyIcyclopropyl]tetradecan- 5-amine, N,N-dimethyl-3-{7-[(lS,2R)-2-octylcyclopropyl]heptyl} dodecan-1 -amine, 1- [(lR,2S)-2-hepty lcyclopropyl]-N,N-dimethyloctadecan-9-amine, 1 -[( 1 S,2R)-2- decylcyclopropyl]-N,N-dimethylpentadecan-6-amine, N,N-dimethyl-l-[(lS,2R)-2- octylcyclopropyl]pentadecan-8-amine, R-N,N-dimethyl-l-[(9Z, 12Z)-octadeca-9, 12-dien-l- yloxy]-3-(octyloxy)propan-2-amine, S-N,N-dimethyl-l-[(9Z, 12Z)-octadeca-9, 12-dien-l-yloxy]- 3-(octyloxy)propan-2-amine, l-{2-[(9Z,12Z)-octadeca-9,12-dien-l-yloxy]-l- [(octyloxy)methyl]ethyl}pyrrolidine, (2S)-N,N-dimethyl-l-[(9Z, 12Z)-octadeca-9, 12-dien-l- yloxy]-3-[(5Z)-oct-5-en-l-yloxy]propan-2-amine, l-{2-[(9Z,12Z)-octadeca-9,12-dien-l-yloxy]- 1 -[(octyloxy )methyl]ethyl} azetidine, (2S)-l-(hexyloxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca- 9, 12-dien-l-yloxy]propan-2-amine, (2S)-l-(heptyloxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca- 9,12-dien-l-yloxy]propan-2-amine, N,N-dimethyl-l-(nonyloxy)-3-[(9Z,12Z)-octadeca-9,12- dien-l-yloxy]propan-2-amine, N,N-dimethyl-l-[(9Z)-octadec-9-en-l-yloxy]-3- (octyloxy)propan-2-amine; (2S)-N,N-dimethyl-l-[(6Z,9Z,12Z)-octadeca-6,9,12-trien-l-yloxy]- 3-(octyloxy)propan-2-amine, (2S)-1-[(1 lZ,14Z)-icosa-l l,14-dien-l-yloxy]-N,N-dimethyl-3- (pentyloxy)propan-2-amine, (2S)-l-(hexyloxy)-3-[(l lZ,14Z)-icosa-l l,14-dien-l-yloxy]-N,N- dimethylpropan-2-amine, 1-[(1 lZ,14Z)-icosa-l l,14-dien-l-yloxy]-N,N-dimethyl-3- (octyloxy)propan-2-amine, 1 -[( 13Z, 16Z)-docosa-13 , 16-dien-l-yloxy] -N,N-dimethyl-3 - (octyloxy)propan-2-amine, (2S)- 1 -[(13Z, 16Z)-docosa- 13,16-dien- 1 -yloxy]-3 -(hexyloxy)-N,N- dimethylpropan-2-amine, (2 S)- 1 -[( 13Z)-docos- 13 -en- 1 -yloxy ] -3 -(hexyloxy)-N,N - dimethylpropan-2-amine, 1 -[( 13Z)-docos- 13 -en- 1 -yloxy]-N,N-dimethyl-3 -(octyloxy)propan-2-amine, l-[(9Z)-hexadec-9-en-l-yloxy]-N,N-dimethyl-3-(octyloxy)propan-2-amine, (2R)-N,N- dimethyl-H(l-metoylo ctyl)oxy]-3-[(9Z,12Z)-octadeca-9,12-dien-l-yloxy]propan-2-amine, (2R)-l-[(3,7-dimethyloctyl)oxy]-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-l- yloxy]propan-2-amine, N,N-dimethyl-l-(octyloxy)-3-({8-[(lS,2S)-2-{[(lR,2R)-2- pentylcyclopropyl]methyl}cyclopropyl]octyl}oxy)propan-2-amine, N,N-dimethyl-l-{[8-(2- oclylcyclopropyl)octyl]oxy}-3-(octyloxy)propan-2-amine and (11E,2OZ,23Z)-N,N- dimethylnonacosa-ll,20,2-trien-10-amine or a pharmaceutically acceptable salt or stereoisomer thereof.[000124] In one embodiment, the lipid may be a cleavable lipid such as those described in International Publication No. WO2012170889, the contents of which are herein incorporated by reference in their entirety.[000125] In one embodiment, the nanoparticles described herein may comprise at least one cationic polymer described herein and / or known in the art.[000126] In one embodiment, the cationic lipid may be synthesized by methods known in the art and / or as described in International Publication Nos. W02012040184, WO2011153120, WO201 1149733, WO2011090965, WO2011043913, WO2011022460, WO2012061259, WO2012054365, WO2012044638, W02010080724 and W0201021865; the contents of each of which is herein incorporated by reference in their entirety.[000127] In one embodiment, the LNP formulations of the saRNA may contain PEG-c-DOMG at 3% lipid molar ratio. In another embodiment, the LNP formulations of the saRNA may contain PEG-c-DOMG at 1.5% lipid molar ratio.[000128] In one embodiment, the pharmaceutical compositions of the saRNA may include at least one of the PEGylated lipids described in International Publication No. 2012099755, the contents of which is herein incorporated by reference in its entirety.[000129] In one embodiment, the LNP formulation may contain PEG-DMG 2000 (1,2- dimyristoyl-sn-glycero-3-phophoethanolamine-N-[methoxy(polyethylene glycol)-2000). In one embodiment, the LNP formulation may contain PEG-DMG 2000, a cationic lipid known in the art and at least one other component. In another embodiment, the LNP formulation may contain PEG-DMG 2000, a cationic lipid known in the art, DSPC and cholesterol. As a non-limiting example, the LNP formulation may contain PEG-DMG 2000, DLin-DMA, DSPC and cholesterol. As another non-limiting example the LNP formulation may contain PEG-DMG 2000, DLin-DMA, DSPC and cholesterol in a molar ratio of 2:40: 10:48 (see e.g., Geall et al., Nonviral delivery of self-amplifying RNA vaccines, PNAS 2012; PMID: 22908294; herein incorporated by reference in its entirety). As another non-limiting example, the saRNAdescribed herein may be formulated in a nanoparticle to be delivered by a parenteral route as described in U.S. Pub. No. 20120207845; the contents of which is herein incorporated by reference in its entirety. The cationic lipid may also be the cationic lipids disclosed in US20130156845 to Manoharan et al. and US 20130129785 to Manoharan et al., WO 2012047656 to Wasan et al., WO 2010144740 to Chen et al., WO 2013086322 to Ansell et al., or WO 2012016184 to Manoharan et al., the contents of each of which are incorporated herein by reference in their entirety.[000130] In one embodiment, the saRNA of the present disclosure may be formulated with a plurality of cationic lipids, such as a first and a second cationic lipid as described in US20130017223 to Hope et al., the contents of which are incorporated herein by reference in their entirety. The first cationic lipid can be selected on the basis of a first property and the second cationic lipid can be selected on the basis of a second property, where the properties may be determined as outlined in US20130017223, the contents of which are herein incorporated by reference in its entirety. In one embodiment, the first and second properties are complementary.[000131] In another embodiment, the saRNA may be formulated with a lipid particle comprising one or more cationic lipids and one or more second lipids, and one or more nucleic acids, wherein the lipid particle comprises a solid core, as described in US Patent Publication No. US20120276209 to Cullis et al., the contents of which are incorporated herein by reference in their entirety.[000132] In one embodiment, the saRNA of the present disclosure may be complexed with a cationic amphiphile in an oil-in-water (o / w) emulsion such as described in EP2298358 to Satishchandran et al., the contents of which are incorporated herein by reference in their entirety. The cationic amphiphile may be a cationic lipid, modified or unmodified spermine, bupivacaine, or benzalkonium chloride and the oil may be a vegetable or an animal oil. As a non-limiting example, at least 10% of the nucleic acid-cationic amphiphile complex is in the oil phase of the oil-in-water emulsion (see e.g., the complex described in European Publication No. EP2298358 to Satishchandran et al., the contents of which are herein incorporated by reference in its entirety).[000133] In one embodiment, the saRNA of the present disclosure may be formulated with a composition comprising a mixture of cationic compounds and neutral lipids. As a non-limiting example, the cationic compounds may be formula (I) disclosed in WO 1999010390 to Ansell et al., the contents of which are disclosed herein by reference in their entirety, and the neutral lipid may be selected from the group consisting of diacylphosphatidylcholine,diacylphosphatidylethanolamine, ceramide and sphingomyelin. In another non-limiting example, the lipid formulation may comprise a cationic lipid of formula A, a neutral lipid, a sterol and a PEG or PEG-modified lipid disclosed in US 20120101148 to Akinc et al., the contents of which are incorporated herein by reference in their entirety.[000134] In one embodiment, the LNP formulation may be formulated by the methods described in International Publication Nos. WO2011127255 or W02008103276, each of which are herein incorporated by reference in their entirety. As a non-limiting example, the saRNA of the present disclosure may be encapsulated in any of the lipid nanoparticle (LNP) formulations described in WO2011127255 and / or W02008103276; the contents of each of which are herein incorporated by reference in their entirety.[000135] In one embodiment, the LNP formulations described herein may comprise a polycationic composition. As a non-limiting example, the polycationic composition may be selected from formula 1-60 of US Patent Publication No. US20050222064; the contents of which is herein incorporated by reference in its entirety. In another embodiment, the LNP formulations comprising a polycationic composition may be used for the delivery of the saRNA described herein in vivo and / or in vitro.[000136] In one embodiment, the LNP formulations described herein may additionally comprise a permeability enhancer molecule. Non-limiting permeability enhancer molecules are described in US Patent Publication No. US20050222064; the contents of which is herein incorporated by reference in its entirety.[000137] In one embodiment, the pharmaceutical compositions may be formulated in liposomes such as, but not limited to, DiLa2 liposomes (Marina Biotech, Bothell, WA), SMARTICLES® / NOV340 (Marina Biotech, Bothell, WA), neutral DOPC (1,2-dioleoyl-sn- glycero-3 -phosphocholine) based liposomes (e.g., siRNA delivery for ovarian cancer (Landen et al. Cancer Biology & Therapy 2006 5(12)1708-1713); the contents of which is herein incorporated by reference in its entirety) and hyaluronan-coated liposomes (Quiet Therapeutics, Israel).[000138] In some embodiments, the pharmaceutical compositions may be formulated with any amphoteric liposome disclosed in WO 2008 / 043575 to Panzner and US 8580297 to Essler et al. (Marina Biotech), the contents of which are incorporated herein by reference in their entirety. The amphoteric liposome may comprise a mixture of lipids including a cationic amphiphile, an anionic amphiphile and optional one or more neutral amphiphiles. The amphoteric liposome may comprise amphoteric compounds based on amphiphilic molecules, the head groups of which being substituted with one or more amphoteric groups. In some embodiments, thepharmaceutical compositions may be formulated with an amphoteric lipid comprising one or more amphoteric groups having an isoelectric point between 4 and 9, as disclosed in US 20140227345 to Essler et al. (Marina Biotech), the contents of which are incorporated herein by reference in their entirety.[000139] In some embodiments, the pharmaceutical composition may be formulated with liposomes comprising a sterol derivative as disclosed in US 7312206 to Panzner et al. (Novosom), the contents of which are incorporated herein by reference in their entirety. In some embodiments, the pharmaceutical composition may be formulated with amphoteric liposomes comprising at least one amphipathic cationic lipid, at least one amphipathic anionic lipid, and at least one neutral lipid, or liposomes comprise at least one amphipathic lipid with both a positive and a negative charge, and at least one neutral lipid, wherein the liposomes are stable at pH 4.2 and pH 7.5, as disclosed in US Pat. No. 7780983 to Panzner et al. (Novosom), the contents of which are incorporated herein by reference in their entirety. In some embodiments, the pharmaceutical composition may be formulated with liposomes comprising a serum-stable mixture of lipids taught in US 20110076322 to Panzner et al, the contents of which are incorporated herein by reference in their entirety, capable of encapsulating the saRNA of the present disclosure. The lipid mixture comprises phosphatidylcholine and phosphatidylethanolamine in a ratio in the range of about 0.5 to about 8. The lipid mixture may also include pH sensitive anionic and cationic amphiphiles, such that the mixture is amphoteric, being negatively charged or neutral at pH 7.4 and positively charged at pH 4. The drug / lipid ratio may be adjusted to target the liposomes to particular organs or other sites in the body. In some embodiments, liposomes loaded with the saRNA of the present disclosure as cargo, are prepared by the method disclosed in US 20120021042 to Panzner et al., the contents of which are incorporated herein by reference in their entirety. The method comprises steps of admixing an aqueous solution of a polyanionic active agent and an alcoholic solution of one or more amphiphiles and buffering said admixture to an acidic pH, wherein the one or more amphiphiles are susceptible of forming amphoteric liposomes at the acidic pH, thereby to form amphoteric liposomes in suspension encapsulating the active agent.[000140] The nanoparticle formulations may be a carbohydrate nanoparticle comprising a carbohydrate carrier and a nucleic acid molecule (e.g., saRNA). As a non-limiting example, the carbohydrate carrier may include, but is not limited to, an anhydride-modified phytoglycogen or glycogen-type material, phtoglycogen octenyl succinate, phytoglycogen beta-dextrin, anhydride- modified phytoglycogen beta-dextrin. (See e.g., International Publication No. W02012109121; the contents of which is herein incorporated by reference in its entirety).[000141] Lipid nanoparticle formulations may be improved by replacing the cationic lipid with a biodegradable cationic lipid which is known as a rapidly eliminated lipid nanoparticle (reLNP). Ionizable cationic lipids, such as, but not limited to, DLinDMA, DLin-KC2-DMA, and DLin-MC3-DMA, have been shown to accumulate in plasma and tissues over time and may be a potential source of toxicity. The rapid metabolism of the rapidly eliminated lipids can improve the tolerability and therapeutic index of the lipid nanoparticles by an order of magnitude from a 1 mg / kg dose to a 10 mg / kg dose in rat. Inclusion of an enzymatically degraded ester linkage can improve the degradation and metabolism profile of the cationic component, while still maintaining the activity of the reLNP formulation. The ester linkage can be internally located within the lipid chain or it may be terminally located at the terminal end of the lipid chain. The internal ester linkage may replace any carbon in the lipid chain.[000142] In one embodiment, the saRNA may be formulated as a lipoplex, such as, without limitation, the ATUPLEX™ system, the DACC system, the DBTC system and other siRNA- lipoplex technology from Silence Therapeutics (London, United Kingdom), STEMFECT™ from STEMGENT® (Cambridge, MA), and polyethylenimine (PEI) or protamine-based targeted and non-targeted delivery of nucleic acids (Aleku et al. Cancer Res. 2008 68:9788- 9798; Strumberg et al. Int J Clin Pharmacol Ther 2012 50:76-78; Santel et al., Gene Ther 2006 13: 1222-1234; Santel et al., Gene Ther 2006 13: 1360-1370; Gutbier et al., Pulm Pharmacol. Ther. 2010 23:334-344; Kaufmann et al. Microvasc Res 2010 80:286-293Weide et al. J Immunother. 2009 32:498-507; Weide et al. J Immunother. 2008 31 : 180-188; Pascolo Expert Opin. Biol. Ther. 4: 1285-1294; Fotin-Mleczek et al., 2011 J. Immunother. 34: 1-15; Song et al., Nature Biotechnol. 2005, 23:709-717; Peer et al., Proc Natl Acad Sci U S A. 2007 6; 104:4095- 4100; deFougerolles Hum Gene Ther. 2008 19: 125-132; the contents of each of which are incorporated herein by reference in its entirety).[000143] In one embodiment such formulations may also be constructed or compositions altered such that they passively or actively are directed to different cell types in vivo, including but not limited to hepatocytes, immune cells, tumor cells, endothelial cells, antigen presenting cells, and leukocytes (Akinc et al. Mol Ther. 2010 18: 1357-1364; Song et al., Nat Biotechnol. 2005 23:709-717; Judge et al., J Clin Invest. 