New method for obtaining innate lymphoid precursors cells

Abstract

Helper innate lymphoid cells (ILC) play important functions in immunity and tissue homeostasis, but their development remains poorly understood. In this study, the inventors investigated the precise function of the transcription factor NFIL3, which they established as the earliest requirement during ILC development in mouse bone marrow. Using NFIL3 retroviral ectopic expression in all-lymphoid progenitors, they showed that NFIL3 triggers a developmental process that recapitulates in vitro natural ILC development, in the absence of any other instructive signal. The present invention relates to an in vitro method for obtaining innate lymphoid precursors cells, said method comprising the step of i) culturing hematopoietic precursors cells in an appropriate culture medium, and ii) manipulating the said hematopoietic precursors cells to increase the expression or function of the Nuclear Factor Interleukin (3) Regulated (NFIL3).

Description

[0001] NEW METHOD FOR OBTAINING INNATE LYMPHOID PRECURSORS CELLS

[0002] FIELD OF THE INVENTION:

[0003] The invention is in the field of immunotherapy. More particularly, the invention relates to an in vitro method for obtaining innate lymphoid precursors cells, said method comprising the step of i) culturing hematopoietic precursors cells in an appropriate culture medium, and ii) manipulating the said hematopoietic precursors cells to increase the expression or function of the Nuclear Factor Interleukin 3 Regulated (NFIL3).

[0004] BACKGROUND OF THE INVENTION:

[0005] Helper innate lymphoid cells (ILC) were recently discovered, and their functions are only starting to be uncovered. They are strategically located at barrier sites and in tissues, and constitute the first line of defense of the immune system. They play overlapping functions with T cells, and additionally fulfill unique immune and non-immune functions in tissue homeostasis and repair. Major efforts are underway to define ILC functions and evaluate their potential to treat pathologies1. However, the molecular mechanisms underlying ILC development are unclear. In particular, factors that initiate ILC-specification and program ILC-specific functional features remain to be identified.

[0006] In the adult, ILC development occurs continuously in the bone marrow (BM), and this process contributes to replenish ILC compartments in tissues throughout life2. Known ILC precursors, characterized by the expression of the transcription factor TCF-1 (encoded by 7c 7)3, arise from multipotential BM all-lymphoid progenitors (ALP)4that give rise to all lymphocytes5. Early ILC-specified precursors (sEILP) retain the ability to generate dendritic cells (DC)6, whereas later ILC precursor (cEILP and ILCP) characterized by the expression of PLZF (encoded by Zbtbl6) have lost this ability, and are thus committed to the ILC fate6,7.

[0007] Several transcription factors are well-established to play important functions during ILC development, namely NFIL38 14, TOX4,6 15, ID23 16, GATA-34,16, TCF-13’6’17, and PLZF4’7. However, their precise functions and their functional relationships remain to be defined. TCF- 1 was shown to be required at the ILC commitment-checkpoint, to induce ILC-genes such as Zbtbl6 and repress DC genes6,18. GATA-3 and ID2 are required around ILC-commitment3,4. GATA-3 contributes to regulating TcV)and might cooperate with TCF-1 to enforce ILC- commitment18. ID2 inhibits the activity of E-proteins, thereby contributing to the loss of T and B cell potential20,21. The requirement for TOX and NFIL3 are less understood as very few ILC precursors were detected in deficient mice, which made the analysis of functional dysregulations in these cells very difficult4,5,9’11,15.

[0008] In this study, the inventors aimed at understanding the initiation of ILC lineage specification in mouse BM. They characterized novel developmental intermediates between upstream lymphoid precursors and known ILC-specified precursors and used them to investigate functions for transcription factors during ILC-specification. They established that the proline and acidic amino-acid-rich (PAR)-like basic leucine zipper (bZIP) transcription factor Nuclear Factor, Interleukin 3 Regulated (NFIL3), also known as E4 Promoter-Binding Protein 4 (E4BP4) acts upstream of all other known controllers. Strikingly, when forcibly expressed in vitro in ALP, NFIL3 triggered a developmental process that recapitulated the steps of ILC development characterized in mouse BM and drove the generation of all canonical helper ILC lineages and conventional natural Killer cells (cNK). Analysis of transcriptional and epigenetic changes following NFIL3 expression during ILC development, together with characterization of NFIL3 genome-wide binding in LC precursors, further revealed the mechanism by which NFIL3 drives ILC specification from multipotent lymphoid precursors.

[0009] SUMMARY OF THE INVENTION:

[0010] The invention relates to methods for obtaining innate lymphoid precursors cells. In particular, the present invention is defined by the claims.

[0011] DETAILED DESCRIPTION OF THE INVENTION:

[0012] Helper innate lymphoid cells (ILC) play important functions in immunity and tissue homeostasis, but their development remains poorly understood. In this study, the inventors investigated the precise function of the transcription factor NFIL3, which they established as the earliest requirement during ILC development in mouse bone marrow. Using NFIL3 retroviral ectopic expression in all-lymphoid progenitors, they showed that NFIL3 triggers a developmental process that recapitulates in vitro natural ILC development, in the absence of any other instructive signal. Mechanistically, they showed that NFIL3 regulates expression of many genes, including key controllers of ILC development, such as 7'ox. Id2, GataS. Tcf7, and Zbtbl6. TOX, once induced by NFIL3, provides additional regulatory input to Tcf7 and Zbtbl6. Their work places NFIL3 as the apex controller of ILC specification. Their in vitro model of ILC development further provides a convenient system to study and manipulate this process. Such an approach may help understand and harness ILC development in human in the future. Main definition of the present invention:

[0013] As used herein, the term “in vivo " refers generally to activities that take place inside an organism.

[0014] As used herein, the expressions “cell”, “cell line” and “cell culture” are used interchangeably and all such designations include progeny.

[0015] As used herein, the terms “hematopoietic stem cell” (HSC) refer to the stem cells that give rise to all the blood cell types of an organism, including myeloid (e.g., monocytes and macrophages, neutrophils, basophils, eosinophils, erythrocytes, megakaryocytes / platelets, dendritic cells), and lymphoid lineages (e.g., T-cells, B-cells, NK-cells). This process is called hematopoiesis. In vertebrates, the very first definitive HSCs arise from the ventral endothelial wall of the embryonic aorta within the (midgestational) aorta-gonad-mesonephros region, through a process known as endothelial-to-hematopoietic transition. In adults, hematopoiesis occurs in the red bone marrow, in the core of most bones. The red bone marrow is derived from the layer of the embryo called the mesoderm.

[0016] As used herein, the term “hematopoiesis” refers to the process by which all mature blood cells are produced. It must balance enormous production needs (the average person produces more than 500 billion blood cells every day) with the need to regulate the number of each blood cell type in the circulation. In vertebrates, the vast majority of hematopoiesis occurs in the bone marrow and is derived from a limited number of hematopoietic stem cells that are multipotent and capable of extensive self-renewal.

[0017] As used herein, the term “bone marrow” refers to a semi-solid tissue found within the spongy (also known as cancellous) portions of bones. It is composed of hematopoietic cells, marrow adipose tissue, and supportive stromal cells. In adult humans, bone marrow is primarily located in the ribs, vertebrae, sternum, and bones of the pelvis.

[0018] As used herein, the terms "flow cytometric methods" refer to a technique for counting and analyzing the phenotype of cells of interest, by suspending them in a stream of fluid and passing them through an electronic detection apparatus. Flow cytometric methods allow simultaneous multiparametric analysis of the physical and / or chemical parameters of up to thousands of particles per second, such as fluorescent parameters. Modem flow cytometric instruments usually have multiple lasers and fluorescence detectors. A common variation of flow cytometric techniques is to physically sort particles based on their properties, so as to purify or detect populations of interest, using "fluorescence-activated cell sorting".

[0019] As used herein, the terms "fluorescence-activated cell sorting" (FACS) refer to a flow cytometric method for sorting a heterogeneous mixture of cells from a biological sample into two or more containers, one cell at a time, based upon the specific light scattering and fluorescent characteristics of each cell and provides fast, objective and quantitative recording of fluorescent signals from individual cells as well as physical separation of cells of particular interest. Accordingly, FACS can be used with the methods described herein to isolate the cells of the present invention.

[0020] Method for obtaining in vitro / ex vivo innate lymphoid precursors cells

[0021] The present invention relates an in vitro method for obtaining innate lymphoid precursors cells, said method comprising the step of i) culturing hematopoietic precursors cells in an appropriate culture medium, and ii) manipulating the said hematopoietic precursors cells to increase the expression or function of the Nuclear Factor Interleukin 3 Regulated (NFIL3).

[0022] As used herein, the terms "progenitor cell" or "precursor cell" refer to a lineage- committed cell derived from a pluripotent stem cell. Thus, progenitor cells or precursor cells are more differentiated than pluripotent stem cells, but still have the capacity to differentiate into more than one type of cell.

[0023] In some embodiment, the precursor cells are, innate lymphoid precursor cells. For example, innate lymphoid precursor cells of the present invention, include but are not limited to early innate lymphoid progenitors (EILP), innate lymphoid cell precursors (ILCP).

[0024] As used herein, the terms “all-lymphoid progenitors” (ALP) refer to a cell derived from the hematopoietic stem cell (HSC) just like the myeloid progenitor cell. The lymphoid progenitor cell will produce cells of the lymphoid lineage including: T-cells / T-lymphocytes, B- cells / B-lymphocytes, Natural killer cells (NK cells), Innate Lymphoid cells (ILC) and dendritic cells.

[0025] As used herein, the terms “innate lymphoid cells” (ILCs) include the most recently discovered family of innate immune cells, derived from all-lymphoid progenitors (ALPs). In response to pathogenic tissue damage, ILCs contribute to immunity via the secretion of signaling molecules, and the regulation of both innate and adaptive immune cells. ILCs are primarily tissue resident cells, found in both lymphoid (immune associated), and non- lymphoid tissues, and rarely in the blood. They are particularly abundant at mucosal surfaces, playing a key role in mucosal immunity and homeostasis. They are divided into five groups: natural killer (NK) cells, helper-like lymphoid cells (ILC Is, ILC2s, ILC3s), and lymphoid tissue inducer (LTi) cells. ILCs are implicated in multiple physiological functions, including tissue homeostasis, morphogenesis, metabolism, repair, and regeneration. ILCs are derived from ILC progenitors (namely EILPs and ILCPs), which are derived from all-lymphoid progenitors (ALPs), which have the ability to differentiate into a number of different lymphoid cell types including T and B cells. ILC progenitors can also differentiate into NK cells. Some ILC progenitors can also differentiate into lymphoid tissue inducer progenitors (LTiPs), but this differentiation pathway is largely restricted to the embryo.

[0026] As used herein, the terms “differentiation” and “cell differentiation” refer to a process by which the precursors cells develop or mature or differentiates to possess a more distinct form and / or function into a more specialized cell or differentiated cell, (i.e innate lymphoid cells (ILC) and Natural Killer (NK) cells).

[0027] In some embodiments, the method of the present invention involves culturing of hematopoietic precursors cells that have been isolated, or partially purified, from bone marrow or any other relevant sample (e.g. blood from GM-CSF treated patients) or generated from iPSC or ESC.

