Telomerase for prevention of tissue damage

Abstract

A nanoparticle including an ionizable lipid encapsulating a nucleic acid encoding a telomerase or a functional fragment of a telomerase and methods of using the same.

Description

TELOMERASE FOR PREVENTION OF TISSUE DAMAGECROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of priority to U.S. Provisional Application No. 63 / 677,082, filed July 30, 2024, which is incorporated by reference herein in its entirety.REFERENCE TO SEQUENCE LISTING

[0002] The sequence listing submitted on July 30, 2025, as an .XML file entitled “10063- 097WOl_ST26.xml” created on July 22, 2025, and having a file size of 11,356 bytes is hereby incorporated by reference pursuant to 37 C.F.R. § 1.52(e)(5).BACKGROUND

[0003] The human genome - and most eukaryotic genomes - are protected by telomeres, which are non-coding DNA sequences at the ends of linear chromosomes that prevent degradation of the primary genetic information of the chromosome. Degradation, or shortening, of telomeres can be caused by routine cellular processes, such as cell division, or by stressors, such as inflammation or oxidative stress. As such, telomere shortening is commonly observed in aged or damaged tissues. Shortened telomeres have impaired protective capabilities, which increases the risk of diseases or disorders caused by damage to the chromosome.

[0004] The ribonucleoprotein telomerase maintains telomeres. Telomerase adds hexamer repeats to the ends of telomeres to restore their length and, as such, strengthen the protection of the chromosome. However, telomerase is largely suppressed in normal somatic cells, which leaves the telomeres vulnerable to damage. The reactivation of telomerase has previously been explored for wound healing. However, other delivery and treatment strategies are needed to expand the protection and regeneration of telomeres from various damages, diseases, or disorders. These needs and others are at least partially satisfied by the present disclosure.SUMMARY

[0005] Disclosed herein are nanoparticles for delivering telomerase and methods of using the same. The nanoparticles include an ionizable lipid, which can, surprisingly, improve penetration of the nanoparticles into a tissue. In particular, conventional cationic nanoparticles can become stuck in upper layers of negatively charged tissues, such as skin, whereas the disclosed nanoparticles can reach deeper layers of the tissue before becoming charged, thereby improving the delivery of the telomerase. The disclosed nanoparticles can be administered fortreatment or prevention of tissue aging or tissue damage (e.g., physical wounds, bums, or radiative damage). For example, the disclosed nanoparticles can be administered as a topical ointment (e.g., as a preventative before cancer radiotherapy) or via microneedling or dermabrasion (e.g., for anti-aging or cosmetic purposes) to increase telomerase activity for the prevention or reversal of telomere shortening. The disclosed nanoparticles can also be used for the preparation, repair, or maintenance of skin grafts, before and / or after implantation.

[0006] In an aspect, provided is a nanoparticle, wherein said nanoparticle can include an ionizable lipid encapsulating a nucleic acid encoding a telomerase or a functional fragment of a telomerase and.

[0007] In another aspect, provided is a nanoparticle, wherein said nanoparticle can include an ionizable lipid encapsulating a telomerase or a functional fragment of a telomerase.

[0008] In yet another aspect, provided is a composition including any of the disclosed nanoparticles.

[0009] In yet still another aspect, provided is a delivery system including any of the disclosed nanoparticles and a system for enhancing tissue permeability.

[0010] In yet still another aspect, provided is a method of delivering a telomerase or a functional fragment thereof to a cell, the method including introducing into the cell any of the disclosed nanoparticles.

[0011] In yet still another aspect, provided is a method of treating or preventing damage to a tissue, the method including introducing into the tissue any of the disclosed nanoparticles.

[0012] Other systems, methods, features, and / or advantages will be or may become apparent to one with skill in the art upon examination of the following drawings and detailed description. It is intended that all such additional systems, methods, features, and / or advantages be included within this description and be protected by the accompanying claims.BRIEF DESCRIPTION OF DRAWINGS

[0013] FIGURE 1 depicts a telomerase structure showing the TERT protein and accessory proteins facilitating its action. TERC sequence portion: CCCUAA (SEQ ID NO: 8). Telomere sequence portions: TTGGGAGGGTTAGGGTTAGGG (SEQ ID NO: 9) and CCCTAACCC (SEQ ID NO: 10).

[0014] FIGURE 2 depicts mechanisms of radiation-induced injury in the skin cells and vasculature and the potential benefit of the proposed telomerase therapy to prevent or reduce these damages.

[0015] FIGURES 3A-3B depict mRNA LNP design and characterization for transfection of human skin cells ex vivo. The designed LNP have size below 120nm in diameter, narrow size distribution, low PDI (<0.2) and high (>90%) mRNA encapsulation efficiency. Formulations A and B containing DOTAP, MC3, and SM-102 GFP mRNA LNP and Formulation A containing DOTAP hTERT mRNA were designed and characterized. Formulations A were prepared at 49:49:2 molar ratio of DOPE, cationic / ionizable lipid, and DMG-PEG2000. Formulations B of DOTAP, MC3, and SM-102 LNP were prepared at 8:1.5:38.5:52 molar ratio of DSPC, DMG-PEG2000, cholesterol, and cationic / ionizable lipid (DOTAP, Dlin-MC3-DMA or SM-102). FIG. 3A shows the size distribution of the systems by Dynamic Light Scattering. FIG. 3B shows a summary of the physicochemical characteristics of the mRNA LNP.

[0016] FIGURE 4 depicts in vitro studies for optimization of LNP delivery in human skin suspension cells (hSCS) isolated from a donor skin. EGFP mRNA expression of six LNP systems and Lipofectamine (transfection positive control). Kinetics of mRNA expression over 24 hours as quantified by Incucyte software, n=4.

[0017] FIGURE 5 depicts in vitro studies in the cultured major cell populations in hSCS, fibroblasts, and keratinocytes with the optimized LNP. LNP were fluorescently labeled with rhodamine (red), and EGFP mRNA (green) was employed as a reporter for mRNA expression.

[0018] FIGURES 6A-6B depict telomerase activity in hSCS following treatment with optimized TERT mRNA LNP. FIG. 6A shows a TRAP assay for telomerase activity in lysates from hSCS transfected with hTERT mRNA LNP (lane 05), with EGFP mRNA LNP (lane 07), and no treatment control (lane 09). Lysate from iPSCs (induced pluripotent stem cells) was used as a positive control (lane 03). Even number lanes were loaded with heat-killed (HK; 85°C for 10 minutes to inactivate telomerase) lysate set up in parallel for each sample extract (lanes 04, 06, 08, 10). Lane 1 was loaded with PCR amplified positive control template. Lane 2 was loaded with lysis buffer only as a negative control. FIG. 6B shows time and dose-response analysis of telomerase activity. hSCS were treated with three concentrations (1.00, 0.50, and 0.25 pg mRNA / mL) of hTERT mRNA LNP or EGFP mRNA LNP.

[0019] FIGURE 7 depicts luciferase mRNA expression in the skin of Balb / c mice (n=3) at 4 and 24 hours after DOTAP- A (cationic lipid based) and MC3-A LNP (ionizable lipid based) intradermal injection. Ionizable lipid-based LNP performed significantly better in vivo at 4h as compared to cationic lipid-based LNP.

[0020] FIGURE 8 depicts luciferase mRNA expression in the humanized mouse model (nude mice) implanted with a human skin graft. DOTAP and MC3 LNP-carrying luciferasemRNA were injected intradermally in both human skin grafts and mouse skin. Mice 1 and 3 - DOTAP LNP; mice 2 and 4 - MC3 LNP; mouse 5 - untreated control. The luminescence was detected with IVIS 24 hours after the injection. Ionizable lipid-based LNP performed significantly better in vivo at 24h as compared to cationic lipid-based LNP.

[0021] FIGURE 9 depicts a TRAP assay in a human skin graft after delivery of hTERT LNP, showing efficient activity of TERT in skin following TERT-mRNA-LNP administration. Negative controls: Hk - heat killed transfected with TERT-mRNA-LNP skin with TERT activity deactivated; skin- untreated skin.

[0022] FIGURE 10 depicts the normalization of replication capacity in endothelial cells in vitro as a function of TERT therapy.

[0023] FIGURE 11 depicts quantitative analysis of hSCS engraftment as a function of TERT therapy. Wound sections from mice implanted with hSCS treated with hTERT mRNA LNP (n = 6), hSCS treated with EGFP mRNA LNP (control, n = 6), and untreated hSCS groups were stained for Ki67 (proliferation), p21 (cellular senescence), and 53BP1 (DNA damage).

[0024] FIGURE 12 depicts the effect of TERT therapy on the reversal of radiation-inducedDNA damage in cells in vitro. Delivery of hTERT mRNA-LNP protected keratinocytes from DNA damage associated with exposure to 5 Gy radiation.

[0025] FIGURES 13A-13B depict that TERT LNPs protect against DNA damage associated with 5Gy radiation in human skin explants (1 and 2 hours after the exposure). DNA breaks appear as a red signal, yH2A.X staining. FIG. 13 A, left, shows skin treated with hTERT LNP; FIG. 13A, right, shows irradiated untreated skin. Blue signal - nuclei, DAPI. FIG. 13B, left, shows untreated irradiated skin at 1 and 2 h post-radiation. FIG. 13B, right, shows skin treated with mRNA-LNP-TERT at 1 and 2 h post-radiation. The effect of TERT therapy is clearly observed based on elimination of DNA damage (depicted by yH2A.X red staining of DNA breaks).

[0026] FIGURES 14A-14E depicts ex vivo ionizing radiation exposure results in dosedependent DNA damage response in cutaneous tissues. Skin explants were divided into unexposed control (FIG. 14A) and irradiated groups (FIG. 14B: 2 Gy; FIG. 14C: 5 Gy; FIG. 14D: 10 Gy). Two hours post irradiation, skin samples were collected for immunohistochemical staining (yH2AX, red; CK14, green, DAPI, blue; H&E, brightfield). FIGS. 14A-14D show representative images, and FIG. 14E is a quantitative summary of the data showing the degree of DNA damage response. Data are shown as mean SD (n = 3). * p < 0.05 which were analyzed using two-way ANOVA.

[0027] FIGURES 15A-15C depict that X-ray irradiation leads to genomic and mitochondrial DNA damage in major skin cell populations, including keratinocytes, fibroblasts and endothelial cells. FIG. 15A shows long amplicon PCR (LA PCR) analysis of genomic DNA extracted immediately (0 hr) from human epidermal keratinocytes, human dermal fibroblasts, and human dermal microvascular endothelial cells after exposure to X-ray irradiation (2 Gy, 5 Gy, 10 Gy, 20 Gy, or No IR control ). A 10.4 kb region in the HPRT gene was used as long amplicon, while a 0.2 kb region in the HPRT gene was used as short amplicon loading control. PCR products were separated on agarose gel (0.8% for long amplicon, 2% for short amplicon). Representative images shown, from 3 independent experiments (top panel). Quantification LA PCR of genomic DNA integrity normalized to short amplicon control (bottom panel). Data are shown as mean SD (n = 3). * p < 0.05 which were analyzed using two way ANOVA. FIG. 15B shows analysis of mitochondrial DNA integrity measured by LA PCR of mitochondrial DNA extracted immediately (0 hr) from human epidermal keratinocytes, human dermal fibroblasts, and human dermal microvascular endothelial cells after treatment of ionizing radiation (2 Gy, 5 Gy, 10 Gy, 20 Gy, or No IR control). An 8.8 kb region in the mitochondrial genome was used as long amplicon, while a 0.2 kb region in the mitochondrial genome was used as short amplicon loading control. PCR products were separated on agarose gel (0.8% for long amplicon, 2% for short amplicon). Representative images shown, from 3 independent experiments (top panel). Quantification LA PCR of mitochondrial DNA integrity normalized to short amplicon control (bottom panel). Data are shown as mean SD (n = 3). * p < 0.05 which were analyzed using two-way ANOVA. FIG. 15C shows JC-1 staining analysis of human skin keratinocytes, dermal fibroblasts, and dermal microvascular endothelial cells at 24 hr after ionizing radiation exposure (2 Gy, 5 Gy, 10 Gy, 20 Gy, or No IR control). Orange fluorescence indicates an intact mitochondrial membrane with strong polarization. Shift to green fluorescence reflects mitochondrial membrane depolarization due to loss of membrane integrity. Data are shown as mean SD (n = 3). * p < 0.05 which were analyzed using two-way ANOVA.

[0028] FIGURES 16A-16B depict that ionizing radiation induces keratinocyte cell death mainly via apoptosis. FIG. 16A shows flow cytometry analysis of human skin keratinocytes at 2 hr or 24 hr post ionizing radiation exposure (2 Gy, 5 Gy, 10 Gy, 20 Gy, or No IR control). FIG. 16B shows a detailed analysis of the effect of high dose (20 Gy) irradiation treatment, comparing to no irradiation (No IR) control. Annexin V staining indicates cell apoptotic. Necrotic cells were identified by Zombie dye. Data are shown as mean SD (n = 3). * p < 0.05 which were analyzed using two-way ANOVA.

[0029] FIGURES 17A-17E depict that TERT treatment reverses radiation-induced apoptosis in primary skin cells. FIG. 17A shows that human epidermal keratinocytes were applied with vehicle control or GFP mRNA encapsulated by cationic lipid nanoparticle DOTAP or mixed with commercial transfection reagents (Lipofectamine Max or jetMessenger), to measure transfection efficiency. Representative images of green fluorescence from live cells shown, from 3 independent experiments (left panel). Cell nuclei are stained with DAPI stain. Quantification GFP+ cells / DAPI are presented as mean percentage SD (n = 3). * p < 0.05 which were analyzed using two way ANOVA. FIG. 17B shows an outline of the experimental setup. FIG. 17C shows that TERT therapy protected human epidermal keratinocytes reducing the number of apoptotic cells to the level of non-irradiated control. (FIGS. 17D-17E) show similar trends for TERT therapy in dermal fibroblasts (FIG. 17D), and dermal microvascular endothelial cells (FIG. 17E) were transfected with DOTAP GFP or hTERT mRNA or vehicle control. Apoptosis was measured 24 hr following ionizing radiation exposure (5 Gy) or No IR control by flow cytometry with Annexin V staining. Cell death was identified by Zombie dye. Data are shown as mean SD (n = 3). * p < 0.05 which were analyzed using two-way ANOVA.

[0030] FIGURES 18A-18C depict that telomerase mRNA treatment accelerates repair in radiation-induced DNA damage. DNA damage quantification was measured by long amplicon PCR (LA PCR) analysis of genomic DNA isolated from human epidermal keratinocytes (FIG. 18A), human dermal fibroblasts (FIG. 18B), and human dermal microvascular endothelial cells (FIG. 18C) after exposure to X-ray irradiation (5 Gy or no irradiation control). At 0 hr, 0.5 hr, 1 hr, 2 hr, 6 hr or 24 hr post-irradiation, nuclear DNA from the cells were subjected for PCR using primers for long amplicon (a 10.4 kb region in the HPRT gene) and short amplicon (a 0.2 kb region in the HPRT gene). PCR products were separated on agarose gel (0.8% for long amplicon, 2% for short amplicon). Representative images shown, from 3 independent experiments (top panel). Quantification LA PCR of genomic DNA integrity normalized to short amplicon control (bottom panel). Data are shown as mean SD (n = 3). * p < 0.05, which were analyzed using two-way ANOVA.

[0031] FIGURES 19A-19I depict optimization of mRNA delivery to human skin explants. FIGS. 19A-19B show 1 cm2pieces of human skin which underwent microneedling using a 36 pin microneedling pen. FIG. 19C shows that following the procedure (6 repetition per second for 20 s, 2.0 mm depth), skin explants were treated with hTERT mRNA and cultured at air liquid interface. FIGS. 19D-19G show immunofluorescence and H&E staining of ex vivo skin samples subjected to microneedle delivery of hTERT mRNA carried by ionizable lipidnanoparticle MC3, cationic lipid nanoparticle DOTAP, or commercial transfection reagent jetMessenger. Vehicle solution served as control for transfection. FIG. 19H shows quantification of TERT+ cells (red) over nuclei (DAPI, blue) is presented. Data are shown as mean SD (n = 3). * p < 0.05, which were analyzed using two-way ANOVA. FIG. 191 shows a TRAP assay for telomerase activity in the ex vivo cutaneous tissues following microneedle delivery of MC3 encapsulated mRNA or vehicle control. Lysates from skin samples treated with MC3 lipid nanoparticle encapsulated GFP (lanes 01 04), hTERT (lanes 05 08), or vehicle control (lanes 09-12). Lysis buffer served as negative control (lane 13) and PCR amplified template was used as a positive control (lane 14). Even number lanes were loaded with heat killed (HK; 85°C for 10 min to inactivate telomerase) lysates set up in parallel for each sample extract.

[0032] FIGURES 20A-20C depict that treatment of hTERT mRNA via microneedling prevents radiation induced damage in skin explants. FIG. 20A shows that human skin (1 cm2pieces) which underwent a microneedling procedure (6 repetition per second for 20 s, 2.0 mm depth) were immediately applied with either vehicle solution or mRNA (hTERT or GFP) complexed with ionizable lipid nanoparticle MC3. Following 24 hr of ex vivo culture, skin explants were exposed to X-ray irradiation (5 Gy) and harvested 2 hr or 24 hr post-irradiation for immunohistochemical staining (yH2AX, red; nuclear DAPI, blue; H&E, brightfield). A group of skin explants treated with vehicle and unexposed to radiation (no irradiation) served as control. Representative images shown, from 3 independent experiments. FIG. 20B is summary data showing the percentage of cells stained positive for DNA damage response marker yH2AX. Data are shown as mean SD (n = 3). * p < 0.05, which were analyzed using two-way ANOVA. FIG. 20C shows an immunoblot analysis of whole cell lysates collected from non- irradiated skin explants treated with vehicle (lane 1), hTERT (lane 2), GFP (lane 3), or from skin samples harvested 2 hr (lane 4 6) or 24 hr (lane 7 9) post-irradiation (5 Gy). actin antibody was used as a loading control.

[0033] FIGURES 21A-21E depict dose-dependent DNA damage in human skin following ex vivo exposure to ionizing radiation (IR). FIGS. 21A-21D show representative yH2A.X, keratin 14 (CK14), and nuclei (DAPI) immunofluorescence, as well as H&E staining in human skin samples 2h post-exposure to 0 Gy-no radiation (control) (FIG. 21A); 2 Gy (FIG. 21B); 5 Gy (FIG. 21C); or 10 Gy (FIG. 21D) of ionizing radiation. FIG. 21E shows quantification of DNA damage foci. Data are shown as mean + SD (n = 3).

[0034] FIGURES 22A-22D depict that x-ray irradiation induces apoptosis in keratinocytes. FIG. 22A shows a schematic representation of the Long Amplicon PCR (LA-PCR) assay used to assess DNA integrity. FIG. 22B shows quantitative analysis of the percentage of apoptotic cells among dead keratinocytes, without or with 5 Gy irradiation, 24 hours post-treatment. FIG. 22C shows a gating strategy for flow cytometric analysis of cell apoptosis in keratinocytes. FIG. 22D shows that flow cytometry analysis reveals the percentage of apoptotic cells among dead keratinocytes 24 hours after exposure to 5 Gy irradiation.

[0035] FIGURES 23A-23E depict that x-ray irradiation induces genomic and mitochondrial DNA damage, leading to apoptosis in primary skin cells. FIGS. 23A-23B show long amplicon PCR (LA-PCR) analysis of genomic (FIG. 23A) and mitochondrial (FIG. 23B) DNA integrity in human epidermal keratinocytes, dermal fibroblasts, and dermal microvascular endothelial cells immediately after exposure to different doses of X-ray irradiation (2 Gy, 5 Gy, 10 Gy, 20 Gy) or no irradiation (No IR, control). FIG. 23C shows quantification of cell death in human keratinocytes by flow cytometry at 2 hours and 24 hours post-exposure to the indicated doses of irradiation. FIGS. 23D-23E show quantitative analysis and representative flow cytometry plots of early and late apoptosis in human keratinocytes at 2 hours and 24 hours post- irradiation. Data are presented as mean ± SD (n = 3). KTN: epidermal keratinocytes; Fb: dermal fibroblasts; MVEC: dermal microvascular endothelial cells.

[0036] FIGURES 24A-24G depict that TERT expression in HAEC (Telo-HAEC) reduces DNA damage and increases cell survival. FIGS. 24A-24B show immunostaining for yH2A.X and its quantification in HAEC and Telo-HAEC at different time points following 5 Gy irradiation, indicating DNA damage levels. FIGS. 24C shows volcano plots which illustrate differentially expressed genes between Telo-HAEC and HAEC after irradiation exposure. A fold change of > 2 and a p-value < 0.05 indicate significance. FIGS. 24D-24E show that gene set enrichment analysis (GSEA) demonstrates pathway enrichment to DNA damage response and DNA repair pathways in HAEC and Telo-HAEC, either without irradiation or 2 hours after exposure to 5 Gy irradiation. FIGS. 24F-24G show representative gel images and quantification of LA-PCR results from HAEC and Telo-HAEC under no irradiation (control) and 2 hours post-irradiation, highlighting differences in DNA damage and repair efficiency.

[0037] FIGURES 25A-25J depict that TERT overexpression in HAECs reduces DNA damage and protects cells from bleomycin-induced senescence. FIGS. 25A-25B show representative western blots and densitometric quantification of yH2A.X protein levels postradiation. FIG. 25C shows quantification analysis of Propidium Iodide (Pl)-positive cells, indicative of cell death, following radiation exposure. FIG. 25D shows representative immunofluorescence staining showing a dose-dependent increase in yH2A.X and 53BP1 fociin HAECs and Telo-HAECs treated with bleomycin. FIGS. 25E-25F show representative images and quantitative analysis of SA-P-gal-positive cells in HAECs treated with varying doses of bleomycin. FIG. 25G shows qPCR analysis of TERT expression in HAEC cells treated with different doses of bleomycin. FIGS. 25H-25J show volcano plots which illustrate differentially expressed genes in HAEC vs HAEC IR (FIG. 25H), Telo-HAEC and Telo- HAEC IR (FIG. 251), and HEAC vs Telo HEAC (FIG. 25J).

[0038] FIGURES 26A-26E depict that TERT overexpression in HAEC reduces DNA damage and increases cell survival. FIG. 26A shows a Venn plot which depicts pathways associated with differentially expressed genes among HAEC-IR vs Telo-HAEC-IR and HAEC vs Telo-HAEC. Heatmap shows differentially expressed genes and common genes from Venn plots in HAEC-IR, Telo-HAEC-IR, HAEC, and Telo-HAEC groups. FIG. 26B shows that gene set enrichment analysis (GSEA) highlights pathway enrichment for DNA damage response and DNA repair in comparisons between HAEC and HAEC IR, as well as Telo HAEC and Telo- HAEC IR. FIG. 26C shows telomere length analysis by TRF (Terminal Restriction Fragment) assay in HAEC and Telo-HAEC 2h post-radiation. FIG. 26D shows qFISH analysis and quantification of yH2A.X, 53BP1, IL-6, IL-8, and SA-P-gal post-bleomycin treatment. FIG. 26E shows a TRAP assay and qPCR analysis of TERT activity in addition and expression in HAECs and Telo-HAECs following bleomycin treatment.

[0039] FIGURES 27A-27C depict pathway analysis performed to compare different groups using differentially expressed genes identified from bulk RNA-seq data.

[0040] FIGURES 28A-28I depict that TERT mRNA treatment reduces radiation-induced apoptosis in primary skin cells. FIG. 28A shows human epidermal fibroblasts and keratinocytes were treated with vehicle control (PBS) or GFP mRNA encapsulated by cationic lipid nanoparticle DOTAP or mixed with commercial transfection reagents (Lipofectamine Max or jetMessenger) to assess transfection efficiency. Representative images of green fluorescence from live cells (left panel) and DAPI-stained nuclei are shown (n = 3 independent experiments). Quantification GFP+ cells / DAPI are presented as mean percentage ± SD (n = 3). FIG. 28B shows a schematic outline of the experimental setup. FIGS. 28C-28E show representative flow cytometry plots and quantitative analysis of early and late apoptosis in human epidermal keratinocytes, assessed 24 hours after ionizing radiation (5 Gy) or no irradiation (No IR control). FIGS. 28F-28G show representative flow cytometry plots and quantitative analysis of Annexin V-positive cells in indicated groups of human epidermal keratinocytes. FIGS. 28H-28I show representative flow cytometry plots and quantitative analysis of Annexin V-positive cells in human dermal microvascular endothelial cells treatedwith indicated groups. Primary cells were transfected with 1 pg / mL DOTAP LNP encapsulated GFP or hTERT mRNA or treated with vehicle control (PBS). Flow cytometry analysis was performed 24 hours following 5 Gy irradiation or No IR control. Early apoptosis was identified as Zombie Aqua (-) / Annexin V (+), while late apoptosis was identified as Zombie Aqua (+) / Annexin V (+). Data are shown as mean ± SD (n = 3). ns, P > 0.05; *, P < 0.05; **, P < 0.01; ***, P < 0.001, ****, P < 0.0001. P values were calculated using two-way ANOVA. KTN: epidermal keratinocytes; MVECs: dermal microvascular endothelial cells. US: Unstained.

[0041] FIGURES 29A-29E depict that TERT mRNA treatment reduces radiation-induced apoptosis in primary skin cells. FIGS. 29A-29C show representative flow cytometry plots and quantitative analysis of early and late apoptosis in human dermal microvascular endothelial cells, assessed 24 hours after ionizing radiation (5 Gy) or no irradiation (No IR control). FIGS. 29D-29E show representative flow cytometry plots and quantitative analysis of Annexin V- positive cells in indicated groups of human fibroblasts. Data are shown as mean ± SD (n = 3). ns, P > 0.05; *, P < 0.05; **, P < 0.01; ***, P < 0.001. P values were calculated using two-way ANOVA. MVECs: dermal microvascular endothelial cells; Fb: dermal fibroblasts.

[0042] FIGURES 30A-30F depict that telomerase mRNA treatment enhances genomic DNA repair post-radiation. FIGS. 30A-30C show quantification of DNA damage by long amplicon PCR (LA-PCR) analysis of genomic DNA isolated from human epidermal keratinocytes, dermal fibroblasts, and dermal microvascular endothelial cells exposed to 5 Gy irradiation or no irradiation. At 0, 0.5, 1, 2, 6, and 24 h post-irradiation, DNA was analyzed using primers for a long amplicon (10.4 kb region in the HPRT gene) and a short amplicon (0.2 kb region in the HPRT gene) as a loading control. PCR products were resolved on agarose gels (0.8% for long amplicons, 2% for short amplicons). Representative gel images from three independent experiments are shown (top panels), with quantification of genomic DNA integrity normalized to the short amplicon control (bottom panels). FIG. 30D shows representative images of MitoSOX analysis at 24 hours post-irradiation in keratinocytes treated with vehicle control, DOTAP LNP encapsulated GFP or hTERT mRNA. FIGS. 30E-30F shows representative flow cytometry plots and quantitative analysis of MitoSOX Red fluorescence in keratinocytes treated with vehicle, GFP mRNA, or TERT mRNA 24 hours after irradiation, indicating differences in mitochondrial superoxide production. KTN: epidermal keratinocytes; Fb: dermal fibroblasts; MVECs: dermal microvascular endothelial cells. MFI: Mean Fluorescence Intensity.

[0043] FIGURES 31A-31I depict optimization of mRNA delivery to human skin explants. FIGS. 31A-31B show that 1-cnr pieces of human skin underwent microneedling using a 36- pin microneedling pen. FIG. 31C shows that, following the procedure (6 repetitions per second for 20 s, 2.0 mm depth), skin explants were treated with hTERT mRNA and cultured at airliquid interface. FIGS. 31D-31G show immunofluorescence and H&E staining of ex vivo skin samples subjected to microneedle delivery of hTERT mRNA carried by LNP with ionizable lipid (MC3), LNP with cationic lipid (DOTAP), or commercial transfection reagent jetMessenger. Vehicle solution (PBS) served as a control for transfection. FIG. 31H shows quantification of TERT+ cells over nuclei (DAPI) presented in the graph. Data are shown as mean ± SD (n = 3). * P < 0.05 which were analyzed using two-way ANOVA. FIG. 311 shows a TRAP assay for telomerase activity in the ex vivo cutaneous tissues following microneedle delivery of MC3 LNP mRNA or vehicle control. Lysates from skin samples treated with MC3 LNP GFP (lanes 01-04), MC3 LNP hTERT (lanes 05-08), or vehicle control (PBS) (lanes 09- 12). Lysis buffer served as a negative control (lane 13) and PCR amplified template was used as a positive control (lane 14). Even number lanes were loaded with heat-killed (HK; 85 °C for 10 min to inactivate telomerase) lysates set up in parallel for each sample extract.

[0044] FIGURES 32A-32C depict treatment of human skin ex vivo with hTERT mRNA reduced radiation-induced yH2A.X signal and senescence markers. FIG. 32A shows that, following microneedling, vehicle solution or 1 pg / mL MC3 LNP mRNA (hTERT or GFP) were applied to the skin surface and incubated for 24h. Further, skin explants were exposed to 5Gy irradiation, incubated and harvested at 2 or 24h post-irradiation for immunofluorescent staining (yH2A.X, red; nuclear DAPI, blue; H&E, brightfield). Skin treated with vehicle (no treatment) or unexposed to radiation (no irradiation) served as a control. Representative images from 3 independent experiments. FIG. 32B is summary data showing the percentage of cells stained positive for DNA damage marker yH2A.X. Data are shown as mean ± SD (n = 3). * p < 0.05 which were analyzed using two-way ANOVA. FIG. 32C shows immunoblot analysis of whole cell lysates collected from non-irradiated skin samples treated with vehicle (lane 1), hTERT (lane 2), GFP (lane 3), or from skin samples harvested 2h (lane 4-6) or 24h (lane 7-9) post-irradiation (5 Gy). -actin antibody was used as a loading control.

[0045] FIGURES 33A-33E depict that TERT mRNA treated skin enhances DNA repair and reduces apoptotic cells. FIG. 33A shows representative figures of skin samples with TUNEL staining. FIG. 33B shows the quantification of the TUNEL assay indicates the percentage of apoptotic cells in skin samples treated with TERT or GFP mRNA or vehicle. FIG. 33C shows qFISH analysis of skin samples treated with TERT or GFP mRNA or vehicle.FIG. 33D is a schematic graph illustrating the colorimetric assay for detecting DNA damage (AP sites). FIG. 33E shows colorimetric analysis of AP sites from DNA extracted from skin samples treated with TERT or GFP mRNA or vehicle. Data are shown as mean ± SD (n = 3- 5). ** P < 0.01, *** P < 0.001, **** P < 0.0001, which were analyzed using one-way ANOVA. TMB : 3 ,3 ’ ,5 ,5 ’ -Tetramethylbenzidine.DETAILED DESCRIPTION

[0046] It is appreciated that certain features of the disclosure, which are, for clarity, described in the context of separate aspects, can also be provided in combination with a single aspect. Conversely, various features of the disclosure, which are, for brevity, described in the context of a single aspect, can also be provided separately or in any suitable subcombination. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure.GENERAL DEFINITIONS

[0047] In this specification and in the claims that follow, reference will be made to a number of terms, which shall be defined to have the following meanings:

[0048] As used herein, “comprising” is to be interpreted as specifying the presence of the stated features, integers, steps, or components as referred to, but does not preclude the presence or addition of one or more features, integers, steps, or components, or groups thereof. Moreover, each of the terms “by,” “comprising,” “comprises,” “comprised of,” “including,” “includes,” “included,” “involving,” “involves,” “involved,” and “such as” are used in their open, non-limiting sense and may be used interchangeably. Further, the term “comprising” is intended to include examples and aspects encompassed by the terms “consisting essentially of” and “consisting of.” Similarly, the term “consisting essentially of’ is intended to include examples encompassed by the term “consisting of.

[0049] As used in the specification and the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a compound,” “a composition,” or “cancer” includes, but is not limited to, two or more such compounds, compositions, or cancers, and the like.

[0050] It should be noted that ratios, concentrations, amounts, and other numerical data can be expressed herein in a range format. It can be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint and independently of theother endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as “about” that particular value in addition to the value itself. For example, if the value “10” is disclosed, then “about 10” is also disclosed. Ranges can be expressed herein as from “about” one particular value, and / or to “about” another particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about,” it can be understood that the particular value forms a further aspect. For example, if the value “about 10” is disclosed, then “10” is also disclosed.

[0051] When a range is expressed, a further aspect includes from the one particular value and / or to the other particular value. For example, where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the disclosure, e.g., the phrase “x to y” includes the range from ‘x’ to ‘y’ as well as the range greater than ‘x’ and less than ‘y’ . The range can also be expressed as an upper limit, e.g., ‘about x, y, z, or less’ and should be interpreted to include the specific ranges of ‘about x,’ ‘about y’, and ‘about z’ as well as the ranges of ‘less than x,’ less than y’, and ‘less than z’. Likewise, the phrase ‘about x, y, z, or greater’ should be interpreted to include the specific ranges of ‘about x,’ ‘about y’, and ‘about z’ as well as the ranges of ‘greater than x,’ greater than y’, and ‘greater than z.’ In addition, the phrase “about ‘x’ to ‘y’,” where ‘x’ and ‘y’ are numerical values, includes “about ‘x’ to about ‘y’.”

[0052] It is to be understood that such a range format is used for convenience and brevity and, thus, should be interpreted in a flexible manner to include not only the numerical values explicitly recited as the limits of the range, but also to include all the individual numerical values or sub-ranges encompassed within that range as if each numerical value and sub-range is explicitly recited. To illustrate, a numerical range of “about 0.1% to 5%” should be interpreted to include not only the explicitly recited values of about 0.1% to about 5%, but also include individual values (e.g., about 1%, about 2%, about 3%, and about 4%) and the subranges (e.g., about 0.5% to about 1.1%; about 5% to about 2.4%; about 0.5% to about 3.2%, and about 0.5% to about 4.4%, and other possible sub-ranges) within the indicated range.

[0053] As used herein, the terms “about,” “approximate,” “at or about,” and “substantially” mean that the amount or value in question can be the exact value or a value that provides equivalent results or effects as recited in the claims or taught herein. That is, it is understood that amounts, sizes, formulations, parameters, and other quantities and characteristics are not and need not be exact, but may be approximate and / or larger or smaller, as desired, reflecting tolerances, conversion factors, rounding off, measurement error and the like, and other factors known to those of skill in the art such that equivalent results or effects are obtained. In somecircumstances, the value that provides equivalent results or effects cannot be reasonably determined. In such cases, it is generally understood, as used herein, that “about” and “at or about” mean the nominal value indicated ±10% variation unless otherwise indicated or inferred. In general, an amount, size, formulation, parameter, or other quantity or characteristic is “about,” “approximate,” or “at or about,” whether or not expressly stated to be such. It is understood that where “about,” “approximate,” or “at or about” is used before a quantitative value, the parameter also includes the specific quantitative value itself, unless specifically stated otherwise.

[0054] As used herein, the term “effective amount” refers to an amount that is sufficient to achieve the desired modification of a physical property of the composition or material. For example, an “effective amount” of a monomer refers to an amount that is sufficient to achieve the desired improvement in the property modulated by the formulation component, e.g., desired antioxidant release rate or viscoelasticity. The specific level in terms of wt% in a composition required as an effective amount will depend upon a variety of factors, including the amount and type of monomer, amount and type of polymer, e.g., acrylamide, amount of antioxidant, and desired release kinetics.

[0055] As used herein, the term “therapeutically effective amount” refers to an amount that is sufficient to achieve the desired therapeutic result or to have an effect on undesired symptoms but is generally insufficient to cause adverse side effects. The specific therapeutically effective dose level for any particular patient will depend upon a variety of factors, including the disorder being treated and the severity of the disorder; the specific composition employed; the age, body weight, general health, sex, and diet of the patient; the time of administration; the route of administration; the rate of excretion of the specific compound employed; the duration of the treatment; drugs used in combination or coincidental with the specific compound employed and like factors within the knowledge and expertise of the health practitioner and which may be well known in the medical arts. In the case of treating a particular disease or condition, in some instances, the desired response can be inhibiting the progression of the disease or condition. This may involve only slowing the progression of the disease temporarily. However, in other instances, it may be desirable to halt the progression of the disease permanently. This can be monitored by routine diagnostic methods known to one of ordinary skill in the art for any particular disease. The desired response to treatment of the disease or condition also can be delaying the onset or even preventing the onset of the disease or condition.