2009 119:661-673; Kaufmann et al., Microvasc Res2010 80:286-293; Santel et al., Gene Ther 2006 13: 1222-1234; Santel et al., Gene Ther 2006 13: 1360-1370; Gutbier et al., Pulm Pharmacol. Ther. 2010 23:334-344; Basha et al., Mol. Ther.2011 19:2186-2200; Fenske and Cullis, Expert Opin Drug Deliv. 2008 5:25-44; Peer et al., Science. 2008 319:627-630; Peer and Lieberman, Gene Ther. 2011 18: 1127-1133; the contents of each of which are incorporated herein by reference in its entirety). One example of passivetargeting of formulations to liver cells includes the DLin-DMA, DLin-KC2-DMA and DLin- MC3 -DMA-based lipid nanoparticle formulations which have been shown to bind to apolipoprotein E and promote binding and uptake of these formulations into hepatocytes in vivo (Akinc et al. Mol Ther. 2010 18: 1357-1364; the contents of which is herein incorporated by reference in its entirety). Formulations can also be selectively targeted through expression of different ligands on their surface as exemplified by, but not limited by, folate, transferrin, N- acetylgalactosamine (GalNAc), and antibody targeted approaches (Kolhatkar et al., Curr Drug Discov Technol. 2011 8: 197-206; Musacchio and Torchilin, Front Biosci. 2011 16: 1388-1412; Yu et al., Mol Membr Biol. 2010 27:286-298; Patil et al., Crit Rev Ther Drug Carrier Syst. 2008 25: 1-61; Benoit et al., Biomacromolecules. 2011 12:2708-2714; Zhao et al., Expert Opin Drug Deliv. 2008 5:309-319; Akinc et al., Mol Ther. 2010 18: 1357-1364; Srinivasan et al., Methods Mol Biol. 2012 820: 105-116; Ben-Arie et al., Methods Mol Biol. 2012 757:497-507; Peer 2010 J Control Release. 20:63-68; Peer et al., Proc Natl Acad Sci U S A. 2007 104:4095-4100; Kim et al., Methods Mol Biol. 2011 721 :339-353; Subramanya et al., Mol Ther. 2010 18:2028-2037; Song et al., Nat Biotechnol. 2005 23:709-717; Peer et al., Science. 2008 319:627-630; Peer and Lieberman, Gene Ther. 2011 18: 1127-1133; the contents of each of which are incorporated herein by reference in its entirety).[000144] In one embodiment, the saRNA is formulated as a solid lipid nanoparticle. A solid lipid nanoparticle (SLN) may be spherical with an average diameter between 10 to 1000 nm. SLN possess a solid lipid core matrix that can solubilize lipophilic molecules and may be stabilized with surfactants and / or emulsifiers. In a further embodiment, the lipid nanoparticle may be a self-assembly lipid-polymer nanoparticle (see Zhang et al., ACS Nano, 2008, 2 (8), pp 1696-1702; the contents of which are herein incorporated by reference in its entirety).[000145] In one embodiment, the saRNA of the present disclosure can be formulated for controlled release and / or targeted delivery. As used herein, “controlled release” refers to a pharmaceutical composition or compound release profile that conforms to a particular pattern of release to effect a therapeutic outcome. In one embodiment, the saRNA may be encapsulated into a delivery agent described herein and / or known in the art for controlled release and / or targeted delivery. As used herein, the term “encapsulate” means to enclose, surround or encase. As it relates to the formulation of the compounds of the disclosure, encapsulation may be substantial, complete or partial. The term “substantially encapsulated” means that at least greater than 50, 60, 70, 80, 85, 90, 95, 96, 97, 98, 99, 99.9, 99.9 or greater than 99.999% of the pharmaceutical composition or compound of the disclosure may be enclosed, surrounded or encased within the delivery agent. “Partially encapsulated” means that less than 10, 10, 20, 30,40 50 or less of the pharmaceutical composition or compound of the disclosure may be enclosed, surrounded or encased within the delivery agent. Advantageously, encapsulation may be determined by measuring the escape or the activity of the pharmaceutical composition or compound of the disclosure using fluorescence and / or electron micrograph. For example, at least 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 85, 90, 95, 96, 97, 98, 99, 99.9, 99.99 or greater than 99.99% of the pharmaceutical composition or compound of the disclosure are encapsulated in the delivery agent.[000146] In another embodiment, the saRNA may be encapsulated into a lipid nanoparticle or a rapidly eliminated lipid nanoparticle and the lipid nanoparticles or a rapidly eliminated lipid nanoparticle may then be encapsulated into a polymer, hydrogel and / or surgical sealant described herein and / or known in the art. As a non-limiting example, the polymer, hydrogel or surgical sealant may be PLGA, ethylene vinyl acetate (EV Ac), poloxamer, GELSITE® (Nanotherapeutics, Inc. Alachua, FL), HYLENEX® (Halozyme Therapeutics, San Diego CA), surgical sealants such as fibrinogen polymers (Ethicon Inc. Cornelia, GA), TISSELL® (Baxter International, Inc., Deerfield, IL), PEG-based sealants, and COSEAL® (Baxter International, Inc., Deerfield, IL).[000147] In another embodiment, the lipid nanoparticle may be encapsulated into any polymer known in the art which may form a gel when injected into a subject. As another non-limiting example, the lipid nanoparticle may be encapsulated into a polymer matrix which may be biodegradable.[000148] In one embodiment, the saRNA formulation for controlled release and / or targeted delivery may also include at least one controlled release coating. Controlled release coatings include, but are not limited to, OPADRY®, polyvinylpyrrolidone / vinyl acetate copolymer, polyvinylpyrrolidone, hydroxypropyl methylcellulose, hydroxypropyl cellulose, hydroxyethyl cellulose, EUDRAGIT RL®, EUDRAGIT RS® and cellulose derivatives such as ethylcellulose aqueous dispersions (AQUACOAT® and SURELEASE®).[000149] In one embodiment, the controlled release and / or targeted delivery formulation may comprise at least one degradable polyester which may contain polycationic side chains. Degradeable polyesters include, but are not limited to, poly(serine ester), poly(L-lactide-co-L- lysine), poly(4-hydroxy-L-proline ester), and combinations thereof. In another embodiment, the degradable polyesters may include a PEG conjugation to form a PEGylated polymer.[000150] In one embodiment, the saRNA of the present disclosure may be formulated with a targeting lipid with a targeting moiety such as the targeting moieties disclosed in US20130202652 to Manoharan et al., the contents of which are incorporated herein by referencein their entirety. As a non-limiting example, the targeting moiety of formula I of US 20130202652 to Manoharan et al. may selected in order to favor the lipid being localized with a desired organ, tissue, cell, cell type or subtype, or organelle. Non-limiting targeting moieties that are contemplated in the present disclosure include transferrin, anisamide, an RGD peptide, prostate specific membrane antigen (PSMA), fucose, an antibody, or an aptamer.[000151] In one embodiment, the saRNA of the present disclosure may be encapsulated in a therapeutic nanoparticle. Therapeutic nanoparticles may be formulated by methods described herein and known in the art such as, but not limited to, International Pub Nos. WO2010005740, W02010030763, W02010005721, W02010005723, WO2012054923, US Pub. Nos.US20110262491, US20100104645, US20100087337, US20100068285, US20110274759, US20100068286 and US20120288541 and US Pat No. 8,206,747, 8,293,276, 8,318,208 and 8,318,211; the contents of each of which are herein incorporated by reference in their entirety. In another embodiment, therapeutic polymer nanoparticles may be identified by the methods described in US Pub No. US20120140790, the contents of which are herein incorporated by reference in its entirety.[000152] In one embodiment, the therapeutic nanoparticle may be formulated for sustained release. As used herein, “sustained release” refers to a pharmaceutical composition or compound that conforms to a release rate over a specific period of time. The period of time may include, but is not limited to, hours, days, weeks, months and years. As a non-limiting example, the sustained release nanoparticle may comprise a polymer and a therapeutic agent such as, but not limited to, the saRNA of the present disclosure (see International Pub No. 2010075072 and US Pub No. US20100216804, US20110217377 and US20120201859, the contents of each of which are herein incorporated by reference in their entirety).[000153] In one embodiment, the therapeutic nanoparticles may be formulated to be target specific. As a non-limiting example, the therapeutic nanoparticles may include a corticosteroid (see International Pub. No. WO2011084518; the contents of which are herein incorporated by reference in its entirety). In one embodiment, the therapeutic nanoparticles may be formulated to be cancer specific. As a non-limiting example, the therapeutic nanoparticles may be formulated in nanoparticles described in International Pub No. WO2008121949, W02010005726, W02010005725, WO2011084521 and US Pub No. US20100069426, US20120004293 and US20100104655, the contents of each of which are herein incorporated by reference in their entirety.[000154] In one embodiment, the nanoparticles of the present disclosure may comprise a polymeric matrix. As a non-limiting example, the nanoparticle may comprise two or morepolymers such as, but not limited to, polyethylenes, polycarbonates, polyanhydrides, polyhydroxyacids, polypropylfumerates, polycaprolactones, polyamides, polyacetals, polyethers, polyesters, poly(orthoesters), polycyanoacrylates, polyvinyl alcohols, polyurethanes, polyphosphazenes, polyacrylates, polymethacrylates, polycyanoacrylates, polyureas, polystyrenes, polyamines, polylysine, polyethylene imine), poly(serine ester), poly(L-lactide- co-L-lysine), poly(4-hydroxy-L-proline ester) or combinations thereof.[000155] In one embodiment, the therapeutic nanoparticle comprises a diblock copolymer. In one embodiment, the diblock copolymer may include PEG in combination with a polymer such as, but not limited to, polyethylenes, polycarbonates, polyanhydrides, polyhydroxyacids, polypropylfumerates, polycaprolactones, polyamides, polyacetals, polyethers, polyesters, poly(orthoesters), polycyanoacrylates, polyvinyl alcohols, polyurethanes, polyphosphazenes, polyacrylates, polymethacrylates, polycyanoacrylates, polyureas, polystyrenes, polyamines, polylysine, poly(ethylene imine), poly(serine ester), poly(L-lactide-co-L-lysine), poly(4- hydroxy-L-proline ester) or combinations thereof.[000156] As a non-limiting example the therapeutic nanoparticle comprises a PLGA-PEG block copolymer (see US Pub. No. US20120004293 and US Pat No. 8,236,330, each of which is herein incorporated by reference in their entirety). In another non-limiting example, the therapeutic nanoparticle is a stealth nanoparticle comprising a diblock copolymer of PEG and PLA or PEG and PLGA (see US Pat No 8,246,968 and International Publication No. WO2012166923, the contents of each of which is herein incorporated by reference in its entirety).[000157] In one embodiment, the therapeutic nanoparticle may comprise a multiblock copolymer such as, but not limited to the multiblock copolymers described in U.S. Pat. No. 8,263,665 and 8,287,910; the contents of each of which are herein incorporated by reference in its entirety.[000158] In one embodiment, the block copolymers described herein may be included in a polyion complex comprising a non-polymeric micelle and the block copolymer. (See e.g., U.S. Pub. No. 20120076836; the contents of which are herein incorporated by reference in its entirety).[000159] In one embodiment, the therapeutic nanoparticle may comprise at least one acrylic polymer. Acrylic polymers include but are not limited to, acrylic acid, methacrylic acid, acrylic acid and methacrylic acid copolymers, methyl methacrylate copolymers, ethoxyethyl methacrylates, cyanoethyl methacrylate, amino alkyl methacrylate copolymer, poly(acrylic acid), poly(methacrylic acid), polycyanoacrylates and combinations thereof.[000160] In one embodiment, the therapeutic nanoparticles may comprise at least one amine- containing polymer such as, but not limited to polylysine, polyethylene imine, poly(amidoamine) dendrimers, poly(beta-amino esters) (See e.g., U.S. Pat. No. 8,287,849; the contents of which are herein incorporated by reference in its entirety) and combinations thereof. [000161] In one embodiment, the therapeutic nanoparticles may comprise at least one degradable polyester which may contain polycationic side chains. Degradable polyesters include, but are not limited to, poly(serine ester), poly(L-lactide-co-L-lysine), poly(4-hydroxy- L-proline ester), and combinations thereof. In another embodiment, the degradable polyesters may include a PEG conjugation to form a PEGylated polymer.[000162] In another embodiment, the therapeutic nanoparticle may include a conjugation of at least one targeting ligand. The targeting ligand may be any ligand known in the art such as, but not limited to, a monoclonal antibody. (Kirpotin et al, Cancer Res. 2006 66:6732-6740; the contents of which are herein incorporated by reference in its entirety).[000163] In one embodiment, the therapeutic nanoparticle may be formulated in an aqueous solution which may be used to target cancer (see International Pub No. WO2011084513 and US Pub No. US20110294717, the contents of each of which is herein incorporated by reference in their entirety).[000164] In one embodiment, the saRNA may be encapsulated in, linked to and / or associated with synthetic nanocarriers. Synthetic nanocarriers include, but are not limited to, those described in International Pub. Nos. W02010005740, W02010030763, W0201213501, WO2012149252, WO2012149255, WO2012149259, WO2012149265, WO2012149268, WO2012149282, W02012149301, WO2012149393, WO2012149405, WO2012149411, WO2012149454 and WO2013019669, and US Pub. Nos. US20110262491, US20100104645, US20100087337 and US20120244222, the contents of each of which are herein incorporated by reference in their entirety. The synthetic nanocarriers may be formulated using methods known in the art and / or described herein. As a non-limiting example, the synthetic nanocarriers may be formulated by the methods described in International Pub Nos. WO2010005740, W02010030763 and W0201213501and US Pub. Nos. US20110262491, US20100104645, US20100087337 and US2012024422, the contents of each of which are herein incorporated by reference in their entirety. In another embodiment, the synthetic nanocarrier formulations may be lyophilized by methods described in International Pub. No. WO2011072218 and US Pat No. 8,211,473; the contents of each of which are herein incorporated by reference in their entirety.[000165] In one embodiment, the synthetic nanocarriers may contain reactive groups to release the saRNA described herein (see International Pub. No. WO20120952552 and US Pub No.US20120171229, the contents of each of which are herein incorporated by reference in their entirety).[000166] In one embodiment, the synthetic nanocarriers may be formulated for targeted release. In one embodiment, the synthetic nanocarrier may be formulated to release the saRNA at a specified pH and / or after a desired time interval. As a non-limiting example, the synthetic nanoparticle may be formulated to release the saRNA after 24 hours and / or at a pH of 4.5 (see International Pub. Nos. W02010138193 and W02010138194 and US Pub Nos.US20110020388 and US20110027217, the contents of each of which is herein incorporated by reference in their entireties).