[0028] In some embodiment, hematopoietic precursors cells may be isolated, or partially purified, from bone marrow or from blood from GM-CSF treated patients using any of the methods well known to persons skilled in the art. One preferred method involves the isolation of hematopoietic precursors cells from the fraction(s) of centrifuged bone marrow (see Kenney et al. Methods in Molecular Biology. 2022.

[0029] In some embodiment, hematopoietic precursors cells may be generated from induced pluripotent stem cells or embryonic stem cells, using any of the methods known to persons skilled in the art.

[0030] As used herein, the term “Nuclear factor interleukin 3 regulated” (NFIL3), also known as E4 Promoter-Binding Protein 4 (E4BP4) is a protein which in humans is encoded by the NFIL3 gene. NFIL3 is having the following Uniprot number: QI 6649 and the following Gene ID: 4783.

[0031] As used herein, the terms "culture medium", refer to a chemical composition that supports the growth and / or differentiation of a cell, suitably of a mammalian cell. Typical culture media include suitable nutrients (e.g. sugars, amino acids, proteins, and the like) to support the growth and / or differentiation of a cell. Media for the culture of mammalian cells are well known to those of skill in the art and include, but are not limited to Medium 199, Eagle's Basal Medium (BME), Eagle's Minimum Essential Medium (MEM), alpha modification MEM (a-MEM), Minimum Essential Medium with Non-Essential Amino Acids (MEM / NEAA), Dulbecco's Modification of Eagle's Medium (DMEM), McCoy's 5 A, Rosewell Park Memorial Institute (RPMI) 1640, modified McCoy's 5 A, Ham's F10 and F 12, CMRL 1066 and CMRL 1969, Fisher's medium, Glasgow Minimum Essential Medium (GMEM), Iscove's Modified Dulbecco's Medium (IMDM), Leibovitz's L-15 Medium, McCoy's 5 A medium, S-MEM, NCTC-109, NCTC-135, Waymouth's MB 752 / 1 medium, Williams' Medium E, and the like.

[0032] The step of isolating hematopoietic precursors cells from the culture may be conducted in accordance with any of the methods well known to persons skilled in the art, for example magnetic bead-based methods and FACS cell sorting techniques. For FACS cell sorting, the sorting or "gating" may preferably be conducted in a manner so as to isolate those cells present in the culture which show the appropriate surface marker phenotype. Alternatively, isolation for cell populations of the present invention (e.g. innate lymphoid precursors cells or innate lymphoid cells) can be performed using bead based sorting methods, such as magnetic beads. Using such methods, cells can be separated and isolated positively or negatively with respect to the particular cell-surface markers.

[0033] As defined herein, the terms "positive selection" refer to techniques that result in the isolation and detection of cells expressing specific cell-surface markers, while "negative selection" refers techniques that result in the isolation and detection of cells not expressing specific cell-surface markers. In some embodiments, beads can be coated with antibodies by a skilled artisan using standard techniques known in the art, such as commercial bead conjugation kits. In some embodiments, a negative selection step is performed to remove cells expressing one or more lineage markers, followed by fluorescence activated cell sorting to positively select the cells of the present invention.

[0034] Methods for making ILC1, ILC2, ILC3 and NK cells

[0035] In some embodiment, the present invention encompasses methods for making ILC1, ILC2, ILC3, and NK cells. ILC1, ILC2, ILC3, and NK cells can be produced from the innate lymphoid precursors cells of the invention by routine techniques in the art. For example, ILC1, ILC2, ILC3, and NK cells can be produced using the specific techniques disclosed in the Examples.

[0036] In one embodiment, a cell system (e.g., the OP9 stromal cell system disclosed in Mohtashami, et al. (2010)) can be used to generate ILC1, ILC2, ILC3, and NK cells from the hematopoietic precursors cells of the invention. The OP9 cell line is available through ATCC (open access). OP9 cells have been used previously to develop early human T cell precursors, for example in US 8,772,028 and US 9,533,009.

[0037] In some embodiments, the hematopoietic precursors cells are treated with various cytokines to promote differentiation into ILC1, ILC2, ILC3, and NK cells. These cytokines include any and all combinations of IL-ip (IL-1 beta), IL-12, IL-18, IL-25, IL-33, IL-23, IL-2, and IL-7.

[0038] In a particular embodiment, the culture medium comprises an amount of at least one cytokine selected from IL-7, Flt3-L, or SCF that is suitable for promoting hematopoietic precursors cells differentiation or expansion that occurs during the step of culturing the said hematopoietic precursors cells that express NFIL3. In particular, the culture medium comprises an amount of a combination of IL-7, Flt3-L, and SCF

[0039] As used herein, the term “IL-7” has its general meaning in the art and refers to the interleukin 7. IL-7 is a hematopoietic growth factor secreted by stromal cells in the bone marrow and thymus. It is also produced by keratinocytes, dendritic cells, hepatocytes, neurons, and epithelial cells,

[0040] As used herein, the term “Flt3-L” has its general meaning in the art and refers to the ligand for the fms like tyrosine kinase 3 (FLT3).

[0041] As used herein, the term “stem cell factor” (SCF) also known as, KIT-ligand, KL, or steel factor is a cytokine that binds to the c-KIT receptor (CD 117). SCF can exist both as a transmembrane protein and a soluble protein. This cytokine plays an important role in hematopoiesis (formation of blood cells), spermatogenesis, and melanogenesis.

[0042] In some embodiments, the cytokines are provided in the culture medium at a concentration in the range of 1 to 100 ng / ml, preferably from 2.5 to 50 ng / ml. In some embodiments, the culture medium comprises 30 ng / ml of IL-7, Flt3-L and SCF.

[0043] Typically, the duration of the culturing step of the hematopoietic precursors cells of the present invention is in the range of about 2 to 30 days, in particular 2 to 20 days and more particularly 2 to 12 days. In a particular, ILC precursors are obtained from day 2 to 5, mature ILC are obtained from day 5.

[0044] Methods for differentiating the hematopoietic precursors cells into innate lymphoid precursors cells and / or their innate lymphoid cells progeny

[0045] In some embodiment, the invention encompasses methods for differentiating the hematopoietic precursors cells into innate lymphoid precursors cells and / or their innate lymphoid cells progeny. For the differentiation of the hematopoietic precursor cells of the present invention, the culture medium comprises IL-7 or Flt3-L, and SCF.

[0046] Additional supplements, such as amino acids or serum, can be added to the medium. Antibiotics and antimycotics can also be added to the medium. In some embodiment, hematopoietic precursors cells can be differentiated using a stromal cell-based approach with OP9.

[0047] In some embodiment, the innate lymphoid precursors cells are provided in a culture medium with irradiated OP9 stromal layers, or any other culture condition known to support innate lymphoid precursors cells survival and proliferation

[0048] In some embodiment, hematopoietic precursors cells can be differentiated directly isolated from patient samples. The cells can be grown as set forth in the examples or by other similar techniques.

[0049] In particular, the hematopoietic precursors cells could also be modified by CRISPR, ZFNs, or TALENs, or other genomic editing technologies to add or eliminate desired genomic sequences. Vectors, including retroviral, AAV, and lentiviral vectors, can also be used to modify these cells.

[0050] The hematopoietic precursors cells can also be modified to contain a chimeric antigen receptor (CAR). These CARs typically comprise a single-chain binding domain, such as from a monoclonal antibody or nanobody, fused to a transmembrane domain and endodomain that results in the transmission of a signal in response to binding of the binding domain to its target. Examples of CARs are well- known in the art. Such a genetically-engineered receptor, can be used to graft the specificity of a monoclonal antibody onto a mature ILC. ILCs expressing CARs may be useful in some autoimmune diseases since some subsets of ILCs (e.g. ILC2) suppress immune responses through myeloid cells. Also in cancer, as ILC1 and NK play anti -tumoral functions.

[0051] In some embodiment, hematopoietic precursors cells of the present invention and the innate lymphoid precursors cells or the ILC1, ILC2, or ILC3 cells could also be modified by the methods cited above at the same time that the modulation of the NFIL3 expression. In some embodiment, if mESC or iPSC are used to generate hematopoietic precursors, these could also be modified by the methods cited above.

[0052] The present invention also relates to a method comprises providing a population of innate lymphoid precursors cells of the present invention, subjecting the cell population to an external stimulus in vivo or in vitro, and detecting an increase in at least one cell type selected from ILC1, ILC2, ILC3, and NK cells. In some embodiments, the ILC1, ILC2, ILC3, and / or NK cells are separated, purified, and / or harvested. In various embodiments, the external stimulus is a cytokine or mixture of cytokines. In various embodiments, the external stimulus is a test compound. In various embodiments, the innate lymphoid precursors cells of the present invention are administered in vivo to promote differentiation into ILC1, ILC2, ILC3, and NK cells.

[0053] The present invention also relates to the use of any treatment increasing NFIL3 expression or function for implementing a differentiation process, preferably in vitro or ex vivo, of hematopoietic precursors cells into innate lymphoid precursors cells and / or their innate lymphoid cells progeny. Many signaling pathways are described in the art to induce the expression ofNFIL3 ((Du et al. Jujuboside A improves cognitive deficiency in delirium through promoting hippocampal E4BP4 in mice - 2023), calcium signaling, cytokines, nutrients, hormones (Velmurugan et al. A minireview of E4BP4 / NFIL3 in heart failure - 2018)).

[0054] In some embodiment, the medium of the present invention contains an integrative retrovirus to force NFIL3 expression in hematopoietic precursors cells thought infection.

[0055] In some embodiment, the increase of the expression or function of the Nuclear Factor Interleukin 3 Regulated (NFIL3) can be achieved by directly forcing expression of an exogeneous NFIL3 or any transcription factor that play similar function, by any transduction or transfection method. Alternatively, it could be done by modulating expression of endogenous factors (eg. NFIL3 or cofactors) in any appropriate culture condition (eg. with pharmacological inhibitors).

[0056] In some embodiment, the hematopoietic precursors cells are transduced with a virus expressing the gene NFIL3. In a particular embodiment, the virus is a retrovirus.

[0057] In some embodiment, the function or biological activity of NFIL3 is total or partial.

[0058] Use of NFIL3 according to the invention

[0059] The present invention also relates to the use of a composition comprising Nuclear Factor Interleukin 3 Regulated (NFIL3) or synthetic or natural transcription factors of similar function for implementing a differentiation process, preferably in vitro or ex vivo, of hematopoietic precursors cells into innate lymphoid precursors cells and / or their innate lymphoid cells progeny.

[0060] In some embodiment, the transcription factors regulated by NFIL3 included but are not limited to Id2, Tox, Gata3 or to synthetic factor engineered to mimic NFIL3 function, such as factors derived of the CRISPR system.

[0061] In some embodiment, the present invention relates to the use of NFIL3 for generating a population of innate lymphoid precursors cells. In some embodiments, the population of innate lymphoid precursors cells and / or their innate lymphoid cells progeny was previously expanded in an appropriate culture medium before being cultured in the presence of the Nuclear factor, interleukin 3 regulated (NFIL3).

[0062] In some embodiments, the appropriate culture medium comprises IL-7 or Flt3-L, and SCF.

[0063] As used herein, the term "expansion" refers to growing cells in culture to achieve a larger population of the cells.

[0064] Population of innate lymphoid precursors cells of the present invention

[0065] The present invention also relates to a population of innate lymphoid precursors cells and / or their innate lymphoid cells progeny obtainable or directly obtained according to the method of the present invention.