[0056] For example, it is well within the skill of the art to start doses of a compound at levels lower than those required to achieve the desired therapeutic effect and to graduallyincrease the dosage until the desired effect is achieved. If desired, the effective daily dose can be divided into multiple doses for purposes of administration. Consequently, single-dose compositions can contain such amounts or submultiples thereof to make up the daily dose. The dosage can be adjusted by the individual physician in the event of any contraindications. It is generally preferred that a maximum dose of the pharmacological agents of the invention (alone or in combination with other therapeutic agents) be used, that is, the highest safe dose according to sound medical judgment. It will be understood by those of ordinary skill in the art, however, that a patient may insist upon a lower dose or tolerable dose for medical reasons, psychological reasons, or for virtually any other reasons.

[0057] A response to a therapeutically effective dose of a disclosed drug delivery composition can be measured by determining the physiological effects of the treatment or medication, such as the decrease or lack of disease symptoms following administration of the treatment or pharmacological agent. Other assays will be known to one of ordinary skill in the art and can be employed for measuring the level of the response. The amount of a treatment may be varied, for example, by increasing or decreasing the amount of a disclosed compound and / or pharmaceutical composition, by changing the disclosed compound and / or pharmaceutical composition administered, by changing the route of administration, by changing the dosage timing, and so on. Dosage can vary and can be administered in one or more dose administrations daily for one or several days. Guidance can be found in the literature for appropriate dosages for given classes of pharmaceutical products.

[0058] As used herein, the term “prophylactically effective amount” refers to an amount effective for preventing onset or initiation of a disease or condition.

[0059] As used herein, the term “prevent” or “preventing” refers to precluding, averting, obviating, forestalling, stopping, or hindering something from happening, especially by advance action. It is understood that where reduce, inhibit, or prevent are used herein, unless specifically indicated otherwise, the use of the other two words is also expressly disclosed.

[0060] As used herein, the terms “optional” or “optionally” means that the subsequently described event or circumstance can or cannot occur, and that the description includes instances where said event or circumstance occurs and instances where it does not.

[0061] As used interchangeably herein, “subject,” “individual,” or “patient” can refer to a vertebrate organism, such as a mammal (e.g., human). "Subject" can also refer to a cell, a population of cells, a tissue, an organ, or an organism, preferably to human and constituents thereof.

[0062] As used herein, the terms "treating" and "treatment" can refer generally to obtaining a desired pharmacological and / or physiological effect. The effect can be, but does not necessarily have to be, prophylactic in terms of preventing or partially preventing a disease, symptom, or condition thereof. The effect can be therapeutic in terms of a partial or complete cure of a disease, condition, symptom, or adverse effect attributed to the disease, disorder, or condition. The term "treatment" as used herein can include any treatment of a disease or disorder in a subject, particularly a human, and can include any one or more of the following: (a) preventing the disease from occurring in a subject which may be predisposed to the disease but has not yet been diagnosed as having it; (b) inhibiting the disease, i.e., arresting its development; and (c) relieving the disease, i.e., mitigating or ameliorating the disease and / or its symptoms or conditions. The term "treatment," as used herein, can refer to both therapeutic treatment alone, prophylactic treatment alone, or both therapeutic and prophylactic treatment. Those in need of treatment (subjects in need thereof) can include those already with the disorder and / or those in which the disorder is to be prevented. As used herein, the term "treating" can include inhibiting the disease, disorder, or condition, e.g., impeding its progress, and relieving the disease, disorder, or condition, e.g., causing regression of the disease, disorder, and / or condition. Treating the disease, disorder, or condition can include ameliorating at least one symptom of the particular disease, disorder, or condition, even if the underlying pathophysiology is not affected, e.g., such as treating the pain of a subject by administration of an analgesic agent even though such agent does not treat the cause of the pain.

[0063] As used herein, “dose,” “unit dose,” or “dosage” can refer to physically discrete units suitable for use in a subject, each unit containing a predetermined quantity of a disclosed compound and / or a pharmaceutical composition thereof calculated to produce the desired response or responses in association with its administration.

[0064] As used herein, “therapeutic” can refer to treating, healing, and / or ameliorating a disease, disorder, condition, or side effect or to decreasing the rate of advancement of a disease, disorder, condition, or side effect.

[0065] As used herein, the term “nucleic acid” or “nucleic acid sequence” refers to the order or sequence of nucleotides along a strand of nucleic acids. In some cases, the order of these nucleotides may determine the order of the amino acids along a corresponding polypeptide chain. The nucleic acid sequence thus codes for the amino acid sequence. The nucleic acid sequence may be single- stranded or double-stranded, as specified, or contain portions of both double- stranded and single-stranded sequences. The nucleic acid sequence may be composed of DNA, both genomic and cDNA, RNA, or a hybrid, where the sequencecomprises any combination of deoxyribo- and ribo-nucleotides, and any combination of bases, including uracil (U), adenine (A), thymine (T), cytosine (C), guanine (G), inosine, xanthine hypoxanthine, isocytosine, isoguanine, etc. It may include modified bases, including locked nucleic acids, peptide nucleic acids, and others known to those skilled in the art.

[0066] As used herein, “amino acid” refers to a compound containing both amino ( — NH2) and carboxyl ( — COOH) groups generally separated by one carbon atom. The central carbon atom may contain a substituent that can be either charged, ionizable, hydrophilic, or hydrophobic. Any of 22 basic building blocks of proteins having the formula NIT — CHR — COOH, where R is different for each specific amino acid, and the stereochemistry is in the ‘L’ configuration. Additionally, the term “amino acid” can optionally include those with an unnatural ‘D’ stereochemistry and modified forms of the ‘D’ and ‘L’ amino acids.

[0067] As used herein, “peptide” refers to a chain of amino acids in which each amino acid is connected to the next by a formation of an amide bond. Peptides are generally considered to consist of up to 30 amino acids, or alternatively up to 25 amino acids, or alternatively up to 20 amino acids, or alternatively up to 15 amino acids, or alternatively up to 10 amino acids, or alternatively up to 5 amino acids, or alternatively between about 5-10 amino acids, or alternatively between about 10-15 amino acids, while the term “protein” is applied to compounds containing longer amino acid chains. As used herein, the term “protein domain” refers to a unit of a protein that serves a single role (e.g., functional, structural, etc.). Proteins can include a single domain or multiple domains. As used herein, the term “enzyme” refers to a protein which can catalyze or facilitate a chemical reaction or biological process.

[0068] As used herein, the term “cell” includes progeny. It is also understood that all progenies may not be precisely identical in DNA content, due to deliberate or inadvertent mutations. Variant progeny that have the same function or biological property, as screened for in the originally transformed cell, are included. The “cells” referred to in the present invention generally are prokaryotic or eukaryotic hosts.

[0069] As used herein, the term “endogenous” refers to processes, moieties, or other phenomena that occur or are generated within a given cell, organism, or subject. In contrast, the term “exogenous” refers to processes, moieties, or other phenomena that occur or are generated outside of a given cell, organism, or subject.

[0070] As used herein, the term “gene” refers to a segment of DNA arranged in a linear manner along a chromosome, which codes for a specific protein or segment of protein. A gene typically includes a promoter, a 5' untranslated region, one or more coding sequences (exons), optionally introns, and a 3' untranslated region. The gene may further comprise a terminator,enhancers and / or silencers. In some aspects, the gene may be “mutated,” which refers to the replacement, absence, or presence of additional nucleic acids as compared to a control gene. In some aspects, the gene may be “abnormal,” which refers to an atypical presentation of a gene as compared to a control gene. In some aspects, the mutation or abnormality may have a negative effect on the expression of the gene.

[0071] As used herein, the term “telomerase” refers to a ribonucleoprotein (i.e., a protein that is conjugated to RNA) which can alter the length of a telomere. A telomerase can be any enzyme capable of affecting this result, including telomerases which are known in the art, functional fragments or derivatives of known telomerases, or synthetically derived, or artificially created, telomerases. The telomerase can be an enzyme with another function, such as a polymerase, that also has telomerase activity. Types of telomerases which are useful with the present invention are described in more detail below. The function of telomerase can refer to the entire process of altering the length of a telomere, or to individual steps or a series of steps involved in altering the length of a telomere including, but not limited to, identifying a nucleic acid sequence, nucleic acid sequence binding, addition or removal of bases to a nucleic acid sequence, etc.

[0072] As used herein, the term “functional fragment” refers to any partial segment of a protein or nucleic acid sequence which at least partially retains the capability to perform a function or a part of a function of the full protein or full nucleic acid sequence. The functional fragment can be capable of performing multiple functions of the full protein or full nucleic acid sequence, a single function of the full protein or full nucleic acid sequence, or a part of one or more functions of the full protein or full nucleic acid sequence.

[0073] A “telomere” is a region of repetitive nucleotide sequences associated with specialized proteins at the ends of linear chromosomes. Telomeres are a widespread genetic feature most commonly found in eukaryotes. In most, if not all species possessing them, they protect the terminal regions of chromosomal DNA from progressive degradation and ensure the integrity of linear chromosomes by preventing DNA repair systems from mistaking the very ends of the DNA strand for a double-strand break.NANOPARTICLES AND COMPOSITIONS

[0074] Disclosed herein is a nanoparticle, wherein said nanoparticle can include an ionizable lipid encapsulating a nucleic acid encoding a telomerase or a functional fragment of a telomerase. In one aspect, this nanoparticle can be used to reduce or prevent radiation induced skin damage using exogenous administration of telomerase. Whereas telomerase is known to repair damage at the telomere (at the ends of the chromosome), a study was conducted whichdiscovered that exogenous telomerase can prevent radiation-induced skin damage (Example 1). By way of specific example, a patient about to receive radiation therapy for a thyroid tumor can have telomerase cream applied to the skin of their neck to prevent disfiguring radiation damage to the cutaneous tissue.

[0075] The telomeres at the ends of chromosomes include thousands of repeats of the hexamer “TTAGGG.” With each cell division, about 50-200 nucleotides are lost at the ends of the chromosomes due to the “end-replication problem.” In addition, telomere erosion is accelerated by cellular oxidative stress associated with conditions such as diabetes mellitus. The telomere erosion can elicit binding of DNA damage response proteins to the telomere, which can trigger a DNA damage response that leads to cellular senescence.

[0076] The enzyme telomerase associates with the noncoding RNA TERC, which guides telomerase to the telomere, where telomerase adds hexamer repeats to repair telomere damage and restore telomere length. DNA damage to the telomere, as observed by binding of DNA response proteins, is reversed by expression of telomerase. In normal somatic cells, the expression of telomerase is suppressed, whereas in stem cells, some telomerase activity is present. The telomerase activity of stem cells can explain, at least in part, their greater capacity for self-renewal and proliferation.

[0077] Exogenous telomerase, or functional fragments thereof, may be administered as a protein (e.g., a recombinant protein therapy); as a nucleic acid (e.g., as mRNA telomerase, selfamplifying RNA telomerase, circular RNA telomerase, or as plasmid DNA telomerase) or as a viral construct (e.g., as an adeno- associated viral construct), or as a cellular therapy (of cells overexpressing telomerase). More detail regarding these are provided below. Again, by way of example, the therapy can be administered prior to radiation therapy; or before exposure to environmental or cosmic radiation (e.g., combat or military exposure) or other environmental bankcauses of cutaneous injury such as ultraviolet light.

[0078] Naturally occurring telomerase includes a telomerase reverse transcriptase (TERT; e.g., GenBank Accession Nos. NT 006576 for the 41881 bp gene and NM„ 198253 for the mRNA sequence) and telomerase RNA (TERC). Telomerase across species can further include other species- specific proteins, for example, dyskerin in human telomerase. In some aspects, the telomerase or fragment thereof can comprise TERT or a functional fragment thereof, or a nucleic acid encoding the same. In some aspects, the telomerase or fragment thereof can comprise a TERT domain selected from essential N-terminal (TEN) domain, a TERT RNA- binding domain (TRBD), a reverse-transcriptase (RT) domain, a C-terminal extension (CTE), or any combinations thereof, or a nucleic acid encoding the same. In some aspects, thenanoparticle described herein can comprise multiple TERT domains selected from the abovelisted TERT domains, or nucleic acids encoding the same. In some aspects, the multiple TERT domains can be connected, conjugated, or complexed together in a naturally occurring telomerase. In some aspects, the multiple TERT domains may not be connected, conjugated, or complexed together in a naturally occurring telomerase. In some aspects, the telomerase or fragment thereof can comprise an entire TERT domain or multiple entire TERT domains selected from the above-listed TERT domains, or nucleic acids encoding the same. In some aspects, the telomerase or fragment thereof can comprise at least one partial TERT domain selected from the above-listed TERT domains, or a nucleic acid encoding the same.

[0079] In some aspects, the telomerase or fragment thereof can comprise TERC or a functional fragment thereof, or a nucleic acid encoding the same. In some aspects, the telomerase or fragment thereof can comprise dyskerin or a functional fragment thereof, or a nucleic acid encoding the same. In some aspects, any combination of TERT or a functional fragment thereof, a full TERT domain or functional fragment thereof, a partial TERT domain or functional fragment thereof, TERC or a functional fragment thereof, and dyskerin or a functional fragment thereof is contemplated, or a nucleic acid encoding any of the same.Polypeptides and Nucleic Acids Encoding Telomerases or Fragments Thereof

[0080] In some aspects, the nucleic acid encoding a telomerase or fragment thereof can include mRNA. In other aspects, the nucleic acid can include DNA. In yet other aspects, the nucleic acid can include DNA, RNA, and / or modified nucleic acids, or any combination of these. The nucleic acid encoding a telomerase or fragment thereof can be double stranded, single stranded, or a combination of double and single-stranded. The nucleic acid encoding a telomerase or fragment thereof can optionally further include one or more linkers (for example, separating domains of the telomerase).

[0081] The terms “nucleic acid” and “nucleic acid sequence” refer to a nucleotide, oligonucleotide, polynucleotide (which terms may be used interchangeably), or any fragment thereof. These phrases also refer to DNA or RNA of genomic or synthetic origin (which may be single- stranded or double-stranded and may represent the sense or the antisense strand).

[0082] Reference also is made herein to peptides, polypeptides, proteins and compositions comprising peptides, polypeptides, and proteins. As used herein, a polypeptide and / or protein is defined as a polymer of amino acids, typically of length>100 amino acids (Garrett & Grisham, Biochemistry, 2nd edition, 1999, Brooks / Cole, 110). A peptide is defined as a short polymer of amino acids, of a length typically of 20 or less amino acids, and more typically ofa length of 12 or less amino acids (Garrett & Grisham, Biochemistry, 2nd edition, 1999, Brooks / Cole, 110).

[0083] A “functional fragment” as referred to herein comprises a portion of a polypeptide which retains its functional ability. In this case, the functional fragment would retain the ability to perform as a telomerase.

[0084] As disclosed herein, exemplary peptides, polypeptides, proteins may comprise, consist essentially of, or consist of any reference amino acid sequence disclosed herein, or variants of the peptides, polypeptides, and proteins may comprise, consist essentially of, or consist of an amino acid sequence having at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any amino acid sequence disclosed herein, or any amount below, above, or in-between these values. Variant peptides, polypeptides, and proteins may include peptides, polypeptides, and proteins having one or more amino acid substitutions, deletions, additions and / or amino acid insertions relative to a reference peptide, polypeptide, or protein. Also disclosed are nucleic acid molecules that encode the disclosed peptides, polypeptides, and proteins (e.g., polynucleotides that encode any of the peptides, polypeptides, and proteins disclosed herein and variants thereof).

[0085] The term “amino acid,” includes but is not limited to amino acids contained in the group consisting of alanine (Ala or A), cysteine (Cys or C), aspartic acid (Asp or D), glutamic acid (Glu or E), phenylalanine (Phe or F), glycine (Gly or G), histidine (His or H), isoleucine (He or I), lysine (Lys or K), leucine (Leu or L), methionine (Met or M), asparagine (Asn or N), proline (Pro or P), glutamine (Gin or Q), arginine (Arg or R), serine (Ser or S), threonine (Thr or T), valine (Vai or V), tryptophan (Trp or W), and tyrosine (Tyr or Y) residues. The term “amino acid residue” also may include amino acid residues contained in the group consisting of homocysteine, 2-Aminoadipic acid, N-Ethylasparagine, 3-Aminoadipic acid, Hydroxylysine, 0-alanine, [>- Amino-propionic acid, allo-Hydroxylysine acid, 2-Aminobutyric acid, 3 -Hydroxyproline, 4-Aminobutyric acid, 4-Hydroxyproline, piperidinic acid, 6- Aminocaproic acid, Isodesmosine, 2-Aminoheptanoic acid, allo-Isoleucine, 2- Aminoisobutyric acid, N-Methylglycine, sarcosine, 3-Aminoisobutyric acid, N- Methylisoleucine, 2-Aminopimelic acid, 6-N-Methyllysine, 2,4-Diaminobutyric acid, N- Methylvaline, Desmosine, Norvaline, 2,2'-Diaminopimelic acid, Norleucine, 2,3- Diaminopropionic acid, Ornithine, and N-Ethylglycine. Typically, the amide linkages of the peptides are formed from an amino group of the backbone of one amino acid and a carboxyl group of the backbone of another amino acid.

[0086] The peptides, polypeptides, and proteins disclosed herein may be modified to include non-amino acid moieties. Modifications may include but are not limited to carboxylation (e.g., N-terminal carboxylation via addition of a di-carboxylic acid having 4-7 straight-chain or branched carbon atoms, such as glutaric acid, succinic acid, adipic acid, and 4,4-dimethylglutaric acid), amidation (e.g., C-terminal amidation via addition of an amide or substituted amide such as alkylamide or dialkylamide), PEGylation (e.g., N-terminal or C- terminal PEGylation via additional of polyethylene glycol), acylation (e.g., O-acylation (esters), N-acylation (amides), S-acylation (thioesters)), acetylation (e.g., the addition of an acetyl group, either at the N-terminus of the protein or at lysine residues), formylation lipoylation (e.g., attachment of a lipoate, a C8 functional group), myristoylation (e.g., attachment of myristate, a C14 saturated acid), palmitoylation (e.g., attachment of palmitate, a C16 saturated acid), alkylation (e.g., the addition of an alkyl group, such as an methyl at a lysine or arginine residue), isoprenylation or prenylation (e.g., the addition of an isoprenoid group such as farnesol or geranylgeraniol), amidation at C-terminus, glycosylation (e.g., the addition of a glycosyl group to either asparagine, hydroxylysine, serine, or threonine, resulting in a glycoprotein). Distinct from glycation, which is regarded as a nonenzymatic attachment of sugars, polysialylation (e.g., the addition of polysialic acid), glypiation (e.g., glycosylphosphatidylinositol (GPI) anchor formation, hydroxylation, iodination (e.g., of thyroid hormones), and phosphorylation (e.g., the addition of a phosphate group, usually to serine, tyrosine, threonine or histidine).

[0087] Variants comprising deletions relative to a reference amino acid sequence or nucleotide sequence are contemplated herein. A “deletion” refers to a change in the amino acid or nucleotide sequence that results in the absence of one or more amino acid residues or nucleotides relative to a reference sequence. A deletion removes at least 1, 2, 3, 4, 5, 10, 20, 50, 100, or 200 amino acids residues or nucleotides. A deletion may include an internal deletion or a terminal deletion (e.g., an N-terminal truncation or a C-terminal truncation or both of a reference polypeptide or a 5 '-terminal or 3 '-terminal truncation or both of a reference polynucleotide).

[0088] Variants comprising a fragment of a reference amino acid sequence or nucleotide sequence are contemplated herein. A “fragment” is a portion of an amino acid sequence or a nucleotide sequence which is identical in sequence to but shorter in length than the reference sequence. A fragment may comprise up to the entire length of the reference sequence, minus at least one nucleotide / amino acid residue. For example, a fragment may comprise from 5 to 1000 contiguous nucleotides or contiguous amino acid residues of a reference polynucleotide1or reference polypeptide, respectively. In some embodiments, a fragment may comprise at least 5, 10, 15, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, 100, 150, 250, or 500 contiguous nucleotides or contiguous amino acid residues of a reference polynucleotide or reference polypeptide, respectively. Fragments may be preferentially selected from certain regions of a molecule, for example the N-terminal region and / or the C-terminal region of a polypeptide or the 5'-terminal region and / or the 3' terminal region of a polynucleotide. The term “at least a fragment” encompasses the full length polynucleotide or full length polypeptide.

[0089] Variants comprising insertions or additions relative to a reference sequence are contemplated herein. The words “insertion” and “addition” refer to changes in an amino acid or nucleotide sequence resulting in the addition of one or more amino acid residues or nucleotides. An insertion or addition may refer to 1, 2, 3, 4, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, or 200 amino acid residues or nucleotides.

[0090] Fusion proteins and fusion polynucleotides also are contemplated herein. A “fusion protein” refers to a protein formed by the fusion of at least one peptide, polypeptide, protein or variant thereof as disclosed herein to at least one molecule of a heterologous peptide, polypeptide, protein or variant thereof. The heterologous protein(s) may be fused at the N- terminus, the C-terminus, or both termini. A fusion protein comprises at least a fragment or variant of the heterologous protein(s) that are fused with one another, preferably by genetic fusion (i.e., the fusion protein is generated by translation of a nucleic acid in which a polynucleotide encoding all or a portion of a first heterologous protein is joined in-frame with a polynucleotide encoding all or a portion of a second heterologous protein). The heterologous protein(s), once part of the fusion protein, may each be referred to herein as a “portion”, “region” or “moiety” of the fusion protein.

[0091] A fusion polynucleotide refers to the fusion of the nucleotide sequence of a first polynucleotide to the nucleotide sequence of a second heterologous polynucleotide (e.g., the 3' end of a first polynucleotide to a 5' end of the second polynucleotide). Where the first and second polynucleotides encode proteins, the fusion may be such that the encoded proteins are in-frame and results in a fusion protein. The first and second polynucleotide may be fused such that the first and second polynucleotide are operably linked (e.g., as a promoter and a gene expressed by the promoter as discussed below).

[0092] A “variant,” “mutant,” or “derivative” of a particular nucleic acid sequence may be defined as a nucleic acid sequence having at least 50% sequence identity to the particular nucleic acid sequence over a certain length of one of the nucleic acid sequences using blastnwith the “BLAST 2 Sequences” tool available at the National Center for Biotechnology Information's website. (See Tatiana A. Tatusova, Thomas L. Madden (1999), “Blast 2 sequences — a new tool for comparing protein and nucleotide sequences”, FEMS Microbiol Lett. 174:247-250). In some embodiments a variant polynucleotide may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to a reference polynucleotide.

[0093] Nucleic acid sequences that do not show a high degree of identity may nevertheless encode similar amino acid sequences due to the degeneracy of the genetic code. It is understood that changes in a nucleic acid sequence can be made using this degeneracy to produce multiple nucleic acid sequences that all encode substantially the same protein.

[0094] “Operably linked” refers to the situation in which a first nucleic acid sequence is placed in a functional relationship with a second nucleic acid sequence. For instance, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. Operably linked DNA sequences may be in close proximity or contiguous and, where necessary to join two protein coding regions, in the same reading frame.

[0095] A “recombinant nucleic acid” is a sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two or more otherwise separated segments of sequence. This artificial combination is often accomplished by chemical synthesis or, more commonly, by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques such as those described in Sambrook, J. et al. (1989) Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1 3, Cold Spring Harbor Press, Plainview N.Y. The term recombinant includes nucleic acids that have been altered solely by addition, substitution, or deletion of a portion of the nucleic acid. Frequently, a recombinant nucleic acid may include a nucleic acid sequence operably linked to a promoter sequence. Such a recombinant nucleic acid may be part of a vector that is used, for example, to transform a cell.

[0096] “Transformation” describes a process by which exogenous DNA is introduced into a recipient cell. Transformation may occur under natural or artificial conditions according to various methods well known in the art, and may rely on any known method for the insertion of foreign nucleic acid sequences into a prokaryotic or eukaryotic host cell. The method for transformation is selected based on the type of host cell being transformed and may include, but is not limited to, bacteriophage or viral infection, electroporation, heat shock, lipofection, and particle bombardment. The term “transformed cells” includes stably transformed cells inwhich the inserted DNA is capable of replication either as an autonomously replicating plasmid or as part of the host chromosome, as well as transiently transformed cells which express the inserted DNA or RNA for limited periods of time.

[0097] “Substantially isolated or purified” nucleic acid or amino acid sequences are contemplated herein. The term “substantially isolated or purified” refers to nucleic acid or amino acid sequences that are removed from their natural environment, and are at least 60% free, preferably at least 75% free, and more preferably at least 90% free, even more preferably at least 95% free from other components with which they are naturally associated.

[0098] In some aspects, the telomerase or a functional fragment thereof, or nucleic acid encoding the same, can be derived from a mammal. In some aspects, the mammal can be swine, human, bovine, or primate. In some aspects, telomerase or a functional fragment thereof, or nucleic acid encoding the same, can be derived from a bird. In some aspects, the bird can be poultry.

[0099] In another aspect, provided is a nanoparticle, wherein said nanoparticle can include an ionizable lipid encapsulating a telomerase or a functional fragment of a telomerase. mRNA

[0100] In a particular embodiment, the telomerase or fragment thereof can be encoded by mRNA. Desired mRNA sequence(s) according to the invention may be determined and incorporated into a DNA template using standard methods. For example, starting from a desired amino acid sequence (e.g., an enzyme sequence), a virtual reverse translation is carried out based on the degenerated genetic code. Optimization algorithms may then be used for selection of suitable codons. Typically, the G / C content can be optimized to achieve the highest possible G / C content on one hand, taking into the best possible account the frequency of the tRNAs according to codon usage on the other hand. The optimized RNA sequence can be established and displayed, for example, with the aid of an appropriate display device and compared with the original (wild-type) sequence. A secondary structure can also be analyzed to calculate stabilizing and destabilizing properties or, respectively, regions of the RNA. Typically, mRNA sequences are codon-optimized for use in accordance with the invention. Codon-optimization is performed to optimize expression in target cells. For example, if the mRNA is for delivery to a human subject, the mRNA will be codon-optimized for expression in human cells.

[0101] mRNA according to the present invention may be synthesized as unmodified or modified mRNA. Typically, mRNAs are modified to enhance stability. Modifications of mRNA can include, for example, modifications of the nucleotides of the RNA. An modified mRNA according to the invention can thus include, for example, backbone modifications,sugar modifications or base modifications. In some embodiments, mRNAs may be synthesized from naturally occurring nucleotides and / or nucleotide analogues (modified nucleotides) including, but not limited to, purines (adenine (A), guanine (G)) or pyrimidines (thymine (T), cytosine (C), uracil (U)), and as modified nucleotides analogues or derivatives of purines and pyrimidines. The preparation of such analogues is known to a person skilled in the art e.g. from the U.S. Pat. Nos. 4,373,071, 4,401,796, 4,415,732, 4,458,066, 4,500,707, 4,668,777, 4,973,679, 5,047,524, 5,132,418, 5,153,319, 5,262,530 and 5,700,642, the disclosures of which are incorporated by reference in their entirety.

[0102] The mRNAs disclosed herein may contain RNA backbone modifications for example. Typically, a backbone modification is a modification in which the phosphates of the backbone of the nucleotides contained in the RNA are modified chemically. Exemplary backbone modifications typically include, but are not limited to, modifications from the group consisting of methylphosphonates, methylphosphoramidates, phosphoramidates, phosphorothioates (e.g. cytidine 5’-O-(l-thiophosphate)), boranophosphates, positively charged guanidinium groups etc., which means by replacing the phosphodiester linkage by other anionic, cationic or neutral groups.

[0103] mRNAs can also contain sugar modifications. A typical sugar modification is a chemical modification of the sugar of the nucleotides it contains including, but not limited to, sugar modifications chosen from the group consisting of 2'-deoxy-2'-fluoro- oligoribonucleotide (2'-fluoro-2’-deoxycytidine 5'-triphosphate, 2'-fluoro-2'-deoxyuridine 5'- triphosphate), 2'-deoxy-2'-deamine-oligoribonucleotide (2'-amino-2'-deoxycytidine 5'- triphosphate, 2'-amino-2'-deoxyuridine 5'-triphosphate), 2'-O-alkyloligoribonucleotide, 2'- deoxy-2'-C-alkyloligoribonucleotide (2'-O-methylcytidine 5'-triphosphate, 2’-methyluridine 5’-triphosphate), 2'-C-alkyloligoribonucleotide, and isomers thereof (2'-aracytidine 5'- triphosphate, 2'-arauridine 5'-triphosphate), or azidotriphosphates (2'-azido-2'-deoxycytidine 5'-triphosphate, 2'-azido-2'-deoxyuridine 5 ’-triphosphate).

[0104] mRNAs can contain modifications of the bases of the nucleotides (base modifications). A modified nucleotide which contains abase modification is also called a basemodified nucleotide. Examples of such base-modified nucleotides include, but are not limited to, 2-amino-6-chloropurine riboside 5 '-triphosphate, 2-aminoadenosine 5 '-triphosphate, 2- thiocytidine 5 '-triphosphate, 2-thiouridine 5 '-triphosphate, 4-thiouridine 5'-triphosphate, 5- aminoallylcytidine 5'-triphosphate, 5 -aminoallyluridine 5 '-triphosphate, 5 -bromocytidine 5'- triphosphate, 5-bromouridine 5 '-triphosphate, 5 -iodocytidine 5'-triphosphate, 5-iodouridine 5'- triphosphate, 5 -methylcytidine 5'-triphosphate, 5-methyluridine 5'-triphosphate, 6-azacytidine5’-triphosphate, 6-azauridine 5'-triphosphate, 6-chloropurine riboside 5 '-triphosphate, 7- deazaadenosine 5'-triphosphate, 7-deazaguanosine 5 ’-triphosphate, 8-azaadenosine 5'- triphosphate, 8-azidoadenosine 5 '-triphosphate, benzimidazole riboside 5'-triphosphate, NI- methyladenosine 5 '-triphosphate, Nl-methylguanosine 5'-triphosphate, N6-methyladenosine 5’-triphosphate, 06-methylguanosine 5'-triphosphate, pseudouridine 5 '-triphosphate, puromycin 5 ’-triphosphate or xanthosine 5'-triphosphate.

[0105] Typically, mRNA synthesis includes the addition of a “cap” on the N-terminal (5') end, and a “tail” on the C-terminal (3') end. The presence of the cap is important in providing resistance to nucleases found in most eukaryotic cells. The presence of a “tail” serves to protect the mRNA from exonuclease degradation.

[0106] In some embodiments, mRNAs include a 5’ cap structure. A 5' cap is typically added as follows: first, an RNA terminal phosphatase removes one of the terminal phosphate groups from the 5' nucleotide, leaving two terminal phosphates; guanosine triphosphate (GTP) is then added to the terminal phosphates via a guanylyl transferase, producing a 5'5'5 triphosphate linkage; and the 7-nitrogen of guanine is then methylated by a methyltransferase. Examples of cap structures include, but are not limited to, m7G(5')ppp (5' (A,G(5')ppp(5')A and G(5')ppp(5')G.

[0107] Naturally occurring cap structures comprise a 7-methyl guanosine that is linked via a triphosphate bridge to the 5'-end of the first transcribed nucleotide, resulting in a dinucleotide cap of m7G(5')ppp(5')N, where N is any nucleoside. In vivo, the cap is added enzymatically. The cap is added in the nucleus and is catalyzed by the enzyme guanylyl transferase. The addition of the cap to the 5' terminal end of RNA occurs immediately after initiation of transcription. The terminal nucleoside is typically a guanosine, and is in the reverse orientation to all the other nucleotides, i.e., G(5’)ppp(5')GpNpNp.

[0108] A common cap for mRNA produced by in vitro transcription is m7G(5')ppp(5’)G, which has been used as the dinucleotide cap in transcription with T7 or SP6 RNA polymerase in vitro to obtain RNAs having a cap structure in their 5’-termini. The prevailing method for the in vitro synthesis of capped mRNA employs a pre-formed dinucleotide of the form m7G(5')ppp(5')G (“m7GpppG”) as an initiator of transcription.

[0109] To date, a usual form of a synthetic dinucleotide cap used in in vitro translation experiments is the Anti-Reverse Cap Analog (“ARCA”) or modified ARCA, which is generally a modified cap analog in which the 2' or 3’ OH group is replaced with — OCH3.

[0110] Additional cap analogs include, but are not limited to, a chemical structures selected from the group consisting of m7GpppG, m7GpppA, m7GpppC; unmethylated cap analogs (e.g., GpppG); dimethylated cap analog (e.g., m2,7GpppG), trimethylated cap analog (e.g., m2,2,7GpppG), dimethylated symmetrical cap analogs (e.g., m7Gpppm7G), or anti reverse cap analogs (e.g., ARCA; m7,2'OmeGpppG, m7,2'dGPPpG, m7,3'OmeGpppG, m7,3'dGpppG and their tetraphosphate derivatives) (see, e.g., Jemielity, J. et al., “Novel ‘anti-reverse’ cap analogs with superior translational properties”, RNA, 9: 1108-1122 (2003)).

[0111] In some embodiments, a suitable cap is a 7-methyl guanylate (“m7G”) linked via a triphosphate bridge to the 5 '-end of the first transcribed nucleotide, resulting in m7G(5')ppp(5')N, where N is any nucleoside.

[0112] In some embodiments, a cap can be added co-transcriptionally. For example, in some such embodiments, the cap can be the CleanCap™ AG or the CleanCap™ AG 3’0Me or the CleanCap™ M6A. When used to cap self-amplifying RNA, the CleanCap™ AU analog is preferentially used.

[0113] In some embodiments, the 5 ’cap may be modified by click chemistry to add a ligand that can provide for cell type specificity or localization.

[0114] Typically, the presence of a “tail” serves to protect the mRNA from exonuclease degradation. The poly A tail is thought to stabilize natural messengers and synthetic sense RNA. Therefore, in certain embodiments a long poly A tail can be added to an mRNA molecule thus rendering the RNA more stable. Poly A tails can be added using a variety of art-recognized techniques. For example, long poly A tails can be added to synthetic or in vitro transcribed RNA using poly A polymerase (Yokoe, et al. Nature Biotechnology. 1996; 14: 1252-1256). A transcription vector can also encode long poly A tails. In addition, poly A tails can be added by transcription directly from PCR products. Poly A may also be ligated to the 3' end of a sense RNA with RNA ligase (see, e.g., Molecular Cloning A Laboratory Manual, 2nd Ed., ed. by Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory Press: 1991 edition)).

[0115] In some embodiments, mRNAs include a 3’ poly(A) tail structure. Typically, the length of the poly A tail can be at least about 10, 50, 100, 200, 300, 400 at least 500 nucleotides. In some embodiments, a poly-A tail on the 3' terminus of mRNA typically includes about 10 to 300 adenosine nucleotides (e.g., about 10 to 200 adenosine nucleotides, about 10 to 150 adenosine nucleotides, about 10 to 100 adenosine nucleotides, about 20 to 70 adenosine nucleotides, or about 20 to 60 adenosine nucleotides). A poly-A tail of 10 to 100 adenosine nucleotides, for example of about 20 to 70 adenosine nucleotides, or of about 20 to 60 adenosine nucleotides, is suitable for practicing the invention. In some embodiments, a poly(U)tail may be used to instead of a poly(A) tail described herein. In some embodiments, a poly(U) tail may be added to a poly(A) tail described herein. In some embodiments, mRNAs include a 3’ poly(C) tail structure.

[0116] In some embodiments, the length of the poly(A), poly(U) or poly(C) tail is adjusted to control the stability of a modified sense mRNA molecule of the invention and, thus, the transcription of protein. For example, since the length of a tail structure can influence the halflife of a sense mRNA molecule, the length of the tail can be adjusted to modify the level of resistance of the mRNA to nucleases and thereby control the time course of polynucleotide expression and / or polypeptide production in a target cell.

[0117] In some embodiments, a poly A tail or a multi- valent poly A tail may be added by click chemistry.

[0118] In some embodiments, mRNAs include a 5' and / or 3' untranslated region. In some embodiments, a 5' untranslated region includes one or more elements that affect an mRNA's stability or translation, for example, an iron responsive element. In some embodiments, a 5 ' untranslated region may be between about 50 and 500 nucleotides in length.

[0119] In some embodiments, a 3' untranslated region includes one or more of a polyadenylation signal, a binding site for proteins that affect an mRNA's stability of location in a cell, or one or more binding sites for miRNAs. In some embodiments, a 3’ untranslated region may be between 50 and 500 nucleotides in length or longer.