[000167] In one embodiment, the synthetic nanocarriers may be formulated for controlled and / or sustained release of the saRNA described herein. As a non-limiting example, the synthetic nanocarriers for sustained release may be formulated by methods known in the art, described herein and / or as described in International Pub No. W02010138192 and US Pub No. 20100303850, the contents each of which is herein incorporated by reference in their entirety. [000168] In one embodiment, the nanoparticle may be optimized for oral administration. The nanoparticle may comprise at least one cationic biopolymer such as, but not limited to, chitosan or a derivative thereof. As a non-limiting example, the nanoparticle may be formulated by the methods described in U.S. Pub. No. 20120282343; the contents of which are herein incorporated by reference in its entirety.[000169] In one embodiment, the saRNA of the present disclosure may be formulated in a modular composition such as described in US 8575123 to Manoharan et al., the contents of which are herein incorporated by reference in their entirety. As a non-limiting example, the modular composition may comprise a nucleic acid, e.g., the saRNA of the present disclosure, at least one endosomolytic component, and at least one targeting ligand. The modular composition may have a formula such as any formula described in US 8575123 to Manoharan et al., the contents of which are herein incorporated by reference in their entirety.[000170] In one embodiment, the saRNA of the present disclosure may be encapsulated in the lipid formulation to form a stable nucleic acid-lipid particle (SNALP) such as described in US8546554 to de Fougerolles et al., the contents of which are incorporated here by reference in their entirety. The lipid may be cationic or non-cationic. In one non-limiting example, the lipid to nucleic acid ratio (mass / mass ratio) (e.g., lipid to saRNA ratio) will be in the range of from about 1 : 1 to about 50: 1, from about 1 : 1 to about 25: 1, from about 3: 1 to about 15: 1, from about 4: 1 to about 10: 1, from about 5:1 to about 9: 1, or about 6: 1 to about 9: 1, or 5: 1, 6: 1, 7: 1, 8: 1, 9: 1, 10: 1, or 11 : 1. In another example, the SNALP includes 40% 2,2-Dilinoleyl-4-dimethylaminoethyl-[l,3]-dioxolane (Lipid A), 10% dioleoylphosphatidylcholine (DSPC), 40% cholesterol, 10% polyethyleneglycol (PEG)-C-D0MG (mole percent) with a particle size of 63.0±20 nm and a 0.027 nucleic acid / lipid ratio. In another embodiment, the saRNA of the present disclosure may be formulated with a nucleic acid-lipid particle comprising an endosomal membrane destabilizer as disclosed in US 7189705 to Lam et al., the contents of which are incorporated herein by reference in their entirety. As a non-limiting example, the endosomal membrane destabilizer may be a Ca2+ion.[000171] In one embodiment, the saRNA of the present disclosure may be formulated with formulated lipid particles (FLiPs) disclosed in US 8148344 to Akinc et al., the contents of which are herein incorporated by reference in their entirety. Akinc et al. teach that FLiPs may comprise at least one of a single or double-stranded oligonucleotide, where the oligonucleotide has been conjugated to a lipophile and at least one of an emulsion or liposome to which the conjugated oligonucleotide has been aggregated, admixed or associated. These particles have surprisingly been shown to effectively deliver oligonucleotides to heart, lung and muscle disclosed in US 8148344 to Akinc et al., the contents of which are herein incorporated by reference in their entirety.[000172] In one embodiment, the saRNA of the present disclosure may be delivered to a cell using a composition comprising an expression vector in a lipid formulation as described in US 6086913 to Tam et al., the contents of which are incorporated herein by reference in their entirety. The composition disclosed by Tam is serum-stable and comprises an expression vector comprising first and second inverted repeated sequences from an adeno associated virus (AAV), a rep gene from AAV, and a nucleic acid fragment. The expression vector in Tam is complexed with lipids.[000173] In one embodiment, the saRNA of the present disclosure may be formulated with a lipid formulation disclosed in US 20120270921 to de Fougerolles et al., the contents of which are incorporated herein by reference in their entirety. In one non-limiting example, the lipid formulation may include a cationic lipid having the formula A described in US 20120270921, the contents of which are herein incorporated by reference in its entirety. In another non-limiting example, the compositions of exemplary nucleic acid-lipid particles disclosed in Table A of US 20120270921, the contents of which are incorporated herein by reference in their entirety, may be used with the saRNA of the present disclosure.[000174] In one embodiment, the saRNA of the present disclosure may be fully encapsulated in a lipid particle disclosed in US 20120276207 to Maurer et al., the contents of which are incorporated herein by reference in their entirety. The particles may comprise alipid composition comprising preformed lipid vesicles, a charged therapeutic agent, and a destabilizing agent to form a mixture of preformed vesicles and therapeutic agent in a destabilizing solvent, wherein the destabilizing solvent is effective to destabilize the membrane of the preformed lipid vesicles without disrupting the vesicles.[000175] In one embodiment, the saRNA of the present disclosure may be formulated with a conjugated lipid. In a non-limiting example, the conjugated lipid may have a formula such as described in US 20120264810 to Lin et al., the contents of which are incorporated herein by reference in their entirety. The conjugate lipid may form a lipid particle which further comprises a cationic lipid, a neutral lipid, and a lipid capable of reducing aggregation.[000176] In one embodiment, the saRNA of the present disclosure may be formulated in a neutral liposomal formulation such as disclosed in US 20120244207 to Fitzgerald et al., the contents of which are incorporated herein by reference in their entirety. The phrase “neutral liposomal formulation” refers to a liposomal formulation with a near neutral or neutral surface charge at a physiological pH. Physiological pH can be, e.g., about 7.0 to about 7.5, or, e.g., about 7.5, or, e.g., 7.0, 7.1, 7.2, 7.3, 7.4, or 7.5, or, e.g., 7.3, or, e.g., 7.4. An example of a neutral liposomal formulation is an ionizable lipid nanoparticle (iLNP). A neutral liposomal formulation can include an ionizable cationic lipid, e.g., DLin-KC2-DMA.[000177] In one embodiment, the saRNA of the present disclosure may be formulated with a charged lipid or an amino lipid. As used herein, the term "charged lipid" is meant to include those lipids having one or two fatty acyl or fatty alkyl chains and a quaternary amino head group. The quaternary amine carries a permanent positive charge. The head group can optionally include an ionizable group, such as a primary, secondary, or tertiary amine that may be protonated at physiological pH. The presence of the quaternary amine can alter the pKa of the ionizable group relative to the pKa of the group in a structurally similar compound that lacks the quaternary amine (e.g., the quaternary amine is replaced by a tertiary amine) In some embodiments, a charged lipid is referred to as an "amino lipid." In a non-limiting example, the amino lipid may be any amino lipid described in US20110256175 to Hope et al., the contents of which are incorporated herein by reference in their entirety. For example, the amino lipids may have the structure disclosed in Tables 3-7 of Hope, such as structure (II), DLin-K-C2-DMA, DLin-K2-DMA, DLin-K6-DMA, etc. The resulting pharmaceutical preparations may be lyophilized according to Hope. In another non-limiting example, the amino lipids may be any amino lipid described in US 20110117125 to Hope et al., the contents of which are incorporated herein by reference in their entirety, such as a lipid of structure (I), DLin-K-DMA, DLin-C- DAP, DLin-DAC, DLin-MA, DLin-S-DMA, etc. In another non-limiting example, the aminolipid may have the structure (I), (II), (III), or (IV), or 4-(R)-DUn-K-DMA (VI), 4-(S)-DUn-K- DMA (V) as described in W02009132131 to Manoharan et al., the contents of which are incorporated herein by reference in their entirety. In another non-limiting example, the charged lipid used in any of the formulations described herein may be any charged lipid described in EP2509636 to Manoharan et al., the contents of which are incorporated herein by reference in their entirety.[000178] In one embodiment, the saRNA of the present disclosure may be formulated with an association complex containing lipids, liposomes, or lipoplexes. In a non-limiting example, the association complex comprises one or more compounds each having a structure defined by formula (I), a PEG-lipid having a structure defined by formula (XV), a steroid and a nucleic acid disclosed in US8034376 to Manoharan et al., the contents of which are incorporated herein by reference in their entirety. The saRNA may be formulated with any association complex described in US8034376, the contents of which are herein incorporated by reference in its entirety.[000179] In one embodiment, the saRNA of the present disclosure may be formulated with reverse head group lipids. As a non-limiting example, the saRNA may be formulated with a zwitterionic lipid comprising a headgroup wherein the positive charge is located near the acyl chain region and the negative charge is located at the distal end of the head group, such as a lipid having structure (A) or structure (I) described in WO2011056682 to Leung et al., the contents of which are incorporated herein by reference in their entirety.[000180] In one embodiment, the saRNA of the present disclosure may be formulated in a lipid bilayer carrier. As a non-limiting example, the saRNA may be combined with a lipid-detergent mixture comprising a lipid mixture of an aggregation-preventing agent in an amount of about 5 mol% to about 20 mol%, a cationic lipid in an amount of about 0.5 mol% to about 50 mol%, and a fusogenic lipid and a detergent, to provide a nucleic acid-lipid-detergent mixture; and then dialyzing the nucleic acid-lipid-detergent mixture against a buffered salt solution to remove the detergent and to encapsulate the nucleic acid in a lipid bilayer carrier and provide a lipid bilayer- nucleic acid composition, wherein the buffered salt solution has an ionic strength sufficient to encapsulate of from about 40 % to about 80 % of the nucleic acid, described in WO1999018933 to Cullis et al., the contents of which are incorporated herein by reference in their entirety. [000181] In one embodiment, the saRNA of the present disclosure may be formulated in a nucleic acid-lipid particle capable of selectively targeting the saRNA to a heart, liver, or tumor tissue site. For example, the nucleic acid-lipid particle may comprise (a) a nucleic acid; (b) 1.0 mole % to 45 mole % of a cationic lipid; (c) 0,0 mole % to 90 mole % of another lipid; (d) 1,0mole % to 10 mole % of a bilayer stabilizing component; (e) 0,0 mole % to 60 mole % cholesterol; and (f) 0,0 mole % to 10 mole % of cationic polymer lipid as described in EP1328254 to Cullis et al., the contents of which are incorporated herein by reference in their entirety. Cullis teaches that varying the amount of each of the cationic lipid, bilayer stabilizing component, another lipid, cholesterol, and cationic polymer lipid can impart tissue selectivity for heart, liver, or tumor tissue site, thereby identifying a nucleic acid-lipid particle capable of selectively targeting a nucleic acid to the heart, liver, or tumor tissue site.Polymers, Biodegradable Nanoparticles, and Core-Shell Nanoparticles[000182] The saRNA of the disclosure can be formulated using natural and / or synthetic polymers. Non-limiting examples of polymers which may be used for delivery include, but are not limited to, DYNAMIC POLYCONJUGATE® (Arrowhead Research Corp., Pasadena, CA) formulations from MIRUS® Bio (Madison, WI) and Roche Madison (Madison, WI), PHASERX™ polymer formulations such as, without limitation, SMARTT POLYMER TECHNOLOGY™ (PHASERX®, Seattle, WA), DMRI / DOPE, poloxamer, VAXFECTIN® adjuvant from Vical (San Diego, CA), chitosan, cyclodextrin from Calando Pharmaceuticals (Pasadena, CA), dendrimers and poly(lactic-co-glycolic acid) (PLGA) polymers. RONDEL™ (RNAi / Oligonucleotide Nanoparticle Delivery) polymers (Arrowhead Research Corporation, Pasadena, CA) and pH responsive co-block polymers such as, but not limited to, PHASERX® (Seattle, WA).[000183] Polymer formulations can also be selectively targeted through expression of different ligands as exemplified by, but not limited by, folate, transferrin, and N-acetylgalactosamine (GalNAc) (Benoit et al., Biomacromolecules. 2011 12:2708-2714; Rozema et al., Proc Natl Acad Sci U S A. 2007 104: 12982-12887; Davis, Mol Pharm. 2009 6:659-668; Davis, Nature 2010 464: 1067-1070; each of which is herein incorporated by reference in its entirety).[000184] The saRNA of the disclosure may be formulated with or in a polymeric compound. The polymer may include at least one polymer such as, but not limited to, polyethenes, polyethylene glycol (PEG), poly(l-lysine)(PLL), PEG grafted to PLL, cationic lipopolymer, biodegradable cationic lipopolymer, polyethyleneimine (PEI), cross-linked branched poly(alkylene imines), a polyamine derivative, a modified poloxamer, a biodegradable polymer, elastic biodegradable polymer, biodegradable block copolymer, biodegradable random copolymer, biodegradable polyester copolymer, biodegradable polyester block copolymer, biodegradable polyester block random copolymer, multiblock copolymers, linear biodegradable copolymer, poly[a-(4-aminobutyl)-L-glycolic acid) (PAGA), biodegradable cross-linked cationic multi-block copolymers, polycarbonates, polyanhydrides, polyhydroxyacids,polypropylfumerates, polycaprolactones, polyamides, polyacetals, polyethers, polyesters, poly(orthoesters), polycyanoacrylates, polyvinyl alcohols, polyurethanes, polyphosphazenes, polyacrylates, polymethacrylates, polycyanoacrylates, polyureas, polystyrenes, polyamines, polylysine, poly(ethylene imine), poly(serine ester), poly(L-lactide-co-L-lysine), poly(4- hydroxy-L-proline ester), acrylic polymers, amine-containing polymers, dextran polymers, dextran polymer derivatives or combinations thereof.[000185] As a non-limiting example, the saRNA of the disclosure may be formulated with the polymeric compound of PEG grafted with PLL as described in U.S. Pat. No. 6,177,274; herein incorporated by reference in its entirety. The formulation may be used for transfecting cells in vitro or for in vivo delivery of the saRNA. In another example, the saRNA may be suspended in a solution or medium with a cationic polymer, in a dry pharmaceutical composition or in a solution that is capable of being dried as described in U.S. Pub. Nos. 20090042829 and 20090042825; each of which are herein incorporated by reference in their entireties.[000186] As another non-limiting example the saRNA of the disclosure may be formulated with a PLGA-PEG block copolymer (see US Pub. No. US20120004293 and US Pat No. 8,236,330, herein incorporated by reference in their entireties) or PLGA-PEG-PLGA block copolymers (See U.S. Pat. No. 6,004,573, herein incorporated by reference in its entirety). As a non-limiting example, the saRNA of the disclosure may be formulated with a diblock copolymer of PEG and PLA or PEG and PLGA (see US Pat No 8,246,968, herein incorporated by reference in its entirety).