[0066] The method of the present invention is particularly suitable for the preparation of large amounts of a population of innate lymphoid precursors cells which can be subsequently used e.g. for research or therapeutics applications.

[0067] The present invention also relates to a method of treatment comprising administering to a subject a therapeutically effective amount of a population of innate lymphoid precursors cells and / or and their innate lymphoid cells progeny obtainable or directly obtained according to the method of the present invention.

[0068] In some embodiment, the invention encompasses compositions comprising the innate lymphoid precursors cells and / or and their innate lymphoid cells progeny of the present invention for use to treat patients in need of innate immune system regulation, or any other regulation conferred by innate lymphoid cells (eg. tissue repair, homeostasis, metabolic regulation,... ). Thus, the invention encompasses the use of these compounds to treat patients and the methods for treating them.

[0069] In some embodiment, the patients have a helminth infection, enteric pathogen infection, tumor, viral infection, allergy, asthma, inflammation or autoimmune disease (e.g., multiple sclerosis, systemic lupus erythematosus, or type I diabetes mellitus).

[0070] In some embodiment, the patients can be immune deficient, immunocompromised, or immune suppressed. In various embodiments, the patient is a cancer patient or has a chronic disease (e.g. Crohn’s disease, IBD).

[0071] As used herein, the term “subject” refers to any mammals, such as a rodent, a feline, a canine, and a primate. Particularly, the subject according to the invention is a human. In some embodiments, the patient is an adult. In some embodiments, the subject is more than 15 years old. In some embodiments, the subject is more than 20 years old. In some embodiments, the subject is more than 25 years old. In some embodiments, the subject is more than 30 years old. In some embodiments, the subject is more than 35 years old. In some embodiments, the patient is an elderly.

[0072] As used herein, the terms “treating” or “treatment” refer to both prophylactic or preventive treatment as well as curative or disease modifying treatment, including treatment of subject at risk of contracting the disease or suspected to have contracted the disease as well as subject who are ill or have been diagnosed as suffering from a disease or medical condition, and includes suppression of clinical relapse. The treatment may be administered to a subject having a medical disorder or who ultimately may acquire the disorder, in order to prevent, cure, delay the onset of, reduce the severity of, or ameliorate one or more symptoms of a disorder or recurring disorder, or in order to prolong the survival of a subject beyond that expected in the absence of such treatment. By "therapeutic regimen" is meant the pattern of treatment of an illness, e.g., the pattern of dosing used during therapy. A therapeutic regimen may include an induction regimen and a maintenance regimen. The phrase "induction regimen" or "induction period" refers to a therapeutic regimen (or the portion of a therapeutic regimen) that is used for the initial treatment of a disease. The general goal of an induction regimen is to provide a high level of drug to a subject during the initial period of a treatment regimen. An induction regimen may employ (in part or in whole) a "loading regimen", which may include administering a greater dose of the drug than a physician would employ during a maintenance regimen, administering a drug more frequently than a physician would administer the drug during a maintenance regimen, or both. The phrase "maintenance regimen" or "maintenance period" refers to a therapeutic regimen (or the portion of a therapeutic regimen) that is used for the maintenance of a subject during treatment of an illness, e.g., to keep the subject in remission for long periods of time (months or years). A maintenance regimen may employ continuous therapy (e.g., administering a drug at regular intervals, e.g., weekly, monthly, yearly, etc.) or intermittent therapy (e.g., interrupted treatment, intermittent treatment, treatment at relapse, or treatment upon achievement of a particular predetermined criteria [e.g., pain, disease manifestation, etc.]).

[0073] As used herein the terms "administering" or "administration" refer to the act of injecting or otherwise physically delivering a substance as it exists outside the body (e.g., the cells of the present invention) into the subject, such as by, oral, intravenous, intramuscular, enteral, subcutaneous, parenteral, systemic, local, spinal, nasal, topical or epidermal administration (e.g., by injection or infusion). When a disease, or a symptom thereof, is being treated, administration of the substance typically occurs after the onset of the disease or symptoms thereof. When a disease or symptoms thereof, are being prevented, administration of the substance typically occurs before the onset of the disease or symptoms thereof.

[0074] A “therapeutically effective amount” is intended for a minimal amount of active agent which is necessary to impart therapeutic benefit to a subject. For example, a "therapeutically effective amount" to a subject is such an amount which induces, ameliorates or otherwise causes an improvement in the pathological symptoms, disease progression or physiological conditions associated with or resistance to succumbing to a disorder. It will be understood that the total daily usage of the compounds of the present invention will be decided by the attending physician within the scope of sound medical judgment. The specific therapeutically effective dose level for any particular subject will depend upon a variety of factors including the disorder being treated and the severity of the disorder; activity of the specific compound employed; the specific composition employed, the age, body weight, general health, sex and diet of the subject; the time of administration, route of administration, and rate of excretion of the specific compound employed; the duration of the treatment; drugs used in combination or coincidential with the specific compound employed; and like factors well known in the medical arts. For example, it is well within the skill of the art to start doses of the compound at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved. However, the daily dosage of the products may be varied over a wide range from 0.01 to 1,000 mg per adult per day. Typically, the compositions contain 0.01, 0.05, 0.1, 0.5, 1.0, 2.5, 5.0, 10.0, 15.0, 25.0, 50.0, 100, 250 and 500 mg of the active ingredient for the symptomatic adjustment of the dosage to the subject to be treated. A medicament typically contains from about 0.01 mg to about 500 mg of the active ingredient, preferably from 1 mg to about 100 mg of the active ingredient. An effective amount of the drug is ordinarily supplied at a dosage level from 0.0002 mg / kg to about 20 mg / kg of body weight per day, especially from about 0.001 mg / kg to 7 mg / kg of body weight per day.

[0075] As used herein, the terms “pharmaceutically acceptable excipient” refer to an excipient that does not produce an adverse, allergic or other untoward reaction when administered to an animal, preferably a human. It includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like. For human administration, preparations should meet sterility, pyrogenicity, general safety and purity standards as required by regulatory offices, such as, for example, FDA Office or EMA. In some embodiments, the hematopoietic precursors cells can be combined with appropriate factors to make them differentiate in vitro or in vivo, into a specific innate lymphoid precursors cells type (ILC1, ILC2 or ILC3), depending on the disease to be treated. In some embodiments, it may be beneficial to either augment or inhibit differentiation of the hematopoietic precursors cells of the present invention or to inhibit differentiation into a specific type, depending on the disease.

[0076] ILC subsets are involved in various diseases and cellular processes, including infections, cancer inflammation, tissue repair, and homeostasis. Tait Wojne et al, 2016, which is incorporated by reference herein. Since ILC3s promote GALT formation, inflammation, immunity, and homeostasis in the intestine (id.), ILC3s generated by the methods of the invention can be used to treat diseases involving these processes. Since ILC2s influence inflammation, immunity, tissue repair, and homeostasis through interactions with hematopoietic and nonhematopoietic cells (id.), ILC2s generated by the methods of the invention can be used to treat diseases involving these processes. Since ILCls express T-bet and IFN-y and contribute to type 1 inflammation (id.), ILCls generated by the methods of the invention can be used to treat diseases involving these processes.

[0077] The innate lymphoid precursors cells obtainable or directly obtained according to the method of the present invention can be administered to the patient by routine techniques in the art. Preferably, 104, 105, 106, 107, 108, 109, or IO10of innate lymphoid precursors cells of the present invention are administered to the patient.

[0078] Innate lymphoid precursors cells of the present invention can be administered to a subject, preferably a human, by direct injection into a tissue or blood, etc. Preferably, the cells of the present invention are administered in combination with a pharmaceutically acceptable carrier. The hematopoietic precursors cells of the present invention can be administered in a single or at least 2, 3, 4, 5, etc. injections. The hematopoietic precursors cells can be genetically modified to alter their immune recognition.

[0079] In some embodiment, the innate lymphoid precursors cells of the present invention can be used for adoptive cell transfer (ACT) therapy.

[0080] As used herein, the terms “adoptive cell transfer” (ACT) refer to the transfer of cells into a patient. The cells may have originated from the patient or from another individual. The cells are most commonly derived from the immune system with the goal of improving immune functionality and characteristics. In autologous cancer immunotherapy, T cells are extracted from the patient, genetically modified and cultured in vitro and returned to the same patient. Comparatively, allogeneic therapies involve cells isolated and expanded from a donor separate from the patient receiving the cells.

[0081] As used herein, the terms “adoptive cell therapeutic composition” refer to any composition comprising cells suitable for adoptive cell transfer.

[0082] In some embodiment, the adoptive cell therapy treatment is intended to reduce or eliminate cancer in the patient.

[0083] Screening methods using hematopoietic precursors cells

[0084] In some embodiment, the invention encompasses method for screening compounds that modulate the differentiation of the hematopoietic precursors cells into innate lymphoid precursors cells or the differentiation of innate lymphoid precursors cells into innate lymphoid cells.

[0085] In some embodiments, a population of hematopoietic precursors cells of the invention or a population of innate lymphoid precursors cells is contacted in vivo or in vitro with a test compound and the effect of the compound on differentiation is assessed. The effect can be observed by detecting a change in the phenotypes or function of the cells in the hematopoietic precursors cells population or in the innate lymphoid precursors cells population.

[0086] The test compound can be a natural compound or a synthetic compound. In some embodiments, the test compound is a viral, parasitic, microbial, or bacterial organism (e.g. HIV or malaria) or a component thereof (e.g., DNA or protein). In some embodiments, the test compound is a cytokine or mixture of cytokines.

[0087] In some embodiments, a change in the phenotypes or function of the cells in the hematopoietic precursor cells population is detected by measuring the levels of innate lymphoid precursors cells, ILC1, ILC2, ILC3, and / or NK cells in the hematopoietic precursors cells population before and after contact with the test compound. The phenotypes of the hematopoietic precursor cells can be detected as disclosed in the Examples and by similar techniques known to the skilled artisan. In some embodiments, the levels of ILCPs, ILC1, ILC2, ILC3, and / or NK cells after contact with the test compound is compared to an untreated innate lymphoid precursors cells control.

[0088] In one embodiment, the invention encompasses a method for screening compounds that affect the development of innate lymphoid cells and Natural Killer cells comprising providing a population of hematopoietic precursors cells of the present invention, contacting the cell population of the present invention with a test compound, and detecting a change in the phenotypes or function of the hematopoietic precursor cells of the present invention. In one embodiment, the invention encompasses a method for screening compounds that affect or module the ARN of the transcription factor NFIL3.

[0089] In some embodiments, the test compound causes a reduction in the differentiation of the hematopoietic precursor cells of the present invention or a reduction in the differentiation of the innate lymphoid precursors cells of the present invention. In some embodiments, the test compound causes an increase in the differentiation of the hematopoietic precursor cells of the present invention an increase in the differentiation of the innate lymphoid precursors cells of the present invention. In some embodiments, the test compound causes a reduction in the differentiation into a specific hematopoietic precursor cells subset of the present invention. In some embodiments, the test compound causes an increase in the differentiation into a specific hematopoietic precursor cells subset of the present invention. In some embodiments, the method comprises combining the hematopoietic precursors cells of the present invention or the innate lymphoid precursors cells of the present invention with a stimulus capable of differentiating them (e.g., OP9-DL4 culture system) and contacting the population of hematopoietic precursors cells of the present invention or the innate lymphoid precursors cells of the present invention with the test compound to determine the effect of the compound on differentiation. In other embodiments, the effect of the compound is determined in the absence of such a stimulus and / or with the addition of other compounds or stimuli (e.g. cytokines).