[0120] Exemplary 3' and / or 5' UTR sequences can be derived from mRNA molecules which are stable (e.g., globin, actin, GAPDH, tubulin, histone, or citric acid cycle enzymes) to increase the stability of the sense mRNA molecule. For example, a 5' UTR sequence may include a partial sequence of a CMV immediate-early 1 (IE1) gene, or a fragment thereof to improve the nuclease resistance and / or improve the half-life of the polynucleotide. Also contemplated is the inclusion of a sequence encoding human growth hormone (hGH), or a fragment thereof to the 3' end or untranslated region of the polynucleotide (e.g., mRNA) to further stabilize the polynucleotide. Generally, these modifications improve the stability and / or pharmacokinetic properties (e.g., half-life) of the polynucleotide relative to their unmodified counterparts, and include, for example modifications made to improve such polynucleotides' resistance to in vivo nuclease digestion.Delivery Vehicles for Telomerase

[0121] According to the present invention, the telomerase or fragment thereof, or a nucleic acid encoding the same, may be delivered as naked peptide or nucleic acid (unpackaged) or viadelivery vehicles. As used herein, the terms “delivery vehicle,” “transfer vehicle,” “nanoparticle” or grammatical equivalent, are used interchangeably.

[0122] In some embodiments, the telomerase or fragment thereof, or a nucleic acid encoding the same, may be delivered via a single delivery vehicle. In some embodiments, the telomerase or fragment thereof, or a nucleic acid encoding the same, may be delivered via one or more delivery vehicles each of a different composition. According to various embodiments, suitable delivery vehicles include, but are not limited to polymer based carriers, such as polyethyleneimine (PEI), lipid nanoparticles and liposomes, nanoliposomes, ceramide- containing nanoliposomes, proteoliposomes, both natural and synthetically-derived exosomes, natural, synthetic and semi-synthetic lamellar bodies, nanoparticulates, calcium phosphorsilicate nanoparticulates, calcium phosphate nanoparticulates, silicon dioxide nanoparticulates, nanocrystalline particulates, semiconductor nanoparticulates, poly(D-arginine), sol-gels, nanodendrimers, starch-based delivery systems, micelles, emulsions, niosomes, multi-domain- block polymers (vinyl polymers, polypropyl acrylic acid polymers, dynamic polyconjugates), cell- or platelet-derived exosomes, ethosomes, or transfersomes.

[0123] In some embodiments, a suitable delivery vehicle is a lipid nanoparticle. As used herein, “lipid nanoparticles” refer to particles having at least one dimension on the order of nanometers (e.g., 1-1000 nm) and including one or more lipids. In the context of the present invention, a lipid nanoparticle typically serves to transport the telomerase or fragment thereof, or a nucleic acid encoding the same, to a target cell or tissue. The process of incorporation of the telomerase or fragment thereof, or a nucleic acid encoding the same, into a lipid nanoparticle is often referred to as “loading”. The lipids and the telomerase or fragment thereof, or a nucleic acid encoding the same, can create a self- assembled structure via counterion interactions. The purpose of incorporating a the telomerase or fragment thereof, or a nucleic acid encoding the same, into a transfer vehicle, such as a lipid nanoparticle, is often to protect the telomerase or fragment thereof, or a nucleic acid encoding the same, from an environment which may contain enzymes or chemicals that degrade peptides / nucleic acids and / or systems or receptors that cause the rapid excretion of peptides / nucleic acids. Accordingly, in some embodiments, a suitable delivery vehicle is capable of enhancing the stability of the the telomerase or fragment thereof, or a nucleic acid encoding the same, contained therein and / or facilitate the delivery of the telomerase or fragment thereof, or a nucleic acid encoding the same, to the target cell or tissue.

[0124] In some embodiments, nanoparticles may comprise one or more ionizable lipids. As used herein, the term “ionizable lipid” refers to a lipid, e.g., cationic lipid, having at leastone protonatable or deprotonatable group, such that the lipid is positively charged at a pH at or below physiological pH (e.g., pH 7.4), and neutral at a second pH, preferably at or above physiological pH. It will be understood by one of ordinary skill in the art that the addition or removal of protons as a function of pH is an equilibrium process, and that the reference to a charged or a neutral lipid refers to the nature of the predominant species and does not require that all of the lipid be present in the charged or neutral form. Generally, ionizable lipids have a pKa of the protonatable group in the range of about 4 to about 7.

[0125] In some aspects, the ionizable lipid can be DLin-MC3-DMA, SM-102, ALC-0315, l,2-dimyristoyl-3-dimethylammonium-propane (DAP), C12-200, 5A2-SC8, [(4- hydroxybutyl)azanediyl]di(hexane-6,l-diyl) bis(2-hexyldecanoate) ALC-135, DODMA, BP Lipid 216, BP Lipid 217 (CAS 2430034-17-4), Lipid III-45 (CAS 2096984-25-5), BP Lipid 226 (CAS 2036272-94-1), 2-[2,2-bis[(9Z,12Z)-octadeca-9,12-dienyl]-l ,3-dioxolan-4-yl]-N,N- dimethylethanamine (DLin-KC2-DMA), KC2, l,2-dilinoleyloxy-n,n-dimethyl-3- aminopropane (DLinDMA), or any combination thereof.

[0126] In some aspects, the nanoparticle can include at least about 30% molar (e.g., at least at least about 32% molar, at least about 34% molar, at least about 36% molar, at least about 38% molar, at least about 40% molar, at least about 42% molar, at least about 44% molar, at least about 46% molar, at least about 48% molar, at least about 50% molar, at least about 52% molar, at least about 54% molar, at least about 56% molar, at least about 58% molar, at least about 60% molar, at least about 62% molar, at least about 64% molar, at least about 66% molar, at least about 68% molar, at least about 70% molar) of the ionizable lipid. In some aspects, the nanoparticle can include up to about 70% molar (e.g., up to about 68% molar, up to about 66% molar, up to about 64% molar, up to about 62% molar, up to about 60% molar, up to about 58% molar, up to about 56% molar, up to about 54% molar, up to about 52% molar, up to about 50% molar, up to about 48% molar, up to about 46% molar, up to about 44% molar, up to about 42% molar, up to about 40% molar, up to about 38% molar, up to about 36% molar, up to about 34% molar, up to about 32% molar, up to about 30% molar) of the ionizable lipid.

[0127] It is considered that the nanoparticle can include an amount of the ionizable lipid ranging from any of the minimum values described above to any of the maximum values described above. For example, in some aspects, the nanoparticle can include from about 30% molar to about 70% molar (e.g., from about 32% molar to about 68% molar, from about 34% molar to about 66% molar, from about 36% molar to about 64% molar, from about 38% molar to about 62% molar, from about 40% molar to about 60% molar, from about 42% molar to about 58% molar, from about 44% molar to about 56% molar, from about 46% molar to about54% molar, from about 48% molar to about 52% molar, from about 30% molar to about 50% molar, from about 32% molar to about 48% molar, from about 34% molar to about 46% molar, from about 36% molar to about 44% molar, from about 38% molar to about 42% molar, from about 50% molar to about 70% molar, from about 52% molar to about 68% molar, from about 54% molar to about 66% molar, from about 56% molar to about 64% molar, from about 58% molar to about 62% molar) of the ionizable lipid.

[0128] Additionally or alternatively, in some aspects, the nanoparticle can include a cationic lipid, for example, 1 ,2-dioleoyl-3-trimethylammonium propane (DOTAP), DOTMA (CAS 104162-48-3), SM-102 N-oxide (CAS 2824195-50-6), TAP (CAS 197974-74-6, 139984-36-4, 220609-41-6, 144189-73-1), or any combination thereof.

[0129] In some aspects, the nanoparticle can further include a phospholipid, a PEGylated lipid, a cholesterol, or any combination thereof.

[0130] In some aspects, the phospholipid can be phosphatidylcholine, egg phosphatidic acid, 1,2-dioleoyl-sn-glycerophosphocholine (DOPC), 1,2-diolyl-sn- lycerophosphoethanolamine (DOPE), 1,2-dipalmitoyl-sn-glycerophosphocholine (DPPC), 1,2-distearoyl-sn-glycerophosphocholine (DSPC), L-a-phosphatidylserine (PS), 1 ,2-dioleoyl- sn-glycero-3-phospho-(l'-rac-glycerol) (DOPG), soybean phosphatidylcholine, 1 -palmitoyl-2- oleoyl-sn-glycero-3-phosphoethanolamine (POPE), 1 ,2-di-O-phytanyl-sn-glycero-3- phosphoethanolamine (4ME), l-palmitoyl-2-oleoyl-glycero-3-phosphocholine (POPC), 1- stearoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine (SOPE), 1 ,2-dielaidoyl-sn-glycero-3- phosphoethanolamine (DEPE), 1 -hexadecyl-2-(9Z-octadecenoyl)-sn-glycero-3- phosphoethanolamine (C16— 18: 1), l-stearoyl-2-oleoyl-sn-glycero-3-phosphocholine (SOPC), N-(7-nitrobenz-2-oxa-l , 3 -diazol-4-yl) -phosphatidylethanolamine (NBD-PE), sphingomyelin (SM), phosphatidylinositol (PI) from soybean, sn-(3-(9Z-octadecenoyl)-2-hydroxy)-glycerol- l-phospho-sn-3’-(l ’-(9Z-octadecenoyl)-2’-hydroxy)-glycerol (BMP-S,R), and sn-(3-oleoyl-2- hydroxy)-glycerol-l-phospho-sn-r-(3’-oleoyl-2’-hydroxy)-glycerol (BMP-S,S), or any combination thereof.

[0131] In some aspects, the nanoparticle can include at least about 5% molar (e.g., at least about 10% molar, at least about 15% molar, at least about 20% molar, at least about 25% molar, at least about 30% molar, at least about 35% molar, at least about 40% molar, at least about 45% molar, at least about 50% molar) of the phospholipid. In some aspects, the nanoparticle can include up to about 50% molar (e.g., up to about 45% molar, up to about 40% molar, up to about 35% molar, up to about 30% molar, up to about 25% molar, up to about 20% molar, up to about 15% molar, up to about 10% molar, up to about 5% molar) of the phospholipid.

[0132] It is considered that the nanoparticle can include an amount of the phospholipid ranging from any of the minimum values described above to any of the maximum values described above. For example, in some aspects, the nanoparticle can include from about 5% molar to about 50% molar (e.g., from about 10% molar to about 45% molar, from about 15% molar to about 40% molar, form about 20% molar to about 35% molar, from about 25% molar to about 30% molar, from about 5% molar to about 30% molar, from about 10% molar to about 25% molar, from about 15% molar to about 20% molar, from about 25% molar to about 50% molar, from about 30% molar to about 45% molar, from about 35% molar to about 40% molar) of the phospholipid.

[0133] In some aspects, the PEGylated lipid can be DMG-PEG2000, ALC-0159, DSPE- PEG2000, DOPE-PEG2000, 18: 1 PEG1000-PE, PEG-carbamate-l,2-dimyristoyl-sn-glycerol (PEG-c-DMG), PEG-DSG, or any combination thereof.

[0134] In some aspects, the nanoparticle can include at least about 1% molar (e.g., at least about 2% molar, at least about 3% molar, at least about 4% molar, at least about 5% molar, at least about 6% molar, at least about 7% molar, at least about 8% molar, at least about 9% molar, at least about 10% molar) of the PEGylated lipid. In some aspects, the nanoparticle can include up to about 10% molar (e.g., up to about 9% molar, up to about 8% molar, up to about 7% molar, up to about 6% molar, up to about 5% molar, up to about 4% molar, up to about 3% molar, up to about 2% molar, up to about 1% molar) of the PEGylated lipid.

[0135] It is considered that the nanoparticle can include an amount of the PEGylated lipid ranging from any of the minimum values described above to any of the maximum values described above. For example, in some aspects, the nanoparticle can include from about 1% molar to about 10% molar (e.g., from about 2% molar to about 9% molar, from about 3% molar to about 8% molar, from about 4% molar to about 7% molar, from about 5% molar to about 6% molar, from about 1% molar to about 6% molar, from about 2% molar to about 5% molar, from about 3% molar to about 4% molar, from about 5% molar to about 10% molar, from about 6% molar to about 9% molar, from about 7% molar to about 8% molar) of the PEGylated lipid.

[0136] In some aspects, the nanoparticle can include at least about 20% molar (e.g., at least about 22% molar, at least about 24% molar, at least about 26% molar, at least about 28% molar, at least about 30% molar, at least about 32% molar, at least about 34% molar, at least about 36% molar, at least about 38% molar, at least about 40% molar, at least about 42% molar, at least about 44% molar, at least about 46% molar, at least about 48% molar, at least about 50% molar, at least about 52% molar, at least about 54% molar, at least about 56% molar, at least about 58% molar, at least about 60% molar) of the cholesterol. In some aspects, thenanoparticle can include up to about 60% molar (e.g., up to about 58% molar, up to about 56% molar, up to about 54% molar, up to about 52% molar, up to about 50% molar, up to about 48% molar, up to about 46% molar, up to about 44% molar, up to about 42% molar, up to about 40% molar, up to about 38% molar, up to about 36% molar, up to about 34% molar, up to about 32% molar, up to about 30% molar, up to about 28% molar, up to about 26% molar, up to about 24% molar, up to about 22% molar, up to about 20% molar) of the cholesterol.

[0137] It is considered that the nanoparticle can include an amount of the cholesterol ranging from any of the minimum values described above to any of the maximum values described above. For example, in some aspects, the nanoparticle can include from about 20% molar to about 60% molar (e.g., from about 22% molar to about 58% molar, from about 24% molar to about 56% molar, from about 26% molar to about 54% molar, from about 28% molar to about 52% molar, from about 30% molar to about 50% molar, from about 32% molar to about 48% molar, from about 34% molar to about 46% molar, from about 36% molar to about 44% molar, from about 38% molar to about 42% molar, from about 20% molar to about 40% molar, from about 22% molar to about 38% molar, from about 24% molar to about 36% molar, from about 26% molar to about 34% molar, from about 28% molar to about 32% molar, from about 40% molar to about 60% molar, from about 42% molar to about 58% molar, from about 44% molar to about 56% molar, from about 46% molar to about 54% molar, from about 48% molar to about 52% molar) of the cholesterol.

[0138] In some aspects, the nanoparticle can have a diameter of at least about 50 nm (e.g., at least about 60 nm, at least about 70 nm, at least about 80 nm, at least about 90 nm, at least about 100 nm, at least about 110 nm, at least about 120 nm, at least about 130 nm, at least about 140 nm, at least about 150 nm, at least about 160 nm, at least about 170 nm, at least about 180 nm, at least about 190 nm, at least about 200 nm, at least about 210 nm, at least about 220 nm, at least about 230 nm, at least about 240 nm, at least about 250 nm, at least about 260 nm, at least about 270 nm, at least about 280 nm, at least about 290 nm, at least about 300 nm). In some aspects, the nanoparticle can have a diameter of up to about 300 nm (e.g., up to about 290 nm, up to about 280 nm, up to about 270 nm, up to about 260 nm, up to about 250 nm, up to about 240 nm, up to about 230 nm, up to about 220 nm, up to about 210 nm, up to about 200 nm, up to about 190 nm, up to about 180 nm, up to about 170 nm, up to about 160 nm, up to about 150 nm, up to about 140 nm, up to about 130 nm, up to about 120 nm, up to about 110 nm, up to about 100 nm, up to about 90 nm, up to about 80 nm, up to about 70 nm, up to about 60 nm, up to about 50 nm).

[0139] It is considered that the nanoparticle can have a diameter ranging from any of the minimum values described above to any of the maximum values described above. For example, in some aspects, the nanoparticle can have a diameter of from about 50 nm to about 300 nm (e.g., from about 60 nm to about 290 nm, from about 70 nm to about 280 nm, from about 80 nm to about 270 nm, from about 90 nm to about 260 nm, from about 100 nm to about 250 nm, from about 110 nm to about 240 nm, from about 120 nm to about 230 nm, from about 130 nm to about 220 nm, from about 140 nm to about 210 nm, from about 150 nm to about 200 nm, from about 160 nm to about 190 nm, from about 170 nm to about 180 nm, from about 50 nm to about 180 nm, from about 60 nm to about 170 nm, from about 70 nm to about 160 nm, from about 80 nm to about 150 nm, from about 90 nm to about 140 nm, from about 100 nm to about 130 nm, from about 110 nm to about 120 nm, from about 170 nm to about 300 nm, from about 180 nm to about 290 nm, from about 190 nm to about 280 nm, from about 200 nm to about 270 nm, from about 210 nm to about 260 nm, from about 220 nm to about 250 nm, from about 230 nm to about 240 nm).

[0140] In some aspects, the nanoparticle can have a zeta potential of at least about -20 mV (e.g., at least about -19 mV, at least about -18 mV, at least about -17 mV, at least about -16 mV, at least about -15 mV, at least about -14 mV, at least about -13 mV, at least about -12 mV, at least about -11 mV, at least about -10 mV, at least about -9 mV, at least about -8 mV, at least about -7 mV, at least about -6 mV, at least about -5 mV, at least about -4 mV, at least about -3 mV, at least about -2 mV, at least about -1 mV, at least about 0 mV, at least about 1 mV, at least about 2 mV, at least about 3 mV, at least about 4 mV, at least about 5 mV, at least about 6 mV, at least about 7 mV, at least about 8 mV, at least about 9 mV, at least about 10 mV). In some aspects, the nanoparticle can have a zeta potential of up to about 10 mV (e.g., up to about 9 mV, up to about 8 mV, up to about 7 mV, up to about 6 mV, up to about 5 mV, up to about 4 mV, up to about 3 mV, up to about 2 mV, up to about 1 mV, up to about 0 mV, up to about -1 mV, up to about -2 mV, up to about -3 mV, up to about -4 mV, up to about -5 mV, up to about -6 mV, up to about -7 mV, up to about -8 mV, up to about -9 mV, up to about -10 mV, up to about -11 mV, up to about -12 mV, up to about -13 mV, up to about -14 mV, up to about -15 mV, up to about -16 mV, up to about -17 mV, up to about -18 mV, up to about -19 mV, up to about -20 mV).

[0141] It is considered that the nanoparticle can have a zeta potential ranging from any of the minimum values described above to any of the maximum values described above. For example, in some aspects, the nanoparticle can have a zeta potential of from about -20 mV to about 10 mV (e.g., from about -19 mV to about 9 mV, from about -18 mV to about 8 mV, fromabout -17 mV to about 7 mV, from about -16 mV to about 6 mV, from about -15 mV to about 5 mV, from about -14 mV to about 4 mV, from about -13 mV to about 3 mV, from about -12 mV to about 2 mV, from about -11 mV to about 1 mV, from about -10 mV to about 0 mV, from about -9 mV to about -1 mV, from about -8 mV to about -2 mV, from about -7 mV to about -3 mV, from about -6 mV to about -4 mV, from about -20 mV to about 1 mV, from about -19 mV to about 0 mV, from about -18 mV to about -1 mV, from about -17 mV to about -2 mV, from about -16 mV to about -3 mV, from about -15 mV to about -4 mV, from about -14 mV to about -5 mV, from about -13 mV to about -6 mV, from about -12 mV to about -7 mV, from about -11 mV to about -8 mV, from about -10 mV to about -9 mV, from about -20 mV to about -9 mV, from about -19 mV to about -10 mV, from about -18 mV to about -11 mV, from about -17 mV to about -12 mV, from about -16 mV to about -13 mV, from about -15 mV to about -14 mV, from about -10 mV to about 1 mV, from about -9 mV to about 0 mV, from about -8 mV to about -1 mV, from about -7 mV to about -2 mV, from about -6 mV to about - 3 mV, from about -5 mV to about -4 mV).Compositions Comprising Nanoparticles

[0142] In yet another aspect, provided is a composition including any of the disclosed nanoparticles, wherein the nanoparticle comprises a telomerase or a functional fragment thereof, or a nucleic acid encoding said telomerase or functional fragment thereof, as described above. In yet still another aspect, provided is a composition including a telomerase or a functional fragment thereof.

[0143] Therapeutic application of compositions disclosed herein can be accomplished by any suitable therapeutic method and technique presently or prospectively known to those skilled in the art. For example, the composition can include a pharmaceutically acceptable carrier. In some such aspects, the pharmaceutically acceptable carrier can be a gel or cream.

[0144] Compositions disclosed herein can be locally administered at one or more anatomical sites, such as sites of radiation, e.g., injected or topically applied to the skin, optionally in combination with a pharmaceutically acceptable carrier such as an inert diluent. The compositions disclosed herein can be systemically administered, such as intravenously, optionally in combination with a pharmaceutically acceptable carrier such as an inert diluent.

[0145] Compositions disclosed herein can be administered intravenously, intramuscularly, intra-arterially, or intraperitoneally by infusion or injection. Solutions of the active agent or its salts can be prepared in water, optionally mixed with a nontoxic surfactant. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, triacetin, and mixtures thereof and inoils. Under ordinary conditions of storage and use, these preparations can contain a preservative to prevent the growth of microorganisms.

[0146] The pharmaceutical dosage forms suitable for injection or infusion can include sterile aqueous solutions or dispersions or sterile powders comprising the active ingredient, which are adapted for the extemporaneous preparation of sterile injectable or infusible solutions or dispersions, optionally encapsulated in lipid nanoparticles. The ultimate dosage form should be sterile, fluid and stable under the conditions of manufacture and storage. The liquid carrier or vehicle can he a solvent or liquid dispersion medium comprising, for example, water, ethanol, a polyol (for example, glycerol, propylene glycol, liquid polyethylene glycols, and the like), vegetable oils, nontoxic glyceryl esters, and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the formation of lipid nanoparticles, by the maintenance of the required particle size in the case of dispersions or by the use of surfactants. Optionally, the prevention of the action of microorganisms can be brought about by various other antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, buffers or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the inclusion of agents that delay absorption, for example, aluminum monostearate and gelatin.

[0147] Sterile injectable solutions are prepared by incorporating a compound and / or agent disclosed herein in the required amount in the appropriate solvent with various other ingredients enumerated above, as required, followed by filter sterilization. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and the freeze drying techniques, which yield a powder of the active ingredient plus any additional desired ingredient present in the previously sterile-filtered solutions.

[0148] For topical administration, compositions disclosed herein can be applied in as a liquid or solid. However, it will generally be desirable to administer them topically to the skin as compositions, in combination with a dermatologically acceptable carrier, which can be a solid or a liquid or semi-solid, such as a gel or cream. Compounds and agents and compositions disclosed herein can be applied topically to a subject’s skin to reduce or prevent radiation damage, optionally in combination with delivery systems for skin permeation enhancement and / or disruption of the stratum comeum as described below. Preferably, the compositions can be applied to the site in a formulation such as an ointment, cream, lotion, solution, suspension,tincture, or the like. Drug delivery systems for delivery of pharmacological substances to dermal areas can also be used, such as that described in U.S. Patent No. 5,167,649.

[0149] Useful solid carriers include finely divided solids such as talc, clay, microcrystalline cellulose, silica, alumina and the like. Useful liquid carriers include water, alcohols or glycols or water- alcohol / gly col blends, in which the compounds can be dissolved or dispersed at effective levels, optionally with the aid of non-toxic surfactants. Adjuvants such as fragrances and additional antimicrobial agents can be added to optimize the properties for a given use. The resultant liquid compositions can be applied from absorbent pads, used to impregnate bandages and other dressings, or sprayed onto the affected area using pump-type or aerosol sprayers, for example.

[0150] Thickeners such as synthetic polymers, fatty acids, fatty acid salts and esters, fatty alcohols, modified celluloses or modified mineral materials can also be employed with liquid carriers to form spreadable pastes, gels, ointments, soaps, and the like, for application directly to the skin of the user. Examples of useful dermatological compositions which can be used to deliver a compound to the skin are disclosed in U.S. Patent No. 4,608,392; U.S. Patent No. 4,992,478; U.S. Patent No. 4,559,157; and U.S. Patent No. 4,820,508.

[0151] The disclosed compositions can further include one or more penetration enhancers to aid topical administration. The term “penetration enhancer” has been used to describe compounds or materials or substances that facilitate drug absorption through the skin. These compounds or materials or substances can have a direct effect on the permeability of the skin, or they can augment percutaneous absorption by increasing the thermodynamic activity of the penetrant, thereby increasing the effective escaping tendency and concentration gradient of the diffusing species. The predominant effect of these enhancers is to either increase the stratum comeum’s degree of hydration or disrupt its lipoprotein matrix, the net result in either case being a decrease in resistance to drug (penetrant) diffusion (Remington, The Science and Practice of Pharmacy, 22nd ed.).

[0152] Non-limiting examples of skin penetration enhancers include oleyl alcohol, isopropyl myristate, and Diethylene Glycol Monoethyl Ether (DGME) which is available under the trade name TRANSCUTOL P. Another skin penetration enhancer includes surfactant based non-LNP nanoemulsions. Other examples of skin penetration enhancers can be found in “Skin Penetration Enhancers Cited in the Technical Literature”, Osborne, David W., and Henke, Jill J., Pharmaceutical Technology, November 1997, herein incorporated by reference. Such examples include: Fatty alcohols such as aliphatic alcohols, Decanol, Lauryl alcohol (dodecanol), Linolenyl alcohol, Nerolidol, 1 -Nonanol, n-Octanol, Oleyl alcohol, Fatty acidesters, Butylacetate, Cetyl lactate, Decyl N,N-dimethylamino acetate, Decyl N,N- dimethylamino isopropionate, Diethyleneglycol oleate, Diethyl sebacate, Diethyl succinate, Diisopropyl sebacate, Dodecyl N,N-dimethylamino acetate, Dodecyl (N,N-dimethylamino)- butyrate, Dodecyl N,N-dimethylamino isopropionate, Dodecyl 2-(dimethylamino) propionate, EO-5-oleyl ester, Ethyl acetate, Ethylaceto acetate, Ethyl propionate, Glycerol monoethers, Glycerol monolaurate, Glycerol monooleate, Glycerol monolinoleate, Isopropyl isostearate, Isopropyl linoleate, Isopropyl myristate, Isopropyl myristate / fatty acid monoglyceride combination, Isopropyl myristate / ethanol / L-lactic acid (87:10:3) combination, Isopropyl palmitate, Methyl acetate, Methyl caprate, Methyl laurate, Methyl propionate, Methyl valerate, 1-Monocaproyl glycerol, Monoglycerides (medium chain length), Nicotinic esters (benzyl), Octyl acetate, Octyl N,N-dimethylamino acetate, Oleyl oleate, n-Pentyl N-acetylprolinate, Propylene glycol monolaurate, Sorbitan dilaurate, Sorbitan dioleate, Sorbitan monolaurate, Sorbitan monooleates, Sorbitan trilaurate, Sorbitan trioleate, Sucrose coconut fatty ester mixtures, Sucrose monolaurate, Sucrose monooleate, and Tetradecyl N,N-dimethylamino acetate; Fatty acids such as Alkanoic acids, Capric acid, Diacid, Ethyloctadecanoic acid, Hexanoic acid, Lactic acid, Lauric acid, Linoelaidic acid, Linoleic acid, Linolenic acid, Neodecanoic acid, Oleic acid, Palmitic acid, Pelargonic acid, Propionic acid, and Vaccenic acid; Fatty alcohol ethers such as a-Monoglyceryl ether, EO-2-oleyl ether, EO-5-oleyl ether, EO-10-oleyl ether, and Ether derivatives of polyglycerols and alcohols (l-O-dodecyl-3-O- methyl-2-0-(2', 3 '-dihydroxy propyl) glycerol); Biologies such as L-a-amino-acids, Lecithin, Phospholipids, Saponin / phospholipids, Sodium deoxycholate, Sodium taurocholate, and Sodium tauroglycocholate; Enzymes such as Acid phosphatase, Calonase, Orgelase, Papain, Phospholipase A-2, Phospholipase C, and Triacylglycerol hydrolase; Amines and Amides such as Acetamide derivatives, Acyclic amides, N-Adamantyl n-alkanamides, Clofibric acid amides, N,N-Didodecyl acetamide, Di-2-ethylhexylamine, Diethyl methyl benzamide, N,N- DiethyLm-tolu amide, N,N-Dimethyl-m-toluarnide, Ethomeen S12 [bis-(2-hydroxyethyl) oleylamine], Hexamethylene lauramide, Lauryl-amine (dodecylamine), Octyl amide, Oleylamine, Unsaturated cyclic ureas, and Urea; Complexing Agents such as, [3- and y- cyclodextrin complexes, Hydroxypropyl methylcellulose, Liposomes, Naphthalene diamide diimide, and Naphthalene diester diimide; Macrocyclics such as Macrocyclic lactones, ketones, and anhydrides (optimum ring-16), and Unsaturated cyclic ureas; Classical surfactants such as Brij 30, Brij 36T, Brij 35, Brij 52, Brij 56, Brij 58, Brij 72, Brij 76, Brij 78, Brij 92, Brij 96, Brij 98, Cetyl trimethyl ammonium bromide, Empicol ML26 / F, HCO-60 surfactant, Hydroxypolyethoxydodecane, Ionic surfactants (ROONa, ROSOrNa, RNH3CI, R=8-16),Lauroyl sarcosine, Nonionic surface active agents, Nonoxynol, Octoxynol, Phenylsulfonate CA, Pluronic F68, Plutonic F 127, Pluronic L62, Polyoleates (nonionic surfactants), Rewopal HV 10, Sodium laurate, Sodium Lauryl sulfate (sodium dodecyl sulfate), Sodium oleate, Sorbitan dilaurate, Sorbitan dioleate, Sorbitan monolaurate, Sorbitan monooleates, Sorbitan trilaurate, Sorbitan trioleate, Span 20, Span 40, Span 85, Synperonic NP, Triton X-100, Tween 20, Tween 40, Tween 60, Tween 80, and Tween 85; N-methyl pyrrolidone and related compounds such as N-Cyclohexyl-2-pyrrolidone, l-Butyl-3-dodecyL2-pyrrolidone, 1,3- Dimethyl-2-imidazolikinone, 1 ,5 Dimethyl-2-pyrrolidone, 4,4-Dimethyl-2-undecyl-2- oxazoline, l-Ethyl-2-pyrrolidone, l-Hexyl-4-methyloxycarbonyl-2-pyrrolidone, l-Hexyl-2- pyrrolidone, l-(2-Hydroxy ethyl) pyrrolidinone, 3-Hydroxy-N-methyl-2-pyrrolidinone, 1- isopropyl-2-undecyl-2-imidazoline, 1 -Lauryl-4-melhyloxycarbonyl-2-pyrrolidone, N-Methyl- 2-pyrrolidone, Poly(N-vinylpyrrolidone), Pyroglutamic acid esters, and 2-Pyrrolidone (2- pyrrolidinone); Ionic compounds such as Ascorbate, Amphoteric cations and anions, Calcium thioglycolate, Cetyl trimethyl ammonium bromide, 3,5-Diiodosalicylate sodium, Lauroylcholine iodide, 5-Methoxysalicylate sodium, Monoalkyl phosphates, 2-PAM chloride, 4-PAM chloride (derivatives of N-methyl picolinium chloride), Sodium carboxylate, and Sodium hyaluronate; Dimethyl sulfoxide and related compounds such as Cyclic sulfoxides, Decylmethyl sulfoxide, Dimethyl sulfoxide (DMSO), and 2-Hydroxyundecyl methyl sulfoxide; Solvents and related compounds such as Acetone, n- Alkanes (chain length between 7 and 16), Cyclohexyl- 1,1 -dimethylethanol, Dimethylacetamide, Dimethyl formamide, Ethanol, Ethanol / d- limonene combination, 2-Ethyl-l,3-hexanediol, Ethoxydiglycol (TRANSCUTOL), Glycerol, Glycols, Lauryl chloride, Limonene, N-Methylformamide, 2- Phenylethanol, 3-Phenyl-l -propanol, 3-Phenyl-2-propen-l-ol, Polyethylene glycol, Polyoxyethylene sorbitan monoesters, Polypropylene glycol, Primary alcohols (tridecanol), Propylene glycol, Squalene, Triacetin, Trichloroethanol, Trifluoroethanol, Trimethylene glycol, and Xylene; Azone and related compounds such as N-Acyl-hexahydro-2-oxo-lH- azepines, N-Alkyl-dihydro-l,4-oxazepine-5, 7-diones, N-Alkylmorpholine-2, 3-diones, N- Alkylmorpholine-3, 5-diones, Azacycloalkane derivatives (-ketone, -thione), Azacycloalkenone derivatives, l-[2-(Decylthio)ethyl]azacyclopentan-2-one (HPE-101), N- (2,2-Dihydroxyethyl)dodecylamine, 1 -Dodecanoy lhexahydro- 1 -H-azepine, 1 -Dodecyl azacycloheptan-2-one (azone or laurocapram), N-Dodecyl diethanolamine, N-DodecyL hexahydro-2-thio-l H-azepine, N-Dodecyl-N-(2-methoxyethyl)acetamide, N-Dodecyl-N-(2- methoxyethyl) isobutyramide, N-Dodecyl-piperidine-2-thione, N-Dodecyl-2-piperidinone, N- Dodecyl pyrrolidine-3, 5-dione, N-Dodecyl pyrrolidine-2-thione, N-Dodecyl-2-pyrrolidone, 1-Famesylazacycloheptan-2-one, 1-F amesylazacyclopentan-2-one, l-Geranylazacycloheptan-2- one, 1 -Geranylazacyclopentan-2-one, Hexahydro-2-oxo-azepine- 1 -acetic acid esters, N-(2- Hydroxyethyl)-2-pyrrolidone, 1 -Laurylazacycloheptane, 2-(l-Nonyl)-l,3-dioxolane, 1-N- Octylazacyclopentan-2-one, N-(l-Oxododecyl)-hexahydro-lH-azepine, N-( 1- Oxododecyl) - morpholines, 1-Oxohydrocarbyl-substituted azacyclohexanes, N-(l-Oxotetradecyl)- hexahydro-2-oxo-lH-azepine, and N-(l-Thiododecyl)-morpholines; and others such as Aliphatic thiols, Alkyl N,N-dialkyl-substituted amino acetates, Anise oil, Anticholinergic agent pretreatment, Ascaridole, Biphasic group derivatives, Bisabolol, Cardamom oil, 1 - Carvone, Chenopodium (70% ascaridole), Chenopodium oil, 1,8 Cineole (eucalyptol), Cod liver oil (fatty acid extract), 4-Decyloxazolidin-2-one, Dicyclohexylmethylamine oxide, Diethyl hexadecylphosphonate, Diethyl hexadecylphosphoramidate, N,N-Dimethyl dodecylamine-N-oxide, 4, 4-Dimelhyl-2-undecyl-2-oxazoline, N-Dodecanoyl-L-amino acid methyl esters, 1,3-Dioxacycloalkanes (SEP As), Dithiothreitol, Eucalyptol (cineole), Eucalyptus oil, Eugenol, Herbal extracts, Lactam N-acetic acid esters, N- Hydroxyethalaceamide, 2-Hydroxy-3-oleoyloxy- 1 -pyroglutamyloxypropane, Menthol, Menthone, Morpholine derivatives, N-Oxide, Nerolidol, Octyl-P-D-(thio)glucopyranosides, Oxazolidinones, Piperazine derivatives, Polar lipids, Polydimelhylsiloxanes, Poly [2- (methylsulfinyl)ethyl acrylate], Polyrotaxanes, Polyvinylbenzyldimethylalkylammonium chloride, Poly(N-vinyl-N-methyl acetamide), Sodium pyroglutaminate, Terpenes and azacyclo ring compounds, Vitamin E (a-tocopherol), and Ylang-ylang oil. Additional examples of penetration enhancers not listed above can be found in “Handbook of Pharmaceutical Excipients”, Fifth edition, and include glycofurol, lanolin, light mineral oil, myristic acid, polyoxyethylene alky ethers, and thymol.

[0153] Useful dosages of the pharmaceutical compositions disclosed herein can be determined by comparing their in vitro activity, and in vivo activity in animal models. Methods for the extrapolation of effective dosages in mice, and other animals, to humans are known to the art; for example, see U.S. Patent No. 4,938,949.

[0154] The dose administered to a patient, particularly a human, should be sufficient to achieve a therapeutic response in the patient over a reasonable time frame, without lethal toxicity, and preferably causing no more than an acceptable level of side effects or morbidity. One skilled in the art will recognize that dosage will depend upon a variety of factors including the condition (health) of the subject, the body weight of the subject, kind of concurrent treatment, if any, frequency of treatment, therapeutic ratio, as well as the severity and stage of the pathological condition.