[000187] A polyamine derivative may be used to deliver nucleic acids or to treat and / or prevent a disease or to be included in an implantable or injectable device (U.S. Pub. No. 20100260817 herein incorporated by reference in its entirety). As a non-limiting example, a pharmaceutical composition may include the saRNA and the polyamine derivative described in U.S. Pub. No. 20100260817 (the contents of which are incorporated herein by reference in its entirety. As a non-limiting example the saRNA of the present disclosure may be delivered using a polyaminde polymer such as, but not limited to, a polymer comprising a 1,3-dipolar addition polymer prepared by combining a carbohydrate diazide monomer with a dilkyne unite comprising oligoamines (U.S. Pat. No. 8,236,280; herein incorporated by reference in its entirety).[000188] In one embodiment, the lipid nanoparticles may comprise a core of the saRNA disclosed herein and a polymer shell. The polymer shell may be any of the polymers described herein and are known in the art. In an additional embodiment, the polymer shell may be used to protect the modified nucleic acids in the core.[000189] Core-shell nanoparticles for use with the saRNA of the present disclosure may be formed by the methods described in U.S. Pat. No. 8,313,777 herein incorporated by reference in its entirety.[000190] In one embodiment, the core-shell nanoparticles may comprise a core of the saRNA disclosed herein and a polymer shell. The polymer shell may be any of the polymers described herein and are known in the art. In an additional embodiment, the polymer shell may be used to protect the saRNA in the core. As a non-limiting example, the core-shell nanoparticle may be used to treat an eye disease or disorder (See e.g. US Publication No. 20120321719, herein incorporated by reference in its entirety).[000191] In one embodiment, the polymer used with the formulations described herein may be a modified polymer (such as, but not limited to, a modified polyacetal) as described in International Publication No. WO2011120053, herein incorporated by reference in its entirety. Delivery[000192] The present disclosure encompasses the delivery of saRNA for any of therapeutic, prophylactic, pharmaceutical, diagnostic or imaging by any appropriate route taking into consideration likely advances in the sciences of drug delivery. Delivery may be naked or formulated.[000193] The saRNA of the present disclosure may be delivered to a cell naked. As used herein in, “naked” refers to delivering saRNA free from agents which promote transfection. For example, the saRNA delivered to the cell may contain no modifications. The naked saRNA may be delivered to the cell using routes of administration known in the art and described herein.[000194] The saRNA of the present disclosure may be formulated, using the methods described herein. The formulations may contain saRNA which may be modified and / or unmodified. The formulations may further include, but are not limited to, cell penetration agents, a pharmaceutically acceptable carrier, a delivery agent, a bioerodible or biocompatible polymer, a solvent, and a sustained-release delivery depot. The formulated saRNA may be delivered to the cell using routes of administration known in the art and described herein.[000195] The compositions may also be formulated for direct delivery to an organ or tissue in any of several ways in the art including, but not limited to, direct soaking or bathing, via a catheter, by gels, powder, ointments, creams, gels, lotions, and / or drops, by using substrates such as fabric or biodegradable materials coated or impregnated with the compositions, and the like. The saRNA of the present disclosure may also be cloned into a retroviral replicating vector (RRV) and transduced to cells.Administration[000196] The saRNA of the present disclosure may be administered by any route which results in a therapeutically effective outcome. These include, but are not limited to enteral, gastroenteral, epidural, oral, transdermal, epidural (peridural), intracerebral (into the cerebrum), intracerebroventricular (into the cerebral ventricles), epicutaneous (application onto the skin), intradermal, (into the skin itself), subcutaneous (under the skin), nasal administration (through the nose), intravenous (into a vein), intraarterial (into an artery), intramuscular (into a muscle), intracardiac (into the heart), intraosseous infusion (into the bone marrow), intrathecal (into the spinal canal), intraperitoneal, (infusion or injection into the peritoneum), intravesical infusion, intravitreal (through the eye), intracavemous injection ( into the base of the penis), intravaginal administration, intrauterine, extra-amniotic administration, transdermal (diffusion through the intact skin for systemic distribution), transmucosal (diffusion through a mucous membrane), insufflation (snorting), sublingual, sublabial, enema, eye drops (onto the conjunctiva), or in ear drops. In specific embodiments, compositions may be administered in a way which allows them cross the blood-brain barrier, vascular barrier, or other epithelial barrier. Routes of administration disclosed in International Publication WO 2013 / 090648 filed December 14, 2012, the contents of which are incorporated herein by reference in their entirety, may be used to administer the saRNA of the present disclosure.[000197] In some embodiments, the saRNAs of the present disclosure are delivered via intraocular (such as intracameral, intravitreal or subretinal), topical, subconjunctival, periocular, or retrobulbar routes.Dosage Forms[000198] A pharmaceutical composition described herein can be formulated into a dosage form described herein, such as a topical, intranasal, intratracheal, or injectable (e.g., intravenous, intraocular, intravitreal, intramuscular, intracardiac, intraperitoneal, subcutaneous). Liquid dosage forms, injectable preparations, pulmonary forms, and solid dosage forms described in International Publication WO 2013 / 090648 filed December 14, 2012, the contents of which are incorporated herein by reference in their entirety may be used as dosage forms for the saRNA of the present disclosure.III. Methods of Use[000199] One aspect of the present disclosure provides methods of using saRNA of the present disclosure and pharmaceutical compositions comprising the saRNA and at least one pharmaceutically acceptable carrier. The saRNA of the present disclosure modulates the expression of its target gene. In one embodiment is provided a method of regulating theexpression of a target gene in vitro and / or in vivo comprising administering the saRNA of the present disclosure. In one embodiment, the expression of the target gene is increased by at least 5, 10, 20, 30, 40%, or at least 45, 50, 55, 60, 65, 70, 75%, or at least 80% in the presence of the saRNA of the present disclosure compared to the expression of the target gene in the absence of the saRNA of the present disclosure. In a further embodiment, the expression of the target gene is increased by a factor of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or by a factor of at least 15, 20, 25, 30, 35, 40, 45, 50, or by a factor of at least 60, 70, 80, 90, 100, in the presence of the saRNA of the present disclosure compared to the expression of the target gene in the absence of the saRNA of the present disclosure.HBG1 and HBG2 genes[000200] Hemoglobinopathies affect 7% of the world’s population, with severe forms, such as Sickle Cell Disease (SCD), affecting a large number of newborns each year. Sickle cell disease is caused by a mutation in the hemoglobin subunit beta (HBB) gene that lead to red blood cell deformation under hypoxic conditions. Beta-thalassemia is also caused by mutations in the HBB gene that reduce its production leading to low levels of haemoglobin. Both conditions cause significant morbidity and mortality. Expression of a fetal form of haemoglobin can compensate for the loss of HBB function. Haemoglobin y (HBG1 / 2) is part of the fetal haemoglobin tetramer (HbF: a2y2) and its expression is silenced in adults through the action of transcription factors and epigenetic effectors. The reactivation of HbF is a promising means to treat hemoglobinopathies. Fitzhugh et al. previously reported that inducing HbF to 30% of total haemoglobin protein in at least 20% of erythroid progenitors has been correlated with a functional cure for SCD patients (Fitzhugh et al., Blood, voll30(17): 1946-1948, (2017)).[000201] One aspect of the present application provides a method of modulating the expression of the HBG1 and / or HBG2 gene comprising administering saRNAs of the present disclosure. In one embodiment, the expression of the HBG1 and / or HBG2 gene is increased by at least 20, 30, 40%, or at least 45, 50, 55, 60, 65, 70, 75%, or at least 80% in the presence of the saRNAs of the present disclosure compared to the expression of the gene in the absence of the saRNAs of the present disclosure. In a further embodiment, the expression of the HBG1 and / or HBG2 gene is increased by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150%, or by a factor of at least 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.5, 3, 4, 5, 6, 7, 8, 9, 10, or by a factor of at least 15, 20, 25, 30, 35, 40, 45, 50, or by a factor of at least 60, 70, 80, 90, 100, in the presence of the saRNAs of the present disclosure compared to the expression of the gene in the absence of the saRNAs of the present disclosure. In some embodiments, the expression of the HBG1 and / or HBG2 gene is increased by a factor of around1.5-2.5. In some embodiments, the expression of the HBG1 and / or HBG2 gene is increased by at least 2 folds. In some embodiments, the expression of the HBG1 and / or HBG2 gene is increased between 2-5 folds. The modulation of the expression of the HBG1 and / or HBG2 gene may be reflected or determined by the change of the HBG1 mRNA and / or HBG2 mRNA and / or HBG1 protein and / or HBG2 protein levels. In some embodiments, both the expressions of HBG1 and HBG2 genes are increased by saRNAs of the present disclosure. In some cases, the total expression of the HBG1 and HBG2 genes is increased by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150%, or by a factor of at least 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.5, 3, 4, 5, 6, 7, 8, 9, 10, or by a factor of at least 15, 20, 25, 30, 35, 40, 45, 50, or by a factor of at least 60, 70, 80, 90, 100, in the presence of the saRNAs of the present disclosure compared to the total expression of the HBG1 and HBG2 genes in the absence of the saRNAs of the present disclosure. In some embodiments, the expression of the HBB gene is not increased. In some embodiments, the ratio of the total expression of the HBG1 and HBG2 genes to the HBB gene expression level is larger than 1. [000202] Another aspect of the present application provides a method of increasing the HbF protein levels in cells of a subject comprising administering saRNAs of the present disclosure. In some embodiments, the cells are progenitor cells, such as but not limited to erythroid progenitor cells. In some embodiments, the cells are haematopoietic stem cells, such as but not limited to CD34+ haematopoietic stem cells. In some embodiments, HbF protein levels are increased by at least 1.5 folds. In some embodiments, HbF protein levels are increased by at least 2 folds. In some embodiments, HbF protein levels are increased between 2-5 folds. In some embodiments, HbF protein levels are increased to more than 10% of total haemoglobin protein. In some embodiments, HbF protein levels are increased to more than 20% of total haemoglobin protein. In some embodiments, HbF protein levels are increased to around 30% of total haemoglobin protein in at least 20% of erythroid progenitor cells. In some embodiments, the subject receives treatment with hydroxyurea (HU) before treatment with saRNAs of the present disclosure. [000203] Yet another aspect of the present application provides a method of treating SCD or beta-thalassemia in a subject in need thereof comprising administering saRNAs of the present disclosure to the patients. In some embodiments, saRNAs of the present disclosure may be administered via intravenous (I.V.) infusion or I.V. injection. In some embodiments, the subject receives treatment with hydroxyurea (HU) before treatment with saRNAs of the present disclosure.IV. Kits and DevicesKits[000204] The disclosure provides a variety of kits for conveniently and / or effectively carrying out methods of the present disclosure. Typically, kits will comprise sufficient amounts and / or numbers of components to allow a user to perform multiple treatments of a subject(s) and / or to perform multiple experiments.[000205] In one embodiment, the present disclosure provides kits for regulate the expression of genes in vitro or in vivo, comprising saRNA of the present disclosure or a combination of saRNA of the present disclosure, saRNA modulating other genes, siRNAs, miRNAs or other oligonucleotide molecules.[000206] The kit may further comprise packaging and instructions and / or a delivery agent to form a formulation composition. The delivery agent may comprise a saline, a buffered solution, a lipidoid, a dendrimer or any delivery agent disclosed herein.[000207] In one non-limiting example, the buffer solution may include sodium chloride, calcium chloride, phosphate and / or EDTA. In another non-limiting example, the buffer solution may include, but is not limited to, saline, saline with 2mM calcium, 5% sucrose, 5% sucrose with 2mM calcium, 5% Mannitol, 5% Mannitol with 2mM calcium, Ringer’s lactate, sodium chloride, sodium chloride with 2mM calcium and mannose (See U.S. Pub. No. 20120258046; herein incorporated by reference in its entirety). In yet another non-limiting example, the buffer solutions may be precipitated or it may be lyophilized. The amount of each component may be varied to enable consistent, reproducible higher concentration saline or simple buffer formulations. The components may also be varied in order to increase the stability of saRNA in the buffer solution over a period of time and / or under a variety of conditions.Devices[000208] The present disclosure provides for devices which may incorporate saRNA of the present disclosure. These devices contain in a stable formulation available to be immediately delivered to a subject in need thereof, such as a human patient.[000209] Non-limiting examples of the devices include a pump, a catheter, a needle, a transdermal patch, a pressurized olfactory delivery device, iontophoresis devices, multi-layered microfluidic devices. The devices may be employed to deliver saRNA of the present disclosure according to single, multi- or split-dosing regiments. The devices may be employed to deliver saRNA of the present disclosure across biological tissue, intradermal, subcutaneously, or intramuscularly. More examples of devices suitable for delivering oligonucleotides are disclosedin International Publication WO 2013 / 090648 filed December 14, 2012, the contents of which are incorporated herein by reference in their entirety.Definitions[000210] For convenience, the meaning of certain terms and phrases used in the specification, examples, and appended claims, are provided below. If there is an apparent discrepancy between the usage of a term in other parts of this specification and its definition provided in this section, the definition in this section shall prevail.[000211] About: As used herein, the term “about” means + / - 10% of the recited value.