[0090] In some embodiments, the method comprises infusing a mouse with the population of hematopoietic precursors cells of the present invention or the population of innate lymphoid precursors cells of the present invention and administering the test compound to the mouse. Preferably, the mouse is a humanized mouse.

[0091] The invention will be further illustrated by the following figures and examples. However, these examples and figures should not be interpreted in any way as limiting the scope of the present invention.

[0092] FIGURES:

[0093] Figure 1: NFIL3 expression in ALP drives ILC development in vitro. A) Flow cytometric analysis of ALP isolated from Nfil3- / - Tcf7YFP / + and Nfil3+ / + Tcf7YFP / + littermate mice, transduced with GFP-retroviruses, either control or encoding for Nfil3, and cultured for 4 days. Macl-GFP+ cells are shown. B) Flow cytometric analysis of cells isolated from cultures as in a, and cultured for 4 additional days. control-GFP+ cells were isolated as Mac-1-GFP+, andNfil3-GFP+ cells were sorted as Mac-1-GFP+Tcf7-YFP+. C) Quantification of NK1.1+ and ICOShi ILC numbers from b. Data are presented as means ± s.d. for n = 3 wells per group. A two-tailed unpaired Student’s t-test was performed to determine significance (***P < 0.001, ****p < 0.0001). d,e RNA-seq analysis of Nfil3-induced Tcf7+ cells (NFIL3, n=3), control-transduced cells (GFP, n=3), and ex vivo ALP (n=7), sEILP (n=5), cEILP (n=6), and ILCP (n=3) isolated as previously 12. D) and E) Flow cytometric analysis of cells generated from ALP transduced with Thy 1.1 -retro viruses, either control or encoding for Nfil3, and cultured for the indicated number of days. Macl- Thy 1.1+ cells are shown. A,B,D,E: Numbers indicate the percentage of cells in each gate. All data are representative of three independent experiments. F) and G) ALP were isolated from Nfil3+ / +Tcf7YFP / +or Nfll3~ / ~Tcf7YFP / +mice, transduced with Thyl.1- retrovirus encoding for the indicated cDNA, and cultured for 4 days in the presence of 4-OHT (200uM) or vehicle (EtOH). Ctrl-transduced cells were sorted as MacL Thyl.l+, and A / z / 3-transduced cells were sorted as Macl" Thyl.l+YFP+. F) Cells were cultured for 4 additional days in absence of Et-OH or 4-OHT, and analyzed by flow cytometry. Macl" Thyl.1+cells are shown. Bottom, quantification of NK1.1+and ICOShlILC numbers. Data are presented as means ± s.d. for n = 3 wells per group. A 2-tailed unpaired Student’s t- test was performed to determine significance (**P < 0.01, ***P < 0.005, ****P < 0.001). G) Flow cytometric analysis of liver, gut, and spleen of NSG mice inoculated with in vitro generated ILC precursors (Nfil3-ER-T2-Thyl.l) or control (Ctrl-Thyl.l) cells. ALP were isolated from Nfll3+ / +Tcf7YFP / +or Nfll3p'Tcf7YFF / +mice, transduced with Thyl.l- retrovirus encoding for the indicated cDNA, and cultured for 4 days in the presence of 4-OHT (200uM) or vehicle (EtOH). Ctrl-transduced cells were sorted as Macl" Thy 1.1+, and A / z / 3-transduced cells were sorted as Macl" Thy 1.1+YFP+. 2000 sorted cells were injected into NSG mice. Liver, gut, and spleen were harvested and analyzed by flow cytometry after 3 months of reconstitution. Quantification of ILC subsets shown in Fig. S8E is presented as means ± s.e.m. for n = 5 mice per group, pooled from 2 independent experiments. A 2-tailed unpaired Student’s t-test was performed to determine significance (*P < 0.05).

[0094] Figure 2: NFIL3 promotes the generation of ILC in vitro and in vivo. A) and B) Flow cytometric analysis of cells generated from ALP transduced with A / z / 3-Thy 1.1 -retro virus and cultured for 10 days. Gated on Macl" Thyl.l+cells. A, NK1.1+cells and ICOShlcells are shown in boxes. B, brefeldin A was added for the last 4h of culture, with (black histogram) or without (grey shaded histogram) PMA (50ng / mL) and ionomycin (500ng / mL). For IL-5 production, cells were cultured on OP9-D11 in the presence of mouse IL-25 (50ng / mL) and mouse IL-33 (50ng / mL) for the last 72h. The top row shows ICOShlcells and the bottom row shows NK1.1+cells. A,B, Data are representative of 3 independent experiments. C) and D) Flow cytometric analysis of liver harvested from NSG mice injected with cells derived from ALP transduced with control-GFP or Nfil3-GFP retroviruses. ALP isolated from Tcf7YFP / + mice were transduced and cultured for 4 days. Control-GFP+ were isolated by flow cytometric sorting as Mac-l-CDllc-GFP+ cells, Nfil3-GFP+ as Mac-l-CDl lc-GFP+YFP+ cells. Each NSG mouse was injected with 2000 cells and analyzed 4 weeks after. A: Experimental scheme. B: Experimental result. An untouched NSG mouse is shown as control (ctrl). Analysis on NSG mice shows CD45.1 - cells (top two rows). CD45.2+ cells from liver harvested from an C57BL / 6 mouse are shown for comparison (bottom row). Data are representative of 4 mice from two independent experiments. Numbers indicate the percentage of cells in each gate. Arrows show successive gating.

[0095] Figure 3. NFIL3 function in ILC specification from FL ALP. A) Left, flow cytometric analysis of ALP isolated from Tcf7> FFFL (E15.5 to E18.5), transduced with GFP- retroviruses, either control or encoding Nfll3, and cultured for 4 days. GFP+cells are shown. Right, quantification of Mac-LYFP+cell frequency. Data are presented as means ± s.d. for n = 4 FL pooled from 2 independent experiments. A 2-tailed unpaired Student’s t-test was performed to determine significance (*P < 0.05). B) and C) Flow cytometric analysis of cells generated from FL ALP (El 8.5) transduced with A / z / 3-Thy 1.1 -retro virus and cultured for 10 days. Gated on MacL Thyl.l+cells. (C) Brefeldin A (lOug / mL) was added for the last 4h of culture, with or without Phorbol-12-myristate-13-acetate (50ng / mL) and ionomycin (500ng / mL) (PMA iono). Gated on either NK1.1+or ICOShlcells as shown is C. (B, C) Numbers indicate the percentage of cells in each gate. All data are representative of 3 independent experiments.

[0096] EXAMPLE:

[0097] Material & Methods

[0098] Mice

[0099] B6-Ly5.2 (CD45.1) and NOD scid gamma deficient (NSG) mice were obtained from the Jackson Laboratory. Nfil3F~ (ref42), Tcf7EGFP(ref.11), Tcf7YFP(ref.7) mice have previously been described. The mice used were 8-10 weeks old and of either sex. Animal procedures were approved by the relevant Ethical Committee (Comite d’Ethique en matiere d’ experimentation animale des Pays de la Loire, Direction Departementale de Protection des Populations, APAFIS #21254; and National Institutes of Health Animal Care and Use Committee).

[0100] Antibodies and flow cytometry BM cell suspensions were incubated with a mix of purified rat, mouse and hamster immunoglobulin G (IgG) before the addition of specific antibodies. Antibodies specific for B220 (RA3-6B3), CD19 (1D3), Mac-1 (MI / 70), Gr-1 (8C5), CDl lc (N418), Teri 19 (TERI 19), NK1.1 (PK136), CD3e (2C11), CD8a (53-6.72), CD8 (H35-17.2), CD4 (GK1.5), TCR (H57), TCRy6 (GL-3), Kit (2B8), Thy 1.2 (53-2.1), a4 7 (DATK32), IL-7Ra (A7R34), Flt3 (A2F10), ICOS (C398.4 A and 7E.17G9), 2B4 (eBio244F4), CD25 (PC61.5), CD45.2 (104), Thyl.l (HIS51), NKP46 (29A1.4), DX5 (DX5), TNF-a (MP9-XT22), IFN-y (XMG1.2, IL-13 (eBiol3A), IL-5 (TRFK5), IL-22 (IL22JOP), IL-17A (eBiol7B7), RORyt (AFKJS-9), T-BET (4B10), TOX (TXRX10), PLZF (Mags.21F7), GATA-3 (TWAJ), and NFIL3 (S2M- E19) were from eBioscience; Antibodies specific for CD122 (TM-pi), Ly-6D (49-H4), VLA1 (HMal) were from BioLegend; anti-Flt3 (A2F10) was from BD Biosciences; and anti-TCF-1 (C63D9) was from Cell Signaling. The lineage ‘cocktail’ (Lin) is a mix of the following antibodies: anti-Ly-6D, B220, CD19, Mac-1, Gr-1, CDl lc, Terll9, NK1.1, CD3e, CD8a, CD8P, CD4, TCRP and TCRy6. PLZF, GATA-3, RORyt, and TCF-1 expressions were detected by intracellular staining using eBioscience’s transcription factor staining buffer set according to the manufacturer’s instructions. TNF-a, IFN-y, IL-13, IL-5, IL-22, and IL-17A expressions were detected by intracellular staining in permeabilization buffer (eBioscience), following fixation with 2% paraformaldehyde. Live / dead discrimination was performed by staining with DAPI or LIVE / DEAD Fixable Blue (Invitrogen). Samples were acquired using an LSRFortessa, a Symphony, or a CANTOII flow cytometer (BD Biosciences) and analyzed using FlowJo software (BD Biosciences). All analyses are presented on singlet live cells. GFP / YFP separation was achieved using the filters 509 / 21, 505LP and 530 / 30, 525LP. Cells were sorted using an Aria flow cytometer (BD Biosciences).

[0101] Retroviral constructs

[0102] Icnl-GFP21 and Gata3-GFP38 (Addgene plasmid #34836) have been described. Additional GFP- retroviral vectors were built by inserting the indicated mouse cDNA (cloned in house) in the poly-linker of MigRl (Addgene plasmid #27490). ctrl-GFP correspond to MigRl. Thyl.l- retroviral vectors were built by inserting the corresponding mouse cDNA followed by P2A (from Addgene plasmid #74056) and Thyl.l (from Addgene plasmid #17442), between the restriction sites EcoRI and Agel of an MSCV backbone (from Addgene plasmid #52114). Nfil3 mouse cDNA was cloned in house, Batf and Batl3 mouse cDNAs were purchased from Addgene (plasmids #34575 and #139837 respectively). Ctrl-Thyl.l correspond to MSCV IRES-Thyl.l (from Addgene plasmid #17442). For Nfll3-ER-T2-r\xy 1.1 , the sequence encoding for the ER-T2 (from Addgene plasmid #87693), was inserted in C-term of Nfil3 after the linker GGGAGCGGAGGAGGTTCCGGTGGAGGTGGTTCTGGA (SEQ ID NO: 1). For Nfil3-HA-L y 1.1, the sequence TACCCATACGATGTTCCAGATTACGCT (SEQ ID NO:2) encoding for the canonical HA-tag was inserted in C-term of Nfll3 after the same 36 base pair linker as for ER-T2 tag.