[0155] For example, in some aspects, the composition can include at least about 0.1 g / mL (e.g., at least about 0.2 g / mL, at least about 0.3 pg / mL, at least about 0.4 pg / mL, at least about 0.5 pg / mL, at least about 1 pg / mL, at least about 2 pg / mL, at least about 3 pg / mL, at least about 4 pg / mL, at least about 5 pg / mL, at least about 10 pg / mL, at least about 15 pg / mL, at least about 20 pg / mL, at least about 30 pg / mL, at least about 40 pg / mL, at least about 50 pg / mL, at least about 60 pg / mL, at least about 80 pg / mL, at least about 100 pg / mL, at least about 120 pg / mL, at least about 140 pg / mL, at least about 160 pg / mL, at least about 180 pg / mL, at least about 200 pg / mL, at least about 225 pg / mL, at least about 250 pg / mL, at least about 275 pg / mL, at least about 300 pg / mL, at least about 325 pg / mL, at least about 350 pg / mL, at least about 375 pg / mL, at least about 400 pg / mL) of the telomerase or functional fragment thereof, or nucleic acid encoding said telomerase or functional fragment thereof. In some aspects, the composition can include up to about 400 pg / mL (e.g., up to about 375 pg / mL, up to about 350 pg / mL, up to about 325 pg / mL, up to about 300 pg / mL, up to about 275 pg / mL, up to about 250 pg / mL, up to about 225 pg / mL, up to about 200 pg / mL, up to about 180 pg / mL, up to about 160 pg / mL, up to about 140 pg / mL, up to about 120 pg / mL, up to about 100 pg / mL, up to about 80 pg / mL, up to about 60 pg / mL, up to about 50 pg / mL, up to about 40 pg / mL, up to about 30 pg / mL, up to about 20 pg / mL, up to about 15 pg / mL, up to about 10 pg / mL, up to about 5 pg / mL, up to about 4 pg / mL, up to about 3 pg / mL, up to about 2 pg / mL, up to about 1 pg / mL, up to about 0.5 pg / mL, up to about 0.4 pg / mL, up to about 0.3 pg / mL, up to about 0.2 pg / mL, up to about 0. 1 pg / mL) of the telomerase or functional fragment thereof, or nucleic acid encoding said telomerase or functional fragment thereof.

[0156] It is considered that the composition can include an amount of the telomerase or functional fragment thereof, or nucleic acid encoding said telomerase or functional fragment thereof, ranging from any of the minimum values described above to any of the maximum values described above. For example, in some aspects, the composition can include from about 0.1 pg / mL to about 400 pg / mL (e.g., from about 0.2 pg / mL to about 375 pg / mL, from about 0.3 pg / mL to about 350 pg / mL, from about 0.4 pg / mL to about 325 pg / mL, from about 0.5 pg / mL to about 300 pg / mL, from about 1 pg / mL to about 275 pg / mL, from about 2 pg / mL to about 250 pg / mL, from about 3 pg / mL to about 225 pg / mL, from about 4 pg / mL to about 200 pg / mL, from about 5 pg / mL to about 180 pg / mL, from about 10 pg / mL to about 160 pg / mL, from about 15 pg / mL to about 140 pg / mL, from about 20 pg / mL to about 120 pg / mL, from about 30 pg / mL to about 100 pg / mL, from about 40 pg / mL to about 80 pg / mL, from about 50 pg / mL to about 60 pg / mL, from about 0.1 pg / mL to about 60 pg / mL, from about 0.2 pg / mL to about 50 pg / mL, from about 0.3 pg / mL to about 40 pg / mL, from about 0.4 pg / mL to about30 pg / mL, from about 0.5 pg / mL to about 20 pg / mL, from about 1 |ig / mL to about 15 |ig / mL, from about 2 |ig / mL to about 10 |ig / mL, from about 3 |ig / mL to about 5 |jg / mL, from about 50 pg / mL to about 400 pg / mL, from about 60 pg / mL to about 375 pg / mL, from about 80 pg / mL to about 350 pg / mL, from about 100 pg / mL to about 325 pg / mL, from about 120 pg / mL to about 300 pg / mL, from about 140 pg / mL to about 275 pg / mL, from about 160 pg / mL to about 250 pg / mL, from about 180 pg / mL to about 225 pg / mL) of the telomerase or functional fragment thereof, or nucleic acid encoding said telomerase or functional fragment thereof.

[0157] In some specific aspects, for example, when the composition is delivered topically, the composition can be administered in an amount to provide a dose of the telomerase or functional fragment thereof, or nucleic acid encoding said telomerase or functional fragment thereof of at least about 0.1 pg / cm2(e.g., at least about 0.2 pg / cm2, at least about 0.3 pg / cm2, at least about 0.4 pg / cm2, at least about 0.5 pg / cm2, at least about 1 pg / cm2, at least about 1.5 pg / cm2, at least about 2 pg / cm2, at least about 2.5 pg / cm2, at least about 3 pg / cm2, at least about 4 pg / cm2, at least about 5 pg / cm2, at least about 6 pg / cm2, at least about 7 pg / cm2, at least about 8 pg / cm2, at least about 9 pg / cm2, at least about 10 pg / cm2, at least about 11 pg / cm2, at least about 12 pg / cm2, at least about 13 pg / cm2, at least about 14 pg / cm2, at least about 15 pg / cm2). In some aspects, the composition can be administered in an amount to provide a dose of the telomerase or functional fragment thereof, or nucleic acid encoding said telomerase or functional fragment thereof of up to about 15 pg / cm2(e.g., up to about 14 pg / cm2, up to about 13 pg / cm2, up to about 12 pg / cm2, up to about 11 pg / cm2, up to about 10 pg / cm2iup to about 9 pg / cm2, up to about 8 pg / cm2, up to about 7 pg / cm2, up to about 6 pg / cm2, up to about 5 pg / cm2, up to about 4 pg / cm2, up to about 3 pg / cm2, up to about 2.5 pg / cm2, up to about 2 pg / cm2, up to about 1.5 pg / cm2, up to about 1 pg / cm2, up to about 0.5 pg / cm2, up to about 0.4 pg / cm2, up to about 0.3 pg / cm2, up to about 0.2 pg / cm2, up to about 0.1 pg / cm2).

[0158] It is considered that the composition can be administered in an amount to provide a dose of the telomerase or functional fragment thereof, or nucleic acid encoding said telomerase or functional fragment thereof, ranging from any of the minimum values described above to any of the maximum values described above. For example, in some aspects, the composition can be administered in an amount to provide a dose of the telomerase or functional fragment thereof, or nucleic acid encoding said telomerase or functional fragment thereof of from about 0.1 pg / cm2to about 15 pg / cm2(e.g., from about 0.2 pg / cm2to about 14 pg / cm2, from about 0.3 pg / cm2to about 13 pg / cm2, from about 0.4 pg / cm2to about 12 pg / cm2, from about 0.5 pg / cm2to about 11 pg / cm2, from about 1 pg / cm2to about 10 pg / cm2, from about 1.5 pg / cm2to about 9 pg / cm2, from about 2 pg / cm2to about 8 pg / cm2, from about 2.5 pg / cm2to about 7 pg / cm2,from about 3 pg / cm2to about 6 g / cm2, from about 4 pg / cm2to about 5 pg / cm2, from about 0.1 g / cm2to about 5 pg / cm2, from about 0.2 pg / cm2to about 4 pg / cm2, from about 0.3 pg / cm2to about 3 pg / cm2, from about 0.4 pg / cm2to about 2.5 pg / cm2, from about 0.5 pg / cm2to about 2 pg / cm2, from about 1 pg / cm2to about 1.5 pg / cm2, from about 5 pg / cm2to about 15 pg / cm2, from about 6 pg / cm2to about 14 pg / cm2, from about 7 pg / cm2to about 13 pg / cm2, from about 8 pg / cm2to about 12 pg / cm2, from about 9 pg / cm2to about 11 pg / cm2).Delivery Systems

[0159] In yet still another aspect, provided is a delivery system including any of the disclosed nanoparticles or compositions and a system for enhancing tissue permeability. In yet still another aspect, provided is a delivery system including a telomerase or a functional fragment thereof and a system for enhancing tissue permeability. For example, in some aspects, the system for enhancing tissue permeability can be directly used for delivery or used to pretreat the tissue to increase its permeability and facilitate delivery. In some aspects, the system for enhancing tissue permeability can be configured for microneedling, dermabrasion, ultrasound-permeability enhancement, thermal ablation, electroporation, and / or stratum comeum removal.

[0160] The pharmaceutical compositions described herein are suitable for use in a transdermal or topical drug delivery system in conjunction with microneedles which create micrometer-scale transport pathways. Microneedles provide a minimally invasive means to transport molecules into and / or through the skin for local or systemic delivery of an active pharmaceutical agent. The channels or pores created by a microneedle array are extremely small on a clinical level. However, because the channels or pores are orders of magnitude larger than even macromolecules, such channels or pores have been shown to significantly increase skin permeability.

[0161] Microneedles can be solid or hollow and are made from many bio-compatible materials, including silicon, biodegradable polymers, and stainless steel. Solid microneedles can be used to create channels or pores in the skin, followed by application of a transdermal patch to the skin surface. Alternatively, solid microneedles can be first coated with an active pharmaceutical agent and then inserted into the skin. Hollow microneedles can also be used to facilitate active permeation through the bore in the microneedle and into the skin. See, e.g., Prausnitz, Microneedles for transdermal drug delivery, Adv. 56 Drug. Deliv. Rev. 581-587 (2004), for a review of some of the microneedle technology suitable for use with the various embodiments of the claimed invention described herein.

[0162] Numerous studies have demonstrated that solid microneedles can increase skin permeability by up to four orders of magnitude for compounds ranging in size from small molecules to proteins to nanoparticles. Henry et al., Microfabricated microneedles: a novel approach to transdermal drug delivery, 87 J. Pharm. Sci. 922-925 (1998); McAllister et al., Microfabricated needles for transdermal delivery of macromolecules and nanoparticles: fabrication methods and transport studies, 100 Proc. Nat'l Acad. Sci. 13755-13760 (2003); Lin et al., Transdermal delivery of antisense oligonucleotides with microprojection patch (Macroflux) technology, 18(12) Pharm. Res. 1787-1793 (2001); and Cormier et al., Transdermal delivery of desmopressin using a coated microneedle array patch system, 97 J. Control. Release. 503-511 (2004). Hollow microneedles have also been shown to deliver macromolecules such as insulin. See McAllister, Proc. Nat'l Acad. Sci. 13755-13760; Martanto et al., Transdermal delivery of insulin using microneedles in vivo, 21 Pharm. Res. 947-952 (2004). Microneedle insertion in human volunteers resulted in a sensation described as that similar to a smooth surface applied to the skin or the “sensation of a piece of tape” applied to the skin. Kaushik et al., Lack of pain associated with microfabricated microneedles, 92 Anesth. & Analg. 502-504 (2001).

[0163] Suitable microneedle arrangements for use with the compounds and compositions described herein can be found in the foregoing references as well as, for example, U.S. patent application Ser. No. 11 / 812,249, published as US 2008-0008745 Al on Jan. 10, 2008, U.S. Patent No. 10,661,066, and U.S. Patent No. 9,358,376, which are incorporated by reference herein in their entireties.

[0164] In some aspects, the composition can be administered during or after dermabrasion, which can increase the permeability of the skin surface (Lee WR et al. Microdermabrasion as a novel tool to enhance drug delivery via the skin: an animal study. Dermatol Surg. 2006 Aug;32(8): 1013-22, herein incorporated by reference in its entirety for its teaching concerning microdermabrasion and drug delivery). Dermabrasion, in contrast to microneedling, uses an abrasive tip to exfoliate the top layer of the skin. Suitable dermabrasion arrangements for use with the compounds and compositions described herein can be found in the foregoing references as well as, for example, U.S. Patent Nos. 11,331,116 and 10,098,653, which are incorporated by reference herein in their entireties.

[0165] In some aspects, the composition can be administered during or after ultrasoundpermeability enhancement (Oberli, M. A. et al. (2014). Ultrasound-enhanced transdermal delivery: recent advances and future challenges. Therapeutic delivery, 5(7), 843-857). In some aspects, the composition can be administered during or after thermal ablation, for example,chemical heating, lasering, radiofrequency ablation, or thermoporation (Parhi, R., & Mandru, A. (2021). Enhancement of skin permeability with thermal ablation techniques: concept to commercial products. Drug delivery and translational research, 11(3), 817-841). In some aspects, the composition can be administered during or after electroporation. In some aspects, the composition can be administered during or after stratum corneum removal.

[0166] In some aspects, the composition can be administered immediately after pretreatment of the tissue with the system for enhancing tissue permeability. In other aspects, the composition can be administered at least about 10 minutes (e.g., at least about 20 minutes, at least about 30 minutes, at least about 40 minutes, at least about 50 minutes, at least about 1 hour, at least about 2 hours, at least about 3 hours, at least about 4 hours, at least about 8 hours, at least about 12 hours, at least about 16 hours, at least about 20 hours, at least about 24 hours, at least about 32 hours, at least about 40 hours, at least about 48 hours, at least about 56 hours, at least about 64 hours, at least about 72 hours) after pre-treatment of the tissue with the system for enhancing tissue permeability. In some aspects, the composition can be administered up to about 72 hours (e.g., up to about 64 hours, up to about 56 hours, up to about 48 hours, up to about 40 hours, up to about 32 hours, up to about 24 hours, up to about 20 hours, up to about 16 hours, up to about 12 hours, up to about 8 hours, up to about 4 hours, up to about 3 hours, up to about 2 hours, up to about 1 hour, up to about 50 minutes, up to about 40 minutes, up to about 30 minutes, up to about 20 minutes, up to about 10 minutes) after pre-treatment of the tissue with the delivery system.

[0167] It is considered that the composition can be administered any time after pretreatment of the tissue with the system for enhancing tissue permeability ranging from any of the minimum values described above to any of the maximum values described above. For example, in some aspects, the composition can be administered from about 10 minutes to about 72 hours (e.g., from about 20 minutes to about 64 hours, from about 30 minutes to about 56 hours, from about 40 minutes to about 48 hours, from about 50 minutes to about 40 hours, from about 1 hour to about 32 hours, from about 2 hours to about 24 hours, from about 3 hours to about 20 hours, from about 4 hours to about 16 hours, from about 8 hours to about 12 hours, from about 10 minutes to about 12 hours, from about 20 minutes to about 8 hours, from about 30 minutes to about 4 hours, from about 40 minutes to about 3 hours, from about 50 minutes to about 2 hours, from about 8 hours to about 72 hours, from about 12 hours to about 64 hours, from about 16 hours to about 56 hours, from about 20 hours to about 48 hours, from about 24 hours to about 40 hours) after pre-treatment of the tissue with the delivery system.

[0168] In yet other aspects, the composition can be directly delivered using the system for enhancing tissue permeability, for example, via microinfusion. Suitable strategies for microinfusion are described in, for example, Longhi, D.S.R., Gasques, L., Antonio, C.R., Michelon Vitale, D. (2021). Microinfusion of Drugs into the Skin (MMP™) and Drug Delivery. In: Kalil, C.L.P.V., Campos, V. (eds) Drug Delivery in Dermatology. Springer, Cham, which is incorporated by reference herein in its entirety.METHODS OF USING THE COMPOSITIONS

[0169] In an aspect, provided is a method of delivering a telomerase or a functional fragment thereof to a cell, the method including introducing into the cell any of the disclosed nanoparticles or compositions. In some aspects, the nanoparticle can include a nucleic acid encoding a telomerase or a functional fragment of a telomerase, and the nucleic acid can be expressed by the cell. These disclosed methods can be used to treat damage (e.g., DNA damage) associated with tissue injury to any organ that may be due to radiation, chemotherapy, physical or chemical trauma, bums, aging, or other forms of damage discussed herein. As one particular non-limiting example, the disclosed methods can be used for treatment of injury to the skin.

[0170] The skin is comprised of three major tissue layers: the epidermis, dermis and subcutaneous tissue. The epidermis is the outermost layer and has two components, the stratum comeum (comprised of anucleate cornified cells) and the Malpighian layers (viable cells under the stratum corneum). The stratum corneum acts as a barrier to microorganisms and toxins while allowing the body to retain water and electrolytes. The dermis is composed of dense fibroelastic connective tissue containing collagen, elastic fibres and grounds substance (an extracellular gel comprising mucopolysaccharides, salts, water and glycoproteins). The dermis is highly vascular and contains nerve networks and glands. Subcutaneous tissue is primarily areolar and fatty connective tissue and contains glands and hair follicles.

[0171] The surface of the skin, as well as most tissues, generally harbors a negative charge. For example, in the skin, the stratum corneum includes negatively charged comeocytes. As such, conventional lipid nanoparticle compositions, which typically include cationic lipids, tend to accumulate in the stratum corneum (see, for example, Baspinar, Y., & Borchert, H.-H. (2012). Penetration and release studies of positively and negatively charged nanoemulsions — is there a benefit of the positive charge? International Journal of Pharmaceutics, 430(1-2), 247- 252, herein incorporated by reference in its entirety). However, the presently disclosed nanoparticles include ionizable lipids which become positively charged when reaching the acidic endosomal environment found in the epidermis and dermis of the skin. This allowsdeeper penetration of the nanoparticles into the skin to provide telomere repair in the epidermis, dermis, and microvasculature of the skin, which can be subject to damage from radiation, physical bums, thermal burns, chemical bums, side effects of therapeutic agents, aging, and scarring. As such, in another aspect, provided is a method of treating or preventing damage to a tissue, the method comprising introducing into the tissue any of the disclosed nanoparticles.

[0172] In some aspects, the nanoparticles or composition can be applied to a tissue and left for at least about 1 minute (e.g., at least about 2 minutes, at least about 3 minutes, at least about 4 minutes, at least about 5 minutes, at least about 10 minutes, at least about 20 minutes, at least about 30 minutes, at least about 40 minutes, at least about 50 minutes, at least about 1 hour, at least about 2 hours, at least about 3 hours, at least about 4 hours, at least about 8 hours, at least about 12 hours, at least about 16 hours, at least about 20 hours, at least about 24 hours, at least about 32 hours, at least about 40 hours, at least about 48 hours, at least about 56 hours, at least about 64 hours, at least about 72 hours). In some aspects, the nanoparticles or composition can be applied to a tissue and left for up to about 72 hours (e.g., up to about 64 hours, up to about 56 hours, up to about 48 hours, up to about 40 hours, up to about 32 hours, up to about 24 hours, up to about 20 hours, up to about 16 hours, up to about 12 hours, up to about 8 hours, up to about 4 hours, up to about 3 hours, up to about 2 hours, up to about 1 hour, up to about 50 minutes, up to about 40 minutes, up to about 30 minutes, up to about 20 minutes, up to about 10 minutes, up to about 5 minutes, up to about 4 minutes, up to about 3 minutes, up to about 2 minutes, up to about 1 minute).

[0173] It is considered that the nanoparticles or composition can be applied to a tissue and left for a duration of time ranging from any of the minimum values described above to any of the maximum values described above. For example, in some aspects, the nanoparticles or composition can be applied to a tissue and left for from about 1 minute to about 72 hours (e.g., from about 2 minutes to about 64 hours, from about 3 minutes to about 56 hours, from about 4 minutes to about 48 hours, from about 5 minutes to about 40 hours, from about 10 minutes to about 32 hours, from about 20 minutes to about 24 hours, from about 30 minutes to about 20 hours, from about 40 minutes to about 16 hours, from about 50 minutes to about 12 hours, from about 1 hour to about 8 hours, from about 2 hours to about 4 hours, from about 1 minute to about 3 hours, from about 2 minutes to about 2 hours, from about 3 minutes to about 1 hour, from about 4 minutes to about 50 minutes, from about 5 minutes to about 40 minutes, from about 10 minutes to about 30 minutes, from about 3 hours to about 72 hours, from about 4 hours to about 64 hours, from about 8 hours to about 56 hours, from about 12 hours to about48 hours, from about 16 hours to about 40 hours, from about 20 hours to about 32 hours). In other aspects, the nanoparticles or composition can be applied to a tissue and left indefinitely.

[0174] In some aspects, the treatment regime (described for specific implementations below) can be implemented once. In other aspects, the treatment regime can be repeated any number of times, either periodically (e.g., daily, weekly, monthly, annually) or as needed. For example, the treatment regime may be repeated to further enhance healing, or after surgical debridement of scar or necrotic tissue.

[0175] In some aspects, telomere length in the tissue may be substantially unchanged (i.e., telomere length may not be extended). For example, in some aspects, telomere length may change by less than 10%, less then 9%, less than 8%, less than 7%, less than 6%, less than 5%, less than 4%, less than 3%, less than 2%, less than 1%, less than 0.5%, or less than 0.1%. This effect can be observed under various administrations and methods of use of the disclosed nanoparticles or composition, and is particularly observed when the disclosed nanoparticles or composition are administered before substantial damage has been inflicted on the tissue. Treating and / or Preventing Burns

[0176] The disclosed nanoparticles or composition can be used to treat and / or prevent tissue injuries, for example, bums or wounds. Thermal burns are by far the most common types of burns. Although the skin is usually the part of the body that is burned, the tissues under the skin can also be burned, and internal organs can be burned even when the skin is not. For example, drinking a very hot liquid or caustic substance such as acid can burn the esophagus and stomach. Inhaling smoke or hot air from a fire burn the lungs. When tissues are damaged by a burn, fluid may leak from blood vessels (capillary permeability), causing swelling or edema. In an extensive bum, loss of a large amount of fluid from abnormally leaky blood vessels can cause shock. In shock, blood pressure decreases so much that too little blood flows to the brain and other vital organs.

[0177] Electrical bums may be caused by a temperature of more than 9,000°F, generated by an electric current when it passes from the electrical source to the body. This type of burn, sometimes called an electrical arc burn, usually completely destroys and chars the skin at the current’s point of entry into the body. Because the resistance (the body's ability to stop or slow the current's flow) is high where the skin touches the current's source, much of the electrical energy is converted into heat, thus burning the surface. Most electrical burns also severely damage the tissues under the skin, including fascia, muscle, tendon, nerve tissue, and bone. These bums vary in size and depth and may affect an area much larger than that indicated by the area of injured skin. Large electrical shocks can paralyze breathing and disturb heartrhythm, causing dangerously irregular heartbeats. Controlled electrical burns can be used for surgical cauterization.

[0178] Chemical burns can be caused by various irritants and poisons, including strong acids and alkalis, phenols and cresols (organic solvents), mustard gas, and phosphorus. Chemical bums can cause tissue death that can slowly spread for hours after the burn. Controlled chemical bums can be used for surgical cauterization.

[0179] Radiation burns can be caused by nuclear weapons, nuclear accidents, laboratory exposure, accidents during X-ray radiation chemotherapy, and over-exposure to sun. Radiation bums can cause inflammation, edema, ulcerations, damage to underlying endothelium and other cell types, as well as mutagenesis resulting in cancer, especially hematologic malignancies.

[0180] Burns are generally classified accordingly to their seriousness and extent. First degree burns are the mildest and normally only affect the epidermis. The bum site is red, painful, dry, no blisters, very sensitive to touch and the damaged skin may be slightly moist from the leakage of fluid in the deeper layers of the skin. The sensory nerve ends are also exposed and create pain. Mild sunburn is typical of a first degree burn. Second degree burns is where both the epidermis and dermis are affected. The damage is deeper and blisters usually appear on the skin. The skin is still painful and sensitive, as the nerves have been affected as well as the sebaceous glands in the area. Third degree burns are the most serious, as the tissues in all layers of the skin are dead. Normally the damaged area goes down into the subcutaneous tissue. Usually there are no blisters, but the burnt surface can have several types of appearance, from white to black (charred) or bright red from blood in the bottom of the wound. In most cases, it can penetrate down through the superficial fascia, and into the muscle layers where various arteries and veins may be affected. Because the skin nerves are damaged the bum can be quite painless and on touching the skin sometimes it has no sensation whatsoever. The lack of sensation or blanching of the skin blood vessels on pressure indicates damaged skin.

[0181] In some aspects, the nanoparticles or composition can be administered immediately (e.g., within about 1 minute) after a burn injury. In other aspects, the nanoparticles or composition can be administered at least about 1 minutes (e.g., at least about 2 minutes, at least about 3 minutes, at least about 4 minutes, at least about 5 minutes, at least about 10 minutes, at least about 20 minutes, at least about 30 minutes, at least about 40 minutes, at least about 50 minutes, at least about 1 hour, at least about 2 hours, at least about 3 hours, at least about 4 hours, at least about 8 hours, at least about 12 hours, at least about 16 hours, at least about 20 hours, at least about 24 hours, at least about 32 hours, at least about 40 hours, at least about 48hours, at least about 56 hours, at least about 64 hours, at least about 72 hours, at least about 4 days, at least about 5 days, at least about 6 days, at least about 1 week, at least about 2 weeks, at least about 3 weeks, at least about 4 weeks) after a burn injury. In some aspects, the nanoparticles or composition can be administered up to about 4 weeks (e.g., up to about 3 weeks, up to about 2 weeks, up to about 1 week, up to about 6 days, up to about 5 days, up to about 4 days, up to about 72 hours, up to about 64 hours, up to about 56 hours, up to about 48 hours, up to about 40 hours, up to about 32 hours, up to about 24 hours, up to about 20 hours, up to about 16 hours, up to about 12 hours, up to about 8 hours, up to about 4 hours, up to about 3 hours, up to about 2 hours, up to about 1 hour, up to about 50 minutes, up to about 40 minutes, up to about 30 minutes, up to about 20 minutes, up to about 10 minutes) after a bum injury.

[0182] It is considered that the nanoparticles or composition can be administered any time after a bum injury ranging from any of the minimum values described above to any of the maximum values described above. For example, in some aspects, the nanoparticles or composition can be administered from about 1 minute to about 4 weeks (e.g., from about 2 minutes to about 3 weeks, from about 3 minutes to about 2 weeks, from about 4 minutes to about 1 week, from about 5 minutes to about 6 days, from about 10 minutes to about 5 days, from about 20 minutes to about 4 days, from about 30 minutes to about 72 hours, from about 40 minutes to about 64 hours, from about 50 minutes to about 56 hours, from about 1 hour to about 48 hours, from about 2 hours to about 40 hours, from about 3 hours to about 32 hours, from about 4 hours to about 24 hours, from about 8 hours to about 20 hours, from about 12 hours to about 16 hours, from about 1 minute to about 16 hours, from about 2 minutes to about 12 hours, from about 3 minutes to about 8 hours, from about 4 minutes to about 4 hours, from about 5 minutes to about 3 hours, from about 10 minutes to about 2 hours, from about 20 minutes to about 1 hour, from about 30 minutes to about 50 minutes, from about 12 hours to about 4 weeks, from about 16 hours to about 3 weeks, from about 20 hours to about 2 weeks, from about 24 hours to about 1 week, from about 32 hours to about 6 days, from about 40 hours to about 5 days, from about 48 hours to about 4 days, from about 56 hours to about 72 hours) after a burn injury.

[0183] In some aspects, for example, when the nanoparticles or composition are used to prevent burns (e.g., radiation burns from radiation chemotherapy), the nanoparticles or composition can be administered immediately (e.g., within about 1 minute) before exposure to a burn-inducing agent (e.g., radiation). In other aspects, the nanoparticles or composition can be administered at least about 1 minute (e.g., at least about 2 minutes, at least about 3 minutes, at least about 4 minutes, at least about 5 minutes, at least about 10 minutes, at least about 20minutes, at least about 30 minutes, at least about 40 minutes, at least about 50 minutes, at least about 1 hour, at least about 2 hours, at least about 3 hours, at least about 4 hours, at least about 8 hours, at least about 12 hours, at least about 16 hours, at least about 20 hours, at least about 24 hours, at least about 32 hours, at least about 40 hours, at least about 48 hours, at least about 56 hours, at least about 64 hours, at least about 72 hours, at least about 4 days, at least about 5 days, at least about 6 days, at least about 1 week, at least about 2 weeks, at least about 3 weeks, at least about 4 weeks) before exposure to a burn-inducing agent. In some aspects, the nanoparticles or composition can be administered up to about 4 weeks (e.g., up to about 3 weeks, up to about 2 weeks, up to about 1 week, up to about 6 days, up to about 5 days, up to about 4 days, up to about 72 hours, up to about 64 hours, up to about 56 hours, up to about 48 hours, up to about 40 hours, up to about 32 hours, up to about 24 hours, up to about 20 hours, up to about 16 hours, up to about 12 hours, up to about 8 hours, up to about 4 hours, up to about 3 hours, up to about 2 hours, up to about 1 hour, up to about 50 minutes, up to about 40 minutes, up to about 30 minutes, up to about 20 minutes, up to about 10 minutes, up to about 5 minutes, up to about 4 minutes, up to about 3 minutes, up to about 2 minutes, up to about 1 minute) before exposure to a bum-inducing agent.

[0184] It is considered that the nanoparticles or composition can be administered any time before exposure to a burn-inducing agent ranging from any of the minimum values described above to any of the maximum values described above. For example, in some aspects, the nanoparticles or composition can be administered from about 1 minute to about 4 weeks (e.g., from about 2 minutes to about 3 weeks, from about 3 minutes to about 2 weeks, from about 4 minutes to about 1 week, from about 5 minutes to about 6 days, from about 10 minutes to about 5 days, from about 20 minutes to about 4 days, from about 30 minutes to about 72 hours, from about 40 minutes to about 64 hours, from about 50 minutes to about 56 hours, from about 1 hour to about 48 hours, from about 2 hours to about 40 hours, from about 3 hours to about 32 hours, from about 4 hours to about 24 hours, from about 8 hours to about 20 hours, from about 12 hours to about 16 hours, from about 1 minute to about 16 hours, from about 2 minutes to about 12 hours, from about 3 minutes to about 8 hours, from about 4 minutes to about 4 hours, from about 5 minutes to about 3 hours, from about 10 minutes to about 2 hours, from about 20 minutes to about 1 hour, from about 30 minutes to about 50 minutes, from about 12 hours to about 4 weeks, from about 16 hours to about 3 weeks, from about 20 hours to about 2 weeks, from about 24 hours to about 1 week, from about 32 hours to about 6 days, from about 40 hours to about 5 days, from about 48 hours to about 4 days, from about 56 hours to about 72 hours) before exposure to a bum-inducing agent.

[0185] In some aspects, the nanoparticles or composition can be administered twice a day, once a day, once every 2 days, once every 3 days, once every 4 days, once every 5 days, once every 6 days, once every 1 week, once every 2 weeks, once every 3 weeks, or once every 4 weeks. In some aspects, treatment with the nanoparticles or composition can be continued for at least 1 day (e.g., at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least about 1 week, at least about 2 weeks, at least about 3 weeks, at least about 4 weeks, at least about 5 weeks, at least about 6 weeks, at least about 7 weeks, at least about 8 weeks, at least about 9 weeks, at least about 10 weeks) after a bum injury. In some aspects, treatment with the nanoparticles or composition can be continued for up to about 10 weeks (e.g., up to about 9 weeks, up to about 8 weeks, up to about 7 weeks, up to about 6 weeks, up to about 5 weeks, up to about 4 weeks, up to about 3 weeks, up to about 2 weeks, up to about 1 week, up to 6 days, up to 5 days, up to 4 days, up to 3 days, up to 2 days, up to 1 day) after a burn injury.

[0186] It is considered that treatment with the nanoparticles or composition can be continued for a period ranging from any of the minimum values described above to any of the maximum values described above. For example, in some aspects, treatment with the nanoparticles or composition can be continued for from 1 day to about 10 weeks (e.g., from 2 days to about 9 weeks, from 3 days to about 8 weeks, from 4 days to about 7 weeks, from 5 days to about 6 weeks, from 6 days to about 5 weeks, from about 1 week to about 4 weeks, from about 2 weeks to about 3 weeks, from 1 day to about 3 weeks, from 2 days to about 2 weeks, from 3 days to about 1 week, from 4 days to 6 days, from about 2 weeks to about 10 weeks, from about 3 weeks to about 9 weeks, from about 4 weeks to about 8 weeks, from about 5 weeks to about 7 weeks) after a bum injury.Treating and / or Preventing DNA Damage

[0187] The disclosed nanoparticles or composition can be used to treat and / or prevent DNA damage. “DNA damage” refers to structural alterations in the DNA molecule that compromise its integrity and function. These lesions can manifest as single-strand breaks (SSBs), doublestrand breaks (DSBs), base modifications (e.g., oxidation, alkylation, deamination), abasic sites, or DNA crosslinks (interstrand or intrastrand). Such damage interferes with critical cellular processes like replication and transcription, potentially leading to mutations, chromosomal aberrations, genomic instability, or cell death if not accurately repaired.

[0188] DNA damage can arise from both endogenous and exogenous events. Endogenously, it is often a byproduct of normal cellular metabolism - particularly oxidative phosphorylation in mitochondria, which generates reactive oxygen species (ROS) that can oxidize nucleotides (e.g., 8-oxoguanine). Spontaneous hydrolytic reactions, such asdepurination and deamination, also contribute to endogenous DNA lesions. Exogenous events include exposure to ultraviolet (UV) radiation (which induces pyrimidine dimers), exposure ionizing radiation (IR) (which causes DSBs and base damage), and exposure to chemical mutagens such as polycyclic aromatic hydrocarbons, alkylating agents, and platinum-based chemo therapeutics .

[0189] In some aspects, the nanoparticles or composition can be administered immediately (e.g., within about 1 minute) after an event which can induce DNA damage. In other aspects, the nanoparticles or composition can be administered at least about 1 minutes (e.g., at least about 2 minutes, at least about 3 minutes, at least about 4 minutes, at least about 5 minutes, at least about 10 minutes, at least about 20 minutes, at least about 30 minutes, at least about 40 minutes, at least about 50 minutes, at least about 1 hour, at least about 2 hours, at least about 3 hours, at least about 4 hours, at least about 8 hours, at least about 12 hours, at least about 16 hours, at least about 20 hours, at least about 24 hours, at least about 32 hours, at least about 40 hours, at least about 48 hours, at least about 56 hours, at least about 64 hours, at least about 72 hours, at least about 4 days, at least about 5 days, at least about 6 days, at least about 1 week, at least about 2 weeks, at least about 3 weeks, at least about 4 weeks) after an event which can induce DNA damage. In some aspects, the nanoparticles or composition can be administered up to about 4 weeks (e.g., up to about 3 weeks, up to about 2 weeks, up to about 1 week, up to about 6 days, up to about 5 days, up to about 4 days, up to about 72 hours, up to about 64 hours, up to about 56 hours, up to about 48 hours, up to about 40 hours, up to about 32 hours, up to about 24 hours, up to about 20 hours, up to about 16 hours, up to about 12 hours, up to about 8 hours, up to about 4 hours, up to about 3 hours, up to about 2 hours, up to about 1 hour, up to about 50 minutes, up to about 40 minutes, up to about 30 minutes, up to about 20 minutes, up to about 10 minutes) after an event which can induce DNA damage.

[0190] It is considered that the nanoparticles or composition can be administered any time after an event which can induce DNA damage ranging from any of the minimum values described above to any of the maximum values described above. For example, in some aspects, the nanoparticles or composition can be administered from about 1 minute to about 4 weeks (e.g., from about 2 minutes to about 3 weeks, from about 3 minutes to about 2 weeks, from about 4 minutes to about 1 week, from about 5 minutes to about 6 days, from about 10 minutes to about 5 days, from about 20 minutes to about 4 days, from about 30 minutes to about 72 hours, from about 40 minutes to about 64 hours, from about 50 minutes to about 56 hours, from about 1 hour to about 48 hours, from about 2 hours to about 40 hours, from about 3 hours to about 32 hours, from about 4 hours to about 24 hours, from about 8 hours to about 20 hours,from about 12 hours to about 16 hours, from about 1 minute to about 16 hours, from about 2 minutes to about 12 hours, from about 3 minutes to about 8 hours, from about 4 minutes to about 4 hours, from about 5 minutes to about 3 hours, from about 10 minutes to about 2 hours, from about 20 minutes to about 1 hour, from about 30 minutes to about 50 minutes, from about 12 hours to about 4 weeks, from about 16 hours to about 3 weeks, from about 20 hours to about 2 weeks, from about 24 hours to about 1 week, from about 32 hours to about 6 days, from about 40 hours to about 5 days, from about 48 hours to about 4 days, from about 56 hours to about 72 hours) after an event which can induce DNA damage.