[000212] Administered in combination: As used herein, the term “administered in combination” or “combined administration” means that two or more agents are administered to a subject at the same time or within an interval such that there may be an overlap of an effect of each agent on the patient. In some embodiments, they are administered within about 60, 30, 15, 10, 5, or 1 minute of one another. In some embodiments, the administrations of the agents are spaced sufficiently close together such that a combinatorial (e.g., a synergistic) effect is achieved.[000213] Amino acid: As used herein, the terms "amino acid" and "amino acids" refer to all naturally occurring L-alpha-amino acids. The amino acids are identified by either the one-letter or three-letter designations as follows: aspartic acid (Asp:D), isoleucine (Ile:I), threonine (Thr:T), leucine (Leu:L), serine (Ser:S), tyrosine (Tyr:Y), glutamic acid (Glu:E), phenylalanine (Phe:F), proline (Pro:P), histidine (His:H), glycine (Gly:G), lysine (Lys:K), alanine (Ala:A), arginine (Arg:R), cysteine (Cys:C), tryptophan (Trp:W), valine (Val:V), glutamine (Gln:Q) methionine (Met:M), asparagines (Asn:N), where the amino acid is listed first followed parenthetically by the three and one letter codes, respectively.[000214] Animal: As used herein, the term “animal” refers to any member of the animal kingdom. In some embodiments, “animal” refers to humans at any stage of development. In some embodiments, “animal” refers to non-human animals at any stage of development. In certain embodiments, the non-human animal is a mammal (e.g., a rodent, a mouse, a rat, a rabbit, a monkey, a dog, a cat, a sheep, cattle, a primate, or a pig). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, and worms. In some embodiments, the animal is a transgenic animal, genetically-engineered animal, or a clone.[000215] Approximately: As used herein, the term “approximately” or “about,” as applied to one or more values of interest, refers to a value that is similar to a stated reference value. In certain embodiments, the term “approximately” or “about” refers to a range of values that fallwithin 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value).[000216] Associated with: As used herein, the terms “associated with,” “conjugated,” “linked,” “attached,” and “tethered,” when used with respect to two or more moieties, means that the moieties are physically associated or connected with one another, either directly or via one or more additional moieties that serves as a linking agent, to form a structure that is sufficiently stable so that the moieties remain physically associated under the conditions in which the structure is used, e.g., physiological conditions. An “association” need not be strictly through direct covalent chemical bonding. It may also suggest ionic or hydrogen bonding or a hybridization based connectivity sufficiently stable such that the “associated” entities remain physically associated.[000217] Biologically active'. As used herein, the phrase “biologically active” refers to a characteristic of any substance that has activity in a biological system and / or organism. For instance, a substance that, when administered to an organism, has a biological effect on that organism, is considered to be biologically active. In particular embodiments, the saRNA of the present disclosure may be considered biologically active if even a portion of the saRNA is biologically active or mimics an activity considered biologically relevant.[000218] Chromosome: As used herein, the term “chromosome” refers to an organized structure of DNA and protein found in cells.[000219] Complementary: As used herein, the term “complementary” as it relates to nucleic acids refers to hybridization or base pairing between nucleotides or nucleic acids, such as, for example, between the two strands of a double-stranded DNA molecule or between an oligonucleotide probe and a target are complementary.[000220] Condition: As used herein, the term “condition” refers to the status of any cell, organ, organ system or organism. Conditions may reflect a disease state or simply the physiologic presentation or situation of an entity. Conditions may be characterized as phenotypic conditions such as the macroscopic presentation of a disease or genotypic conditions such as the underlying gene or protein expression profiles associated with the condition. Conditions may be benign or malignant.[000221] Delivery: As used herein, “delivery” refers to the act or manner of delivering a compound, substance, entity, moiety, cargo or payload.[000222] Delivery Agent. As used herein, “delivery agent” refers to any substance which facilitates, at least in part, the in vivo delivery of a saRNA of the present disclosure to targeted cells.[000223] Destabilized: As used herein, the term “destable,” “destabilize,” or “destabilizing region” means a region or molecule that is less stable than a starting, wild-type or native form of the same region or molecule.[000224] Equivalent subject: As used herein, “equivalent subject" may be e.g. a subject of similar age, sex and health such as liver health or cancer stage, or the same subject prior to treatment according to the disclosure. The equivalent subject is "untreated" in that he does not receive treatment with a saRNA according to the disclosure. However, he may receive a conventional anti-cancer treatment, provided that the subject who is treated with the saRNA of the disclosure receives the same or equivalent conventional anti-cancer treatment.[000225] Exosome: As used herein, “exosome” is a vesicle secreted by mammalian cells.[000226] Expression'. As used herein, “expression” of a nucleic acid sequence refers to one or more of the following events: (1) production of an RNA template from a DNA sequence (e.g., by transcription); (2) processing of an RNA transcript (e.g., by splicing, editing, 5’ cap formation, and / or 3’ end processing); (3) translation of an RNA into a polypeptide or protein; and (4) post-translational modification of a polypeptide or protein.[000227] Feature: As used herein, a “feature” refers to a characteristic, a property, or a distinctive element.[000228] Formulation'. As used herein, a “formulation” includes at least one saRNA of the present disclosure and a delivery agent.[000229] Fragment: A “fragment,” as used herein, refers to a portion. For example, fragments of proteins may comprise polypeptides obtained by digesting full-length protein isolated from cultured cells. Fragments of oligonucleotides may comprise nucleotides, or regions of nucleotides.[000230] Functional'. As used herein, a “functional” biological molecule is a biological molecule in a form in which it exhibits a property and / or activity by which it is characterized. [000231] Gene: As used herein, the term "gene" refers to a nucleic acid sequence that comprises control and most often coding sequences necessary for producing a polypeptide or precursor. Genes, however, may not be translated and instead code for regulatory or structural RNA molecules.[000232] A gene may be derived in whole or in part from any source known to the art, including a plant, a fungus, an animal, a bacterial genome or episome, eukaryotic, nuclear orplasmid DNA, cDNA, viral DNA, or chemically synthesized DNA. A gene may contain one or more modifications in either the coding or the untranslated regions that could affect the biological activity or the chemical structure of the expression product, the rate of expression, or the manner of expression control. Such modifications include, but are not limited to, mutations, insertions, deletions, and substitutions of one or more nucleotides. The gene may constitute an uninterrupted coding sequence or it may include one or more introns, bound by the appropriate splice junctions.[000233] Gene expression: As used herein, the term "gene expression" refers to the process by which a nucleic acid sequence undergoes successful transcription and in most instances translation to produce a protein or peptide. For clarity, when reference is made to measurement of “gene expression”, this should be understood to mean that measurements may be of the nucleic acid product of transcription, e.g., RNA or mRNA or of the amino acid product of translation, e.g., polypeptides or peptides. Methods of measuring the amount or levels of RNA, mRNA, polypeptides and peptides are well known in the art.[000234] Genome: The term "genome" is intended to include the entire DNA complement of an organism, including the nuclear DNA component, chromosomal or extrachromosomal DNA, as well as the cytoplasmic domain (e.g., mitochondrial DNA).[000235] Homology. As used herein, the term “homology” refers to the overall relatedness between polymeric molecules, e.g. between nucleic acid molecules (e.g. DNA molecules and / or RNA molecules) and / or between polypeptide molecules. In some embodiments, polymeric molecules are considered to be “homologous” to one another if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical or similar. The term “homologous” necessarily refers to a comparison between at least two sequences (polynucleotide or polypeptide sequences). In accordance with the disclosure, two polynucleotide sequences are considered to be homologous if the polypeptides they encode are at least about 50%, 60%, 70%, 80%, 90%, 95%, or even 99% for at least one stretch of at least about 20 amino acids. In some embodiments, homologous polynucleotide sequences are characterized by the ability to encode a stretch of at least 4-5 uniquely specified amino acids. For polynucleotide sequences less than 60 nucleotides in length, homology is determined by the ability to encode a stretch of at least 4-5 uniquely specified amino acids. In accordance with the disclosure, two protein sequences are considered to be homologous if the proteins are at least about 50%, 60%, 70%, 80%, or 90% identical for at least one stretch of at least about 20 amino acids.[000236] Identity. As used herein, the term “identity” refers to the overall relatedness between polymeric molecules, e.g., between oligonucleotide molecules (e.g. DNA molecules and / or RNA molecules) and / or between polypeptide molecules. Calculation of the percent identity of two polynucleotide sequences, for example, can be performed by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second nucleic acid sequences for optimal alignment and non-identical sequences can be disregarded for comparison purposes). In certain embodiments, the length of a sequence aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100% of the length of the reference sequence. The nucleotides at corresponding nucleotide positions are then compared. When a position in the first sequence is occupied by the same nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which needs to be introduced for optimal alignment of the two sequences. The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. For example, the percent identity between two nucleotide sequences can be determined using methods such as those described in Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; Computer Analysis of Sequence Data, Part I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey, 1994; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991; each of which is incorporated herein by reference. For example, the percent identity between two nucleotide sequences can be determined using the algorithm of Meyers and Miller (CABIOS, 1989, 4: 11-17), which has been incorporated into the ALIGN program (version 2.0) using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4. The percent identity between two nucleotide sequences can, alternatively, be determined using the GAP program in the GCG software package using an NWSgapdna.CMP matrix. Methods commonly employed to determine percent identity between sequences include, but are not limited to those disclosed in Carillo, H., and Lipman, D., SIAM J Applied Math., 48: 1073 (1988); incorporated herein by reference. Techniques for determining identity are codified in publicly available computer programs. Exemplary computer software to determine homology between two sequences include, but are not limited to, GCG program package, Devereux, J., et al. , Nucleic Acids Research, 12(1), 387(1984)), BLASTP, BLASTN, and FASTA Altschul, S. F. et al., J. Molec. Biol., 215, 403 (1990)).[000237] Inhibit expression of a gene: As used herein, the phrase “inhibit expression of a gene” means to cause a reduction in the amount of an expression product of the gene. The expression product can be an RNA transcribed from the gene (e.g., an mRNA) or a polypeptide translated from an mRNA transcribed from the gene. Typically a reduction in the level of an mRNA results in a reduction in the level of a polypeptide translated therefrom. The level of expression may be determined using standard techniques for measuring mRNA or protein. [000238] In vitro'. As used herein, the term “in vitro" refers to events that occur in an artificial environment, e.g., in a test tube or reaction vessel, in cell culture, in a Petri dish, etc., rather than within an organism (e.g., animal, plant, or microbe).[000239] In vivo'. As used herein, the term “in vivo" refers to events that occur within an organism (e.g., animal, plant, or microbe or cell or tissue thereof).[000240] Isolated. As used herein, the term “isolated” refers to a substance or entity that has been separated from at least some of the components with which it was associated (whether in nature or in an experimental setting). Isolated substances may have varying levels of purity in reference to the substances from which they have been associated. Isolated substances and / or entities may be separated from at least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or more of the other components with which they were initially associated. In some embodiments, isolated agents are more than about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or more than about 99% pure. As used herein, a substance is “pure” if it is substantially free of other components. Substantially isolated'. By “substantially isolated” is meant that the compound is substantially separated from the environment in which it was formed or detected. Partial separation can include, for example, a composition enriched in the compound of the present disclosure. Substantial separation can include compositions containing at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, or at least about 99% by weight of the compound of the present disclosure, or salt thereof. Methods for isolating compounds and their salts are routine in the art.[000241] Modified: As used herein “modified” refers to a changed state or structure of a molecule of the disclosure. Molecules may be modified in many ways including chemically, structurally, and functionally. In one embodiment, the saRNAs of the present disclosure are modified by the introduction of non-natural nucleosides and / or nucleotides.[000242] Naturally occurring: As used herein, “naturally occurring” means existing in nature without artificial aid.