[0103] ALP isolation, transduction, and culture

[0104] For culture experiments, Lin Thyl.2'YFP'Kit+Flt3hlIL-7Ra+ALPs were isolated by flow cytometric sort from Lin-depleted BM cells of TcYFPmice, as previously described44. ALPs were transduced and cultured on irradiated OP9 stromal layers in a-MEM media supplemented with 5% fetal bovine serum, glutamine, penicillin and streptomycin. All cultures were supplemented with mouse stem cell factor, mouse Flt3-ligand and mouse IL-7 at 30 ng.ml-1 unless indicated otherwise. For transduction, retroviral supernatant and polybrene (4 ng.ml-1 , Sigma- Aldrich) were added to the cells, and centrifuged for 2 hours at 32°C, 2000rpm. To ensure the reproducibility of the results, we used an infection rate of less than 37%, so that transduced cells would only express one copy of the transgene (Poisson distribution)52. All cytokines were purchased from PeproTech. Phorbol-12-myristate-13-acetate (PMA), ionomycin, and brefeldin A were purchased from Sigma- Aldrich. CD45.2+cells were considered for analysis of ALP progeny. Because ALP generate a large proportion of myeloid cells that can mask their other differentiation potential9, most results are displayed after gating on Mac- 1 cells. Quantifications of cell numbers following culture of rare precursors was done as following. The number of cells in the starting population was calculated from the number of cells counted by the cell sorter, corrected for the error rate experimentally determined for each sorter. The number of cells after culture was calculated from the number of cells analyzed by flow cytometry, corrected for the loss during cell staining and analysis, as experimentally determined for each experiment. Quantification of progeny of transduced cells 4 days after transduction (Data not shown) was estimated by considering that the frequency of transduced ALP measured at day 2 (when expression of the reporter was optimal) was similar to the one at day 0. qPCR and RNA-seq

[0105] RNA was extracted by RNeasy Plus Micro Kits (Qiagen) according to the manufacturer’s instructions. Quality control was performed by bioanalyzer (Agilent), and RNA samples with a RNA integrity number of >9 were subsequently used. For qPCR, RNA was reverse transcribed to cDNA, using SuperScript II Kit (Invitrogen). Real-time PCR was performed using pre-made Taqman PCR Master Mix and probes specific for indicated transcripts (Applied Biosystems) and analyzed on a StepOnePlus Real-Time PCR system (Applied Biosystems). Relative transcript abundance was determined using the AACt method after normalization to Gapdh. Previously generated RNA-sequencing data7were reanalyzed along with additional RNA-sequencing data generated using the same protocol: messenger RNA-Seq libraries were prepared using a SMARTer Ultra Low Input RNA Kit version 3 (Clontech) andNexteraXT DNA Library Preparation Kit (Illumina). Paired-end sequence reads of 126 base pairs were generated with a HiSeq 2500 sequencer (Illumina).

[0106] For samples prepared with the DNB™ technology, trimming was not needed.

[0107] Transcript quantification from raw FASTQ reads was performed using RSEM by alignment to the mouse genome (mm39) using STAR (2.7.10b) with Ensembl GTF (release 108). Further analysis for gene expression changes and statistics were realized using Limma- Voom45, with quantile normalization and batch correction using ComBat-Seq49. Genes with pval < 0.05 and absolute value of Log2 Fold Change > 1 were considered statistically significant. Visualization was done using R (4.1.3)47.

[0108] CUT&RUN data generation

[0109] NFIL3 CUT&RUN was performed with the CUT ANA ChIC / CUT&RUN Kit Version 3 (EpiCypher), on nuclei from Thyl. l+Mac-T cells isolated from 2 days cultures of Nfll3- transduced ALP. 38000 ILC precursors generated with Nfll3-HA- xy\A retrovirus were used to obtain NFIL3 specific binding, and 27000 ILC precursors generated with A / iG-Thy 1. 1 were used to control for background with the anti-HA. Both cell samples were split into two technical replicates, nuclei extraction was performed before proceeding to CUT&RUN. Incubation with the anti-HA antibody (Invitrogen SG77) was for 2 hours. Libraries were prepared from extracted DNA fragments using MGIEasy Universal DNA Library Prep Set. Sequence reads of 50 base pairs were sequenced by DNBSEQ-G400 (MGI).

[0110] CUT&RUN and ChlP-seq analysis

[0111] Newly generated and publicly available datasets25were analyzed. Duplicates raw FATSQ reads were removed using Clumpify (BBMap 39.00)43, and adapter sequences and low- quality reads were removed using Trimmomatic (0.39)44. The remaining reads were aligned to mouse genome (mm39) using Bowtie2 (2.5. 1)45using previously described parameters66. Reads mapped with a MAPQ score<10 were filtered out using Samtools (2.23.5). Peak calling was done using HOMER (4.11)63-style factor default parameters, with untagged NFIL3 sample as input control. For reanalyzed CUT&RUN data, available IgG samples were used as input control. Reanalyzed ChlP-seq data were processed without input, as it was not available. Motif enrichment analysis and peak annotation to the nearest transcription start site (TSS) was performed using HOMER (4.11)63. This annotation identified 94 binding sites located in close proximity to the promoters of 49 out of the 102 NFIL3 candidate gene targets. 24 additional NFIL3 peaks initially assigned to other genes whose promoter was closer or to long non-coding RNA of unknown functions were manually re-assigned to NFIL3 candidate gene targets when justified (eg. peaks located in gene body or in known regulatory elements). Locations of all NFIL3 binding of potential interests are described in Table S3. Mapped reads were converted in bigwig files for visualization using Deeptools (3.5.0) with RPKM normalization method, and used for heatmap representation generated by Bedtools (2.30.0). UCSC tracks and NFIL3 known motifs genome wide were generated with HOMER (4. I l)63makeUCSCfile and scanMotifGenomeWide functions using default parameters.

[0112] DNase-seq and ChIC-seq analysis

[0113] DNase-seq analysis. DNase-seq data froml4 were reanalyzed. Duplicates raw FATSQ reads were removed using Clumpify40 (BBMap 39.00), and adapter sequences and low-quality reads were removed using Trimmomatic41 (0.39). The remaining reads were aligned to mouse genome (mm39) using Bowtie242 (2.5.1), and peak calling was performed with MACS243 (2.2.7.1). Differential peaks and variation patterns were identified using DiffBind44 (3.4.11) with FDR threshold set to 0.25, and motif enrichment analysis was performed using HOMER45 (4.11). Mapped reads were converted in bigwig files for visualization using Deeptools (3.5.0) with RPKM normalization method, and used for heatmap representation generated by Bedtools (2.30.0). UCSC tracks were generated from mapped reads using HOMER (4. Il)48makeUCSCfile function with default parameters.

[0114] Statistics

[0115] Statistical analysis was performed on groups with limited variance using Excel or Prism. Differences between groups of mice or wells were determined by two-tailed unpaired Student’s t-test calculated with Prism or Excel. Differences of gene expression between RNA-sequencing samples were determined by moderated t-test using Limma-Voom45. P < 0.05 was considered significant. Sample sizes were empirically determined. No samples or animals were excluded from the analysis, and no randomization or blinding was used. Data availability scRNAseq and RNAseq data, both newly generated or reanalyzed from6, as well as CUT&RUN data generated in the current study are available in the Gene Expression Omnibus database with the accession number GSE291077, using the token evkfcoeqjfcrxgl. Previously generated RNA-seq data (GSE113767)6, DNase-seq data (GSE128483)6, ChlP-seq data (GSE59486)63and CUT&RUN data (GSE188579)25were also reanalyzed in this work. All code is available on GitHub : https: / / github.com / JosephLeger / NFIL3_dev_ILC.

[0116] Results

[0117] NFIL3 is required for ILC development in BM

[0118] Transcription factors that drive lineage specification have been proposed to confer de novo chromatin accessibility, enabling activation of lineage specific programs28'30(eg. EBF1 in B cells, TCF-1 in T cells). We thus investigated changes in chromatin accessibility at the earliest step of ILC development in the adult BM, using publically available DNAse-seq datasets6. We identified 3436 regions that significantly opened from ALP to the early innate lymphoid progenitors (EILPs) (Data not shown defined by expression of TCF-1 (Tcf7)3. These regions were split into three categories depending on the chromatin configuration at the later ILC precursor (ILCPs) stage defined by expression of PLZF (Zbtbl6)7(Data not shown and a motif enrichment analysis was performed on each of the category, in order to identify epigenetic candidate regulators. Regions that were stably or progressively opening, partly overlapped with previously analyzed regions18, and were not enriched with novel motifs of interests (not shown). On the other hand, regions that transiently opened at EILP stage were not previously examined. These regions presented motif enrichments for transcription factors of the ETS, RUNX and IRF families, which are important during hematopoiesis and not specifically for early ILC development (Data not shown}. Additionally, these regions showed enrichment for binding motifs shared by the transcription factors of the bZIP family, and motifs specific for the factors of the prolin and acidic amino-acid-rich (PAR) bZIP subfamily investigate which of these factors may drive chromatin opening during ILC specification, we investigated their expression by RNA-sequencing (RNA-seq) analysis at the known stages of ILC development, namely multipotential ALP, EILP, and ILC lineage-committed ILCP. To focus on initial steps of specification, EILP were separated into the early ILC-specified EILP (sEILP) and the later ILC-committed EILP (cEILP) stagel4 for this analysis. Only 4 bZIP factors were significantly upregulated from ALP to sEILP (fold change > 2, p.val < 0.05): Cebpa, Creb312, Batf3, and the PAR bZIP factor Nfil3 (Data not shown). A similar analysis was performed on the 642 regions that closed from ALP to EILP (Data not shown).

[0119] Among the 4 bZIP factors of interest, only NFIL3 is known to play a role in ILC development in the adult mouse BM8'14. To better determine the precise stage of requirement for NFIL3 during ILC development, we quantified all known ILC precursors in BM of Nfll3- / ~ mice beginning with ALPs that are developmentally upstream of ILC-specified precursors 11. Because ALPs as initially defined5may include a fraction of a4p7+ ILC-specified precursors that express and require NFIL331, we used a refined definition of ALPs that better excludes such subsets, as previously described6. These ALPs were not significantly impacted by NFIL3 deficiency (Data not shown), whereas EILPs and ILCPs defined by expression of Tcf73, 4,6were greatly reduced or absent. (Data not shown). Because we defined ILC-specified precursors using a4p7 and this marker may not be properly expressed in Nfll3- / - mice (Data not shown)31, we also quantified EILPs and ILCPs using an alternative strategy as previously described4(Data not shown), and confirmed that ILC-specified precursors failed to develop in the absence of NFIL3. Our analysis demonstrates that NFIL3 is required for the development of all known BM ILC-specified precursors.