[0191] In some aspects, for example, when the nanoparticles or composition are used to prevent DNA damage, the nanoparticles or composition can be administered immediately (e.g., within about 1 minute) before exposure to a DNA damage- inducing agent. In other aspects, the nanoparticles or composition can be administered at least about 1 minute (e.g., at least about 2 minutes, at least about 3 minutes, at least about 4 minutes, at least about 5 minutes, at least about 10 minutes, at least about 20 minutes, at least about 30 minutes, at least about 40 minutes, at least about 50 minutes, at least about 1 hour, at least about 2 hours, at least about 3 hours, at least about 4 hours, at least about 8 hours, at least about 12 hours, at least about 16 hours, at least about 20 hours, at least about 24 hours, at least about 32 hours, at least about 40 hours, at least about 48 hours, at least about 56 hours, at least about 64 hours, at least about 72 hours, at least about 4 days, at least about 5 days, at least about 6 days, at least about 1 week, at least about 2 weeks, at least about 3 weeks, at least about 4 weeks) before exposure to a DNA damage-inducing agent. In some aspects, the nanoparticles or composition can be administered up to about 4 weeks (e.g., up to about 3 weeks, up to about 2 weeks, up to about 1 week, up to about 6 days, up to about 5 days, up to about 4 days, up to about 72 hours, up to about 64 hours, up to about 56 hours, up to about 48 hours, up to about 40 hours, up to about 32 hours, up to about 24 hours, up to about 20 hours, up to about 16 hours, up to about 12 hours, up to about 8 hours, up to about 4 hours, up to about 3 hours, up to about 2 hours, up to about 1 hour, up to about 50 minutes, up to about 40 minutes, up to about 30 minutes, up to about 20 minutes, up to about 10 minutes, up to about 5 minutes, up to about 4 minutes, up to about 3 minutes, up to about 2 minutes, up to about 1 minute) before exposure to a DNA damage-inducing agent.

[0192] It is considered that the nanoparticles or composition can be administered any time before exposure to a DNA damage-inducing agent ranging from any of the minimum values described above to any of the maximum values described above. For example, in some aspects, the nanoparticles or composition can be administered from about 1 minute to about 4 weeks (e.g., from about 2 minutes to about 3 weeks, from about 3 minutes to about 2 weeks, fromabout 4 minutes to about 1 week, from about 5 minutes to about 6 days, from about 10 minutes to about 5 days, from about 20 minutes to about 4 days, from about 30 minutes to about 72 hours, from about 40 minutes to about 64 hours, from about 50 minutes to about 56 hours, from about 1 hour to about 48 hours, from about 2 hours to about 40 hours, from about 3 hours to about 32 hours, from about 4 hours to about 24 hours, from about 8 hours to about 20 hours, from about 12 hours to about 16 hours, from about 1 minute to about 16 hours, from about 2 minutes to about 12 hours, from about 3 minutes to about 8 hours, from about 4 minutes to about 4 hours, from about 5 minutes to about 3 hours, from about 10 minutes to about 2 hours, from about 20 minutes to about 1 hour, from about 30 minutes to about 50 minutes, from about 12 hours to about 4 weeks, from about 16 hours to about 3 weeks, from about 20 hours to about 2 weeks, from about 24 hours to about 1 week, from about 32 hours to about 6 days, from about 40 hours to about 5 days, from about 48 hours to about 4 days, from about 56 hours to about 72 hours) before exposure to a DNA damage-inducing agent.

[0193] In some aspects, the nanoparticles or composition can be administered twice a day, once a day, once every 2 days, once every 3 days, once every 4 days, once every 5 days, once every 6 days, once every 1 week, once every 2 weeks, once every 3 weeks, or once every 4 weeks. In some aspects, treatment with the nanoparticles or composition can be continued for at least 1 day (e.g., at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least about 1 week, at least about 2 weeks, at least about 3 weeks, at least about 4 weeks, at least about 5 weeks, at least about 6 weeks, at least about 7 weeks, at least about 8 weeks, at least about 9 weeks, at least about 10 weeks) after an event which can induce DNA damage. In some aspects, treatment with the nanoparticles or composition can be continued for up to about 10 weeks (e.g., up to about 9 weeks, up to about 8 weeks, up to about 7 weeks, up to about 6 weeks, up to about 5 weeks, up to about 4 weeks, up to about 3 weeks, up to about 2 weeks, up to about 1 week, up to 6 days, up to 5 days, up to 4 days, up to 3 days, up to 2 days, up to 1 day) after an event which can induce DNA damage.

[0194] It is considered that treatment with the nanoparticles or composition can be continued for a period ranging from any of the minimum values described above to any of the maximum values described above. For example, in some aspects, treatment with the nanoparticles or composition can be continued for from 1 day to about 10 weeks (e.g., from 2 days to about 9 weeks, from 3 days to about 8 weeks, from 4 days to about 7 weeks, from 5 days to about 6 weeks, from 6 days to about 5 weeks, from about 1 week to about 4 weeks, from about 2 weeks to about 3 weeks, from 1 day to about 3 weeks, from 2 days to about 2 weeks, from 3 days to about 1 week, from 4 days to 6 days, from about 2 weeks to about 10weeks, from about 3 weeks to about 9 weeks, from about 4 weeks to about 8 weeks, from about 5 weeks to about 7 weeks) after an event which can induce DNA damage.

[0195] In some aspects, treatment with the nanoparticles or composition can decrease expression of one or more DNA damage markers (e.g., yH2AX, 53BP1, Nbsl, BRCA1 / 2, Ku, p53, p21, pl6, or any combination thereof).

[0196] In some aspects, treatment with the nanoparticles or composition can decrease expression of one or more DNA damage markers by about 1% or more (e.g., about 5% or more, about 10% or more, about 15% or more, about 20% or more, about 25% or more, about 30% or more, about 35% or more, about 40% or more, about 45% or more, about 50% or more, about 55% or more, about 60% or more, about 65% or more, about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 95% or more). In some aspects, treatment with the nanoparticles or composition can decrease expression of one or more DNA damage markers by about 95% or less (e.g., about 90% or less, about 85% or less, about 80% or less, about 75% or less, about 70% or less, about 65% or less, about 60% or less, about 55% or less, about 50% or less, about 45% or less, about 40% or less, about 35% or less, about 30% or less, about 25% or less, about 20% or less, about 15% or less, about 10% or less, about 5% or less, about 1 % or less).

[0197] It is understood that treatment with the nanoparticles or composition can decrease expression of one or more DNA damage markers by any amount ranging from any of the minimum values described above to any of the maximum values described above. For example, in some aspects, treatment with the nanoparticles or composition can decrease expression of one or more DNA damage markers by from about 1% to about 95% (e.g., from about 5% to about 90%, from about 10% to about 85%, from about 15% to about 80%, from about 20% to about 75%, from about 25% to about 70%, from about 30% to about 65%, from about 35% to about 60%, from about 40% to about 55%, from about 45% to about 50%, from about 1% to about 50%, from about 5% to about 45%, from about 10% to about 40%, from about 15% to about 35%, from about 20% to about 30%, from about 45% to about 95%, from about 50% to about 90%, from about 55% to about 85%, from about 60% to about 80%, from about 65% to about 75%).Cosmetic Uses

[0198] The disclosed nanoparticles or composition can be used to treat and / or prevent cosmetic flaws, for example, aging and / or scarring of the skin. The term “aging” refers to the changes experienced by the skin with age (chronoaging) or through exposure to the sun (photoaging) or to environmental agents such as tobacco smoke, extreme climatic conditionsof cold or wind, chemical contaminants or pollutants, and includes all the external visible and / or perceptible changes through touch, such as and not restricted to, the development of discontinuities on the skin such as wrinkles, fine lines, expression lines, stretch marks, furrows, irregularities or roughness, increase in the size of pores, loss of hydration, loss of elasticity, loss of firmness, loss of smoothness, loss of the capacity to recover from deformation, loss of resilience, sagging of the skin such as sagging cheeks, the appearance of bags under the eyes or the appearance of a double chin, among others, changes to the color of the skin such as marks, reddening, bags or the appearance of hyperpigmented areas such as age spots or freckles among others, anomalous differentiation, hyperkeratinization, elastosis, keratosis, hair loss, orange-peel skin, loss of collagen structure and other histological changes of the stratum comeum, of the dermis, epidermis, vascular system (for example the appearance of spider veins or telangiectasia) or of those tissues close to the skin, among others. The term “photoaging” groups together the set of processes due to the prolonged exposure of the skin to ultraviolet radiation which result in the premature aging of the skin, and it presents the same physical characteristics as aging, such as and not restricted to, flaccidity, sagging, changes to the color or irregularities in the pigmentation, abnormal and / or excessive keratinization. The sum of various environmental factors such as exposure to tobacco smoke, exposure to pollution, and climatic conditions such as cold and / or wind also contribute to the aging of the skin.

[0199] As used herein, “scarring” refers to the formation of a scar. In one aspect, the scar is a hypertrophic scar, or keloid scar, or a scar resulting from acne. As used herein, a “scar” is an area of fibrous tissue that results from the overproduction of collagen. In certain instances, wound healing comprises the migration of fibroblasts to the site of injury. In certain instances, fibroblasts deposit collagen. In certain instances, fibroblasts deposit excess collagen at the wound site, resulting in a scar.

[0200] In some aspects, the nanoparticles or composition can be administered twice a day, once a day, once every 2 days, once every 3 days, once every 4 days, once every 5 days, once every 6 days, once every 1 week, once every 2 weeks, once every 3 weeks, or once every 4 weeks. In some aspects, treatment with the nanoparticles or composition can be continued for at least 1 day (e.g., at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least about 1 week, at least about 2 weeks, at least about 3 weeks, at least about 4 weeks, at least about 5 weeks, at least about 6 weeks, at least about 7 weeks, at least about 8 weeks, at least about 9 weeks, at least about 10 weeks). In some aspects, treatment with the nanoparticles or composition can be continued for up to about 10 weeks (e.g., up to about 9 weeks, up to about 8 weeks, up to about 7 weeks, up to about 6 weeks, up to about 5 weeks, up to about 4weeks, up to about 3 weeks, up to about 2 weeks, up to about 1 week, up to 6 days, up to 5 days, up to 4 days, up to 3 days, up to 2 days, up to 1 day).

[0201] It is considered that treatment with the nanoparticles or composition can be continued for a period ranging from any of the minimum values described above to any of the maximum values described above. For example, in some aspects, treatment with the nanoparticles or composition can be continued for from 1 day to about 10 weeks (e.g., from 2 days to about 9 weeks, from 3 days to about 8 weeks, from 4 days to about 7 weeks, from 5 days to about 6 weeks, from 6 days to about 5 weeks, from about 1 week to about 4 weeks, from about 2 weeks to about 3 weeks, from 1 day to about 3 weeks, from 2 days to about 2 weeks, from 3 days to about 1 week, from 4 days to 6 days, from about 2 weeks to about 10 weeks, from about 3 weeks to about 9 weeks, from about 4 weeks to about 8 weeks, from about 5 weeks to about 7 weeks). In other aspects, treatment with the nanoparticles or composition can be continued indefinitely (i.e., as a routine -use cosmetic product).Skin Grafts

[0202] The disclosed nanoparticles or composition can further be used for the maintenance and / or preparation of a tissue graft, for example, a skin graft. Skin grafting is useful for treatment of wounds that heal very slowly or fail to heal. Skin is placed onto the wound, where typically skin cells from the graft can then migrate laterally throughout the wound surface in order to form a layer of skin. Depending on the source of skin, grafting may be in the form of an autograft, a xenograft, or an allograft. In an autograft, a patient that is sufficiently healthy for additional surgery undergoes a procedure when skin is obtained from another area of the patient's body. In a xenograft, skin is obtained from another animal, such as a pig. In an allograft, skin is obtained from another person or from donor skin from a frozen cadaver. Allografts and xenografts are often a temporary measure since the patient's immune system often rejects these within about ten days. After an allograft or xenograft is used and rejected, an autograft may subsequently be used (Halim, A S et al., Indian J Plast Surg. 43(Suppl): S23- S28 (2010)). In some aspects, the disclosed nanoparticles or composition can be used to treat and / or prevent damage to the tissue graft. For example, the disclosed nanoparticles or composition can improve revascularization of the tissue graft and / or prevent reperfusion injury of the graft by reducing the generation of inflammatory cytokines, protecting the tissue from oxidative DNA damage, and / or enhancing cell replication. Additionally or alternatively, in other aspects, the disclosed nanoparticles or composition can be used to improve the cosmetic appearance of the tissue graft (e.g., minimizing scarring).

[0203] In some aspects, the disclosed nanoparticles or composition can be used on the tissue graft before explantation. In some aspects, the disclosed nanoparticles or composition can be used on the tissue graft before and / or during grafting. For example, in some aspects, the disclosed nanoparticles or composition can be administered immediately (e.g., within 1 minute) before grafting. In other aspects, the disclosed nanoparticles or composition can be administered at least about 1 minute (e.g., at least about 2 minutes, at least about 3 minutes, at least about 4 minutes, at least about 5 minutes, at least about 10 minutes, at least about 20 minutes, at least about 30 minutes, at least about 40 minutes, at least about 50 minutes, at least about 1 hour, at least about 2 hours, at least about 3 hours, at least about 4 hours, at least about 8 hours, at least about 12 hours, at least about 16 hours, at least about 20 hours, at least about 24 hours, at least about 32 hours, at least about 40 hours, at least about 48 hours, at least about 56 hours, at least about 64 hours, at least about 72 hours, at least about 4 days, at least about 5 days, at least about 6 days, at least about 1 week, at least about 2 weeks, at least about 3 weeks, at least about 4 weeks) before explantation and / or grafting. In some aspects, the nanoparticles or composition can be administered up to about 4 weeks (e.g., up to about 3 weeks, up to about 2 weeks, up to about 1 week, up to about 6 days, up to about 5 days, up to about 4 days, up to about 72 hours, up to about 64 hours, up to about 56 hours, up to about 48 hours, up to about 40 hours, up to about 32 hours, up to about 24 hours, up to about 20 hours, up to about 16 hours, up to about 12 hours, up to about 8 hours, up to about 4 hours, up to about 3 hours, up to about 2 hours, up to about 1 hour, up to about 50 minutes, up to about 40 minutes, up to about 30 minutes, up to about 20 minutes, up to about 10 minutes, up to about 5 minutes, up to about 4 minutes, up to about 3 minutes, up to about 2 minutes, up to about 1 minute) before explantation and / or grafting.

[0204] It is considered that the nanoparticles or composition can be administered any time before explantation and / or grafting ranging from any of the minimum values described above to any of the maximum values described above. For example, in some aspects, the nanoparticles or composition can be administered from about 1 minute to about 4 weeks (e.g., from about 2 minutes to about 3 weeks, from about 3 minutes to about 2 weeks, from about 4 minutes to about 1 week, from about 5 minutes to about 6 days, from about 10 minutes to about 5 days, from about 20 minutes to about 4 days, from about 30 minutes to about 72 hours, from about 40 minutes to about 64 hours, from about 50 minutes to about 56 hours, from about 1 hour to about 48 hours, from about 2 hours to about 40 hours, from about 3 hours to about 32 hours, from about 4 hours to about 24 hours, from about 8 hours to about 20 hours, from about 12 hours to about 16 hours, from about 1 minute to about 16 hours, from about 2 minutes to about12 hours, from about 3 minutes to about 8 hours, from about 4 minutes to about 4 hours, from about 5 minutes to about 3 hours, from about 10 minutes to about 2 hours, from about 20 minutes to about 1 hour, from about 30 minutes to about 50 minutes, from about 12 hours to about 4 weeks, from about 16 hours to about 3 weeks, from about 20 hours to about 2 weeks, from about 24 hours to about 1 week, from about 32 hours to about 6 days, from about 40 hours to about 5 days, from about 48 hours to about 4 days, from about 56 hours to about 72 hours) before explantation and / or grafting.

[0205] In some aspects, the disclosed nanoparticles or composition can be used on the tissue graft after grafting. For example, in some aspects, the nanoparticles or composition can be administered immediately (e.g., within about 1 minute) after grafting. In other aspects, the nanoparticles or composition can be administered at least about 1 minute (e.g., at least about 2 minutes, at least about 3 minutes, at least about 4 minutes, at least about 5 minutes, at least about 10 minutes, at least about 20 minutes, at least about 30 minutes, at least about 40 minutes, at least about 50 minutes, at least about 1 hour, at least about 2 hours, at least about 3 hours, at least about 4 hours, at least about 8 hours, at least about 12 hours, at least about 16 hours, at least about 20 hours, at least about 24 hours, at least about 32 hours, at least about 40 hours, at least about 48 hours, at least about 56 hours, at least about 64 hours, at least about 72 hours, at least about 4 days, at least about 5 days, at least about 6 days, at least about 1 week, at least about 2 weeks, at least about 3 weeks, at least about 4 weeks) after grafting. In some aspects, the nanoparticles or composition can be administered up to about 4 weeks (e.g., up to about 3 weeks, up to about 2 weeks, up to about 1 week, up to about 6 days, up to about 5 days, up to about 4 days, up to about 72 hours, up to about 64 hours, up to about 56 hours, up to about 48 hours, up to about 40 hours, up to about 32 hours, up to about 24 hours, up to about 20 hours, up to about 16 hours, up to about 12 hours, up to about 8 hours, up to about 4 hours, up to about 3 hours, up to about 2 hours, up to about 1 hour, up to about 50 minutes, up to about 40 minutes, up to about 30 minutes, up to about 20 minutes, up to about 10 minutes, up to about 5 minutes, up to about 4 minutes, up to about 3 minutes, up to about 2 minutes, up to about 1 minute) after grafting.

[0206] It is considered that the nanoparticles or composition can be administered any time after grafting ranging from any of the minimum values described above to any of the maximum values described above. For example, in some aspects, the nanoparticles or composition can be administered from about 1 minute to about 4 weeks (e.g., from about 2 minutes to about 3 weeks, from about 3 minutes to about 2 weeks, from about 4 minutes to about 1 week, from about 5 minutes to about 6 days, from about 10 minutes to about 5 days, from about 20 minutesto about 4 days, from about 30 minutes to about 72 hours, from about 40 minutes to about 64 hours, from about 50 minutes to about 56 hours, from about 1 hour to about 48 hours, from about 2 hours to about 40 hours, from about 3 hours to about 32 hours, from about 4 hours to about 24 hours, from about 8 hours to about 20 hours, from about 12 hours to about 16 hours, from about 1 minute to about 16 hours, from about 2 minutes to about 12 hours, from about 3 minutes to about 8 hours, from about 4 minutes to about 4 hours, from about 5 minutes to about 3 hours, from about 10 minutes to about 2 hours, from about 20 minutes to about 1 hour, from about 30 minutes to about 50 minutes, from about 12 hours to about 4 weeks, from about 16 hours to about 3 weeks, from about 20 hours to about 2 weeks, from about 24 hours to about 1 week, from about 32 hours to about 6 days, from about 40 hours to about 5 days, from about 48 hours to about 4 days, from about 56 hours to about 72 hours) after grafting.

[0207] In some aspects, the nanoparticles or composition can be administered twice a day, once a day, once every 2 days, once every 3 days, once every 4 days, once every 5 days, once every 6 days, once every 1 week, once every 2 weeks, once every 3 weeks, or once every 4 weeks. In some aspects, treatment with the nanoparticles or composition can be continued for at least 1 day (e.g., at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least about 1 week, at least about 2 weeks, at least about 3 weeks, at least about 4 weeks, at least about 5 weeks, at least about 6 weeks, at least about 7 weeks, at least about 8 weeks, at least about 9 weeks, at least about 10 weeks) after grafting. In some aspects, treatment with the nanoparticles or composition can be continued for up to about 10 weeks (e.g., up to about 9 weeks, up to about 8 weeks, up to about 7 weeks, up to about 6 weeks, up to about 5 weeks, up to about 4 weeks, up to about 3 weeks, up to about 2 weeks, up to about 1 week, up to 6 days, up to 5 days, up to 4 days, up to 3 days, up to 2 days, up to 1 day) after grafting.

[0208] It is considered that treatment with the nanoparticles or composition can be continued for a period ranging from any of the minimum values described above to any of the maximum values described above. For example, in some aspects, treatment with the nanoparticles or composition can be continued for from 1 day to about 10 weeks (e.g., from 2 days to about 9 weeks, from 3 days to about 8 weeks, from 4 days to about 7 weeks, from 5 days to about 6 weeks, from 6 days to about 5 weeks, from about 1 week to about 4 weeks, from about 2 weeks to about 3 weeks, from 1 day to about 3 weeks, from 2 days to about 2 weeks, from 3 days to about 1 week, from 4 days to 6 days, from about 2 weeks to about 10 weeks, from about 3 weeks to about 9 weeks, from about 4 weeks to about 8 weeks, from about 5 weeks to about 7 weeks) after grafting.EXAMPLESExample 1: Telomerase mRNA for Prevention of Radiation Induced Skin Damage

[0209] This study has shown that telomerase can be expressed in human skin using lipid nanoparticles encapsulating mRNA telomerase, for example, applied to the epidermis and dermis by microneedling. The mRNA telomerase is expressed in epidermal and dermal cells, including the vasculature. Damage to the vasculature is particularly contributory to the loss of vascularity and formation of disfiguring scar tissue that can afflict patients exposed to head and neck radiation.

[0210] These nanoparticles can be used for a topical therapy including mRNA telomerase in lipid nanoparticles in a cream that can increase penetration through the stratum comeum into the epidermis and dermis. Alternatively, dermabrasion or microneedling can be used to treat the skin. A prototype can be tested in keratinocytes, fibroblasts and vascular cells in cell culture; in an ex vivo model of human skin explants; in human skin grafts in immunodeficient mice. Further development may include GLP studies in small (mouse) and large (swine) animal models.

[0211] The nanoparticles have a number of benefits, including:

[0212] 1) Prevention of cutaneous radiation injury in patients undergoing radiation therapy for visceral tumors.

[0213] 2) Prevention against other forms of DNA damage and tissue injury with radiation therapy.

[0214] 3) Prevention of DNA damage and tissue injury due to cosmic radiation

[0215] 4) Prevention of DNA damage and tissue injury due to ultraviolet light or excessive energy of other wavelengths.

[0216] Currently, approaches to minimize radiation damage often carefully titrate the dose of radiation therapy to avoid injury to tissues other than the tumor. This reduces off-target effects, but does not prevent them entirely. Off-target effects still occur and cause substantial morbidity and mortality, e.g., accelerated loss of the vasculature which is replaced by disfiguring avascular scar tissue. Radiation therapy is also often localized to specific regions, e.g., by placing lead over regions of the body that one doesn’t want to irradiate, or by directly placing the radioactive source next to or within the tumor. Again, these approaches reduce, but do not abrogate, collateral tissue injury.

[0217] This therapy, applied exogenously, can reduce or prevent the incidence of radiation- induced skin damage as a sequela of treatment for cancer, industrial exposure to radiation, or eventually, more mundane exposure to UV radiation., i.e., from sunlight. The therapy includesapplication of telomerase, the enzyme that adds hexamer repeats to repair telomere damage and restore telomere length, to the skin. DNA damage to the telomere results from exposure to UV radiation, so application of telomerase can ameliorate or prevent telomere shortening.

[0218] Exogenous telomerase can be administered via a variety of known pharmaceutical methods as a: recombinant protein; nucleic acid; nucleic acid incorporated into a viral vector; or therapy including cells that overexpress telomerase. Administration of nucleic acids can employ lipid nanoparticle (LNP) delivery methods.

[0219] To achieve maximum delivery efficiency, six LNP formulations and commercially available transfection systems were tested. It was shown that LNPs formulated with a cationic lipid (DOTAP-A) were efficiently taken up by human skin cells in suspension (hSCS). This formulation does not appear to be proprietary. Further in vitro experiments showed TERT mRNA uptake and gene expression when donor hSCSs were applied to keratinocytes and fibroblasts, i.e., recipient cells showed enhanced telomerase activity in a dose-dependent fashion. In vivo experiments in mice showed that a different LNP formulation, one using a MC3 -based LNP (also non-proprietary), was more effective for intradermal delivery and gene expression. hTERT expression was then tested in a humanized mouse model by injecting the hTERT-MC3-LNP into a human skin graft. Results in the mice showed the presence of telomerase activity in the graft; this was not seen in an untreated graft (control). Next, in in vitro experiments, the effect of TERT therapy on radiation-induced DNA damage was assessed. It was shown that delivery of hTERT mRNA protected keratinocytes from such damage (DNA damage was measured by selectively staining DNA double-strand breaks with dye and subsequent microscopic visualization of skin cells). TERT mRNA LNPs were then delivered to intact explanted human and porcine skin grafts using a minimally invasive microneedling technique. Results showed that in the grafts receiving TERT had lower levels of proteins associated with DNA damage compared to untreated skin.

[0220] A pig study was performed to determine if exogenous mRNA telomerase encapsulated into lipid nanoparticles could increase the viability and proliferation of porcine skin cells disaggregated using the Avita approach, and applied to a wounded area. Major findings of the study were:

[0221] Endogenous telomerase is markedly activated after wounding in healthy swine. This observation was unexpected and intriguing. However, young Yorkshire pigs are known to heal rapidly after surgery, and it is possible that telomerase re-activation participates in healthy healing. Of relevance to the consideration of telomerase therapy in older individuals with impaired healing, application of exogenous telomerase is arguably a replacement therapyfor a deficient endogenous re-activation of telomerase. As a replacement of a normal process, the regulatory pathway for such a product may be simpler.

[0222] Treatment of the disaggregated porcine cells with exogenous mRNA telomerase markedly enhanced Ki67, the marker of cell proliferation. This increase in Ki67 was substantially more with the use of the mRNA telomerase LNPs (despite a robust re-activation of endogenous telomerase in the wound bed of all treatment groups).

[0223] These nanoparticles can be used as a therapeutic to prevent or treat cutaneous damage from radiation exposure; initially it can be used for patients undergoing radiation therapy for cancer. It can also be used to avert skin damage caused by exposure to industrial radiation, sunlight, or other external sources of DNA damage. Specifically, the product can be TERT mRNA delivered as a therapeutic via microneedling, dermabrasion, or as a cream to the skin for example.Example 2: Development of a Therapeutic to Treat DNA Damage Associated with Atypical Burns

[0224] A study was conducted which aimed to develop an mRNA nanotherapeutic system for prevention and therapy of DNA damage in skin cells caused by atypical radiation-induced bums. Thus, the study addressed two MBRP focus areas, namely: (1) Development of interventions to prevent and / or treat atypical burns resulting from exposure to radiation; and (2) Development of methods to prevent and / or treat burn injury-related complications. Recent studies show that administration of clinically relevant lipid nanoparticles (LNP) encapsulating mRNA encoding for telomerase reverse transcriptase (TERT) to human and porcine skin cells and tissues has a pronounced protective effect against radiation-induced damage, preventing cellular senescence, DNA double breaks and increasing cell survival (FIG. 12, FIGS. 13A- 13B)

[0225] Burn injuries represent a significant portion of the casualties within the active Service Members during military training and combat, causing an immense health burden to the military personnel, veterans, their family members, and the healthcare system. Importantly, burns sustained during the deployment are significantly more severe in their nature than those sustained in the civilian setting. While much effort is being placed on developing better methods to protect soldiers, there is a great lack of biological approaches that could protect, or prevent, skin wounds after exposure. Moreover, most combat burns sustained in recent conflicts are resulting from explosive device detonation, leading to greater wounds and injury. Since combat tools and explosives are constantly evolving and due to the development ofnuclear weapons and related threats, the need becomes even greater to protect active military and civil populations against radiation exposure.

[0226] Telomeres are repetitive non-coding DNA sequences that are found at the end of linear chromosomes in all eukaryotic cells and are playing pivotal roles in 1) protection of genetic information during cell division (Maynard et al. 2015); 2) recruiting proteins responsible for DNA repair (Maynard et al. 2015); and 3) protection of DNA from damage that can initiate cell apoptosis. Shortening of telomeres occurs naturally during cell division, cell aging (Aubert et al. 2008) and extrinsic damage (Conklin et al. 2019). Telomere shortening can result from blood flow impairment and cell-death related inflammation (Eitan et al. 2014) and can affect tissue regeneration ability (Martinez et al. 2017) (Nazari-Shafti et al. 2015). Telomere dysfunction has been implicated in degenerative processes (Wright et al. 2018), and telomerase, the enzyme responsible for maintaining telomere length (TL) during cell division, was shown to have a protective effect under oxidative stress, by decreasing reactive oxygen species (ROS) formation and blocking cellular apoptosis (Gonzalez-Giraldo et al. 2016) (Zhao et al. 2016). Additionally, regenerative capacity of multiple tissues / organs has been shown to directly relate to telomere length (Westhoff et al. 2010). Two pathophysiological processes in wound regeneration, namely inflammation and oxidative stress, have been reported as causes for extensive telomere shortening (Eitan et al. 2014) (Smith et al. 2013).

[0227] Telomerase is a ribonucleoprotein polymerase including an RNA subunit providing the RNA template (TTAGGG repeats) and a catalytic subunit encoded by the telomerase reverse transcriptase (TERT, FIG. 1) (Yan et al. 2014). Without TERT, telomeres shorten, and somatic cells ultimately undergo senescence. Reactivation of telomerase activity enhances wound healing (Buckingham et al. 2011), thus, telomere elongation through TERT expression may enable better wound healing and prevent scarring. Also, TERT has important non- canonical extranuclear functions in regulation of mitochondrial and cytosolic ROS (Rosen et al. 2020). It has been previously shown that restoring TL using TERT mRNA is beneficial in degenerative conditions, such as Hutchinson- Gilford Progeria Syndrome (HGPS) (Li et al. 2019) and in rejuvenation of a variety of senescent human cell types (Li et al. 2017) (Ramunas et al. 2015). While telomerase is a holoenzyme, the TERT subunit when added to human cells is sufficient to lengthen telomeres and restore cellular functions (Nazari-Shafti et al. 2015) (Li et al. 2019) (Li et al. 2017) (Ramunas et al. 2015) (Matrone et al. 2019) (Mojiri et al. 2021). Specifically, this was observed in endothelial cells (ECs) derived from induced pluripotent stem cells generated from HGPS patients or control subjects (Li et al. 2019). It was found that HGPS patient-derived ECs proliferated poorly; had impaired functions (e.g., nitric oxiderelease); manifested abnormal cell and nuclear morphology; generated inflammatory cytokines; and had an altered transcriptional profile and DNA damage. These abnormalities were reversed or reduced after transient transfection with TERT mRNA. Importantly, as opposed to constitutive expression in cancer, mRNA provided only a transient (<48 h) TERT expression, yet this was sufficient to extend the telomeres and improve cells’ replicative capacity, without resulting in cell immortalization (Li el al. 2019) (Li el al. 2017) (Ramunas et al. 2015) (Mojiri et al. 2021). It was observed that short-term expression of TERT reduces many determinants of cancer including the generation of inflammatory cytokines and DNA damage (Lentz et al. 2012) (Allen et al. 2013). In this regard, transient expression of telomerase in a tamoxifen-inducible construct in transgenic mice was associated with improved insulin sensitivity, decreased osteoporosis, no increase in cancer, and a 24% increase in lifespan (Bernardes de Jesus et al. 2012).

[0228] Recently, several studies suggested that TERT has non-canonical functions beyond telomere repair. The non-canonical functions of TERT have also been shown to protect cells from chemotherapeutic agents (Chatterjee et al. 2021). Both radiation and chemotherapeutic agents cause mitochondrial DNA damage (Maida et al. 2009) and generation of reactive oxygen species (ROS) (Ahmed et al. 2008). Induction of telomerase activity protects against these adverse effects However, the molecular mechanism by which telomerase protects cells has not yet been clearly established.

[0229] Although TERT is reactivated in cancer cells, there is no evidence that TERT promotes tumorigenesis. In fact, many studies of somatic cells, such as endothelial cells have shown that overexpression of TERT restores normal phenotype and functions (Baumer et al. 2010), and reverses many markers of senescence without inducing immortalization. Mice overexpressing mouse TERT do not exhibit more prevalent tumor formation, suggesting that this enzyme is not capable of inducing transformation in vivo. It is hypothesized that the reappearance of telomerase in cancer might be a response to DNA damage.

[0230] Lipid Nanoparticles (LNP) for mRNA therapeutics'. The recent pandemic solidified the use of mRNA therapies and showed the potential of lipid nanoparticles (LNP) technology as a delivery system for mRNA. Recent advances in mRNA therapeutics and vaccines have attracted significant attention based on their ability to tackle unmet clinical needs. More specifically, there has been a speedy and efficient clinical development of mRNA vaccines against COVID- 19 in the past two years, slowing down the pandemic worldwide. It is now clear that mRNA promises to transform clinical applications such as immunizations, tissue regeneration, genetic disorders, and protein replacement therapies. Efficient delivery of mRNAand its targeted expression in specific cells are the key factors to optimize mRNA therapeutic applications (Kowalski et al. 2019). Previously, viral vectors and DNA plasmids have been extensively employed as gene therapy methods in vivo (Lentz et al. 2012). However, these delivery approaches may integrate exogenous DNA and permanently alter the human genome and, therefore, have seen limited application in the clinic. Despite the advances in mRNA synthesis and regulation, the use of mRNA as gene therapy is hampered due to its susceptibility to nucleases and the need for a protective delivery system that enables a long half-life and a slow body clearance (Kowalski et al. 2019) (Granot et al. 2017) (Yoder et al. 2021 ). Furthermore, the negative charge, high molecular weight and the hydrophilicity of mRNA impair its cellular uptake. These hurdles are overcome in large part by liposomes and other LNP. These agents have been in clinical use for the therapy of cancer and infectious diseases for more than 25 years (Allen et al. 2013) (Anchordoquy et al. 2017). They are the most frequently used non-viral vector for RNA delivery (Cullis et al. 2017) due to their efficient binding and condensing of RNA, providing protection from enzymatic and chemical degradation in the extracellular milieu, and facilitating efficient intracellular delivery. Clinically used mRNA vaccines are based on mRNA encapsulated in LNP. LNP are formed by the self-assembly of mRNA, phospholipids and cholesterol. A key feature of the LNP for mRNA delivery is the presence of the positively charged lipid during the preparation of LNP to enable complexation and encapsulation of negatively charged RNA. The lipid can be either permanently cationic (Simberg et al. 2004) (Kulkami et al. 2018) (e.g., DOTAP) or neutral at physiological pH to reduce cytotoxicity and positively charged in an acidic endosomal environment (aka ionizable, e.g., DLin-MC3-DMA) (Kulkarni et al. 2018). Charged lipids disrupt the endosomal membrane, facilitating the endosomal escape of the LNP (Kowalski et al. 2019) (Simberg et al. 2004) (Kulkami et al. 2018). Significant progress has been made in preparing LNP with the microfluidic technology introduction (Belliveau et al. 2012). This study has aimed to develop LNP to be used to encapsulate and efficiently deliver the mRNA telomerase therapy (Chang et al. 2023) (Samaridou et al. 2020).

[0231] Atypical bums and skin reactions caused by ionizing radiation: Exposure to ionizing radiation causes atypical radiation burns, which involve short and long-term damage to cutaneous epidermis, dermis and microvasculature, as schematically summarized in FIG. 2. Several accidental or intentional events of exposure to nuclear radiation have raised awareness of the shocking damage these exposures can cause to the human body. Although uncommon, nuclear plant tragedies, such as the 1986 Chernobyl accident due to nuclear reactor core overheating and Fukushima 2011 accident, caused by a tsunami, are considered among thegreatest ecological disasters throughout human history. Moreover, there is an increasing risk of military personnel and civilians’ exposure to the high doses of radiation from radiological weapons, and specifically by nuclear weapons of mass destruction, possessed by terrorist organizations (e.g., improvised nuclear or radiological dispersal devices, also called dirty nuclear bombs) or countries with unstable / totalitarian regimes, which have a nuclear power capabilities (Singh el al. 2015) (Flynn et al. 2006).