[000243] Nucleic acid: The term "nucleic acid" as used herein, refers to a molecule comprised of one or more nucleotides, i.e., ribonucleotides, deoxyribonucleotides, or both. The term includes monomers and polymers of ribonucleotides and deoxyribonucleotides, with the ribonucleotides and / or deoxyribonucleotides being bound together, in the case of the polymers, via 5' to 3' linkages. The ribonucleotide and deoxyribonucleotide polymers may be single or double-stranded. However, linkages may include any of the linkages known in the art including, for example, nucleic acids comprising 5' to 3' linkages. The nucleotides may be naturally occurring or may be synthetically produced analogs that are capable of forming base-pair relationships with naturally occurring base pairs. Examples of non-naturally occurring bases that are capable of forming base-pairing relationships include, but are not limited to, aza and deaza pyrimidine analogs, aza and deaza purine analogs, and other heterocyclic base analogs, wherein one or more of the carbon and nitrogen atoms of the pyrimidine rings have been substituted by heteroatoms, e.g., oxygen, sulfur, selenium, phosphorus, and the like.[000244] Patient: As used herein, “patient” refers to a subject who may seek or be in need of treatment, requires treatment, is receiving treatment, will receive treatment, or a subject who is under care by a trained professional for a particular disease or condition.[000245] Peptide: As used herein, “peptide” is less than or equal to 50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long.[000246] Pharmaceutically acceptable'. The phrase “pharmaceutically acceptable” is employed herein to refer to those compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.[000247] Pharmaceutically acceptable excipients: The phrase “pharmaceutically acceptable excipient,” as used herein, refers any ingredient other than the compounds described herein (for example, a vehicle capable of suspending or dissolving the active compound) and having the properties of being substantially nontoxic and non-inflammatory in a patient. Excipients may include, for example: anti adherents, antioxidants, binders, coatings, compression aids, disintegrants, dyes (colors), emollients, emulsifiers, fillers (diluents), film formers or coatings, flavors, fragrances, glidants (flow enhancers), lubricants, preservatives, printing inks, sorbents, suspensing or dispersing agents, sweeteners, and waters of hydration. Exemplary excipients include, but are not limited to: butylated hydroxytoluene (BHT), calcium carbonate, calciumphosphate (dibasic), calcium stearate, croscarmellose, crosslinked polyvinyl pyrrolidone, citric acid, crospovidone, cysteine, ethylcellulose, gelatin, hydroxypropyl cellulose, hydroxypropyl methylcellulose, lactose, magnesium stearate, maltitol, mannitol, methionine, methylcellulose, methyl paraben, microcrystalline cellulose, polyethylene glycol, polyvinyl pyrrolidone, povidone, pregelatinized starch, propyl paraben, retinyl palmitate, shellac, silicon dioxide, sodium carboxymethyl cellulose, sodium citrate, sodium starch glycolate, sorbitol, starch (corn), stearic acid, sucrose, talc, titanium dioxide, vitamin A, vitamin E, vitamin C, and xylitol. [000248] Pharmaceutically acceptable salts'. The present disclosure also includes pharmaceutically acceptable salts of the compounds described herein. As used herein, “pharmaceutically acceptable salts” refers to derivatives of the disclosed compounds wherein the parent compound is modified by converting an existing acid or base moiety to its salt form (e.g., by reacting the free base group with a suitable organic acid). Examples of pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts of basic residues such as amines; alkali or organic salts of acidic residues such as carboxylic acids; and the like. Representative acid addition salts include acetate, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethanesulfonate, fumarate, glucoheptonate, glycerophosphate, hemisulfate, heptonate, hexanoate, hydrobromide, hydrochloride, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3 -phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, toluenesulfonate, undecanoate, valerate salts, and the like. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like, as well as nontoxic ammonium, quaternary ammonium, and amine cations, including, but not limited to ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, ethylamine, and the like. The pharmaceutically acceptable salts of the present disclosure include the conventional non-toxic salts of the parent compound formed, for example, from non-toxic inorganic or organic acids. The pharmaceutically acceptable salts of the present disclosure can be synthesized from the parent compound which contains a basic or acidic moiety by conventional chemical methods. Generally, such salts can be prepared by reacting the free acid or base forms of these compounds with a stoichiometric amount of the appropriate base or acid in water or in an organic solvent, or in a mixture of the two; generally, nonaqueous media like ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are preferred. Lists of suitable saltsare found in Remington ’s Pharmaceutical Sciences, 17thed., Mack Publishing Company, Easton, Pa., 1985, p. 1418, Pharmaceutical Salts: Properties, Selection, and Use, P.H. Stahl and C.G. Wermuth (eds.), Wiley-VCH, 2008, and Berge et al., Journal of Pharmaceutical Science, 66, 1-19 (1977), each of which is incorporated herein by reference in its entirety.[000249] Pharmaceutically acceptable solvate'. The term “pharmaceutically acceptable solvate,” as used herein, means a compound of the disclosure wherein molecules of a suitable solvent are incorporated in the crystal lattice. A suitable solvent is physiologically tolerable at the dosage administered. For example, solvates may be prepared by crystallization, recrystallization, or precipitation from a solution that includes organic solvents, water, or a mixture thereof. Examples of suitable solvents are ethanol, water (for example, mono-, di-, and tri-hydrates), A-methylpyrrolidinone (NMP), dimethyl sulfoxide (DMSO), N,N’- dimethylformamide (DMF), 7V,7V’-dimethylacetamide (DMAC), l,3-dimethyl-2-imidazolidinone (DMEU), l,3-dimethyl-3,4,5,6-tetrahydro-2-(lH)-pyrimidinone (DMPU), acetonitrile (ACN), propylene glycol, ethyl acetate, benzyl alcohol, 2-pyrrolidone, benzyl benzoate, and the like. When water is the solvent, the solvate is referred to as a “hydrate.”[000250] Pharmacologic effect'. As used herein, a “pharmacologic effect” is a measurable biologic phenomenon in an organism or system which occurs after the organism or system has been contacted with or exposed to an exogenous agent. Pharmacologic effects may result in therapeutically effective outcomes such as the treatment, improvement of one or more symptoms, diagnosis, prevention, and delay of onset of disease, disorder, condition or infection. Measurement of such biologic phenomena may be quantitative, qualitative or relative to another biologic phenomenon. Quantitative measurements may be statistically significant. Qualitative measurements may be by degree or kind and may be at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more different. They may be observable as present or absent, better or worse, greater or less. Exogenous agents, when referring to pharmacologic effects are those agents which are, in whole or in part, foreign to the organism or system. For example, modifications to a wild type biomolecule, whether structural or chemical, would produce an exogenous agent. Likewise, incorporation or combination of a wild type molecule into or with a compound, molecule or substance not found naturally in the organism or system would also produce an exogenous agent.[000251] The saRNA of the present disclosure, comprises exogenous agents. Examples of pharmacologic effects include, but are not limited to, alteration in cell count such as an increase or decrease in neutrophils, reticulocytes, granulocytes, erythrocytes (red blood cells), megakaryocytes, platelets, monocytes, connective tissue macrophages, epidermal langerhanscells, osteoclasts, dendritic cells, microglial cells, neutrophils, eosinophils, basophils, mast cells, helper T cells, suppressor T cells, cytotoxic T cells, natural killer T cells, B cells, natural killer cells, or reticulocytes. Pharmacologic effects also include alterations in blood chemistry, pH, hemoglobin, hematocrit, changes in levels of enzymes such as, but not limited to, liver enzymes AST and ALT, changes in lipid profiles, electrolytes, metabolic markers, hormones or other marker or profile known to those of skill in the art.[000252] Physicochemical: As used herein, “physicochemical” means of or relating to a physical and / or chemical property.[000253] Preventing'. As used herein, the term “preventing” refers to partially or completely delaying onset of an infection, disease, disorder and / or condition; partially or completely delaying onset of one or more symptoms, features, or clinical manifestations of a particular infection, disease, disorder, and / or condition; partially or completely delaying onset of one or more symptoms, features, or manifestations of a particular infection, disease, disorder, and / or condition; partially or completely delaying progression from an infection, a particular disease, disorder and / or condition; and / or decreasing the risk of developing pathology associated with the infection, the disease, disorder, and / or condition.[000254] Protein: A "protein" means a polymer of amino acid residues linked together by peptide bonds. The term, as used herein, refers to proteins, polypeptides, and peptides of any size, structure, or function. Typically, however, a protein will be at least 50 amino acids long. In some instances the protein encoded is smaller than about 50 amino acids. In this case, the polypeptide is termed a peptide. If the protein is a short peptide, it will be at least about 10 amino acid residues long. A protein may be naturally occurring, recombinant, or synthetic, or any combination of these. A protein may also comprise a fragment of a naturally occurring protein or peptide. A protein may be a single molecule or may be a multi-molecular complex. The term protein may also apply to amino acid polymers in which one or more amino acid residues are an artificial chemical analogue of a corresponding naturally occurring amino acid. [000255] Protein expression: The term "protein expression" refers to the process by which a nucleic acid sequence undergoes translation such that detectable levels of the amino acid sequence or protein are expressed.[000256] Purified: As used herein, “purify,” “purified,” “purification” means to make substantially pure or clear from unwanted components, material defilement, admixture or imperfection.[000257] Similarity'. As used herein, the term “similarity” refers to the overall relatedness between polymeric molecules, e.g. between polynucleotide molecules (e.g. DNA moleculesand / or RNA molecules) and / or between polypeptide molecules. Calculation of percent similarity of polymeric molecules to one another can be performed in the same manner as a calculation of percent identity, except that calculation of percent similarity takes into account conservative substitutions as is understood in the art.[000258] Split dose'. As used herein, a “split dose” is the division of single unit dose or total daily dose into two or more doses.[000259] Subject: As used herein, the term “subject” or “patient” refers to any organism to which a composition in accordance with the disclosure may be administered, e.g., for experimental, diagnostic, prophylactic, and / or therapeutic purposes. Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans) and / or plants.[000260] Substantially. As used herein, the term “substantially” refers to the qualitative condition of exhibiting total or near-total extent or degree of a characteristic or property of interest. One of ordinary skill in the biological arts will understand that biological and chemical phenomena rarely, if ever, go to completion and / or proceed to completeness or achieve or avoid an absolute result. The term “substantially” is therefore used herein to capture the potential lack of completeness inherent in many biological and chemical phenomena.[000261] Substantially equal'. As used herein as it relates to time differences between doses, the term means plus / minus 2%.[000262] Therapeutic Agent: The term “therapeutic agent” refers to any agent that, when administered to a subject, has a therapeutic, diagnostic, and / or prophylactic effect and / or elicits a desired biological and / or pharmacological effect.[000263] Therapeutically effective amount: As used herein, the term “therapeutically effective amount” means an amount of an agent to be delivered (e.g., nucleic acid, drug, therapeutic agent, diagnostic agent, prophylactic agent, etcf that is sufficient, when administered to a subject suffering from or susceptible to an infection, disease, disorder, and / or condition, to treat, improve symptoms of, diagnose, prevent, and / or delay the onset of the infection, disease, disorder, and / or condition.[000264] Therapeutically effective outcome'. As used herein, the term “therapeutically effective outcome” means an outcome that is sufficient in a subject suffering from or susceptible to an infection, disease, disorder, and / or condition, to treat, improve symptoms of, diagnose, prevent, and / or delay the onset of the infection, disease, disorder, and / or condition.[000265] Transcription factor: As used herein, the term “transcription factor” refers to a DNA- binding protein that regulates transcription of DNA into RNA, for example, by activation orrepression of transcription. Some transcription factors effect regulation of transcription alone, while others act in concert with other proteins. Some transcription factor can both activate and repress transcription under certain conditions. In general, transcription factors bind a specific target sequence or sequences highly similar to a specific consensus sequence in a regulatory region of a target gene. Transcription factors may regulate transcription of a target gene alone or in a complex with itself (as a homodimer) other with other molecules (as a heterodimer). Each of these complex formation is able to induce multiple regulatory function from a single transcription factor.[000266] Treating'. As used herein, the term “treating” refers to partially or completely alleviating, ameliorating, improving, relieving, delaying onset of, inhibiting progression of, reducing severity of, and / or reducing incidence of one or more symptoms or features of a particular infection, disease, disorder, and / or condition.[000267] Unmodified. As used herein, “unmodified” refers to any substance, compound or molecule prior to being changed in any way. Unmodified may, but does not always, refer to the wild type or native form of a biomolecule. Molecules may undergo a series of modifications whereby each modified molecule may serve as the “unmodified” starting molecule for a subsequent modification.Equivalents and Scope[000268] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments in accordance with the disclosure described herein. The scope of the present disclosure is not intended to be limited to the above Description, but rather is as set forth in the appended claims.[000269] In the claims, articles such as “a,” “an,” and “the” may mean one or more than one unless indicated to the contrary or otherwise evident from the context. Claims or descriptions that include “or” between one or more members of a group are considered satisfied if one, more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process unless indicated to the contrary or otherwise evident from the context. The disclosure includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process. The disclosure includes embodiments in which more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process.