[0120] NFIL3 expression in ALP induces ILC-lineage cells in vitro

[0121] Because the lack of BM ILC-specified precursors in Nfll3- / - mice precluded the analysis of NFIL3 function, we alternatively investigated the effect of ectopically expressing NFIL3 in BM ALP, by using the MSCV retroviral system32. ALP isolated from TcfYFPmice were transduced with Nfil3-expressing or control retrovirus. After 2 days in culture on BM stromal layers in the presence of stem cell factor, Flt3-ligand and interleukin (IL)-7, ALP transduced with A / z / 3-expressing virus generated a population of Mac- l-7' / 7 cells, reaching about 30% of the cells after 3 days in culture (Data not shown). On the other hand, only about 1% of cells derived from ALP transduced with a control virus were Tcf7+(Data not shown) .

[0122] As Tcf7 is expressed by both T cell and ILC precursors, we compared the Tcf7+cells induced by NFIL3 with Tcf7+T cell precursors induced by retroviral expression of the constitutively active intracellular domain of Notchl (Icnl)33in ALP (Data not shown). Nfll3- and / rtZ-induced Tcf7 cells both expressed transcription factors that are shared between T- and ILC-lineage cells (Tcf7, Gata3, Hesl)(Data not shown). However, compared to Icnl- induced Tcf7+cells, Nfil3-induced Tcf7+cells lacked expression of key T cell and adaptive lymphocyte genes (pTa, Rag2, Ragl) (Data not shown) and consistently, did not generate Thyl.2hiCD25+ T-lineage cells22(Data not shown). On the other hand, A / 773-induced Tcf7+ cells highly expressed the ILC transcription factors Tox, Id2, and Zbtbl6 that are minimally expressed by T cell precursors (Data not shown .

[0123] We investigated whether the A / z / 3-induced Tcf7+cells are ILC-lineage cells by examining their expression of the cell surface markers NK1.1 and ICOS, which are expressed by cNK and helper ILC generated in culture 12. At day 2 after transduction with Nfil3- expressing virus, the Mac-1- progeny of ALP lacked NK1.1 or ICOS. At day 4, both markers were expressed on a small fraction of Tcf7+cells, but undetectable on Tcf7- cells (Data not shown . We further isolated separately the Mac-1- Tcf7+and Tcf7' cells obtained at day 4, and cultured them for 4 additional 116 days. Tcf7+cells gave rise to a large fraction of NK1.1+ cells and ICOShi cells, whereas Mac-1 -Tcf7- cells did not, similar to ALP transduced with a control virus (Data not shown). NFIL3 expression in ALP thus rapidly generates Tcf7+cells that express ILC transcription factors and that can give rise to cells that express the ILC markers NK1.1 and ICOS.

[0124] NFIL3 expression in ALP drives ILC development in vitro

[0125] We next asked whether NFIL3 promotes the generation of ILC-lineage cells by expanding ILC-specified cells that may be phenotypically similar to ALP, and be included in our input ALP sample. Indeed, although we isolated ALP as Thyl.2'7c 7-YFP‘ to exclude all known ILC-specified precursors and ILC (Data not shown), they consistently generated a small subset of Tcf7 cells (Data not shown), and further generated very small frequencies of NK1.1+and ICOShlcells when transduced with a control virus (Data not shown). We thus used ALP isolated from mice, which lack all known ILC-lineage cells in BM (Data not shown). These cells failed to generate Tcf7 cells when transduced with a control virus, however, transduction with a / 73-expressing retrovirus efficiently induced Tcf7 cells (Figure 1A). Furthermore, A / z / 3-induced Tcf7+cells generated NK1.1+and ICOShlILC-lineage cells in similar numbers, whether they were derived from Nfll3+ / +o Nfi.13^' ALP (Figures IB and 1C). These results indicate that NFIL3 does not promote the generation of ILC solely by expanding ILC-specified cells.

[0126] We alternatively examined whether NFIL3 promotes the generation of ILC-lineage cells by driving their development. We characterized the Tcf7 cells that arise from A / z / 3-transduced ALP at 4 days of culture, thus prior to upregulation of the ILC cell surface markers NK1.1 and ICOS (Data not shown), and we performed bulk RNA sequencing on them. We compared them with ctrl-transduced ALP and ex vivo isolated ILC precursors that describe the successive stages of ILC development, namely the upstream ALP, the ILC-specified EILP (sEILP), the ILC- committed EILP (cEILP), and the ILCP6. This analysis showed that A / lG-induced Tcp cells were transcriptionally closest to ILCP (Data not shown). Gene expression analysis of transcription factors variably expressed during ILC development6further confirmed that Nfil3- induced Tcf7 cells were transcriptionally distinct from ALP and control GFP-transduced ALP, and similar to the ILC-committed precursors cEILP and ILCP (Data not shown).

[0127] We characterized the populations derived from A / z / 3-transduced ALP at different time points of culture. As soon as two days after A / z / 3-transduction, about 30% of Mac-T cells expressed TCF-1 (Figure ID). Within TCF-1+cells, the frequency of cells that expressed the transcription factor PLZF (encoded by Zbtbl6) was initially very low, and gradually increased until reaching more than 50% at day four (Figure ID). At later time points, the frequency of TCF-1+PLZF+cells decreased, and the cells became largely TCF-1 PLZF" (Figure IE), which coincided with the appearance of the ILC cell surface markers NK1.1+and ICOShl(Data not shown). These expression changes were consistent with natural BM ILC development, proceeding through the previously characterized successive stages: the early TCF-1 PLZF' sEILP, the later ILC-committed precursors TCF-1+PLZF+cEILP and ILCP, and finally, NK1.1+or ICOShlILC that downregulated PLZF9,10’7. Our work thus indicates that NFIL3 expression in ALP triggers a developmental process that recapitulates in vitro the hallmarks of natural ILC development.

[0128] Transient NFIL3 activity drives ILC development

[0129] NFIL3 is transiently expressed during BM ILC development (Data not shown). We thus examined whether transient activity of NFIL3 was sufficient to drive ILC development from ALP in vitro. We generated a retroviral construct to ectopically express an NFIL3-ER-T2 fusion, which enabled the inducible and reversible control of NFIL3 activity53. Consistent with a constitutive trapping in the cytoplasm, NFIL3-ER-T2 was unable to drive ILC development from ALP (Data not shown). Addition of 4-hydroxy -tamoxifen (4-OHT) to the culture media, allowing NFIL3-ER-T2 to translocate to the nucleus, induced the development of ALP into Tcf7+cells within 4 days, similar to WT NFIL3 (Data not shown). These cells were further able to generate NK1.1+ad ICOShlILC in vitro after 4-OHT withdrawal, in numbers comparable to Tcp cells that constitutively expressed NFIL3 (Figure IF). NfllS^' ALP were equally able to generate ILC after transient activation of NFIL3-ER-T2 (Figure IF), indicating that the effect of NFIL3-ER-T2 did not rely on the activity of endogenous NFIL3. Finally, we examined whether the Tcp+cells generated upon 4-OHT treatment of ALP transduced with NFIL3-ER-T2 were able to give rise to ILC in vivo, after 4-OHT withdrawal. We inj ected Nfil3- induced Tcff cells or control -transduced cells into NSG mice, and analyzed ILC in liver, spleen, and gut after 14-15 weeks. Mice inoculated with A / z / 3-induced Tcf7 cells all had clear populations of ILC, whereas mice that received control-transduced cells had little to no ILC Figure 1G). Nfil3-induced Tcf7 cells generated similar numbers of ILC, whether they were originated from Nfll3+ / +or Nfil.3^ ALP Figure 1G). Our work thus supports that transient activity of NFIL3 is sufficient to trigger ILC development from ALP.

[0130] Role for other transcription factors in driving ILC development

[0131] Several transcription factors have been proposed to drive ILC generation in vitro, from populations that included hematopoietic precursors (ID2, GATA-3, BATF)11,23 ,24. We thus investigated whether their upregulation in ALP could induce ILC development similar to NFIL3. Like Nfll3, Gata3 and Id2 are upregulated at sEILP stage compared to ALP {Data not shown). However, their retroviral expression in ALP did not induce efficient ILC specification as assessed by upregulation of Tcf7 {Data not shown). Although Id2 expression induced a small subset of cells expressing some level of Tcf7 {Data not shown), it did not promote the generation of NK1.1+and ICOShlILC {Data not shown). Importantly, Id2 expression in ALP cultured in the presence of Notch ligand led to the generation of a CD44lowPLZF+cell subset {Data not shown), attesting that our L / 2-expressing retrovirus was functional6. Next, we investigated whether upregulation of BATF in ALP could induce ILC development similar to NFIL3. Although previous work found that Batf was upregulated in the heterogeneous aLP subset compared to lymphoid precursors24, our transcriptional profiling of highly purified ILC precursor subsets did not show a significant upregulation of / L / / / from ALP to sEILP {Data not shown). On the other hand, the related factor Batf 3 was weakly but significant upregulated from ALP to sEILP {Data not shown). However, neither transcription factor induced ILC specification when ectopically expressed in ALP {Data not shown). Ectopic expression of the transcription factors ID2 or TOX rescues some levels of ILC development in vivo from Nfil 3~ hematopoietic stem cells We investigated whether they were sufficient to induce ILC development in vitro in the context of NFIL3 deficiency. However, retroviral expression of neither ID2 nor TOX induced Tcf7 expression in Nfll3_ / _ALP in vitro {Data not shown). Recent work on type conventional dendritic cell development established that the key function of NFIL3 in this process is to repress expression of the transcription factor Zeb225. However, ILC still developed when this mechanism is abrogated25indicating that this mechanism could not explain NFIL3 function in ILC development. Furthermore, Zeb2 was not significantly downregulated from ALP to sEILP {Data not shown). Therefore, we did not find evidence that transcription factors other than NFIL3 are sufficient to drive ILC development from ALP in vitro.

[0132] NFIL3 promotes the generation of all adult ILC lineages in vitro

[0133] We characterized the NK1.1+cells and ICOShlcells generated from A / z / 3-transduced ALP. A large fraction of the ICOShlcells expressed higher level of CD25 and the transcription factor GAT A- 3 as compared to NK1.1+cells (Figure 2 A), and produced TNF-a and IL-13 when activated with PMA and ionomycin (Figure 2B). A subset of them additionally produced IL-5 when cultured in the presence of Notch ligand, IL-25 and IL-33 for three days before PMA and ionomycin stimulation (Figure 2B). These ICOShlcells thus largely corresponded to ILC226,27. Additionally, a small subset of ICOShlcells co-expressed the transcription factor RORyt and a4p7 (Figure 2 A) indicating they were ILC3. Consistently, a small fraction of ICOShlcells produced IL-17A when activated with PMA and ionomycin (Figure 2B)26. NK1.1+cells produced TNF-a and IFN-y when activated with PMA and ionomycin (Figure 2B). thus presenting the functional hallmarks of group 1 ILC26. To investigate whether these group 1 ILC corresponded to either cNK or helper ILC1, we injected A / z / 3-induced Tcf7 cells or control - GFP cells into NSG mice (Figure 2C). Control-GFP cells did not generate detectable progeny in liver at 4 weeks of reconstitution, whereas N / / 73-induced Tcf7+cells exclusively generated TCR NK1.1+NKP46+group 1 ILC that included DX5+cNK and VLA1+ILC1 (Figure 2D)26. Altogether, our data indicate that ectopic expression of NFIL3 in ALP drives the generation of all adult ILC, namely cNK, ILC1, ILC2, and ILC3.