[0232] Additionally, military personnel, Veterans and civilians are exposed to ionizing radiation during some routine medical procedures, such as high exposure to radiation during repeated diagnostic medical imaging, interventional radiology procedures, or radiation therapy radiotherapy (Chan et al. 2014) (Anker et al. 2016). Radiation therapy is one of the most common forms of cancer therapy, with more than four million people treated in the US annually, more than 90% of whom will develop various grades of radiation skin injury

[0233] Ionizing radiation is the underlying cause for the devastating health effects related to the above exposures and is defined as radiation with sufficient energy to interfere with the electron orbitals, making the atom charged or ionized (World Health Organization 2023). There are some agents approved by FDA for relieving the symptoms of exposure to radiation in hematopoietic system (e.g., granulocyte colony stimulating factors, NeupogenVR and Nulasta VR by Amgen, and Leukine by Partner Therapeutics) as well as chelators for removing systemic burden of radionucleotides (Zn-DTPA, Ca-DTPA etc.). On other hand, skin represents the most external organ of the body that, besides the bone marrow is readily affected by the exposure to ionizing radiation, which causes atypical injury and burns, due to the number of cells that possess “sternness” and proliferate and differentiate on a constant basis (Prise et al. 2011). However, there are currently no agents approved by FDA that treat skin bums / injuries originated from ionizing radiation.

[0234] Better management of radiation-induced skin effects might improve the therapeutic benefit of medical radiation therapy in military personnel, Veterans and civilians, as well as reduce the mortality expected in any radiation device related assaults or incidents. Although several hundreds of decomposition products can be a direct result from a nuclear reaction, the main mechanism of decay is by the emission of ionizing gamma and beta particles. The skin is highly sensitive and susceptible to radioactive decay, which causes damage mainly through apoptosis and senescence in keratinocytes, vacuolization of the basal layer progenitors, destroying skin microvasculature and epidermal edema. Basal keratinocytes, stem cells in the hair follicles, and melanocytes are highly radiosensitive (McQuestion et al. 2011) (Mendelsohn et al. 2002). During radiation therapy, the first fractionated dose of radiation causes immediatestructural tissue damage, ionization of cellular water and generation of short-lived free radicals, double-stranded breaks in nuclear and mitochondrial DNA, and inflammation (Hymes et al. 2006) (Lopez et al. 2005) (McBride et al. 2004). Due to the significant damage to basal keratinocytes the self-renewing property of the epidermis is largely impaired. Repeated or higher dose exposures prevent replenishing of the viable basal cells. Currently, the only treatment includes providing a standard of wound care to avoid further tissue destruction and damage, thus therapy and preventative measures for radiation-induced skin wounds represent an unmet clinical need.

[0235] Necrosis of the epidermis and dermis, accompanied by a blister formation and ultimately detaching of the skin layers and spontaneous bleeding can be observed in higher radiation doses (Jensen et al. 2011). These wounds have a significantly impaired healing capacity, may require skin grafts to heal and cause significant mortality. Moreover, radiation bums significantly differ from thermal bums due to an initial difficulty in delineating wounded areas from unaffected ones. This diagnostic difficulty is due to the unpredictable progression of radiation-induced wounds, that can take hours to years to develop (Yigit et al. 2021) (Korman et al. 2017). In addition, radiation-induced bums result in extreme, opiate-resistant pain (Mendelsohn et al. 2002) (Hymes et al. 2006) (Korman et al. 2017) (Ryan et al. 2012).

[0236] Besides epidermal integrity, radiation exposure can directly affect dermal vasculature by causing endothelial cells (EC) to undergo senescence and apoptosis due to impaired homeostasis. Exposure of EC to radiation appears to present in an abundant increase in inducible nitric oxide synthase (NOS), activation of inflammatory signaling cascades, and dysregulation of glycolytic and lipid metabolic pathways. These pathways are also altered during vascular and tissue injury (Nazari-Shafti et al. 2015) (Matrone et al. 2019) (Mojiri et al. 2021). A glycolytic switch has been identified where oxidative phosphorylation is down regulated, and glycolysis becomes the primary source of energy. This metabolic switch resembles the Warburg syndrome described for cancer. Previous demonstrated that the increase in glycolysis led to an increased production of acetyl CoA, necessary for epigenetic remodeling. Other studies suggest that the excessive radiation-induced ROS disrupts the electron transport chain and causes denaturation of proteins that lead to changes in the electrochemical gradient of the mitochondrial membrane. This ultimately mimics aging and degenerative abnormalities that resemble mitochondrial oxidative disorders (Azzam et al. 2012). Radiation further increases the expression of monocarboxylate transporter, leading to extrusion of lactate to the exterior of the cell and activation of adenosine monophosphate- activated protein kinase, leading to cellular senescence.

[0237] Here, this study proposes to develop an mRNA based therapeutic, to prevent or minimize symptoms and disease caused from exposure. The approach is based on cutaneous delivery of mRNA encoding for telomerase reverse transcriptase (TERT) for protection or repair of genomic DNA damage causing atypical burns associated with radiation exposure in keratinocyte progenitors and cutaneous endothelial cells. Supporting the development of the proposed therapeutic approach, preliminary data has shown that:

[0238] (1) Delivery using clinically relevant LNP encapsulating TERT mRNA to skin and endothelial cells markedly reduces DNA damage, prevents cellular senescence, and increases cell survival after radiation exposure in vitro in human and porcine skin.

[0239] (2) mRNA LNPs can be effectively delivered into human skin explants using a clinically relevant microneedling approach, with excellent expression of reporter constructs in the epidermis and dermis.

[0240] Additionally, it has been shown that lentiviral transfection of TERT in an HGPS mouse model of accelerated aging, reduced vascular senescence and DNA damage, and increased overall animal lifespan (Mojiri et al. 2021). It is important to note, that unlike in the case of constant expression of TERT leading to tumorigenesis (e.g., plasmids), transient expression of TERT with mRNA does not cause cell immortalization or transformation; nor did sustained lentiviral expression of murine TERT induce tumor formation. Thus, there is no evidence that TERT can induce cancer, and in fact this protein may offer very powerful protection against genomic DNA damage induced by exposures to toxins, radiation and other agents that might cause significant DNA damage leading to cell senescence, death or cellular transformation. Additionally, optimized TERT mRNA LNP improved wound healing through engraftment of donor skin cells used to treat partial thickness wounds, while reducing cellular senescence (p21) and DNA damage (53BP1) (Belliveau et al. 2012).

[0241] As described above: (1) radiation-induced skin burns involve various processes that have detrimental effects on the skin; (2) TERT plays a significant role in tissue repair and the data show that can prevent radiation-induced damage to human and porcine skin cells and skin explants.

[0242] It is hypothesized that skin delivery of mRNA TERT encapsulated in LNP can prevent or rapidly repair genomic DNA damage to protect skin and vascular cells as well as stem progenitors from ionizing radiation damage. This study proposes to develop TERT mRNA as a potential product to prevent and treat damaged external tissues (skin layers and vasculature) after radiation exposure. This product can be delivered to skin through encapsulation of the mRNA in an LNP with or without microneedling. The proposed therapycan address unmet clinical needs in prevention and therapy of atypical burns resulting from various exposures to ionizing radiation.

[0243] The LNP can be optimized to provide efficient uptake of the mRNA without causing significant toxicity. Uptake in appropriate cells can be confirmed, and efficacy and biocompatibility of mRNA TERT therapy can be demonstrated in animal models and human tissues. This can show that delivery of TERT nanotherapy is safe and effective at prevention and treatment of damage caused by radiation exposure. The data could allow the determination a final formulation / system of the product and to complete efficacy studies. Histopathology data pertaining to the toxicity associated with the TERT mRNA LNP can also be obtained in two animal models, which can serve as a guide for developing safety and toxicity studies.

[0244] Currently, there are established human and pig skin explants and skin cellular models, including skin cell suspensions, as well as rodent models of radiation exposure. Histopathology assessment of various organs in pigs and rodents can also be conducted to evaluate toxicity of the mRNA-LNP in the other tissues and vital organs.

[0245] mRNA LNP design improving TERT mRNA delivery and expression in target cells and skin: There is a significant body of knowledge and expertise on the design of mRNA LNP for treating skin conditions. The choice of the formulation highly depends on the administration mode. Application of TERT mRNA in optimized LNP to human skin cell suspension (hSCS) ex vivo can improve cellular functions associated with promoting wound healing in a partial-thickness murine wound model (Chang et al. 2023). RNA therapeutics require LNP for efficient administration and protection from enzymatic and chemical degradation (Han et al. 2021). Accordingly, the LNP system was first optimized for mRNA delivery to hSCS. In this clinical scenario, to deliver hTERT mRNA to hSCS during the point- of-care procedure, the carrier should enable a prompt and efficient uptake into the skin cells ex vivo pre-application to the wound, and effective mRNA expression. To encapsulate highly anionic mRNA, lipids in LNP should bear positive charge. Clinically, RNAs are administered systemically and contain ionizable (at low pH) lipids (Han et al. 2021). While in vivo parenteral administration of ionizable LNP was proven safer than cationic (constantly charged) lipids (Dokka et al. 2000) (Ewert et al. 2021) (Hafez et al. 2001), for topical mRNA applications cationic LNPs are safe and more effective for mRNA delivery. This study explored six LNP formulations (FIGS. 3A-3B) and tested their delivery and mRNA expression in hSCS isolated from human donor skin (FIG. 4). Data show that out of the six tested systems and commercially available transfection reagent, LNP formulated with cationic lipid (DOTAP-A) were promptly taken up by hSCS resulting in high transfection efficiency of skin cell suspension (FIG. 4).However, other LNP formulations and lipofectamine did not allow for efficient mRNA transfection under the conditions of the hSCS therapy relevant for clinical translation. It was further demonstrated that optimized EGFP mRNA DOTAP-A LNP were taken up and expressed in the major cell populations in the skin and hSCS, keratinocytes (65%) and fibroblasts (30%) (Motamedi et al. 2021) (Wood et al. 2012) (FIG. 5) and hTERT mRNA formulated in DOTAP-A LNP enhanced the telomerase activity in hSCS from donor, as early as one-hour post treatment, and in a dose-dependent fashion (FIGS. 6A-6B see below the explanation for TRAP assay).

[0246] Surprisingly, it was found that this trend is different when in vivo application is required. As an example, FIG. 7 shows that MC3 based LNP were the most effective formulation for intradermal delivery of mRNA in mice (in vivo). MC3 based LNP provided a stronger luciferase signal, as compared to similar LNP made with DOTAP lipids (FIG. 7, FIG. 8). In these studies, the LNP was injected into the skin in vivo at a specific location, in order to use the same graft as a control for the particles alone. The particles had no chemiluminescence associated with them and all appeared to be specific to the luciferase RNA.

[0247] Finally, the study tested hTERT expression in the humanized mouse model by injecting the hTERT-LNP (MC3) into the human skin graft. The graft was later isolated and subjected to a telomerase repeated amplification assay, in which telomerase activity is measured by the repeated DNA possessing a label being added to the ends of the telomeres. The TRAP assay includes three steps: extension, amplification, and detection of telomerase products. In the extension step, telomeric repeats are added to the telomerase substrate (which is a non-telomeric oligonucleotide) by telomerase. In the amplification step, the extension products are amplified by the polymerase chain reaction (PCR) using specific primers (non- telomeric oligo upstream primer and a telomeric downstream primer) and in the detection step, the presence or absence of telomerase is analyzed by electrophoresis (Mender et al. 2015) (FIG. 9). The results show the presence of telomerase activity in the skin, that received the hTERT LNP but not the untreated skin, and not when the protein extract was heated to inactivate telomerase (HK).

[0248] TERT therapy for cellular senescence, tissue regeneration and prevention of radiation-induced DNA damage: Cell senescence is a fundamental mechanism of aging that is a critical driver of radiation induced injury (Peng et al. 2020) (Hai et al. 2018) (Li et al. 2018). Accumulation of DNA damage is central to radiation exposure as well as progressive cell aging. DNA damage causes genomic instability and induces transcription and replication stalling throughout the genome. This activates a complex network of DNA repair and DNAdamage response (DDR) systems to maintain DNA integrity. DNA damage is more prominent at dysfunctional telomeres, which are excessively shortened and have lost their telomeric structure. To avoid telomeric damage, stem cells and germline cells express TERT which maintains the length of telomeres. Conversely, critically short telomeres initiate chronic DDR activation in somatic cells leading them to be replicatively senescent. Increased DNA damage in cells isolated from Hutchinson Gilford Progeria Syndrome (HGPS) patients has been previously reported. Hutchinson-Gilford progeria syndrome (HGPS) derived iPSC-endothelial cells (iPSC-ECs) exhibit features of premature senescence, including reduced telomere length and cell proliferation (Matrone et al. 2019). Previous studies observed the prevalence of nuclear dysmorphology in HGPS iPSC-ECs by comparison to non-HGPS iPSC-ECs. HGPS iPSC-EC also has a size and shape consistent with senescence. HGPS iPSC-ECs also have reduced production of nitric oxide, a phenomenon also observed in aged ECs. HGPS iPSC-ECs formed fewer network structures, thus having a reduced angiogenic capacity (Matrone et al. 2019). Thus, iPSC-derived vascular cells derived from these patients provide a unique model for cellular senescence in both male and female versions of these cells. Further, TERT mRNA therapy reverses senescence and DNA damage in HGPS hiPSC-derived ECs. Recent work has shown that hTERT treatment of human HGPS hiPSC-ECs improved replicative capacity; restored endothelial functions such as nitric oxide generation, acLDL uptake, and angiogenesis; and reduced the elaboration of inflammatory cytokines (Mojiri et al. 2021). In addition, TERT treatment improved cellular and nuclear morphology, in association with a normalization of the transcriptional profile. The treatment reversed DNA damage.

[0249] Moreover, studies in endothelial cells have shown normalization of the replicative capacity of senescent cells by mRNA TERT, which is dose and treatment frequency dependent (FIG. 10). No abnormal growth was observed in these studies. Further, the markers of DNA damage and cellular senescence (53BP1 and p21) are reduced and cell proliferation markers (Ki67) increase in skin wound healing when hSCS are pre-treated with TERT mRNA LNP (FIG. 11).

[0250] Next, the study assessed the effect of TERT therapy on radiation-induced DNA damage, staining the DNA double-breaks with gH2Ax (green) (FIG. 12). The data demonstrate that delivery of hTERT mRNA protected keratinocytes from DNA damage associated with exposure to 5 Gy radiation.

[0251] Further, transfection with TERT mRNA LNP prevents DNA damage in cells in skin tissue. TERT mRNA LNP were delivered to intact human and porcine skin by intradermal delivery into skin explants. In these experiments, TERT LNP was introduced into human andporcine skin grafts using a minimally invasive microneedling technique The results showed in all cases that skin receiving TERT had significantly lower levels of proteins associated with DNA damage (gH2Ax) as compared to untreated skin.

[0252] Collectively, these data serve as a significant foundation showing high feasibility of the proposed research to provide first in class therapeutic for prevention or therapy of atypical radiation-induced bums.

[0253] Optimize TERT mRNA LNP in human and porcine skin cell models and skin explants: The study next focused on optimization of the delivery system in vitro and mechanisms of protection from radiation-induced atypical skin burns in in vitro and ex vivo models. Human cells, cell suspensions isolated from human skin donors and porcine cells can be used. The study can use pig skin and porcine skin cells, as these represent a well- characterized model for dermal delivery with the most similarities to human skin. Animal skin models are frequently used in research and development of dermal products (Godin et al. 2007). Although rodent skin has served a common substitute for human skin in many studies in the literature, due to the ethical considerations, cost and availability, it is well accepted that the most accurate model for human skin is the porcine skin, based on anatomy and physiology (Abd et al. 2016), immunogenicity, cellular composition, and morphology (Jacobi et al. 2007).

[0254] Kinetic uptake and reporter gene expression (GFP mRNA) in human and porcine skin suspension cells as well as cultured human keratinocytes, fibroblasts and skin endothelial cells (see preliminary data) can be assessed using IncuCyte™ live in vitro imaging system. The cells can be seeded in a 96 well plate (4,000 cells / well) 24 h before the experiment. Cells incubated with GFP mRNA LNP labeled with rhodamine lipid (0.2-4 pg / mL mRNA) can be imaged hourly for 48 h using IncuCyte™ S3. For fluorescence imaging, the acquisition times can be 300 msec for the green channel (GFP) and 400 msec for the red channel (fluorescent lipid, LNP).

[0255] Further, the study can assess 4 delivery methods in human and porcine skin explants:

[0256] 1) Minimally invasive microneedling followed by administration of MC3 basedTERT mRNA LNP.

[0257] 2) Minimally invasive microneedling followed by administration of SMI 02 basedTERT mRNA LNP.

[0258] 3) TERT mRNA LNP with skin permeation enhancement properties based on LNP delivery carrier with DOTAP lipid, as previously described (Godin et al. 2007) (Godin et al. 2004) (Godin et al. 2005) (Touitou et al. 2008).

[0259] 4) TERT mRNA LNP with skin permeation enhancement properties based on delivery carrier with MC3.

[0260] For methods 1 and 2, the study can use a microneedling device commonly employed for cosmetic procedures (DermaPen) = at 3 different needle lengths (0.5, 1 and 2mm) for administration of the GFP mRNA LNP to the skin. For methods 3 and 4 skin permeation enhancers (oleic acid (Jiang et al. 2003) or ethanol (Godin el al. 2007) (Godin et al. 2004) (Godin et al. 2005) (Touitou et al. 2008)) can be added to the LNP design. Fluorescence from the reporter protein and fluorescent lipid can be assessed at 24 and 48 h post-administration and a local injection into the skin can be used as a positive control.

[0261] Methodology:

[0262] Human and porcine skin explants and cell suspensions'. De-identified adult human skin samples are purchased from BIOIVT or procured under the Houston Methodist Research Institute (HMRI) Institutional Review Board approved protocol with patient / family consent (IRB #PR000027413). To minimize animal use, for in vitro and ex vivo studies porcine skin can be used from the pigs undergoing terminal procedures on other research protocols in Houston Methodist. Tissues can be processed immediately or stored in 4°C for up to 48 hours. To create skin cell suspension (e.g., FIG. 4, FIGS. 6A-6B), split-thickness skin (0.15-0.20 cm) including epidermal and partial dermal layers can be isolated from a donor skin using an electric dermatome (#88710100, Zimmer Biomet, Warsaw, IN). hSCS can be prepared from split thickness skin using RECELL Autologous Cell Harvesting Device (AVITA Medical) following the manufacturer’s instructions (>50% cell viability is achieved).

[0263] Skin explants'. The dermatomed or full-thickness skin is cut into 2x2cm squares, apical side is immersed in serum free DMEM culture media (with antibiotics). Skin explants maintain viability for up to 7 days.

[0264] Cell Culture'. Normal human neonatal primary epidermal keratinocytes (#PCS-200- 010, ATCC) can be grown in Dermal Cell Basal Medium (#PCS-200-030, ATCC) and supplemented with the Keratinocyte Growth Kit. Normal adult human dermal fibroblasts (#PCS-201-012, ATCC) will be cultured in DMEM media with 10% FBS and 1% penicillinstreptomycin. Cells were maintained at 37°C and 5% CO2.

[0265] mRNA therapy. The telomerase mRNA can be constructed and purified by the Center for RNA Therapeutics within HMRI. This facility has been making mRNA for clients both commercial and academic for eight years and is supported by the Cancer Prevention Research Institute of Texas (CPRIT). Briefly, the cDNA template contains the TERT subunit downstream of a T7 RNA polymerase promoter with a start site and poly adenylation site toproduce linear RNA. After IVT, the mRNA is purified by LiCl precipitation and tangential flow filtration. Synthetic RNA for EGFP and luciferase can also be generated to assess efficiency of skin transfection. Additionally, various animal models may require species specific TERT. Previous studies have created and tested both human TERT mRNA (hTERT) and porcine TERT mRNA (pTERT). The constructs have greater than 95% expression of the reporter gene with commercially available transfection reagents. However, some cell toxicity from the transfection reagents was noted. LNP encapsulation can resolve this issue. Both hTERT and pTERT mRNA have high expression in respective cell models when delivered by optimized LNP and protect from radiation induced DNA damage in human and porcine skin explants respectively (see preliminary data). For the in vivo models, the study can further create and characterize rat TERT mRNA (rTERT) based on the established protocols.

[0266] LNP design: LNP for therapeutic application can be produced using various manufacturing methods, mostly done by thin layer drying followed by sonication or extrusion, or by ethanol injection. Sonication and extrusion techniques are used due their simplicity, although they suffer from batch-to-batch variations and are not easily scaled up. Newly developed technology with microfluidics called NanoAssemblerTM (Precision NanoSystems, Inc) can alleviate these problems (Kastner et al. 2014) (Roces et al. 2020). NanoassemblerTM enables rapid, reproducible and scalable manufacture of homogeneous next-generation LNP (Belliveau et al. 2012) (Zhigaltsev et al. 2012) using a microfluidic mixing cartridge, where lipid-containing solvent is pumped into one inlet and aqueous buffer into the other inlet. LNP formation takes place at the interface of the solvent and aqueous streams and is based on polarity change along the chamber. The mixing is promoted by the design of the channel and channel floor groove, which enhance the controlled turbulence flow, creating an increase in the surface area of the fluid interface.

[0267] Rigor and Reproducibility: Nanoassemblr has been used in previous studies (Chang et al. 2023) (Ramishetti et al. 2015) and is able to improve mRNA LNP production, reproducibility and scalability (Kastner et al. 2014) (Belliveau et al. 2012) (Zhigaltsev et al. 2012) and is cGMP-ready.

[0268] Four LNP systems (as described above) can be designed. Besides the charged lipid, the systems can contain dioleoylphosphatidylcholine (DOPC), cholesterol, 1 ,2-Dimyristoyl- rac-glycerol-3-methoxy polyethylene glycol-2000 (DMG-PEG 2000), and phosphatidylethanolamine (PE) and may contain oleic acid and / or ethanol. For testing the biodistribution of mRNA IN delivered from LNP, the study can design LNP including reporter mRNA (GFP and luciferase [luc]). Luc of GFP mRNA (capped) can be produced by mRNAcore in HMRI using established protocols suitable for clinical-grade mRNA. Several lipids and lipid / mRNA ratios can be used to optimize the mRNA loading and LNP characteristics using Nanoassemblr technology. Briefly, lipids can be dissolved in the ethanolic phase and mRNA in the aqueous phase. The phases are combined using a microfluidic chip at the ratio of 1 :3 and a flow rate of 4-10mL / min. For the initial studies, LNP can be labeled by integrating lipid labeled with Cy5.5 probe (l,2-dioleoyl-sn-glycerol-3-phosphoethanolamine-N-(Cyanine 5.5)) in the membrane. The mixture can be dialyzed in phosphate-buffered saline for 8 hours at 4°C to remove ethanol and unbound mRNA.

[0269] LNP can be formed with >90% encapsulation efficiency of mRNA, diameter within the range of 70-150nm. It could also be possible to positively charge LNP and absorb the negatively charged mRNA on the surface. The best performing methods can be further tested for protection against radiation-induced skin injury as well as in vivo delivery and transfection to the deep skin layers.

[0270] Optimize the delivery method and timing of hTERT LNP to provide efficient skin delivery porcine model in vivo and maximum protection against atypical burns induced by radiation in human / porcine skin explants and rat model of radiation -induced skin burns in rodents (rats): The study can next focus on efficacy evaluation ex vivo and in vivo and in vivo skin permeation and mRNA expression studies.

[0271] Irradiation studies in skin cells and skin explants'. Skin explants can be produced as described above from human and porcine skin. Skin cells as described above can be used. For radiation studies in in vitro and ex vivo models, RadSource biological irradiator RS2000 can be used. The irradiator is engineered to allow for radiation dose uniformity at 6 levels of exposure (1-10 Gy / min) and the beam quality within the system is considered by the FDA to be equivalent to Cesium- 137 gamma irradiators and can be used both for small animals and ex vivo / in vitro samples. For in vitro and ex vivo studies all the delivery methods listed can be assessed. The TERT therapy can be applied 2, 8 or 24h prior to radiation exposure or immediately after the exposure (cumulative exposure doses of l-20Gy). Following the irradiation, cells / skin explants can be incubated at 37°C until the evaluation (1, 2, 4, 24h, 48h and 7 days for skin explants). No treatment control and EGFP mRNA LNP treated controls can be used for comparison to assess the TERT therapy efficacy. The study can include TRAP assay to assess TERT activity, measure DNA damage (53BP1; gH2Ax). The study can include measurement of skin damage (Transepithelial water loss for skin integrity / permeability; - galactosidase staining for cellular senescence; and TUNEL for apoptosis) and skin health(keratin expression; vascular density; proliferative markers, and histological organization of skin structural layers) before and after atypical burns.

[0272] Irradiation studies in in vivo model: Two delivery methods with appropriate controls can be chosen based on mRNA delivery and expression efficiency as well as efficacy observed with skin explants for in vivo animal irradiation studies. Importantly, radiation skin reactions in Sprague-Dawley rats represent an established model for evaluation of potential therapies in radiation induced burns in the literature (Zhang et al. 2012) (Zu et al. 2014).

[0273] For studies in rats, Sprague-Dawley rats (3m+3f / group / timepoint, ~200g) can be exposed once or three times at 5 days intervals with 5, 20 and 60Gy cumulative doses (6 dosing schedules). The irradiated area can be 2x2cm and a stereotype shield can be used. Based on ex vivo and in vitro evaluation the study can choose two optimized TERT delivery schedules / methods to be assessed in in vivo model. The no treatment control and EGFP mRNA can be used as controls. The animals can be monitored and sacrifieced at 4, 24h and 1 week and 1 month after the exposure to access the effect of TERT therapy on immediate and delayed radiation-induced skin damage. The skin damage can be graded based on Acute RTOG grading standards are as follows: 0: basic unchanged; grade 1: blisters, light erythema, hair loss, dry desquamation and decreased sweating; grade II: skin touch pain, obvious erythema with flaky moist desquamation and moderate edema; grade III: confluent moist desquamation in addition to skin folds and severe edema; grade IV: ulcers, bleeding and necrosis. Besides the markers of tissue damage listed above (SAI, skin explants), skin lesions, epidermal and dermal tissues, dermal edema, capillaries, bleeding, neutropenia, and hair follicle structure can be assessed microscopically. Further, membrane integrity, mitochondria, endoplasmic reticulum structure, collagen fibers, and nucleus film structure were observed using a transmission electron microscopy.

[0274] Evaluation of skin delivery in vivo in pigs: Two delivery methods with appropriate controls can be chosen based on mRNA delivery and expression efficiency. Both pTERT and a reporter gene EGFP can be used in Cy5.5 lipid labeled LNP to evaluate the delivery and transfection in pigs. A total number of pigs (Yorkshire, 20-401b, Oak Hill Genetics) can be 20 (10f+10m) with 12 applications sites on each animal (2 delivery methods-i- 2 controls x3 on each animal). The animals can be sacrificed at 4, 24, 48 and 72 h after application (2m+2f / timepoint), the skin from the marked application areas can be excised and processed for histological evaluation (cryosectioning and paraffin sectioning). LNP delivery and mRNA expression can be assessed based on the EGFP expression (green fluorescence) and Cy5.5 fluorescence, and immunostaining of pTERT and EGFP.

[0275] TERT therapy can have a protective effect against radiation-induced skin burns in vivo, significantly reducing the RTOG scores across various radiation doses in rats. The study could also utilize immuno-deficient mice that receive human skin grafts (FIG. 8).

[0276] Confirm that the proposed therapy is biocompatible in rodents (rats) and a large animal model (pigs): Two healthy animal models are generally required for indication of the systems safety. The study can assess the initial biocompatibility and tolerability of three doses of the proposed product in both rat and porcine models. Pig skin is the most accurate animal model for human skin studies, from the perspectives of anatomy and physiology (Abd et al. 2016), immunogenicity, cellular composition, and morphology (Jacobi et al. 2007). In terms of studies in rodents, rats represent the model with the most similar thickness and morphology of the skin layers (Todo 2017) as well as the model of choice for FDA toxicity studies.

[0277] Studies in pigs: Minimizing animal numbers is an important consideration. Thus, the tissues from pigs described above can be processed to assess the biocompatibility and reduce the number of animals. An additional 1 -month time-point can be added to the study (2f + 2m pigs).

[0278] Studies in rats: 6 rats / group (3m+3f) / timepoint x 3 application doses x 2 TERT therapies+ 1 control x 4 times x single and multiple application modes can be used for assessment of biocompatibility. Dorsal hair can be shaved 24h prior to application of the systems and 10, 50 or 100 pL containing up to lOug / TERT mRNA will be applied using 2 application schedules selected in SA2.

[0279] Assessment: The treatment areas can be marked (2x2cm each) and applied with the using delivery methods with LNP containing mRNA luciferase as in SAI. Animals are observed daily for dietary intake, water consumption, behavior, and general state of health. After 1, 2, 7 and 30 days, the animals are euthanized, blood is drawn for safety studies (biochemistry, inflammatory cytokines, blood cell counts), LNP tissue uptake assessed based on fluorescence and luminescence (days 1-7) and the treated sites harvested for dermatopathology. The spleen, liver, hearts, brains and kidneys are harvested for pathological studies. The excised organs can be either embedded in OCT for cryosectioning or fixed in 10% formalin in PBS, embedded in paraffin blocks and sectioned. The slides will be stained with hematoxylin and eosin (H&E). The histological examination can be performed by an independent pathologist and images can be taken using a light microscope (Olympus, BH-2).

[0280] Cytokine levels in the plasma can be measured using Rat Magnetic Luminex Mutiplex Cytokine / Chemokine Array and Porcine Luminex Cytokine Panel. The blood countscan be measured within 4h post collection. In the blood count analysis, hematology markers from the whole blood, namely, erythrocyte count, platelet count, leukocyte count, and hemoglobin levels can be measured on a CBC-DIFF Instrument (Heska, Loveland, CO). Liver function indicators (albumin, aspartate aminotransferase, alanine aminotransferase, total bilirubin), renal function indicators (blood urea nitrogen, creatinine), globulin and protein levels can be tested with DRI-CHEM (Heska, Loveland, CO) veterinary blood chemistry analyzer. Rigor and Reproducibility: All animal studies can utilize 7 measures against bias (allocation concealment, blinding, randomization, sample size calculation, inclusion / exclusion criteria, identification of primary outcome variable and a prospectively described analysis plan).

[0281] Data analysis / statistics'. Data can be analyzed by Student's t-test (2 groups) or ANOVA (more than two groups) followed by Tukey's post hoc analysis and expressed as mean ± SEM. For repeated measures, use Two-Way ANOVA with Repeated Measures (Bonferroni posthoc analysis) can be used to analyze sex or treatment differences between groups. Statistical power and sample size estimation can be calculated with b = 0.20 (power of 80%) with a type I error of 5%. Male and female animals are used. The statistical analysis is performed using GraphPad Prism software, p values of less than 0.05 will be considered statistically significant. All animals can be randomized to experimental conditions in all experiments using a random number generator, experimenters and data analysis can be blind to experimental conditions throughout.Example 3: Additional Experimental Results

[0282] FIGS. 14A-14E, FIGS. 15A-15C, FIGS. 16A-16B, FIGS. 17A-17E, FIGS. 18A- 18C, FIGS. 19A-19I, and FIGS. 20A-20C depict additional experimental results.Example 4: Telomerase mRNA Therapy Protects Human Skin Against Radiation- Induced DNA Damage

[0283] Radiotherapy induces DNA damage to destroy or halt the growth of malignant cells. Whereas it is effective against many types of cancer, the collateral damage to normal tissues poses a significant challenge (Huber et al. 2011). Approximately 85-95% of patients undergoing radiotherapy experience varying degrees of cutaneous radiation injury, manifesting as erythema, dry and wet desquamation, secondary ulceration, or infection (Burke et al. 2022). The cutaneous damage can compromise the course of radiotherapy. Furthermore, the acute cutaneous damage is painful, and the subsequent fibrosis can cause functional impairment and disfigurement, affecting the quality of life, particularly when affecting the breast, head, or neck.There is an unmet need for interventions that can mitigate these adverse effects while maintaining treatment efficacy.

[0284] Telomerase holoenzyme is a complex of several proteins including telomerase (TERT) which has reverse transcriptase activity. The canonical function of telomerase is to maintain telomere integrity (Park et al. 2009) (Ghosh et al. 2012) (Khattar et al. 2016). Previously, it was observed that, in human skin cells derived from adult patients, a single treatment with human telomerase (hTERT) mRNA could reduce markers of DNA damage, increase proliferation, and enhance engraftment in a pre-clinical wound model (Chang et al. 2024). These observations were consistent with prior work showing that, in replicatively aged human cells or in cells derived from patients with genetically accelerated aging, treatment with TERT mRNA extends telomeres, normalizes cell and nuclear morphology, restores cellular functions and proliferation, normalizes the transcriptional profile, and reduces oxidative stress, inflammatory cytokines, markers of DNA damage and senescence (Chang et al. 2024) (Li et al. 2017) (Li et al. 2019) (Mojiri et al. 2021). Furthermore, in human endothelial cells derived from patients with genetically accelerated aging, hTERT mRNA increased the expression of genes that participate in the repair of genomic DNA damage (such as FANCC, PARPBP, and RECQL5) (Mojiri et al. 2021). Although telomerase is well known to repair and extend telomeres, it is less widely recognized that telomerase can also repair genomic DNA damage (Morin et al. 1991). Accordingly, the current study was driven by the hypothesis that hTERT mRNA might protect human skin cells from genomic DNA damage induced by clinically relevant levels of radiation.

[0285] This study demonstrated that in human primary skin cells, and skin explants, the expression of hTERT attenuates radiation-induced DNA damage, mitochondrial dysfunction, and apoptosis. Intriguingly, this appears to be due to a non-canonical function of hTERT, as the beneficial effects of hTERT mRNA delivery are seen in the absence of telomere extension. These findings could contribute to the development of therapies for radiation-induced skin damage.Material and Methods

[0286] Messenger RNA Synthesis: Human TERT (NM_198253.2) and GFP mRNA were synthesized by Houston Methodist Research Institute (HMRI) RNA Core by in vitro transcription (IVT) with pseudouridine added to the nucleotide mix to reduce inflammatory activation and to improve translation, as previously described (Ramunas et al. 2015). mRNA was purified by filtration and assessed for integrity using a TapeStation (Agilent).

[0287] Lipid Nanoparticle (mRNA LNP) Formulation: Previous studies (Chang et al. 2023) employed two types of lipid nanoparticles (LNPs), MC3-LNP and DOTAP, to optimize TERT mRNA delivery in ex vivo skin models and primary cells. LNP were formulated and characterized as previously described. Briefly, MC3 mRNA LNP were formulated using a molar ratio of DSPC, DMG-PEG2000, cholesterol, and Dlin-MC3-DMA at 8:1.5:38.5:52 respectively. DOTAP mRNA LNP were prepared with a molar ratio of DOPE, DOTAP, and DMG-PEG2000 at 49:49:2 respectively. The lipid components were dissolved in ethanol, while mRNA was dissolved in citric buffer (100 mM, pH 5.0). Mixing occurred at a flow rate of 3: 1 aqueous to ethanol, with a total flow rate of 10 mL / min, followed by dialysis in PBS at 4°C for a minimum of 8 hours. The mRNA LNP were formulated using the NanoAssemblr Benchtop (Precision Nanosystems) and characterized for size distribution, PDI and zeta potential using Dynamic Light Scattering (Malvern) and for encapsulation efficiency by RiboGreen assay (Chang et al. 2023).

[0288] Cell Culture: Human adult epidermal keratinocytes (Lonza #00192627) were grown in KGM-Gold medium (Lonza #00192060). Human adult dermal fibroblasts (Lonza #CC-2511) were cultured in FGM medium (Lonza #CC-3132). Human dermal microvascular endothelial cells (Lonza #CC-2516) were grown in EGM2 medium (Lonza #CC-3162). Human Primary Aortic Endothelial Cells (HAEC, ATCC # PCS- 100-011) and TeloHAEC (ATCC # CRL-4052) were grown in EGM2 medium. Cells were maintained at 37°C and 5% CO2.

[0289] Ex vivo culture of human skin: De-identified adult human skin samples were collected under the Houston Methodist Research Institute Institutional Review Board approved protocol with patient / family consent (IRB #PR000027413). Hypodermal fat layer of the skin was removed by scalpel, then cut into 1 -cm2pieces using a disposable scalpel (Integra Miltex #4-410). Skin explants were cultured in keratinocyte growth medium (ATCC #PCS-200-040) at 37°C, 5% CO2, maintaining an air-liquid interphase as described56.