[000270] It is also noted that the term “comprising” is intended to be open and permits the inclusion of additional elements or steps.[000271] Where ranges are given, endpoints are included. Furthermore, it is to be understood that unless otherwise indicated or otherwise evident from the context and understanding of one of ordinary skill in the art, values that are expressed as ranges can assume any specific value or subrange within the stated ranges in different embodiments of the disclosure, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise.[000272] In addition, it is to be understood that any particular embodiment of the present disclosure that falls within the prior art may be explicitly excluded from any one or more of the claims. Since such embodiments are deemed to be known to one of ordinary skill in the art, they may be excluded even if the exclusion is not set forth explicitly herein. Any particular embodiment of the compositions of the disclosure (e.g., any nucleic acid or protein encoded thereby; any method of production; any method of use; etc.) can be excluded from any one or more claims, for any reason, whether or not related to the existence of prior art.[000273] All cited sources, for example, references, publications, databases, database entries, and art cited herein, are incorporated into this application by reference, even if not expressly stated in the citation. In case of conflicting statements of a cited source and the instant application, the statement in the instant application shall control.[000274] The disclosure is further illustrated by the following non-limiting examples.EXAMPLESMaterials and Procedures:Nucleofection / Transfection of saRNA[000275] The saRNA of the present disclosure may be produced by any suitable method, for example synthetically or by expression in cells using standard molecular biology techniques which are well-known to a person of ordinary skill in the art. For example, the saRNA of the present disclosure may be chemically synthesized or recombinantly produced using methods known in the art.[000276] CD34+ cells isolated from human cord blood or bone marrow are expanded using the StemSpan™ CD34+ Expansion Supplement (STEMCELL Technologies) which contains a combination of recombinant human cytokines and other additives formulated to selectively promote the expansion of CD34+ cells. The StemSpan™ CD34+ Expansion Supplement is used in combination with StemSpan™ Erythroid Expansion Supplement (STEMCELL Technologies). This system is formulated to selectively expand and produce large numbers of human CD34+ hematopoietic cells in liquid cultures initiated with CD34+ cord blood or bone marrow cells.[000277] Sense and antisense strands of saRNA are synthesized. They are first annealed in a Tris-EDTA based buffer following a denaturing step at 90°C, followed by a gradual anneal step to room temperature. In some cases, oligonucleotides were introduced into CD34+ cells by Nucleofection using the 4D-Nucleofector System with the 96-well unit (Lonza). Nucleofections were conducted using the P3 Primary Cell 96-well Nucleofector Kit (Lonza) according to the manufacturer’s instructions. Primary bone marrow-derived CD34+ cells were cultured in expansion medium for 3-6 days before Nucleofection. On the day of Nucleofection, cells were spun down, counted, and resuspended in Nucleofection buffer for a final amount of IxlO5cells and either 500 or 2000nM oligonucleotide per 20pL Nucleofection reaction. Cells without oligonucleotide were also Nucleofected for a mock control. After Nucleofection, cells were resuspended in expansion medium, transferred to a 96-well plate, and incubated at 37°C for 48 hours. In some other cases, cells were seeded at 0.25 to IxlO5per well in a 24-well plate and transfected using Lipofectamine RNAiMax (Thermo Fisher Scientific) Transfection is performed immediately after seeding with 10-20 nM of oligonucleotide using luL of Lipofectamine RNAiMax. Cells were then harvested for analysis 72 hours after seeding.RT-PCR[000278] In some cases, saRNA was Nucleofected into IxlO5cells. Total RNA was harvested post-transfection at 48 hours. Total RNA was isolated using the RNeasy 96 Kit (QIAGEN) following the manufacturer's recommendation with on-column DNase digestion. Relative expression levels were determined by real-time relative PCR using the TaqPath 1-Step Multiplex Master Mix (Thermo Fisher) and TaqMan primers and probes from IDT (POLR2A) or Thermo Fisher Scientific predesigned probes (HBG).[000279] In some other cases, saRNA was transfected into 0.25 to IxlO5cells. Total RNA is harvested post-transfection at 72 hours. Total RNA is recovered using the RNeasy Mini Kit (QIAGEN) following the manufacturer's recommendation. The RNA is quantified using a QIAxpert machine (QIAGEN). 100 ng - 500 ng of total RNA from each sample is reverse transcribed using the QuantiTect RT kit(Qiagen) or SuperScript III RT (Invitrogen) following the manufacturer's recommendation. Relative expression levels were determined by real-time relative PCR using TaqMan primers and probes from IDT (custom HBG1 / HBG2 primers and probes) or Thermo Fisher Scientific predesigned probes (HBB, HBA, BCL11 A and housekeeping genes).Example 1. Upregulation of HB HBG2 gene expression with saRNAs in vitro[000280] In this study, upregulation of HBG1 and / or HBG2 gene expression by saRNA treatment was tested in a range of cells lines that reflected high, medium and low / null HBG expression: K562 (human erythroleukemia): high; NCI-H661 (human lung carcinoma): medium to low; and SK-MEL-30 (human melanoma): background to null levels. HBG1 and / or HBG2 gene expressions were also tested in hCD34+ cells (a marker of human hematopoietic stem cells and all colony -forming activity of human bone marrow (BM) cells). In brief, HBGl-mRNA and / or HBG2-mRNA was measured by RT-qPCR relative to a housekeeper gene (either B2M or HPRT1 depending on the cell line). All samples were normalized to a saRNA oligo control FLUC, which has no known target in the genome. The relative expressions of HBG1 (mean of each biological replicate (n=3)) and HBG2 (mean of each biological replicate (n=3)) in K562, NCI-H661 and SK-MEL-30 cells are shown in Tables 5.1, 5.2 and 5.3 below. The expressions of HBB, as an off target gene, were also measured to make sure the saRNAs were selectively upregulating HBG1 and / or HBG2, not HBB.Table 5.1. Relative expression of HBG1, HBG2 and HBB (relative to B2M) in K562 cells - 72hrTable 5.2. Relative expression of HBG2 and HBB (relative to B2M) in NCI-H661 cells* - 72hr*HBG1 mRNA was not detected in this cell line.Table 5.3. Relative expression of HBG1 and HBG2 (relative to HPRT1) in SK-MEL-30 cells* - 72hr*HBB gene was not expressed in this cell line.[000281] The saRNAs that upregulated HBG1 and / or HBG2 gene expressions were then tested in CD34+ haematopoietic stem cells, as these are the cell types relevant to the treatment of sickle cell disease (SCD) and beta-thalassemia.Example 2. Delivery of saRNAs to Committed Erythroid Progenitor Cells (ErPs) in NonHuman Primates[000282] In some embodiments, saRNAs of the present disclosure are formulated with NOV340 SMARTICLES® liposomes. CEBPA-51 is a saRNA duplex that upregulates C / EBPa. The sequences of the sense and antisense strands of CEBPA-51 are shown in Table 6.Table 6. CEBPA-51 SequencesmU, mG, and mC mean 2’-O-methyl modified U, G, and C. invabasic = inverted abasic sugar cap.[000283] In this study, Cy3-labeled tool saRNA compound (CEBPA-51) was encapsulated inNOV340 SMARTICLES® and was given to cynomolgus monkeys (n=3) at a single dose of 4 mg / kg via I V. injection. Termination happened 24hrs post dose and marrow from hip bone wasanalyzed. As shown in Table 7 below, NOV340 preferentially delivered to committed erythroid progenitor cells (CFU-E / Pro-E).Table 7. Delivery EfficiencyExample 3. Delivery of saRNAs to Bone Marrow in Rodents[000284] In this study, Cy3-labeled tool saRNA compound (CEBPA-51) was encapsulated in NOV340 SMARTICLES® and was given to mice (n=15) at a single dose of 4 mg / kg via I V. injection. Imaging of whole bone marrow using fluorescent microscopy was conducted 2 hours and 24 hours after the treatment. Fluorescence could be seen throughout the bone marrow and inside cells at 2 hours and 24 hours after the treatment. Further, CEBPA-mRNA levels were measured in bulk bone marrow at week 4 after the treatment. CEBPA-mRNA levels were increased compared with the control. This study demonstrated efficient in vivo intracellular delivery of saRNAs in the bone marrow of rodents with NOV340 liposomes.Example 4. Upregulation of HBG1 an&lor HBG2 gene expression with saRNAs in vitro1. mRNA levels:[000285] In this study, upregulation of HBG1 / 2 (i.e., HBG1 and HBG2 may also be referred to as H G) gene expression by saRNA treatment was tested in primary bone marrow-derived CD34+ cells (a marker of human hematopoietic stem cells and all colony -forming activity of human bone marrow (BM) cells). In brief, the total HBGl-mRNA and HBG2-mRNA level (i.e., HBG1 / 2 mRNA or HBG mRNA) was measured by RT-qPCR relative to a housekeeper gene (POLR2A). In brief, a qPCR assay that detects both HBGl-mRNA and HBG2-mRNA was used to measure total HBG1 / 2 mRNA. All samples were normalized to mock Nucleofected cells that contained Nucleofection buffer but no oligo during Nucleofection. The relative expressions of HBG1 / 2 genes (mean of each biological replicate and n number shown) in expanded CD34+ cells are shown in Table 8 below.Table 8. Relative expression of HBG1 / 2 genes (relative to POLR2A) in CD34+ cells - 48hr2. Protein levels:[000286] CD34 cells were nucleofected on expansion day (ED) 6 or ED7 with 2uM oligos and transferred into differentiation media for 7 days (= differentiation day (DD) 7). Otherwise CD34 cells were nucleofected with 2uM oligos on DD3 and collected on DD7. For collection cells were spun down, washed with PBS and then lysed in Permeabilization Buffer. Automated capillary immunoassay (Simple Western) was performed on a Jess system (Protein Simple, San Jose, CA, USA). The target proteins were immune-probed with anti-HBG (Hemoglobin y D4K7X, Cell Signaling Technology Cat No 39386S) or anti-HBB primary antibody (Hemoglobin P D4W4I, Cell Signaling Technology, Cat No 84934S) diluted in antibody diluent (Protein Simple 042-203). Within-capillary total protein normalization was performed to account for any differences in protein loading. Jess operations and peak calculations were performed using the Compass software (ProteinSimple). Relative protein amounts were assessed using the corrected area of chemiluminescent peak.[000287] Ratio of HBG to HBB was calculated dividing the fold of HBG to Mock nucleofected sample for the fold of HBB protein to Mock nucleofected sample. Mock Nucleofected cells contained Nucleofection buffer but no oligo during Nucleofection.[000288] The relative HBG protein fold (mean of each biological replicate and n number shown) in differentiated CD34 cells are shown in Table 9 and 10 below. The relative HBB protein fold (mean of each biological replicate and n number shown) in differentiated CD34cells are shown in Table 11 and 12 below. HBG to HBB fold ratio (mean of each biological replicate and n number shown) in differentiated CD34 cells are shown in Table 13 and 14 below.Table 9. Relative fold expression of HBG protein (relative to mock, normalized to total protein) in CD34 cells - 96hrTable 10. Relative fold expression of HBG protein (relative to mock, normalized to total protein) in CD34 cells - 7 daysTable 11. Relative fold expression of HBB protein (relative to mock, normalized to total protein) in CD34 cells - 96hrTable 12. Relative fold expression of HBB protein (relative to mock, normalized to total protein) in CD34 cells - 7daysTable 13. HBG to HBB fold ratio in CD34 cells - 96hrTable 14. HBG to HBB fold ratio in CD34 cells - 7days[000289] In a further study, activity of HBG2-S8354S-IS was evaluated in primary human erythroid progenitor cells derived from primary human bone-marrow isolated CD34+ cells using a two-phase culture system (expansion followed by erythroid differentiation). Cells were nucleofected with 2pM HBG2-S8354S-IS at day 1 of differentiation. Protein levels of gamma and beta globin were assessed 7 days after by digital Western blot. Negative controls included a nucleofection only control (mock) and an oligo with no human genome homology. Data represent eight independent donors were shown in FIG. 1 A and FIG. IB.[000290] It was observed that HBG2-S8354S-IS induced persistent gamma globin protein induction in human primary erythroid progenitor cells (average=9.4X, range=3.3 to 23X fold), and decreased beta globin protein (average=0.49X, range=0.23 to 0.83X).Example 5. Induction of % HbF and Pancellular HbF with saRNAs in vitro in Comparison with Hydroxyurea[000291] In this study, % HbF induction was measured by HPLC in expanded primary human erythroid progenitor cells after 7 days of differentiation and treatment with either lOmM hydroxyurea (HU) or nucleofection with 2mM HBG2-S8354S-IS, with appropriate controls. % HbF, as used herein, is defined as the HbF protein amount divided by the total haemoglobin protein amount. % HbF levels of cells from three independent donors treated with either HU or HBG2-S8354S-IS are shown in FIG. 2. HBG2-S8354S-IS is superior in inducing HbF (average=3.6X, range 2.7-4.4X), as measured by HPLC, to that achieved with hydroxyurea (HU) (average 1.5X, range 1.2-1.8X). Further, the level of induction achieved exceeds the clinical protective threshold of 20%.[000292] Pancellular HbF is a key attribute for maximum therapeutic effect of HbF induction. Therefore, in another study, HbF expression was measured at a single cell level using antibody clone 2D12 in bone marrow-derived differentiated primary erythroid cells (ErPs) from six independent donors, 7 days after treatment with HU or after nucleofection with HBG2-S8354S- IS. As shown in FIG. 3, HBG2-S8354S-IS induced pancellular HbF that persisted for at least 7 days in ErPs. HU also increased pancellular HbF, albeit non-significantly.Example 6. Pharmacodynamic Activity in Non-Human Primates (NHP)[000293] In this study, pharmacodynamic activity of the composition comprising HBG2- S8354S-IS and NOV340 SMARTICLES® liposomes was assessed in non-human primates (NHP) that had previously undergone phlebotomy and HU treatment to induce HbF cells (pre- saRNA % HbF cell levels are lower in this model than seen in SCD patients). In brief, HBG2- S8354S-IS was formulated within NOV340 liposome particles. Previously phlebotomised cynomologus macaques were dosed with 100 mg / kg of HU orally daily for 5 days (n=3). Two doses of formulated HBG2-S8354S-IS, at 10 mg / kg, were administered intravenously (TV.) 3 days and 10 days post HU.[000294] Pharmacodynamic activity was observed in 2 animals following treatment with formulated HBG2-S8354S-IS. The third animal had a muted response of HbF induction to phlebotomy, HU, and formulated HBG2-S8354S-IS Therefore, saRNAs can be delivered to therapeutically relevant ErP cells in vivo using NOV340 liposome particles. NHP data demonstrates delivery to greater than 60% of committed ErPs and a PD response.OTHER EMBODIMENTS[000295] It is to be understood that while the present disclosure has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the present disclosure, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