[0134] NFIL3 plays similar function in adult and fetal ILC development

[0135] NFIL3 requirement during early ILC development in fetal liver (FL) was not investigated in detail. Consistent with previous observationsn, we found that TCF-l+ROR-yt+LTi-lineage cells were present in normal numbers in the FL of NFIL3 deficient El 8.5 embryos (Data not shown). These may account for the residual development of lymph nodes and Peyer’s patches observed in NFIL3 deficient mice11. However, TCF-l+ROR-yf non-LTi ILC precursors where reduced by more than 10-fold (Data not shown). NFIL3 thus plays a crucial function in ILC specification in FL.

[0136] We further examined the effect of forcing expression of NFIL3 in FL ALP in vitro. Similar to BM ALP, Mv / J-transduced FL ALP generated a population of 7 / 7-expressing cells by day 4 (Figure 3A). and upregulated expression of NK1.1 and ICOS at later time points (Figure 3B). ICOShlcells produced the ILC2 cytokines IL-5, IL-13 and TNF-a and the ILC3 cytokines IL-17A and IL-22 upon activation (Figure 3C). NK1.1+cells produced the cNK and ILC1 cytokines TNF-a and IFN-y (Figure 3C). Therefore, our results support that ectopic expression of NFIL3 in FL ALP in vitro drives the generation of all canonical ILC, namely cNK, ILC1, ILC2, and ILC3.

[0137] NFIL3 initiates ILC specification independently of TOX

[0138] We investigated NFIL3 mechanism of action during ILC development. We considered as NFIL3 candidate gene targets all genes that were regulated in the same direction downstream of NFIL3 in vitro and in vivo (Data not shown . 72 upregulated candidates were strongly enriched for genes involved in lymphocyte development and function (Data not shown , such as Tox, Tcf7, or Gata3 (Data not shown}. 30 downregulated genes did not appear enriched for relevant pathways (Data not shown}, but included genes whose loss is associated with lymphocyte development, such as IrfiS or Lmo2 (Data not shown}.

[0139] We predicted that TOX, induced by NFIL3, may mediate part of NFIL3 function, possibly by regulating the key transcriptional controllers Id2, Gata3, Tcf7, and Zbtbl6 (Data not shown}. To investigate which NFIL3 candidate gene targets were in fact regulated by TOX, we examined their expression in Tbx-deficient ILC-specified precursors compared to WT precursors using our scRNAseq data. We found that most genes whose expression is regulated very early during ILC development were still regulated in the absence of TOX. Some of these genes, such as Gata3 and Id2 (Data not shown), Htra3, or Nrgn (Data not shown), appeared properly regulated in the absence of TOX, whereas others, such as Ccl5 or Tnfrsfi) (Data not shown), showed an initial upregulated expression that may fail to be maintained in the absence of TOX. The induction of some later ILC genes such as Tcfi7 and Zbtbl6 was delayed (Data not shown), suggesting TOX contributed to the upregulated expression. Finally, for genes that were expressed at later stages of ILC development (eg. Pdcdl, Cxcr5, Data not shown), TOX contribution was not possible to establish, because there was very few or no Tox-deficient ILC- specify precursors left at these developmental stages. To further investigate whether TOX was sufficient to regulate some NFIL3 candidate gene targets, we transduced WT ALP with Tox- expressing retrovirus, cultured them for 4 days, and analyzed them by RNA-seq. This analysis showed that, among NFIL3 candidate gene targets, TOX was only sufficient to regulate expression of Tcf7, Zbtbl6, Ccl5, and Tnfrsfi) in WT ALP, however, it failed to do so mNfil3~ / _ALP (Data not shown). We further found that forced expression of TOX in Nfil3 sufficient ALP induced a small but distinct subset of 7 / 7-expressing cells, which expressed lower level of Tcfi as compared to A / z / 3-induced 7 / 7-expressing cells (Data not shown). Altogether, our data indicate that NFIL3 initiates ILC-specification independently of TOX, including Id2 and Gata3 induction. Once expressed, TOX cooperates with NFIL3 to provide additional regulatory input to some of these genes, such as Tcf7, and Zbtbl6.

[0140] NFIL3 mechanism of action

[0141] To investigate whether NFIL3 might directly regulate its proposed gene targets, we defined its chromatin binding in ILC precursors. We generated an A / i / J-HA retroviral construct that could be specifically targeted with the anti -HA antibody (Data not shown) and was able to induce ILC specification similar to WT NFIL3 (Data not shown). We defined NFIL3 binding genome-wide in A / z / 3-HA-transduced ALP cultured for 2 days by CUT&RUN with an anti- HA, using ALP transduced with the untagged Nfll3 as negative control. Peak calling identified 17572 NFIL3 binding sites (Data not shown), most enriched for an NFIL3 known motif, and for a de novo PAR bZIP recognized by NFIL3 (Data not shown)' NFIL3 binding was detected at several relevant locations established in other cell types, such as the Perl59, Per26". and Per3Mpromoters and the Zeb2 enhancer62(Data not shown). However, NFIL3 binding was largely distinct in ILC precursors as compared to binding defined in other cell types (Data not shown)62’63.

[0142] In ILC precursors, NFIL3 peaks were mostly located in intergenic and intronic regions (Data not shown). They were not associated with significant overall changes in chromatin accessibility during ILC development, although DNase-seq showed a slightly higher signal in EILP as compared with ALP and ILCP (Data not shown). Consistent with a contribution in transiently opening chromatin at EILP stage, NFIL3 showed some binding to 102 of the 192 region we previously identified as transiently opened at EILP stage (Data not shown), although only 20 regions overlapped with clearly identified peaks (eg. Agr2, Pasp, Data not shown). NFIL3 binding sites were located in the vicinity of 10042 out of the 32621 experimentally validated genes coding for proteins, antisense RNA, and long non-coding RNA. Overall, these genes did not show significant expression changes downstream of NFIL3 (Data not shown), and neither did genes located in the vicinity of transiently opened region, whether they were bound or not by NFIL3 (Data not shown).

[0143] NFIL3 peaks were detected in the first intron of Tox, in the intronic enhancer of Zbtbl6M, and in a distal enhancer of Gata36(Data not shown). Overall, we identified 118 NFIL3 binding peaks located in the vicinity or known regulatory elements of 58 of the 102 NFIL3 candidate gene targets (Data not shown). NFIL3 likely regulates additional genes through unidentified distal regulatory elements (eg. Id2 putative enhancer, Data not shown) or through short-lived binding that can be challenging to document (eg. Tcf7 enhancer19, Data not shown . We further investigated the mechanism by which NFIL3 may regulate its gene targets. The 118 NFIL3 binding locations associated with the 58 identified gene targets were split into regions associated with repressed genes, and regions associated with activated genes. NFIL3 binding sites associated with downregulated genes (Data not shown were enriched for NFIL3 canonical PAR bZIP motif (Data not shown}, and were disproportionally located in intergenic and promoter regions (Data not shown}. Furthermore, chromatin accessibility of these regions decreased overall from EILP to ILCP stages (Data not shown}. NFIL3 binding sites associated with upregulated genes (Data not shown} were enriched for a bZIP motif associated with Fos or B ATF (Data not shown}, were predominantly located in intronic regions (Data not shown}, and showed overall chromatin opening from ALP to EILP stages (Data not shown}. Our results thus support that NFIL3 may both activate and repress gene expression using distinct mechanisms, and may regulate chromatin accessibility.

[0144] Discussion

[0145] In this study, we identified NFIL3 as a candidate epigenetic regulator of early ILC development, and investigated its precise function during BM ILC development in mouse. We showed that NFIL3 is required for the generation of all known BM ILC-specified precursors, thus establishing NFIL3 as the earliest requirement to date in ILC development, before the established requirement for the transcription factors TOX4’6’28, ID23, TCF-13’6’17, and GATA- 34, 16. By ectopically expressing NFIL3 in vitro in ALP, we further demonstrated that NFIL3 directly regulates the expression of many genes that are involved in ILC specification and triggers a developmental process that recapitulated normal BM ILC development, resulting in the generation of all adult ILC. We showed that, similar to its function in BM, NFIL3 is necessary and sufficient to drive ILC specification from FL ALP. Finally, we showed that NFIL3 initiate ILC specification independently of the downstream factor TOX, by directly regulating expression of many gene targets. We thus propose that expression of NFIL3 in ALP directs ILC-specification and drives ILC development in BM and FL.

[0146] Several transcription factors had been proposed to induce ILC development in vitro (ID2, GATA-3, BATF)11’23’24However this proposed key role was not consistent with the non essential function of each of these factors in ILC specification3’24’16’3^ Furthermore, the experimental settings used to establish roles for these factors may not have been adequate to assess bona fide ILC development in the BM. First, experiments investigating ID2 and BATF were performed under Notch signaling10’24, which is dispensable for BM ILC developmen35. Such setting perhaps replicated extramedulary environments that support the development of some minor subsets of ILC, such as the elusive thymic NK / ILC1 that may develop independently of NFIL3. Alternatively, such setting may drive development of T cell precursors that could not be distinguished from ILC according to the read out used. Second, ILC-lineage cells were not excluded from starting populations, and cytokines that very efficiently promote ILC expansion in vitro31’38were used to assess roles for GATA-3 and BATF23’24. It is thus possible that these studies might have evidenced roles for the tested factors in ILC expansion rather than development.

[0147] In the present study, we focused on the analysis of ILC development in BM. We excluded the contribution of rare ILC-specified BM precursors by systematically using Tcf7- YFP’Thy 1.2’ ALP as starting population, and culture conditions that do not specifically promote expansion of ILC-lineage cells. In these stringent conditions, we found no evidence for ILC specification being induced by transcription factors other than NFIL3. Importantly, this key early requirement we establish concurs with previous reports that BM cell populations that included ILC precursors were reduced in number in Nfll3 deficient mice8-11,31. It is further consistent with the proposed role of NFIL3 upstream of TOX and ID210,11, and provides a tangible candidate for the putative basic leucine zipper transcription factor that dictate ILC- specific function of other transcription factors (eg. Bell lb)39. Our surprising finding that, in the absence of any instructive signal, NFIL3 expression in ALP is sufficient to trigger in vitro a developmental process that recapitulated natural BM ILC development, additionally place NFIL3 as an apex controler of ILC specification.

[0148] Transcription factors that drive lineage specification have been proposed to confer de novo chromatin accessibility, enabling activation of lineage specific programs28'30(eg. EBF1 in B cells6, TCF-1 in T cells). Consistently, NFIL3 binding motif was enriched in chromatin regions that become accessible during early ILC specification, and NFIL3 ectopic epression was rapidely followed by upregulation of ILC-lineage genes. Future work will decipher the precise mechanism by which NFIL3 instructs ILC specification.

[0149] We further explored NFIL3 mechanism of action during ILC development. We found that, beyond triggering a regulatory network that underlies ILC specification, NFIL3 is directly involved in the regulation of many genes. We identified 102 robust candidate gene targets that are regulated downstream of NFIL3 both in vitro and in vivo. Among these, 58 genes were physically bound by NFIL3 in their vicinity or in known distal regulatory elements. Additional genes are also most likely regulated by NFIL3 through binding to unidentified distal regulatory elements or through short-lived interactions (eg. Id2, Tcf7). Consistent with previous reports, our results support that NFIL3 can be involved in both gene activation10’11and gene repression62. Analysis of NFIL3 binding modalities further indicated that NFIL3 may use distinct mechanisms to regulate its gene targets. Distinct DNA motifs were enriched in the vicinity of activated and repressed genes, implying that NFIL3 may interact with several bZIP partners, resulting in bZIP dimers that might recognize specific DNA motifs and mediate distinct regulatory mechanisms34. Our data further indicate that NFIL3 might contribute to regulating chromatin accessibility. Finally, we found that NFIL3 binding in ILC was largely distinct from its binding in closely related cDCl precursors that also require NFIL350, indicating that NFIL3 function is context-dependent.