[0290] Transfection with mRNA LNP: Primary human skin cells were seeded 1 x 105cells / well in 12-well culture plates or 2.5 x 105cells / well in 6-well culture plates for 24 hours. For studies in cells, DOTAP mRNA LNP (hTERT or GFP) or a transfection reagent were added at 1 pg / mL mRNA to the culture media for 24 hours. Human skin explants were subjected to microneedling using the Dr. Pen Ultima M8 microneedling device (36 pins, 6 repetitions per second for 20 seconds, 2.0 mm depth), followed by the application of an appropriate volume of MC3 LNP systems or a transfection reagent.

[0291] Irradiation protocols: Human skin tissue or primary cells were cultured in 6-well or 12- well plates and exposed to irradiation in the RS 2000 X-ray Biological irradiator (Rad Source Technologies, Inc.) for 3 minutes at doses of 2, 5, 10, or 20 Gy.

[0292] Bleomycin treatment: A monolayer of HAECs or Telo-HAECs in 6- or 12- well plates was incubated with bleomycin at concentrations of 4.5, 10, or 50 pg / ml overnight. Afterward, the cells were washed and maintained in complete EC media for 72 hours. Cells were then collected for senescence studies.

[0293] Histological Analysis: Skin explants were fixed in 10% formalin, paraffin- embedded, and sectioned (5 pm) by the HMRI Pathology Core Laboratory. Histological sections were stained with hematoxylin and eosin (H&E) for tissue morphology or immunostained using anti-yH2A.X antibody (Abeam #ab81299), anti-CK14 antibody (Abeam #ab7800) or anti-TERT antibody (Novus #NBP3-14565). Slides were preserved with VECTASHIELD HardSet Antifade Mounting Medium with DAPI (Vector Labs #H-1500-10) and imaged by EVOS-FL-Auto-Imaging System (Life Technologies).

[0294] Western Blot Analysis: Total cell lysates were collected from skin explants using a handheld rotor-stator homogenizer (Qiagen TissueRuptor 11 #9002755) and T-Per protein extraction reagent (ThermoFisher #78510) according to manufacturer's protocol. Whole cell lysates (25 ng / lane) were resolved by SDS / PAGE (Bio-Rad Any kD Mini Gel #4569036) and transferred to PVDF membrane (Bio-Rad #1704156), followed by immunoblotting using SuperSignal West Pico PLUS chemiluminescent reagent (ThermoFisher #34580) and imaged by ChemiDoc MP Imaging System (Bio-Rad #12003154).

[0295] Telomerase Activity Detection: For Telomeric Repeat Amplification Protocol (TRAP) assay (MilliporeSigma TRAPeze Telomerase Detection Kit #S7700) total cell lysates were collected from skin explants (n = 3) using handheld rotor-stator homogenizer (Qiagen TissueRuptor II #9002755) and CHAS lysis buffer according to manufacturer's protocol. Samples were diluted to equal protein concentration (0.03 pg / pL). For heat-kill (HK) control, each sample was subjected to 85 °C for 10 minutes to inactivate telomerase. Following 32 cycles of PCR amplification, TRAP products were resolved by gel electrophoresis. Quantification of telomerase activity in each sample was normalized to HK control.

[0296] MitoSOX detection assay: The MitoSOX (Cat# M36008) reagent was used to detect mitochondrial ROS according to the manufacturer’s protocol. In brief, the 5 mM MitoSOX reagent stock solution was diluted in HBSS buffer (provided by the kit) to make a 5 pM solution. Cells prepared in a 24- well plate were incubated with the 5 pM MitoSOX reagent working solution for 10 minutes at 37°C, protected from light. Following incubation, the cellswere washed with PBS and either imaged using a fluorescence microscope or collected for ROS quantification via flow cytometry.

[0297] Apoptosis analysis: For cell apoptosis analysis, cells were collected and stained using the Zombie Aqua Fixable Viability Kit (BioLegend) according to the manufacturer’s instructions. After staining, the cells were washed with PBS, resuspended in Annexin V binding buffer (catalog number 422201 ; BioLegend), and incubated with APC Annexin V (catalog number 640920; BioLegend) for 15 minutes at room temperature in the dark. The samples were then analyzed using an LSR II or Fortessa flow cytometer. Data analysis was performed using FlowJo software, version 10 (Tree Star, Inc., Ashland, OR, USA).

[0298] TUNEL assay: Human skin tissue from four donors was used for the TUNEL assay (Abeam ab206386), conducted according to the manufacturer’s instructions. Paraffin- embedded tissue samples were cut into sections and mounted on glass slides, followed by rehydration through sequential immersion in Xylene Substitute (Safeclear II, Fisher Healthcare) and graded ethanol solutions. The slides were washed with lx TBS, permeabilized with proteinase K solution, and treated with Hydrogen Peroxide to quench endogenous peroxidase activity. The tissues were labeled with Terminal deoxynucleotidyl transferase) and developed using DAB (3,3’ -Diaminobenzidine) solution. Total cells were stained with Methyl Green, and specimens were mounted with mounting media. Images were captured using an Olympus BX61 microscope at 40x magnification. Apoptotic cells in each specimen were counted in at least five fields of view, ensuring a minimum of 150 cells per field, and data were analyzed using GraphPad Prism 10.

[0299] qFISH analysis: Cells or cut sections from tissues were fixed in 3.7% formaldehyde, followed by dehydration with an ethanol series: 5 minutes each in 70%, 85%, and 100%. The telomere probe (PNA Bio F1013 TelC-Alexa 647) was added to the slide and incubated overnight at 4°C. After washing twice with 70% formamide and twice with 1% BAS respectively, the slides were dehydrated with ethanol. DAPI was added, and telomere length was reported as the intensity of probe normalized to the area of nuclei.

[0300] Beta-gal analysis: Beta-galactosidase staining was performed on cultured cells following the manufacturer’s protocol (Senescence 0-Galactosidase Staining Kit, Cell Signaling #9860). In brief, cells were fixed in the plate and washed with PBS, followed by incubation with a staining solution containing X-gal (5-bromo-4-chloro-indoxyl) in citratephosphate buffer (pH 6.0). Blue-stained cells were visualized under a microscope to identify senescent cells. The positive cells were quantified using ImageJ software.

[0301] Long- Amplicon Polymerase Chain Reaction (LA-PCR): DNA was isolated using a DNeasy Blood and Tissue Kit (Qiagen #69504) according to the manufacturer’s instructions. LA-PCR was performed from a modified protocol previously described (Dharmalingam et al. 2020). Briefly, 10 ng DNA from each sample was amplified with LongAmp Taq DNA Polymerase (NEB #M0323) for genomic and mitochondrial DNA amplicons, using the primer sequences and PCR conditions given in TABLE 1 and TABLE 2. Genomic DNA integrity was assessed using a 10.4 kb long amplicon from the HPRT gene and a 0.2 kb short amplicon from the same gene as a loading control. Mitochondria] DNA integrity was assessed using an 8.8 kb long amplicon from the mitochondrial genome and a 0.2 kb short amplicon as a loading control. PCR products were separated by gel electrophoresis (0.8% agarose gel for long amplicon products and 2% agarose gels for short amplicon products), stained by GelRed nucleic acid stain (MilliporeSigma #SCT123), and imaged by ChemiDoc MP Imaging System (Bio-Rad #12003154). Quantification of PCR products was based on band intensity using ImageJ software.TABLE 1. Primers for LA-PCR.TABLE 2. PCR program for LA-PCR.

[0302] RNA sequencing data analysis: Low-quality reads were removed, and the remaining high-quality sequences were aligned to the human genome reference (GRCh38) using the STAR aligner. Differential gene expression analysis was performed using the DESeq2 package. Genes with an absolute fold change > 2 and an adjusted p- value (p-adj) < 0.05 were considered significantly differentially expressed genes (DEGs). Pathway analysis of DEGs was conducted using Gene Ontology (GO) term analysis. Additionally, Gene Set Enrichment Analysis (GSEA) of DNA damage and DNA repair pathways was performed using the GSEA R package.

[0303] Data analysis: Data visualization and statistical analyses were performed using R and GraphPad Prism. Measurement data are presented as Mean ± SD. Comparisons between two groups were conducted using Student’s t-test, while comparisons among multiple groups were carried out using one-way or two-way ANOVA. Significance is determined at P < 0.05.Results

[0304] Dose-dependent increase in DNA damage marker with ionizing radiation (IR) : To evaluate whether ionizing radiation induces DNA damage in human cutaneous tissue, the study exposed ex vivo skin tissue to 2, 5, or 10 Gy of ionizing radiation and performed immunofluorescence staining for a DNA damage marker yH2A.X, 2 hours post-exposure. A dose-dependent increase of yH2A.X signal was observed without structural disruption of the skin (FIGS. 21A-21E). The increase in / H2A.X levels was most notable in the skin epidermis (keratinocytes), while higher radiation doses (5 and 10 Gy) induced yH2A.X signals in skin microvasculature (endothelial cells) as well.

[0305] IR induces genomic and mitochondrial DNA damage, and apoptosis: DNA damage impacts a broad array of biological processes and disease pathways across both nuclear and mitochondrial genomes (Fang et al. 2016). To investigate the impact of ionizing radiation on DNA integrity, the study examined nuclear DNA and mitochondrial DNA in primary skin cells, including epidermal keratinocytes (KTN), dermal fibroblasts (Fb), and dermal microvascular endothelial cells (MVECs), after exposure to 2, 5, 10, or 20 Gy of radiation. The study employed a long amplicon PCR assay (LA-PCR) (Kodavati et al. 2024) to amplify a 10.4kb segment of the HPRT gene or an 8.8 kb segment of the MITO gene, which serve as markers for genomic or mitochondria DNA integrity respectively. Intact DNA results in robust amplification, whereas damaged DNA yields weaker signals. Additionally, a 200 bp short amplicon within those genes was used as an internal control to confirm amplification efficiency, as its short length increases the probability of successful amplification even from damaged DNA. LA-PCR revealed a dose-dependent loss of DNA integrity in both nuclear and mitochondrial genomes across all three cell types (FIG. 22A, FIGS. 23A-23B).

[0306] DNA damage can lead to apoptosis and cell death (Borges et al. 2008) (Rich et al. 2000) (Roos et al. 2006), which the study examined both in keratinocytes at 2- and 24-hour post-irradiation. Zombie Aqua (+) staining indicates dead cells and Annexin V (+) staining indicates apoptotic cells. Early apoptotic cells are Zombie Aqua (-) / Annexin V (+), whereas late apoptotic cells are Zombie Aqua (+) / Annexin V (+), indicating compromised membrane integrity. Flow cytometry analysis indicated an increase in cell death proportional to both radiation dose and the time after exposure (FIG. 23C). Further analysis showed that apoptosis accounted for 87% of the observed radiation-induced cell death (FIGS. 22B-22D). Quantification of apoptotic cells at different radiation doses confirmed a dose-dependent increase in apoptosis (FIGS. 23D-23E). After determining that 24 hours post-5 Gy irradiation induces a significant level of apoptosis, the study identified this as the optimal dose and time point for subsequent experiments. A 5 Gy dose is also more clinically relevant.

[0307] Collectively, these findings demonstrate that ionizing radiation induces both nuclear and mitochondrial DNA damage, leading to apoptosis in a dose-dependent manner, with increasing manifestation of cellular damage over time.

[0308] Telomerase enhances genomic DNA repair and promotes cell viability: Previously, it was demonstrated that expression of telomerase reverse transcriptase (TERT) reduces DNA damage markers in cells derived from patients with premature aging (progeria) (Li et al. 2019) (Weifeng et al. 2025) and extends lifespan in a progeria mouse model (Mojiri et al. 2021). Therefore, it was hypothesized that TERT expression might mitigate DNA damage and enhance cell viability following ionizing radiation. To test this hypothesis, the study compared primary human aortic endothelial cells (HAECs) to HAECs with constitutive hTERT expression (Telo-HAECs) after exposure to 5 Gy radiation. The DNA damage marker yH2A.X was reduced in Telo-HAECs compared to HAECs at 2- and 6-hours post-irradiation (FIGS. 24A-24B). Western blot analysis further confirmed reduced yH2A.X protein levels in Telo- HAECs compared to HAECs (FIGS. 25A-25B). Fewer dead cells were observed in Telo- HAECs than in HAECs at various time points post-radiation (FIG. 25C). To confirm thesefindings, the study induced DNA damage in HAECs using bleomycin and observed a dosedependent increase in DNA damage markers (yH2A.X and 53BP1) and senescence- associated P-galactosidase activity. In contrast, Telo-HAECs exhibited minimal induction of these markers (FIGS. 25D-25G), suggesting that constitutive hTERT expression protects cells from senescence triggered by radiation- or bleomycin-induced DNA damage.

[0309] To explore the potential molecular mechanisms underlying TERT-mediated protection, the study analyzed the transcriptional profile of HAECs and Telo-HAECs using bulk RNA sequencing, both with or without radiation. Upon radiation exposure, Telo-HAECs exhibited 179 upregulated and 125 downregulated genes compared to HAECs (FIG. 24A, FIG. 24C, FIGS. 25H-25J). Gene Set Enrichment Analysis (GSEA) revealed the enrichment of genes involved in DNA damage response and repair pathways (FIG. 24D, FIG. 26B). Notably, even under basal conditions, Telo-HAECs exhibited differential gene expression profiles positively correlated with DNA repair pathways (FIG. 24E), suggesting that TERT primes cells for DNA damage response.

[0310] Given that TERT is classically associated with telomere maintenance, the study assessed telomere length using two different methods Quantitative Fluorescent in situ (qFISH) and Terminal Restriction Fragment (TRF) analysis. Importantly, the study found no significant differences in telomere length between irradiated and non-irradiated cells in both HAECs and Telo-HAECs (FIGS. 26C-26D). Nevertheless, the Telomeric Repeat Amplification Protocol (TRAP) assay confirmed the presence of telomerase activity in Telo-HAECs (but not HAECs) treated with bleomycin across various doses (FIG. 26E). Thus, the beneficial effect of telomerase expression is not due to telomere extension, but more likely related to a non- canonical effect of telomerase.

[0311] Additionally, in TERT expressing cells, transcriptomic analysis identified differential expression of genes involved in structural support, extracellular matrix organization, migration, cellular homeostasis, and stress responses, which are essential for cell survival and repair (FIG. 27D). Furthermore, the LA-PCR assays documented genomic DNA damage in all experimental groups; however, within 2 hours post-radiation, the genomic integrity of Telo-HAECs was restored, highlighting the accelerated DNA repair response of these cells (FIGS. 24F-24G).

[0312] Together, these findings suggest that TERT enhances DNA repair and promotes cell viability independently of its canonical role in telomere elongation.

[0313] TERT mRNA pretreatment enhances DNA repair and reduces radiation- induced apoptosis: Due to the chemical and enzymatic instability of naked mRNA inphysiological fluids, in vivo mRNA administration requires a delivery system that can protect mRNA from degradation and effectively transfect target cells. Lipid nanoparticles (LNPs), commonly used in mRNA delivery (as seen in the SARS-CoV-2 mRNA vaccines), have emerged as a critical delivery system. The recent success of mRNA-based therapies has further underscored the importance of LNPs for efficient mRNA delivery. Previous studies suggested that TERT mRNA treatment reduces DNA damage in HGPS-derived iPSC fibroblasts and endothelial cells (Li et al. 2017) (Li et al. 2019) (Mojiri et al. 2021). Therefore, it was hypothesized that cells could be protected from radiation-induced damage through pretreatment with TERT mRNA delivered via LNP. Since radiation-induced cell death is primarily mediated by apoptosis (FIG. 22D, FIGS. 23D-23E), the study first examined whether TERT mRNA pretreatment could reduce radiation-induced apoptosis in keratinocytes, endothelial cells, and fibroblasts. Previous work indicated that the LNP formulation including a cationic lipid, DOTAP (DOTAP LNP), was the most efficient for in vitro / ex vivo transfection of skin cells (Chang et al. 2023). Accordingly, the study evaluated the efficiency of DOTAP LNP compared to commercially available RNA delivery reagents (Lipofectamine-Max and Jet- Messenger) in keratinocytes and fibroblasts using GFP mRNA. Confirming prior work, DOTAP LNP exhibited the highest transfection efficiency (FIG. 28A). Consequently, the study used DOTAP to deliver TERT mRNA for subsequent in vitro experiments. Cells were pretreated with vehicle (PBS), and LNP containing GFP mRNA, or TERT mRNA 24 hours prior to 5 Gy radiation exposure, and apoptotic cells were quantified 24 hours post-radiation (FIG. 28B). Pretreatment with TERT mRNA reduced the apoptotic cell population, including both early and late apoptosis, in keratinocytes and MVECs compared to vehicle or GFP mRNA (FIGS. 28C-28I). A similar trend, though not statistically significant, was observed in fibroblasts (FIG. 29), suggesting cell type-specific variability in response to TERT mRNA pretreatment.

[0314] To investigate the potential mechanism of TERT mRNA treatment in reducing apoptosis, the study examined genomic DNA integrity in keratinocytes, fibroblasts, and MVECs following 5 Gy radiation at various time points post-irradiation (0, 0.5, 1, 2, 6, and 24 hours). LA-PCR analysis revealed a progressive loss of DNA integrity over time, which was mitigated by TERT mRNA pretreatment in all cell types (FIGS. 30A-30C). These findings are consistent with the protective effects observed in Telo-HAECs (FIG. 24), suggesting that TERT mRNA pretreatment enhances DNA repair.

[0315] Telomerase protects against oxidative stress by reducing mitochondrial reactive oxygen species (ROS) production and preventing cellular apoptosis (Moustakli et al. 2023)(Singhapol et al. 2013). Elevated ROS levels are a hallmark of mitochondrial damage and dysfunction (Singhapol et al. 2013) (Zheng et al. 2019). The study next investigated whether TERT mRNA pretreatment reduces mitochondrial ROS levels. Using the MitoSOX assay, the study observed lower mitochondrial ROS levels in TERT mRNA-pretreated keratinocytes when compared to vehicle or GFP-treated cells at 24 hours post- radiation (FIGS. 30D-30F). These data suggest that TERT mRNA pretreatment enhances the repair of both genomic and mitochondrial DNA damage to reduce radiation-induced apoptosis.

[0316] Optimal delivery system of TERT mRNA pretreatment for the human skin: To investigate the clinical applicability of TERT mRNA pretreatment, the study optimized its delivery using human skin tissue ex vivo. Three delivery systems were tested, two LNP formulations (with an ionizable lipid MC3 and cationic lipid DOTAP), and a transfection reagent JetMessenger in combination with microneedling. Among the tested formulations, MC3 LNP exhibited the highest transfection efficiency (FIGS. 31A-31H). In addition, the TRAP assay confirmed active TERT protein in skin treated with MC3 LNP containing TERT mRNA 24 hours post-delivery, compared to skin treated with GFP LNP (FIG. 311). These results demonstrate the effectiveness of MC3 LNP-mediated TERT mRNA delivery using microneedling in human skin, forming the basis for subsequent experiments.

[0317] Telomerase mRNA reduces radiation-induced DNA damage and apoptosis in human skin: Next, the study investigated whether TERT mRNA pretreatment had an effect on radiation-induced DNA damage and cellular survival in human skin ex vivo. Human skin samples were pretreated with vehicle or MC3 encapsulating GFP mRNA, or TERT mRNA via microneedling, incubated for 24 hours, and subsequently exposed to 5 Gy radiation. To assess DNA damage, the study quantified yH2A.X immunofluorescent staining. Sequential H&E staining was performed in parallel to indicate the analyzed area and signal localization within the epidermis. Radiation substantially increased yH2A.X signals in skin samples treated with vehicle or GFP LNP, but not in TERT LNP-treated skin (FIGS. 32A-32B). These findings were consistent with the results obtained from cultured HAECs (FIGS. 24A-24B). Radiation also induced an increase in pl 6 and p21. These genes regulate cell cycle arrest and are associated with senescence (Yan et al. 2024). Notably, the radiation-induced increase in these genes was attenuated in TERT-pretreated skin (FIG. 32C).

[0318] To evaluate apoptosis, the study performed a TUNEL (terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling) assay to measure DNA fragmentation associated with apoptosis (Denton et al. 2015). TERT-pretreated skin exhibited significantly fewer Tunel + (apoptotic) cells compared to vehicle- or GFP -pretreated skin at 24 hours post-radiation(FIGS. 33A-33B). To confirm that the protective effect of pretreated TERT mRNA was independent of telomere function, the study measured telomere length before and after radiation in all samples. No changes in telomere length were detected with qFISH (FIG. 33C). Apurinic / apyrimidinic (AP) sites occur when DNA bases are lost due to damage from reactive oxygen species (ROS), radiation, alkylating agents, or spontaneous hydrolysis (Minko et al. 2016). AP sites are among the most frequent types of DNA damage (Lindahl et al. 1993). The study quantified AP sites in DNA isolated from skin samples pretreated with vehicle, GFP, and TERT mRNA at 24 hours post-radiation. A significant number of AP sites were present in DNA extracted from vehicle- or GFP-pretreated skin, while TERT-pretreated skin exhibited a marked reduction in AP sites at 24 hours post-radiation, confirming enhanced DNA repair (FIGS. 33D-33E). Collectively, these findings demonstrate that TERT mRNA pretreatment enhances DNA repair and reduces apoptosis in human skin following radiation exposure.Discussion

[0319] In the current study, it was observed that pretreatment with mRNA hTERT substantially reduced radiation induced genomic and mitochondrial DNA damage, mitochondrial ROS and apoptosis in human skin cells, while enhancing DNA repair. Interestingly, telomere length was not extended by TERT mRNA in the current study, suggesting a non-canonical function of TERT to accelerate the cellular recovery from radiation. These findings highlight a potential therapeutic approach for preventing radiation- induced skin injury.

[0320] Previously, it has been demonstrated that treatment with hTERT-mRNA restores telomere length, reduces senescence-associated secretory phenotype (SASP), and DNA damage, and rescues normal cellular functions in endothelial and vascular smooth muscle cells derived from patients with Hutchison-Gilford Progeria syndrome (HGPS) (Mojiri et al. 2021). Furthermore, TERT overexpression in an HGPS mouse model reduced DNA damage markers and inflammatory cytokines in the systemic vasculature and extended the lifespan of the animals. These observations may not be entirely explained by the canonical function of telomerase.

[0321] Radiation-induced skin dermatitis remains a significant clinical challenge, with various palliative treatments being explored to mitigate its effects. Several options, including natural products, corticosteroids, and other topical agents, have been investigated for their potential to alleviate symptoms. As outlined in recent studies, some natural compounds, such as aloe vera and honey-based formulations, have shown promise in reducing inflammation and promoting healing (Yang et al. 2020). Additionally, corticosteroids are commonly prescribedto manage radiation dermatitis by suppressing inflammatory responses; however, their longterm effectiveness remains debated (Borrelli et al. 2019). Despite these interventions, a comprehensive review of clinical trials suggests that no single treatment has demonstrated consistent efficacy in preventing or significantly reducing radiation-induced skin injury (Chan et al. 2014). This underscores the need for continued research to identify more effective therapeutic strategies and improve patient outcomes. This study proposed a potential therapeutic approach to prevent radiation-induced skin injury through pretreatment with TERT mRNA.

[0322] Analysis of the transcriptome profile of constitutive TERT expression in Telo- HAEC has revealed higher basal levels of genes that could equip the cells to handle cellular stress, including the response to radiation-induced damage (Zheng et al. 2019). The transcriptional response to radiation was different in Telo-HAEC versus HAEC. After radiation, transcriptional profiling in Telo-HAEC as compared to HAEC, demonstrated that there was differential upregulation of pathways associated with cell migration, angiogenesis, wound healing, and tissue generation, such as Networks of ECM (Extracellular Matrix)- Associated proteins ( ABA ECM), glycoproteins pathway, or Hallmark of Epithelial- Mesenchymal Transition (EMT). Furthermore, the downregulation of pathways associated with cell junction organization would also favor increased cell migration and wound-healing processes (Kim et al. 2015). While the expression of TERT has been primarily studied for its role in the context of cancer, the data suggest that it may also prime cells against specific stress responses, particularly when analyzing pathway enrichment for both DNA damage response and repair. Genes in these two pathways are upregulated in Telo-HAEC, which could account for the enhanced DNA repair observed shortly after radiation exposure. Others have suggested the involvement of TERT in DNA repair (Park et al. 2009) (Ghosh et al. 2012) (Khattar et al. 2016) (Masutomi et al. 2005), although its direct role has not been fully elucidated. The data suggests it operates through a non-telomeric mechanism possibly mediated by gene regulation. Importantly, it was observed that enhanced cellular viability and DNA repair do not require the constitutive expression of TERT, since transient expression of TERT using mRNA, in both ex vivo skin and keratinocytes, reduces yH2A.X signals, AP sites, and apoptosis. Interestingly, TERT expression in keratinocytes reduced mitochondrial ROS, which was significantly high after radiation exposure in untreated cells, suggesting a key process in the recovery of cellular function by TERT30. Similarly, in the studies on cardiac regeneration following exposure to doxorubicin and myocardial infarction, TERT has been shown to protect telomere length and enhance the repair of ROS-induced DNA damage in cardiomyocytes, both in vitro and in vivo(Chatterjee et al. 2021) (Wei et al. 2024). Importantly, when TERT mRNA was delivered using lipid nanoparticles to human ex vivo skin, the beneficial effects observed in vitro were recapitulated in a model closer to clinical application. Importantly, two hours post-radiation, a significant reduction of yH2A.X foci was observed using immunostaining. Indeed, the long amplicon PCR (LA-PCR) and AP (apurinic / apyrimidinic) site analysis indicate enhanced DNA repair in both in vivo and in vitro. Furthermore, the transcriptional response to radiation in Telo-HAECs suggested an immediate increase in genes that enhance cellular recovery compared to HAECs.

[0323] Accumulation of DNA damage is a key factor in cellular aging (Schumacher et al. 2021). Damage to genomic as well as telomeric DNA can induce gene dysregulation and activation of DNA repair pathways (Maynard et al. 2015) (Broustas et al. 2014). DNA damage generates ROS and drives chronic inflammation and cellular senescence (Davalli et al. 2016). Cells have evolved sophisticated mechanisms to manage various types of DNA damage (Marshall et al. 2020). When exposed to harmful agents like pollution or radiation, cells halt division by upregulating checkpoint proteins, allowing them to repair DNA and maintain genomic integrity (Langie et al. 2015). While some cells successfully repair damage and continue functioning, others face an overwhelming challenge, especially from double-strand breaks, which can lead to apoptosis. Cells that partially resolve damage may enter senescence. Senescent cells actively release inflammatory factors, a state known as the senescence associate secretory phenotype (SASP) (Lopes -Paciencia et al. 2019). Sustained non-lethal damage, such as low-grade radiation or chemotherapy, can prematurely induce senescence, leading to chronic inflammation and oxidative stress (Prasanna et al. 2021). The data suggest that enhanced DNA repair in TERT-treated skin reduces the expression of senescence-associated genes such as pl 6, p21, and p53, contributing to cellular recovery and improved cell survival.

[0324] Recent molecular and cellular studies indicate that the damage to normal tissues following radiation may be due to ROS and reactive nitrogen species (RNS), as well as pro- inflammatory cytokines and chemokines, which alter organ function or degrade tissue (Kim et al. 2014) (Giaccia et al. 2014) (Citrin et al. 2017). A major source of chronic ROS and inflammation is radiation-induced senescent cells, as evidenced by biomarkers such as DNA damage response pathways, mitochondrial dysfunction, and oncogene activation (Kumari et al. 2021) (Liu et al. 2018) (Wang et al. 2006) (Wang et al. 2016). Radiation-induced senescence in mouse skin47 and various types of cultured cells have been demonstrated (Zou et al. 2012) (Schneider et al. 2013). Importantly, the elimination of senescent cells by senolytic drugs has been shown to improve the recovery from muscle weakness and pulmonary fibrosis inducedby radiation (Kirkland et al. 2020) (Pan et al. 2017). Several strategies to block proinflammatory molecules or reduce oxidative stress have been shown to prevent or alleviate radiation toxicity. For instance, pan- suppression of macrophage infiltration and cytokines / chemokines has been observed to mitigate effects in normal tissues, including the skin and brain (Jenrow et al. 2013) (Jenrow et al. 2014) (Yan et al. 2008).

[0325] The data indicates that enhancing the repair of genomic DNA damage with TERT mRNA therapy increases cellular viability and reduces markers of senescence in ex vivo skin and various cell types exposed to radiation. While TERT is commonly associated with telomere extension, the data show that its role in DNA repair extends beyond telomeres. Notably, the reduction in DNA damage marker yH2A.X occurs within 2 hours, suggesting no telomere extension is involved, as telomere elongation is replication dependent. Consistently, qFISH analysis revealed no significant changes in telomere length at 2, 24, or even 72 hours postradiation or post-bleomycin treatment. Telomere shortening after radiation depends on dose, frequency, and cell type, and 72 hours may not be sufficient for significant changes in telomeres in endothelial cells, given their limited divisions during this time. Preclinical models and patients with genetic causes of defective DNA repair are more radiosensitive, as in Fanconi Anemia (FA), Nijmegan Break Syndrome, Bloom’s Syndrome, and Ataxia Telangiectasia (Ostoich et al. 2024). These studies suggest that enhancing DNA damage repair could preserve the homeostasis of the cells / tissue that are not the target of the therapy.

[0326] DNA damage could induce genomic instability and enhance the risk of mutations in tumor suppressor genes, leading to cancer. While it has been shown that TERT expression in normal cells does not initiate cancer, telomerase becomes activated in 80% of cancer cells. This activation not only extends their telomeres, providing greater proliferation capabilities, but also reduces DNA damage, and increases resistance to radiation therapy. These findings offer valuable insight into the pathological effects of TERT expression in cancer cells, beyond its role in telomere maintenance. While the study observed increased DNA repair activity in TERT-treated cells and skin, it is crucial to determine whether this repair occurs with high fidelity. Further investigation, potentially through whole-genome sequencing, is needed to explore this aspect of DNA repair in TERT-enhanced environments.

[0327] The current findings highlight that pretreatment with TERT enhances cellular repair following radiation exposure, suggesting its potential as a therapeutic strategy to improve the safety and effectiveness of treatments for radiation-damaged normal skin.EXAMPLE ASPECTS

[0328] Example 1: A nanoparticle, wherein said nanoparticle comprises an ionizable lipid encapsulating a nucleic acid encoding a telomerase or a functional fragment of a telomerase.

[0329] Example 2 : The nanoparticle of any examples herein, particularly Example 1, wherein the nucleic acid comprises mRNA, self-amplifying RNA, circular RNA, or plasmid DNA

[0330] Example 3: The nanoparticle of any examples herein, particularly Examples 1-2, wherein the nucleic acid further comprises one or more mutations to a nucleic acid encoding a naturally occurring telomerase or a functional fragment of a naturally occurring telomerase.

[0331] Example 4: The nanoparticle of any examples herein, particularly Examples 1-3, wherein the nucleic acid encodes a telomerase reverse transcriptase (TERT) domain selected from essential N-terminal (TEN) domain, a TERT RNA-binding domain (TRBD), a reversetranscriptase (RT) domain, a C-terminal extension (CTE), or any combinations thereof.

[0332] Example 5: The nanoparticle of any examples herein, particularly Examples 1-4, wherein the nucleic acid encodes a telomerase or a functional fragment of a telomerase that is derived from a mammal.

[0333] Example 6 : The nanoparticle of any examples herein, particularly Example 5, wherein the mammal is human.

[0334] Example 7: The nanoparticle of any examples herein, particularly Examples 1-6, wherein the ionizable lipid is DLin-MC3-DMA, SM-102, ALC-0315, l,2-dimyristoyl-3- dimethylammonium-propane (DAP), C 12-200, 5A2-SC8, [(4- hydroxybutyl)azanediyl]di(hexane-6,l-diyl) bis(2-hexyldecanoate) ALC-135, DODMA, BP Lipid 216, BP Lipid 217 (CAS 2430034-17-4), Lipid III-45 (CAS 2096984-25-5), BP Lipid 226 (CAS 2036272-94-1), 2-[2,2-bis[(9Z,12Z)-octadeca-9,12-dienyl]-l,3-dioxolan-4-yl]-N,N- dimethylethanamine (DLin-KC2-DMA), KC2, l,2-dilinoleyloxy-n,n-dimethyl-3- aminopropane (DLinDMA), or any combination thereof.

[0335] Example 8: The nanoparticle of any examples herein, particularly Examples 1-7, wherein the nanoparticle comprises from about 30% molar to about 70% molar of the ionizable lipid.

[0336] Example 9: The nanoparticle of any examples herein, particularly Examples 1-8, wherein the nanoparticle further comprises a phospholipid, a PEGylated lipid, a cholesterol, or any combination thereof.

[0337] Example 10: The nanoparticle of any examples herein, particularly Example 9, wherein the phospholipid is phosphatidylcholine, egg phosphatidic acid, 1,2-dioleoyl-sn-glycerophosphocholine (DOPC), 1,2-diolyl-sn-lycerophosphoethanolamine (DOPE), 1,2- dipalmitoyl-sn-glycerophosphocholine (DPPC), 1 ,2-distearoyl-sn-glycerophosphocholine (DSPC), L-a-phosphatidylserine (PS), l,2-dioleoyl-sn-glycero-3-phospho-(T-rac-glycerol) (DOPG), soybean phosphatidylcholine, l-palmitoyl-2-oleoyl-sn-glycero-3- phosphoethanolamine (POPE), l,2-di-O-phytanyl-sn-glycero-3-phosphoethanolamine (4ME), l-palmitoyl-2-oleoyl-glycero-3-phosphocholine (POPC), l-stearoyl-2-oleoyl-sn-glycero-3- phosphoethanolamine (SOPE), l,2-dielaidoyl-sn-glycero-3-phosphoethanolamine (DEPE), 1- hexadecyl-2-(9Z-octadecenoyl)-sn-glycero-3-phosphoethanolamine (Cl 6-18:1 ), 1 -stearoyl-2- oleoyl-sn-glycero-3-phosphocholine (SOPC), N-(7-nitrobenz-2-oxa-l ,3-diazol-4-yl)- phosphatidylethanolamine (NBD-PE), sphingomyelin (SM), phosphatidylinositol (PI) from soybean, sn-(3-(9Z-octadecenoyl)-2-hydroxy)-glycerol-l-phospho-sn-3’-(l ’-(9Z- octadecenoyl)-2’-hydroxy)-glycerol (BMP-S,R), and sn-(3-oleoyl-2-hydroxy)-glycerol-l- phospho-sn-l’-(3’-oleoyl-2’-hydroxy)-glycerol (BMP-S,S), or any combination thereof, or any combination thereof.

[0338] Example 11: The nanoparticle of any examples herein, particularly Examples 9-10, wherein the nanoparticle comprises from about 5% molar to about 50% molar of the phospholipid.

[0339] Example 12: The nanoparticle of any examples herein, particularly Examples 9-11, wherein the PEGylated lipid is DMG-PEG2000, ALC-0159, DSPE-PEG2000, DOPE- PEG2000, 18:1 PEG1000-PE, PEG-carbamate- 1 ,2-dimyristoyl-sn-glycerol (PEG-c-DMG), PEG-DSG, or any combination thereof.

[0340] Example 13: The nanoparticle of any examples herein, particularly Examples 9-12, wherein the nanoparticle comprises from about 1% molar to about 10% molar of the PEGylated lipid.

[0341] Example 14: The nanoparticle of any examples herein, particularly Examples 9-13, wherein the nanoparticle comprises from about 20% molar to about 60% molar of the cholesterol.

[0342] Example 15: The nanoparticle of any examples herein, particularly Examples 1-14, wherein the nanoparticle has a diameter of from about 50 nm to about 300 nm.

[0343] Example 16: The nanoparticle of any examples herein, particularly Examples 1-15, wherein the nanoparticle has a zeta potential of from about -20 mV to about 1 mV.

[0344] Example 17: A nanoparticle, wherein said nanoparticle comprises an ionizable lipid encapsulating a telomerase or a functional fragment of a telomerase.

[0345] Example 18: The nanoparticle of any examples herein, particularly Example 17, wherein the telomerase or the functional fragment of a telomerase further comprises one or more mutations to a naturally occurring telomerase or a functional fragment of a naturally occurring telomerase.

[0346] Example 19: The nanoparticle of any examples herein, particularly Examples 17-18, wherein the telomerase or the functional fragment of a telomerase comprises a telomerase reverse transcriptase (TERT) domain selected from essential N-terminal (TEN) domain, a TERT RNA-binding domain (TRBD), a reverse-transcriptase (RT) domain, a C-terminal extension (CTE), or any combinations thereof.