Claims1. A synthetic isolated small activating RNA (saRNA) which up-regulates the expression of at least one target gene, wherein the at least one target gene is HBG1 and / or HBG2, and wherein the saRNA comprises at least one chemical modification.

2. The saRNA of claim 1, wherein the saRNA comprises an antisense strand that is at least 80% complement to a targeted sequence located in the transcription start site (TSS) core of the at least one target gene, wherein the TSS core has the sequence of SEQ ID NO: 1 or 2, and wherein the antisense strand has 14-30 nucleotides.

3. The saRNA of claim 2, wherein the target sequence is selected from SEQ ID NOs: 3-70 or SEQ ID NOs: 365-497.

4. The saRNA of claim 2 or 3, wherein the target sequence is located upstream or downstream of TSS.

5. The saRNA of any one of claims 2-4, wherein the target sequence is located between 1500 nucleotides upstream and 800 nucleotides upstream of the TSS, between 1500 nucleotides upstream and 1000 nucleotides upstream of the TSS, or between 2000 nucleotides upstream and 1500 nucleotides upstream of the TSS.

6. The saRNA of any one of claims 2-5, wherein the antisense strand comprises a 3’ overhang.

7. The saRNA of claim 6, wherein the 3’ overhang is mUmU, UU, or UUU.

8. The saRNA of any one of claims 2-7, wherein the antisense strand comprises a sequence selected from SEQ ID NOs: 139-206, 285-362, 631-763, or 907-1049.

9. The saRNA of any one of claims 2-8, wherein the antisense strand comprises a sequence selected from SEQ ID NOs: 907-1049.

10. The saRNA of any one of claims 2-9, wherein the saRNA is double stranded and further comprises a sense strand.

11. The saRNA of claim 10, wherein the sense strand comprises a 3’ overhang.

12. The saRNA of claim 11, wherein the 3’ overhang is mUmU, UU, or UUU.

13. The saRNA of any one of claims 10-12, wherein the sense strand comprises a sequence selected from SEQ ID NOs: 71-138, 207-284, 498-630, or 764-906.

14. The saRNA of any one of claims 10-13, wherein the sense strand comprises a sequence selected from SEQ ID NOs: 764-906.

15. A synthetic isolated small activating RNA (saRNA) selected from the saRNAs in Table 4.

16. The saRNA of claim 15, wherein the saRNA is HBG12-S1136, HBG12-S1136-IS, HBG2-Pr-29-003-SS, HBG2-Pr-29-003-SS-IS, HBG2-Pr-397-002-SS, HBG2-Pr-397-002-IS, HBG2-S8354S, HBG2-S8354S-IS, HBG12-S113S_p2, HBG12-S113S_p2-IS, HBG12- S113S_p2-ISVS, HBG2-Pr-157-003-SS_ml, HBG2-Pr-157-003-SS_ml-IS, HBG2-Pr-157-003- SS ml-ISVS, HBG2-Pr-29-003-SS_m2, HBG2-Pr-29-003-SS_m2-IS, or HBG2-Pr-29-003- SS_m2-ISVS.

17. A pharmaceutical composition comprising the saRNA of any one of claims 1-16 and at least one pharmaceutically acceptable excipient.

18. The pharmaceutical composition of claim 17, wherein the pharmaceutical composition comprises liposomes.

19. The pharmaceutical composition of claim 18, wherein the liposomes comprise 1- palmitoyl-2-oleoyl-sn-glycero-3 -phosphocholine (POPC), l,2-dioleoyl-sn-glycero-3- phosphoethanolamine (DOPE), Cholesteryl hemisuccinate (CHEMS), and Cholesteryl-4-[[2-(4- morpholinyl)ethyl]amino]-4-oxobutanoate (MOCHOL).

20. The pharmaceutical composition of claim 19, wherein the molar ratio of POPC :DOPE: CHEMS :MOCHOL is 6:24:23:47.

21. A method of upregulating the expression of at least one target gene in a cell, wherein the at least one target gene is HBG1 and / or HBG2, comprising contacting the at least one target gene with the saRNA of any one of claims 1-16 or the pharmaceutical composition of any one of claims 17-20.

22. The method of claim 21, wherein the expression of the at least one target gene or the total expression of the target genes is increased by at least 30%, 40%, 50%, or 2 folds in thepresence of the saRNA compared to expression of the target gene or the total expression of the target genes in the absence of the saRNA.

23. The method of claim 21 or claim 22, wherein the total HBG1 and HBG2 gene expression level (HBG) is increased.

24. The method of any one of claims 21-23, wherein HBB gene expression is not increased or the ratio of HBG gene expression level to HBB gene expression level is larger than 1.

25. The method of any one of claims 21-24, wherein the cell is a progenitor cell or a haematopoietic stem cell.

26. A method of increasing fetal hemoglobin (HbF) protein levels, increasing % HbF levels, increasing gamma globin levels, and / or reducing beta globin levels in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of the saRNA of any one of claims 1-16 or the pharmaceutical composition of any one of claims 17-20.

27. The method of claim 26, wherein the HbF protein level is increased to more than 10% or 20% of total haemoglobin protein.

28. The method of any one of claims 26 and 27, wherein the HbF protein level is increased to around 30% of total haemoglobin protein.

29. The method of any one of claims 26-28, further comprising administering hydroxyurea (HU) to the subject before administering the saRNA or the pharmaceutical composition.

30. A method of treating sickle cell disease or beta-thalassemia in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of the saRNA of any one of claims 1-16 or the pharmaceutical composition of any one of claims 17-20.

31. The method of claim 30, wherein the saRNA or the pharmaceutical composition is administered to the patient through I V. infusion or I.V. injection.

32. The method of any one of claims 30-31, further comprising administering hydroxyurea (HU) to the subject before administering the saRNA or the pharmaceutical composition.

33. The saRNA of any one of claims 1-16 or the pharmaceutical composition of any one of claims 17-20 for use in treating sickle cell disease or beta-thalassemia in a subject.

34. The saRNA or the pharmaceutical composition for use of claim 33, wherein the treating comprises administering the saRNA or the pharmaceutical composition to the subject through I.V. infusion or I.V. injection.

35. The saRNA or the pharmaceutical composition for use of claim 33 or claim 34, wherein the treating further comprises administering hydroxyurea (HU) to the subject before administering the saRNA or the pharmaceutical composition.

36. The saRNA of any one of claims 1-16 or the pharmaceutical composition of any one of claims 17-20 for use in increasing fetal hemoglobin (HbF) protein levels, increasing % HbF levels, increasing gamma globin levels, and / or reducing beta globin levels in a subject.

37. The saRNA or the pharmaceutical composition for use of claim 36, wherein the HbF protein level is increased to more than 10% or 20% of total haemoglobin protein.

38. The saRNA or the pharmaceutical composition for use of claim 36 or claim 37, wherein the HbF protein level is increased to around 30% of total haemoglobin protein.

39. The saRNA or the pharmaceutical composition for use of any one of claims 36-38, wherein hydroxyurea (HU) is administered to the subject before administering of the saRNA or the pharmaceutical composition.

40. Use of the saRNA of any one of claims 1-16 or the pharmaceutical composition of any one of claims 17-20 for the preparation of a medicament for upregulating HBG1 and / or HBG2 gene expressions and / or increasing HbF protein levels, increasing % HbF levels, increasing gamma globin levels, and / or reducing beta globin levels in a subject.

41. The use of claim 40, wherein the medicament increases HbF protein level to more than 10% or 20% of total haemoglobin protein.

42. The use of claim 40 or claim 41, wherein the medicament increases HbF protein level to around 30% of total haemoglobin protein.

43. Use of the saRNA of any one of claims 1-16 or the pharmaceutical composition of any one of claims 17-20 for the preparation of a medicament for treating sickle cell disease or betathalassemia in a subject.

44. The use of claim 43, wherein the medicament is administered to the subject through I V. infusion or I.V. injection.

45. The use of any one of claims 40-44, wherein hydroxyurea (HU) is administered to the subject before administering of the medicament.