[0347] Example 20: The nanoparticle of any examples herein, particularly Examples 17-19, wherein the telomerase or the functional fragment of a telomerase is derived from a mammal.

[0348] Example 21: The nanoparticle of any examples herein, particularly Example 20, wherein the mammal is human.

[0349] Example 22: The nanoparticle of any examples herein, particularly Examples 17-21, wherein the ionizable lipid is DLin-MC3-DMA, SM-102, ALC-0315, l,2-dimyristoyl-3- dimethylammonium-propane (DAP), C 12-200, 5A2-SC8, [(4- hydroxybutyl)azanediyl]di(hexane-6,l-diyl) bis(2-hexyldecanoate) ALC-135, DODMA, BP Lipid 216, BP Lipid 217 (CAS 2430034-17-4), Lipid III-45 (CAS 2096984-25-5), BP Lipid 226 (CAS 2036272-94-1), 2-[2,2-bis[(9Z,12Z)-octadeca-9,12-dienyl]-l,3-dioxolan-4-yl]-N,N- dimethylethanamine (DLin-KC2-DMA), KC2, l,2-dilinoleyloxy-n,n-dimethyl-3- aminopropane (DLinDMA), or any combination thereof.

[0350] Example 23: The nanoparticle of any examples herein, particularly Examples 17-22, wherein the nanoparticle comprises from about 30% molar to about 70% molar of the ionizable lipid.

[0351] Example 24: The nanoparticle of any examples herein, particularly Examples 17-23, wherein the nanoparticle further comprises a phospholipid, a PEGylated lipid, a cholesterol, or any combination thereof.

[0352] Example 25: The nanoparticle of any examples herein, particularly Example 24, wherein the phospholipid is phosphatidylcholine, egg phosphatidic acid, 1,2-dioleoyl-sn- glycerophosphocholine (DOPC), 1,2-diolyl-sn-lycerophosphoethanolamine (DOPE), 1,2- dipalmitoyl-sn-glycerophosphocholine (DPPC), 1 ,2-distearoyl-sn-glycerophosphocholine (DSPC), L-a-phosphatidylserine (PS), l,2-dioleoyl-sn-glycero-3-phospho-(l'-rac-glycerol) (DOPG), soybean phosphatidylcholine, l-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine (POPE), l,2-di-O-phytanyl-sn-glycero-3-phosphoethanolamine (4ME), l-palmitoyl-2-oleoyl-glycero-3-phosphocholine (POPC), l-stearoyl-2-oleoyl-sn-glycero-3- phosphoethanolamine (SOPE), l,2-dielaidoyl-sn-glycero-3-phosphoethanolamine (DEPE), 1- hexadecyl-2-(9Z-octadecenoyl)-sn-glycero-3-phosphoethanolamine (Cl 6-18: 1 ), 1 -stearoyl-2- oleoyl-sn-glycero-3-phosphocholine (SOPC), N-(7-nitrobenz-2-oxa-l ,3-diazol-4-yl)- phosphatidylethanolamine (NBD-PE), sphingomyelin (SM), phosphatidylinositol (PI) from soybean, sn-(3-(9Z-octadecenoyl)-2-hydroxy)-glycerol-l-phospho-sn-3’-(l ’-(9Z- octadecenoyl)-2’-hydroxy)-glycerol (BMP-S,R), and sn-(3-oleoyl-2-hydroxy)-glycerol-l- phospho-sn-l’-(3’-oleoyl-2’-hydroxy)-glycerol (BMP-S,S), or any combination thereof, or any combination thereof.

[0353] Example 26: The nanoparticle of any examples herein, particularly Examples 24-25, wherein the nanoparticle comprises from about 5% molar to about 50% molar of the phospholipid.

[0354] Example 27: The nanoparticle of any examples herein, particularly Examples 24-26, wherein the PEGylated lipid is DMG-PEG2000, ALC-0159, DSPE-PEG2000, DOPE- PEG2000, 18: 1 PEG1000-PE, PEG-carbamate- 1 ,2-dimyristoyl-sn-glycerol (PEG-c-DMG), PEG-DSG, or any combination thereof.

[0355] Example 28: The nanoparticle of any examples herein, particularly Examples 24-27, wherein the nanoparticle comprises from about 1% molar to about 10% molar of the PEGylated lipid.

[0356] Example 29: The nanoparticle of any examples herein, particularly Examples 24-28, wherein the nanoparticle comprises from about 20% molar to about 60% molar of the cholesterol.

[0357] Example 30: The nanoparticle of any examples herein, particularly Examples 17-29, wherein the nanoparticle has a diameter of from about 50 nm to about 300 nm.

[0358] Example 31: The nanoparticle of any examples herein, particularly Examples 17-30, wherein the nanoparticle has a zeta potential of from about -20 mV to about 1 mV.

[0359] Example 32: A composition comprising the nanoparticle of any examples herein, particularly Examples 1-31.

[0360] Example 33: The composition of any examples herein, particularly Example 32, wherein the composition comprises a pharmaceutically acceptable carrier.

[0361] Example 34: The composition of any examples herein, particularly Example 33, wherein the pharmaceutically acceptable carrier is a gel or cream.

[0362] Example 35: A delivery system comprising the nanoparticle of any examples herein, particularly Examples 1-31, and a system for enhancing tissue permeability.

[0363] Example 36: The delivery system of any examples herein, particularly Example 35, wherein the system for enhancing tissue permeability is configured for microneedling, dermabrasion, ultrasound-permeability enhancement, thermal ablation, electroporation, and / or stratum comeum removal.

[0364] Example 37: A method of delivering a telomerase or a functional fragment thereof to a cell, the method comprising introducing into the cell the nanoparticle of any examples herein, particularly Examples 1-31.

[0365] Example 38: The method of any examples herein, particularly Example 37, wherein the cell is a skin cell.

[0366] Example 39: The method of any examples herein, particularly Example 37, wherein the cell is an endothelial cell.

[0367] Example 40: The method of any examples herein, particularly Examples 37-39, wherein the cell is human.

[0368] Example 41: The method of any examples herein, particularly Examples 37-40, wherein the method is performed in vivo, in vitro, or ex vivo.

[0369] Example 42: A method of treating or preventing damage to a tissue, the method comprising introducing into the tissue the nanoparticle of any examples herein, particularly Examples 1-31.

[0370] Example 43: The method of any examples herein, particularly Example 42, wherein the tissue is skin.

[0371] Example 44: The method of any examples herein, particularly Example 43, wherein the nanoparticle reaches an endosomal membrane of the skin and subsequently becomes charged.

[0372] Example 45: The method of any examples herein, particularly Examples 42-44, wherein the damage comprises damage from radiation, a physical burn, a chemical bum, damage as a side effect of a therapeutic agent, aging, scarring, reperfusion injury, ischemic injury, or any combination thereof.

[0373] Example 46: The method of any examples herein, particularly Examples 42-45, wherein the damage comprises DNA damage.

[0374] Example 47: The method of any examples herein, particularly Examples 42-46, wherein the method is performed in vivo, in vitro, or ex vivo.

[0375] Example 48: The method of any examples herein, particularly Example 47, wherein the method is performed on a subject having or at risk of tissue damage.

[0376] Example 49: The method of any examples herein, particularly Example 47, wherein the method is performed on a skin graft.

[0377] Example 50: The method of any examples herein, particularly Examples 42-49, wherein telomere length in the tissue is substantially unchanged.

[0378] The following patents, applications and publications as listed below and throughout this document are hereby incorporated by reference in their entirety herein.Reference ListAbd, E., et al. (2016) Skin models for the testing of transdermal drugs, Clin Pharmacol 8, 163- 176.Ahmed, S., et al. (2008) Telomerase does not counteract telomere shortening but protects mitochondrial function under oxidative stress, J Cell Sci 121, 1046-1053.Allen, T. M., et al. (2013) Liposomal drug delivery systems: from concept to clinical applications, Adv Drug Deliv Rev 65, 36-48.Anchordoquy, T. J., et al. (2017) Mechanisms and Barriers in Cancer Nanomedicine: Addressing Challenges, Looking for Solutions, ACS Nano 11, 12-18.Anker, C. J., et al. (2016) Avoiding Severe Toxicity From Combined BRAF Inhibitor and Radiation Treatment: Consensus Guidelines from the Eastern Cooperative Oncology Group (ECOG), Int J Radiat Oncol Biol Phys 95, 632-646.Aubert, G., et al. (2008) Telomeres and aging, Physiol Rev 88, 557-579.Azzam, E. I., et al. (2012) Ionizing radiation-induced metabolic oxidative stress and prolonged cell injury, Cancer Lett 327, 48-60.Bauhammer, I., et al. (2019) Establishment of an in vitro model of cultured viable human, porcine and canine skin and comparison of different media supplements, PeerJ 7, e781 1.Baumer, Y., et al. (2010) Does telomerase reverse transcriptase induce functional dedifferentiation of human endothelial cells?, Cell Mol Life Sci 67, 2451-2465.Belliveau, N. M., et al. (2012) Microfluidic Synthesis of Highly Potent Limitsize Lipid Nanoparticles for In vivo Delivery of siRNA, Mol Ther Nucleic Acids 1, e37.Bemardes de Jesus, B., et al. (2012) Telomerase gene therapy in adult and old mice delays aging and increases longevity without increasing cancer, EMBO Mol Med 4, 691-704.Borges, H.L., et al. (2008) DNA damage-induced cell death: lessons from the central nervous system. Cell Res. 18:17-26.Borrelli, M.R., et al. (2019) Radiation-Induced Skin Fibrosis: Pathogenesis, Current Treatment Options, and Emerging Therapeutics. Ann Plast Surg. 83:S59-S64.Broustas, C.G., et al. (2014) DNA damage response genes and the development of cancer metastasis. Radiat Res. 181: 111-130.Buckingham, E. M., et al. (2011) The role of telomeres in the ageing of human skin, Exp Dermatol 20, 297-302.Burke, G., et al. (2022) Radiation induced skin reactions during and following radiotherapy: A systematic review of interventions. Radiography (Lend). 28:232-239.Chan, R. J., et al. (2014) Prevention and treatment of acute radiation-induced skin reactions: a systematic review and meta-analysis of randomized controlled trials, BMC Cancer 14, 53.Chang, D. F., et al. (2023) Telomerase Mma Enhances Human Skin Engraftment for Wound Healing, Adv Healthc Mater, e2302029.Chatterjee, S., et al. (2021) Telomerase therapy attenuates cardiotoxic effects of doxorubicin, Mol Ther 29, 1395-1410.Citrin, D.E., et al. (2017) Mechanisms of Normal Tissue Injury From Irradiation. Semin Radiat Oncol. 27:316-324.Conklin, Q. A., et al. (2019) Meditation, stress processes, and telomere biology, Curr Opin Psychol 28, 92-101.Corzo-Leon, D.E., et al. (2019) An ex vivo Human Skin Model to Study Superficial Fungal Infections. Front Microbiol. 10:1172.Cullis, P. R., et al. (2017) Lipid Nanoparticle Systems for Enabling Gene Therapies, Mol Ther 25, 1467-1475.Dav alii, P., et al. (2016) ROS, Cell Senescence, and Novel Molecular Mechanisms in Aging and Age-Related Diseases. Oxid Med Cell Longev. 2016:3565127.Denton, D., et al. (2015) Terminal Deoxynucleotidyl Transferase (TdT)-Mediated dUTP Nick- End Labeling (TUNEL) for Detection of Apoptotic Cells in Drosophila. Cold Spring Harb Protoc. 2015:568-571.Dharmalingam, P., et al. (2020) Pervasive Genomic Damage in Experimental Intracerebral Hemorrhage: Therapeutic Potential of a Mechanistic-Based Carbon Nanoparticle. ACS Nano. 14:2827-2846.Dokka, S., et al. (2000) Oxygen radical-mediated pulmonary toxicity induced by some cationic liposomes, Pharm Res 17, 521-525.Eitan, E., et al. (2014) Telomere shortening in neurological disorders: an abundance of unanswered questions, Trends Neurosci 37, 256-263.Ewert, K. K., et al. (2021) Cationic Liposomes as Vectors for Nucleic Acid and Hydrophobic Drug Therapeutics, Pharmaceutics 13.Fang, E.F., et al. (2016) Nuclear DNA damage signalling to mitochondria in ageing. Nat Rev Mol Cell Biol. 17:308-321.Flynn, D. F., et al. (2006) Nuclear terrorism: triage and medical management of radiation and combined-injury casualties, Surg Clin North Am 86, 601-636.Ghosh, A., et al. (2012) Telomerase directly regulates NF-kappaB -dependent transcription. Nat Cell Biol. 14:1270-1281.Giaccia, A.J. (2014) Molecular radiobiology: the state of the art. J Clin Oncol. 32:2871-2878.Godin, B., et al. (2004) Mechanism of bacitracin permeation enhancement through the skin and cellular membranes from an ethosomal carrier, J Control Release 94, 365-379.Godin, B., et al. (2005) Erythromycin ethosomal systems: physicochemical characterization and enhanced antibacterial activity, Curr Drug Deliv 2, 269-275.Godin, B., et al. (2007) Transdermal skin delivery: predictions for humans from in vivo, ex vivo and animal models, Adv Drug Deliv Rev 59, 1152-1161.Gonzalez-Giraldo, et al. (2016) Neuroprotective effects of the catalytic subunit of telomerase: A potential therapeutic target in the central nervous system, Ageing Res Rev 28, 37-45.Granot, Y., et al. (2017) Delivering the right message: Challenges and opportunities in lipid nanoparticles-mediated modified mRNA therapeutics -An innate immune system standpoint, Semin Immunol 34, 68-77.Hafez, I. M., et al. (2001) On the mechanism whereby cationic lipids promote intracellular delivery of polynucleic acids, Gene Ther 8, 1188-1196.Hai, B., et al. (2018) Delivery of Sonic Hedgehog Gene Repressed Irradiation-induced Cellular Senescence in Salivary Glands by Promoting DNA Repair and Reducing Oxidative Stress, Theranostics 8, 1159-1167.Han, X., et al. (2021) An ionizable lipid toolbox for RNA delivery, Nat Commun 12, 7233.Huber, R., et al. (2011) Chromosomal radiosensitivity and acute radiation side effects after radiotherapy in tumour patients— a follow-up study. Radiat Oncol. 6:32.Hymes, S. R., et al. (2006) Radiation dermatitis: clinical presentation, pathophysiology, and treatment 2006, J Am Acad Dermatol 54, 28-46.Jacobi, U., et al. (2007) Porcine ear skin: an in vitro model for human skin, Skin Res Technol 13, 19-24.Jenrow, K.A., et al. (2013) Selective inhibition of microglia-mediated neuroinflammation mitigates radiation-induced cognitive impairment. Radiat Res. 179:549-556.Jenrow, K.A., et al. (2014) Time-dependent inhibition of pan-inflammatory cytokines mitigates radiation-induced skin injury in mice. Radiat Res. 182:316-321.Jensen, J. M., et al. (2011) Treatment of acute radiodermatitis with an oil-in-water emulsion following radiation therapy for breast cancer: a controlled, randomized trial, Strahlenther Onkol 187, 378-384.Jiang, S. J., et al. (2003) Examination of the mechanism of oleic acid-induced percutaneous penetration enhancement: an ultrastructural study, Biol Pharm Bull 26, 66-68.Kastner, E., et al. (2014) High-throughput manufacturing of size- tuned liposomes by a new microfluidics method using enhanced statistical tools for characterization, International Journal of Pharmaceutics 477, 361-368.Khattar, E., et al. (2016) Telomerase reverse transcriptase promotes cancer cell proliferation by augmenting tRNA expression. J Clin Invest. 126:4045-4060.Kim, J.H., et al. (2014) Mechanisms of radiation-induced normal tissue toxicity and implications for future clinical trials. Radiat Oncol J. 32:103-115.Kim, M.O., et al. cAMP Promotes Cell Migration Through Cell Junctional Complex Dynamics and Actin Cytoskeleton Remodeling: Implications in Skin Wound Healing. Stem Cells Dev. 24:2513-2524.Kirkland, J.L., et al. (2020) Senolytic drugs: from discovery to translation. J Intern Med. 288:518-536.Kodavati, M., et al. (2024) FUS unveiled in mitochondrial DNA repair and targeted ligase-1 expression rescues repair-defects in FUS-linked motor neuron disease. Nat Commun. 15:2156.Korman, A. M., et al. (2017) Radiation recall dermatitis associated with nivolumab for metastatic malignant melanoma, Int J Dermatol 56, e75-e77.Kowalski, P. S., et al. (2019) Delivering the Messenger: Advances in Technologies for Therapeutic mRNA Delivery, Mol Ther 27, 710-728.Kulkarni, J. A., et al. (2018) On the Formation and Morphology of Lipid Nanoparticles Containing Ionizable Cationic Lipids and siRNA, ACS Nano 12, 4787-4795.Kumari, R., et al. (2021) Mechanisms of Cellular Senescence: Cell Cycle Arrest and Senescence Associated Secretory Phenotype. Front Cell Dev Biol. 9:645593.Langie, S.A., et al. (2015) Causes of genome instability: the effect of low dose chemical exposures in modem society. Carcinogenesis. 36 Suppl LS61-88.Lentz, T. B., et al. (2012) Viral vectors for gene delivery to the central nervous system, Neurobiol Dis 48, 179-188.Li, M., et al. (2018) Ionizing Radiation-Induced Cellular Senescence in Normal, Nontransformed Cells and the Involved DNA Damage Response: A Mini Review, Front Pharmacol 9, 522.Li, Y., et al. (2017) Telomerase mRNA Reverses Senescence in Progeria Cells, J Am Coll Cardiol 70, 804-805.Li, Y., et al. (2019) Transient introduction of human telomerase mRNA improves hallmarks of progeria cells, Aging Cell 18, el 2979.Lindahl, T. (1993) Instability and decay of the primary structure of DNA. Nature. 362:709- 715.Liu, X.L., et al. (2018) Oncogene-induced senescence: a double edged sword in cancer. Acta Pharmacol Sin. 39:1553-1558.Lopes-Paciencia, S., et al. (2019) The senescence-associated secretory phenotype and its regulation. Cytokine. 117:15-22.Lopez, E., et al. (2005) Early and late skin reactions to radiotherapy for breast cancer and their correlation with radiation-induced DNA damage in lymphocytes, Breast Cancer Res 7, R690- 698.Maida, Y., et al. (2009) An RNA-dependent RNA polymerase formed by TERT and the RMRP RNA, Nature 461, 230-235.Marshall, C.J., et al. (2020) Archaeal DNA Repair Mechanisms. Biomolecules. 10.Martinez, P., et al. (2017) Telomere-driven diseases and telomere-targeting therapies, J Cell Biol 216, 875-887.Masutomi, K., et al. (2005) The telomerase reverse transcriptase regulates chromatin state and DNA damage responses. Proc Natl Acad Sci U S A. 102:8222-8227.Matrone, G., et al. (2019) Dysfunction of iPSC-derived endothelial cells in human Hutchinson- Gilford progeria syndrome, Cell Cycle 18, 2495-2508.Maynard, S., et al. (2015) DNA Damage, DNA Repair, Aging, and Neurodegeneration, Cold Spring Harb Perspect Med 5.McBride, W. H., et al. (2004) A sense of danger from radiation, Radiat Res 162, 1-19.McCart, E.A., et al. (2017) Accelerated senescence in skin in a murine model of radiation- induced multi-organ injury. J Radiat Res. 58:636-646.McQuestion, M. (2011) Evidence-based skin care management in radiation therapy: clinical update, Semin Oncol Nurs 27, el -17.Mendelsohn, F. A., et al. (2002) Wound care after radiation therapy, Adv Skin Wound Care 15, 216-224.Mender, I., et al. (2015) Telomerase Repeated Amplification Protocol (TRAP), Bio Protoc 5.Minko, LG., et al. (2016) Catalysts of DNA Strand Cleavage at Apurinic / Apyrimidinic Sites. Sci Rep. 6:28894.Mojiri, A., et al. (2021) Telomerase therapy reverses vascular senescence and extends lifespan in progeria mice, Eur Heart J 42, 4352-4369.Morin, G.B. (1991) Recognition of a chromosome truncation site associated with alpha- thalassaemia by human telomerase. Nature. 353:454-456.Motamedi, S., et al. (2021) The Current Challenges on Spray-Based Cell Delivery to the Skin Wounds, Tissue Eng Part C Methods 27, 543-558.Moustakli, E., et al. (2023) Functional association between telomeres, oxidation and mitochondria. Front Reprod Health. 5: 1107215.Nazari-Shafti, T. Z., et al. (2015) Telomerase Therapy to Reverse Cardiovascular Senescence, Methodist Debakey Cardio vase J 11, 172-175.Ostoich, P.V. (2024) The Significance of the Response: Beyond the Mechanics of DNA Damage and Repair-Physiological, Genetic, and Systemic Aspects of Radiosensitivity in Higher Organisms. Int J Mol Sci. 26.Pan, J., et al. (2017) Inhibition of Bcl-2 / xl With ABT-263 Selectively Kills Senescent Type 11 Pneumocytes and Reverses Persistent Pulmonary Fibrosis Induced by Ionizing Radiation in Mice. Int J Radiat Oncol Biol Phys. 99:353-361.Park, J.I., et al. (2009) Telomerase modulates Wnt signalling by association with target gene chromatin. Nature. 460:66-72.Peng, X., et al. (2020) Cellular senescence contributes to radiation-induced hyposalivation by affecting the stem / progenitor cell niche, Cell Death Dis 11, 854.Prasanna, P.G., et al. (2021) Therapy-Induced Senescence: Opportunities to Improve Anticancer Therapy. J Natl Cancer Inst. 113:1285-1298.Prise, K. M., et al. (2011) Concise review: stem cell effects in radiation risk, Stem Cells 29, 1315-1321.Qin, W. et al. (2025) Circular RNA telomerase reverses endothelial senescence in Progeria.Aging Cell. 24(6):e70021.Ramishetti, S., et al. (2015) Systemic Gene Silencing in Primary T Lymphocytes Using Targeted Lipid Nanoparticles, ACS Nano 9, 6706-6716.Ramunas, J., et al. (2015) Transient delivery of modified mRNA encoding TERT rapidly extends telomeres in human cells, FASEB J 29, 1930-1939.Rich, T., et al. (2000) Defying death after DNA damage. Nature. 407:777-783.Roces, C. B., et al. (2020) Manufacturing Considerations for the Development of Lipid Nanoparticles Using Microfluidics, Pharmaceutics 12.Roos, W.P., et al. (2006) DNA damage-induced cell death by apoptosis. Trends Mol Med. 12:440-450.Rosen, J., et al. (2020) Non-canonical functions of Telomerase Reverse Transcriptase - Impact on redox homeostasis, Redox Biol 34, 101543.Ryan, J. L. (2012) Ionizing radiation: the good, the bad, and the ugly, J Invest Dermatol 132, 985-993.Samaridou, E., et al. (2020) Lipid nanoparticles for nucleic acid delivery: Current perspectives, Adv Drug Deliv Rev 154-155, 37-63.Schneider, L., et al. (2013) DNA damage in mammalian neural stem cells leads to astrocytic differentiation mediated by BMP2 signaling through JAK-STAT. Stem Cell Reports. 1:123- 138.Schumacher, B., et al. (2021) The central role of DNA damage in the ageing process. Nature. 592:695-703.Simberg, D., et al. (2004) DOTAP (and other cationic lipids): chemistry, biophysics, and transfection, Crit Rev Ther Drug Carrier Syst 21, 257-317.Singh, V. K., et al. (2015) Medical Countermeasures for Radiation Exposure and Related Injuries: Characterization of Medicines, FDA- Approval Status and Inclusion into the Strategic National Stockpile, Health Phys 108, 607-630.Singhapol, C., et al. (2013) Mitochondrial telomerase protects cancer cells from nuclear DNA damage and apoptosis. PLoS One. 8:e52989.Smith, J. A., et al. (2013) Oxidative stress, DNA damage, and the telomeric complex as therapeutic targets in acute neurodegeneration, Neurochem Int 62, 764-775.Todo, H. (2017) Transdermal Permeation of Drugs in Various Animal Species, Pharmaceutics 9.Touitou, E., et al. (2008) Efficacy and tolerability of clindamycin phosphate and salicylic acid gel in the treatment of mild to moderate acne vulgaris, J Eur Acad Dermatol Venereol 22, 629- 631.Wang, Y., et al. (2006) Total body irradiation selectively induces murine hematopoietic stem cell senescence. Blood. 107:358-366.Wang, Y., et al. (2016) Ioniz...

Claims

CLAIMS1. A nanoparticle, wherein said nanoparticle comprises an ionizable lipid encapsulating a nucleic acid encoding a telomerase or a functional fragment of a telomerase.

2. The nanoparticle of claim 1 , wherein the nucleic acid comprises mRNA, selfamplifying RNA, circular RNA, or plasmid DNA3. The nanoparticle of any one of claims 1-2, wherein the nucleic acid further comprises one or more mutations to a nucleic acid encoding a naturally occurring telomerase or a functional fragment of a naturally occurring telomerase.

4. The nanoparticle of any one of claims 1-3, wherein the nucleic acid encodes a telomerase reverse transcriptase (TERT) domain selected from essential N-terminal (TEN) domain, a TERT RNA-binding domain (TRBD), a reverse-transcriptase (RT) domain, a C- terminal extension (CTE), or any combinations thereof.

5. The nanoparticle of any one of claims 1-4, wherein the nucleic acid encodes a telomerase or a functional fragment of a telomerase that is derived from a mammal.

6. The nanoparticle of claim 5, wherein the mammal is human.

7. The nanoparticle of any one of claims 1-6, wherein the ionizable lipid is DLin-MC3- DMA, SM-102, ALC-0315, l,2-dimyristoyl-3-dimethylammonium-propane (DAP), C12- 200, 5A2-SC8, [(4-hydroxybutyl)azanediyl]di(hexane-6,l-diyl) bis(2-hexyldecanoate) ALC- 135, DODMA, BP Lipid 216, BP Lipid 217 (CAS 2430034-17-4), Lipid III-45 (CAS 2096984-25-5), BP Lipid 226 (CAS 2036272-94-1), 2-[2,2-bis[(9Z,12Z)-octadeca-9, 12- dienyl]-!, 3-dioxolan-4-yl]-N,N-dimethylethanamine (DLin-KC2-DMA), KC2, 1,2- dilinoleyloxy-n,n-dimethyl-3 -aminopropane (DLinDMA), or any combination thereof.

8. The nanoparticle of any one of claims 1-7, wherein the nanoparticle comprises from about 30% molar to about 70% molar of the ionizable lipid.

9. The nanoparticle of any one of claims 1-8, wherein the nanoparticle further comprises a phospholipid, a PEGylated lipid, a cholesterol, or any combination thereof.

10. The nanoparticle of claim 9, wherein the phospholipid is phosphatidylcholine, egg phosphatidic acid, 1,2-dioleoyl-sn-glycerophosphocholine (DOPC), 1 ,2-diolyl-sn- lycerophosphoethanolamine (DOPE), 1,2-dipalmitoyl-sn-glycerophosphocholine (DPPC), 1,2-distearoyl-sn-glycerophosphocholine (DSPC), L-a-phosphatidylserine (PS), 1 ,2-dioleoyl- sn-glycero-3-phospho-(l'-rac-glycerol) (DOPG), soybean phosphatidylcholine, 1-palmitoyl- 2-oleoyl-sn-glycero-3-phosphoethanolamine (POPE), 1 ,2-di-O-phytanyl-sn-glycero-3- phosphoethanolamine (4ME), l-palmitoyl-2-oleoyl-glycero-3-phosphocholine (POPC), 1- stearoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine (SOPE), 1 ,2-dielaidoyl-sn-glycero-3- phosphoethanolamine (DEPE), 1 -hexadecyl-2-(9Z-octadecenoyl)-sn-glycero-3- phosphoethanolamine (C 16— 18: 1), l-stearoyl-2-oleoyl-sn-glycero-3-phosphocholine (SOPC), N-(7-nitrobenz-2-oxa-l , 3 -diazol-4-yl) -phosphatidylethanolamine (NBD-PE), sphingomyelin (SM), phosphatidylinositol (PI) from soybean, sn-(3-(9Z-octadecenoyl)-2-hydroxy)-glycerol-1-phospho-sn-3’-(l ’-(9Z-octadecenoyl)-2’-hydroxy)-glycerol (BMP-S,R), and sn-(3-oleoyl-2-hydroxy)-glycerol-l-phospho-sn-r-(3’-oleoyl-2’-hydroxy)-glycerol (BMP-S,S), or any combination thereof, or any combination thereof.

11. The nanoparticle of any one of claims 9-10, wherein the nanoparticle comprises from about 5% molar to about 50% molar of the phospholipid.

12. The nanoparticle of any one of claims 9-11, wherein the PEGylated lipid is DMG- PEG2000, ALC-0159, DSPE-PEG2000, DGPE-PEG2000, 18:1 PEG1000-PE, PEG- carbamate- 1 ,2-dimyristoyl-sn-glycerol (PEG-c-DMG), PEG-DSG, or any combination thereof.

13. The nanoparticle of any one of claims 9-12, wherein the nanoparticle comprises from about 1% molar to about 10% molar of the PEGylated lipid.

14. The nanoparticle of any one of claims 9-13, wherein the nanoparticle comprises from about 20% molar to about 60% molar of the cholesterol.

15. The nanoparticle of any one of claims 1-14, wherein the nanoparticle has a diameter of from about 50 nm to about 300 nm.

16. The nanoparticle of any one of claims 1-15, wherein the nanoparticle has a zeta potential of from about -20 mV to about 1 mV.

17. A nanoparticle, wherein said nanoparticle comprises an ionizable lipid encapsulating a telomerase or a functional fragment of a telomerase.

18. The nanoparticle of claim 17, wherein the telomerase or the functional fragment of a telomerase further comprises one or more mutations to a naturally occurring telomerase or a functional fragment of a naturally occurring telomerase.

19. The nanoparticle of any one of claims 17-18, wherein the telomerase or the functional fragment of a telomerase comprises a telomerase reverse transcriptase (TERT) domain selected from essential N-terminal (TEN) domain, a TERT RNA-binding domain (TRBD), a reverse-transcriptase (RT) domain, a C-terminal extension (CTE), or any combinations thereof.

20. The nanoparticle of any one of claims 17-19, wherein the telomerase or the functional fragment of a telomerase is derived from a mammal.

21. The nanoparticle of claim 20, wherein the mammal is human.

22. The nanoparticle of any one of claims 17-21, wherein the ionizable lipid is DLin- MC3-DMA, SM-102, ALC-0315, l,2-dimyristoyl-3-dimethylammonium-propane (DAP), C12-200, 5A2-SC8, [(4-hydroxybutyl)azanediyl]di(hexane-6,l-diyl) bis(2-hexyldecanoate) ALC-135, DODMA, BP Lipid 216, BP Lipid 217 (CAS 2430034-17-4), Lipid III-45 (CAS 2096984-25-5), BP Lipid 226 (CAS 2036272-94-1), 2-[2,2-bis[(9Z,12Z)-octadeca-9, 12- dienyl]-!, 3-dioxolan-4-yl]-N,N-dimethylethanamine (DLin-KC2-DMA), KC2, 1,2- dilinoleyloxy-n,n-dimethyl-3-aminopropane (DLinDMA), or any combination thereof.

23. The nanoparticle of any one of claims 17-22, wherein the nanoparticle comprises from about 30% molar to about 70% molar of the ionizable lipid.

24. The nanoparticle of any one of claims 17-23, wherein the nanoparticle further comprises a phospholipid, a PEGylated lipid, a cholesterol, or any combination thereof.

25. The nanoparticle of claim 24, wherein the phospholipid is phosphatidylcholine, egg phosphatidic acid, 1,2-dioleoyl-sn-glycerophosphocholine (DOPC), 1,2-diolyl-sn- lycerophosphoethanolamine (DOPE), 1,2-dipalmitoyl-sn-glycerophosphocholine (DPPC),1 ,2-distearoyl-sn-glycerophosphocholine (DSPC), L-a-phosphatidylserine (PS), 1 ,2-dioleoyl- sn-glycero-3-phospho-(l'-rac-glycerol) (DOPG), soybean phosphatidylcholine, 1-palmitoyl- 2-oleoyl-sn-glycero-3-phosphoethanolamine (POPE), 1 ,2-di-O-phytanyl-sn-glycero-3- phosphoethanolamine (4ME), l-palmitoyl-2-oleoyl-glycero-3-phosphocholine (POPC), 1- stearoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine (SOPE), 1 ,2-dielaidoyl-sn-glycero-3- phosphoethanolamine (DEPE), 1 -hexadecyl-2-(9Z-octadecenoyl)-sn-glycero-3- phosphoethanolamine (C 16— 18: 1), l-stearoyl-2-oleoyl-sn-glycero-3-phosphocholine (SOPC), N-(7-nitrobenz-2-oxa- 1 ,3-diazol-4-yl)-phosphatidylethanolamine (NBD-PE), sphingomyelin (SM), phosphatidylinositol (Pl) from soybean, sn-(3-(9Z-octadecenoyl)-2-hydroxy)-glycerol-1-phospho-sn-3’-(r-(9Z-octadecenoyl)-2’-hydroxy)-glycerol (BMP-S,R), and sn-(3-oleoyl-2-hydroxy)-glycerol-l-phospho-sn-r-(3’-oleoyl-2’-hydroxy)-glycerol (BMP-S,S), or any combination thereof, or any combination thereof.

26. The nanoparticle of any one of claims 24-25, wherein the nanoparticle comprises from about 5% molar to about 50% molar of the phospholipid.

27. The nanoparticle of any one of claims 24-26, wherein the PEGylated lipid is DMG- PEG2000, ALC-0159, DSPE-PEG2000, DGPE-PEG2000, 18:1 PEG1000-PE, PEG- carbamate- 1 ,2-dimyristoyl-sn-glycerol (PEG-c-DMG), PEG-DSG, or any combination thereof.

28. The nanoparticle of any one of claims 24-27, wherein the nanoparticle comprises from about 1% molar to about 10% molar of the PEGylated lipid.

29. The nanoparticle of any one of claims 24-28, wherein the nanoparticle comprises from about 20% molar to about 60% molar of the cholesterol.

30. The nanoparticle of any one of claims 17-29, wherein the nanoparticle has a diameter of from about 50 nm to about 300 nm.

31. The nanoparticle of any one of claims 17-30, wherein the nanoparticle has a zeta potential of from about -20 mV to about 1 mV.

32. A composition comprising the nanoparticle of any one of claims 1-31.

33. The composition of claim 32, wherein the composition comprises a pharmaceutically acceptable carrier.

34. The composition of claim 33, wherein the pharmaceutically acceptable carrier is a gel or cream.

35. A delivery system comprising the nanoparticle of any one of claims 1-31 and a system for enhancing tissue permeability.

36. The delivery system of claim 35, wherein the system for enhancing tissue permeability is configured for microneedling, dermabrasion, ultrasound-permeability enhancement, thermal ablation, electroporation, and / or stratum comeum removal.

37. A method of delivering a telomerase or a functional fragment thereof to a cell, the method comprising introducing into the cell the nanoparticle of any one of claims 1-31.

38. The method of claim 37, wherein the cell is a skin cell.

39. The method of claim 37, wherein the cell is an endothelial cell.

40. The method of any one of claims 37-39, wherein the cell is human.

41. The method of any one of claims 37-40, wherein the method is performed in vivo, in vitro, or ex vivo.

42. A method of treating or preventing damage to a tissue, the method comprising introducing into the tissue the nanoparticle of any one of claims 1-31.

43. The method of claim 42, wherein the tissue is skin.

44. The method of claim 43, wherein the nanoparticle reaches an endosomal membrane of the skin and subsequently becomes charged.

45. The method of any one of claims 42-44, wherein the damage comprises damage from radiation, a physical bum, a chemical bum, damage as a side effect of a therapeutic agent, aging, scarring, reperfusion injury, ischemic injury, or any combination thereof.

46. The method of any one of claims 42-45, wherein the damage comprises DNA damage.

47. The method of any one of claims 42-46, wherein the method is performed in vivo, in vitro, or ex vivo.

48. The method of claim 47, wherein the method is performed on a subject having or at risk of tissue damage.

49. The method of claim 47, wherein the method is performed on a skin graft.

50. The method of any one of claims 42-49, wherein telomere length in the tissue is substantially unchanged.

Images