[0150] Interestingly, although we show that ILC precursors are absent from the BM of NfllS^' mice, the development of some subsets of tissue-resident NK cells appears unaffected by NFIL3 deficiency (for review, see12). Our work thus clarifies the debated origin of this lineage55,56by establishing that tissue-resident NK develop independently of canonical BM ILC precursors. Similarly, although we confirmed previous results showing that ILC precursors are greatly reduced or absent in Nfll3 FL11, we found that LTi are minimally affected. This result explains why lymph nodes, Peyer’s patches, and crypto patches still develop in NfllS^' mice8,9. It further supports that LTi diverge from other ILC very early during ontogeny56, and may not share a common progenitor with canonical helper ILC beyond ALP stage.

[0151] In summary, our work establishes that NFIL3 is both necessary in vivo and sufficient in vitro to trigger specification of canonical ILC from multipotential lymphoid progenitors, notably by inducing expression of a network of key transcriptional controllers of ILC development. These observations place NFIL3 as an apex controller of ILC specification.

[0152] REFERENCES:

[0153] Throughout this application, various references describe the state of the art to which this invention pertains. The disclosures of these references are hereby incorporated by reference into the present disclosure.

[0154] 1. Jacquelot, N., Seillet, C., Vivier, E. & Belz, G. T. Innate lymphoid cells and cancer. Nat Immunol 23, 371-379 (2022).

[0155] 2. Kogame, T., Egawa, G., Nomura, T. & Kabashima, K. Waves of layered immunity over innate lymphoid cells. Frontiers in Immunology 13, (2022).

[0156] 3. Yang, Q. et al. TCF-1 upregulation identifies early innate lymphoid progenitors in the bone marrow. Nat Immunol 16, 1044-1050 (2015). 4. Harly, C., Cam, M., Kaye, J. & Bhandoola, A. Development and differentiation of early innate lymphoid progenitors. J Exp Med 215, 249-262 (2018).

[0157] 5. Inlay, M. A. et al. Ly6d marks the earliest stage of B-cell specification 343 and identifies the branchpoint between B-cell and T-cell development. Genes Dev 23, 2376-2381 (2009).

[0158] 6. Harly, C. et al. The transcription factor TCF-1 enforces commitment to the innate lymphoid cell lineage. Nat Immunol 20, 1150-1160 (2019).

[0159] 7. Constantinides, M. G., McDonald, B. D., Verhoef, P. A. & Bendelac, A. A committed precursor to innate lymphoid cells. Nature 508, 397-401 (2014).

[0160] 8. Geiger, T. L. et al. Nfil3 is crucial for development of innate lymphoid cells and host protection against intestinal pathogens. J Exp Med 211, 1723-1731 (2014).

[0161] 9. Seillet, C. et al. Nfil3 is required for the development of all innate lymphoid cell subsets. J Exp Med 211, 1733-1740 (2014).

[0162] 10. Yu, X. et al. The basic leucine zipper transcription factor NFIL3 directs the development of a common innate lymphoid cell precursor. Elife 3, (2014).

[0163] 11. Xu, W. et al. NFIL3 orchestrates the emergence of common helper innate lymphoid cell precursors. Cell Rep 10, 2043-2054 (2015).

[0164] 12. Das, A., Harly, C., Ding, Y. & Bhandoola, A. ILC Differentiation from Progenitors in the Bone Marrow. Adv Exp Med Biol 1365, 7-24 (2022).

[0165] 13. Klose, C. S. N. et al. Differentiation of type 1 ILCs from a common progenitor to all helper like innate lymphoid cell lineages. Cell 157, 340-356 (2014).

[0166] 14. Kobayashi, T. et al. NFIL3-deficient mice develop microbiota-dependent, IL-12 / 23-driven spontaneous colitis. J Immunol 192, 1918-1927 (2014).

[0167] 15. Seehus, C. R. et al. The development of innate lymphoid cells requires TOX-dependent generation of a common innate lymphoid cell progenitor. Nat Immunol 16, 599-608 (2015).

[0168] 16. Zhong, C. et al. Differential Expression of the Transcription Factor GAT A3 Specifies Lineage and Functions of Innate Lymphoid Cells. Immunity 52, 83-95. e4 (2020).

[0169] 17. Jeevan-Raj, B. et al. The Transcription Factor Tcfl Contributes to Normal NK Cell Development and Function by Limiting the Expression of Granzymes. Cell Reports 20, 613 626 (2017).

[0170] 18. Ren, G. et al. Transcription factors TCF-1 and GAT A3 are key factors for the epigenetic priming of early innate lymphoid progenitors toward distinct cell fates. Immunity 55, 1402- 1413. e4 (2022).

[0171] 19. Harly, C. et al. A Shared Regulatory Element Controls the Initiation of Tcf7 Expression During Early T Cell and Innate Lymphoid Cell Developments. Front Immunol 11, 470 (2020). 20. Miyazaki, M. et al. The E-Id Protein Axis Specifies Adaptive Lymphoid Cell Identity and Suppresses Thymic Innate Lymphoid Cell Development. Immunity 46, 818-834. e4 (2017).

[0172] 21. Wang, H.-C. etal. Downregulation of E Protein Activity Augments an ILC2 Differentiation Program in the Thymus. The Journal of Immunology 198, 3149-3156 (2017).

[0173] 22. Weber, B. N. et al. A critical role for TCF-1 in T-lineage specification and differentiation. Nature 476, 63-68 (2011).

[0174] 23. Tufa, D. M. et al. Transient Expression of GATA3 in Hematopoietic Stem Cells Facilitates Helper Innate Lymphoid Cell Differentiation. Front Immunol 10, 510 (2019).

[0175] 24. Liu, Q., Kim, M. H., Friesen, L. & Kim, C. H. BATF regulates innate lymphoid cell hematopoiesis and homeostasis. Science Immunology 5, (2020).

[0176] 25. Liu, T.-T. et al. Ablation of cDC2 development by triple mutations within the Zeb2 enhancer. Nature 1-7 (2022) doi:10.1038 / s41586-022-04866-z.

[0177] 26. Meininger, I. et al. Tissue-Specific Features of Innate Lymphoid Cells. Trends in Immunology 41, 902-917 (2020).

[0178] 27. Howard, E. et al. PD-1 Blockade on Tumor Microenvironment-Resident ILC2s Promotes TNF-a Production and Restricts Progression of Metastatic Melanoma. Frontiers in Immunology 12, (2021).

[0179] 28. Iwafuchi-Doi, M. & Zaret, K. S. Cell fate control by pioneer transcription factors. Development 143, 1833-1837 (2016).

[0180] 29. Johnson, J. L. et al. Lineage-Determining Transcription Factor TCF-1 Initiates the Epigenetic Identity of T Cells. Immunity 48, 243-257. elO (2018).

[0181] 30. Li, R. et al. Dynamic EBF1 occupancy directs sequential epigenetic and transcriptional events in B-cell programming. Genes Dev 32, 96-111 (2018).

[0182] 31. Seillet, C. et al. Deciphering the Innate Lymphoid Cell Transcriptional Program. Cell Rep 17, 436-447 (2016).

[0183] 32. Hawley, R. G., Lieu, F. H., Fong, A. Z. & Hawley, T. S. Versatile retroviral vectors for potential use in gene therapy. Gene Ther 1, 136-138 (1994).

[0184] 33. Pui, J. C. et al. Notchl Expression in Early Lymphopoiesis Influences 366 B versus T Lineage Determination. Immunity 11, 299-308 (1999).

[0185] 34. Miller, M. M. et al. BATF acts as an essential regulator of IL-25-responsive 388 migratory ILC2 cell fate and function. Science Immunology 5, (2020).

[0186] 35. Golub, R. The Notch signaling pathway involvement in innate lymphoid cell biology. Biomed J 44, 133-143 (2021). 36. Yang, Q. et al. T cell factor 1 is required for group 2 innate lymphoid cell generation. Immunity 38, 694-704 (2013).

[0187] 37. Hernandez, D. C. et al. An in vitro platform supports generation of human innate lymphoid cells from CD34+ hematopoietic progenitors that recapitulate ex vivo identity. Immunity 0, 396 (2021).

[0188] 38. Lim, A. I. et al. Systemic Human ILC Precursors Provide a Substrate for Tissue ILC Differentiation. Cell 168, 1086-1 lOO.elO (2017).

[0189] 39. Hosokawa, H. et al. Cell type-specific actions of Bell lb in early T-lineage and group 2 innate lymphoid cells. J Exp Med 217, (2020).

[0190] 40. Kashiwada, M. et al. IL-4-induced transcription factor NFIL3 / E4BP4 controls IgE class switching. Proc Natl Acad Sci U S A 107, 821-826 (2010).

[0191] 41. Hernandez-Hoyos, G., Anderson, M. K., Wang, C., Rothenberg, E. V. & Alberola-Ila, J. GATA-3 expression is controlled by TCR signals and regulates CD4 / CD8 differentiation. Immunity 19, 83-94 (2003).

[0192] 42. Kenney, D. & Harly, C. Purification of Bone Marrow Precursors to T Cells and ILCs. Methods Mol Biol 2580, 211-232 (2023).

[0193] 43. BBMap. SourceForge https: / / sourceforge.net / projects / bbmap / (2023).

[0194] 44. Bolger, A. M., Lohse, M. & Usadel, B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 30, 2114-2120 (2014).

[0195] 45. Langmead, B. & Salzberg, S. L. Fast gapped-read alignment with Bowtie 411 2. Nat Methods 9, 412 357-359 (2012).

[0196] 46. Zhang, Y. et al. Model-based analysis of ChlP-Seq (MACS). Genome Biol 9, R137 (2008).

[0197] 47. Stark, R. & Brown, G. DiffBind: Differential binding analysis of ChlP-Seq peak data.

[0198] 48. Heinz, S. et al. Simple combinations of lineage-determining transcription factors prime cis regulatory elements required for macrophage and B cell identities. Mol Cell 38, 576-589 (2010).

[0199] 49. Ritchie, M. E. et al. limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Research 43, e47 (2015).

[0200] 50. Zhang, Y., Parmigiani, G. & Johnson, W. E. ComBat-seq: batch effect adjustment for RNA seq count data. NAR Genom Bioinform 2, lqaa078 (2020).

[0201] 51. {R Core Team}. R: A Language and Environment for Statistical Computing. (2022).

[0202] 52. Dulbecco, R. & Vogt, M. PLAQUE FORMATION AND ISOLATION OF PURE LINES WITH POLIOMYELITIS VIRUSES. Journal of Experimental Medicine 99, 167-182 (1954). 53. Whitfield, J., Littlewood, T., Evan, G. I. & Soucek, L. The estrogen receptor fusion system in mouse models: a reversible switch. Cold Spring Harb Protoc 2015, 227-234 (2015).

[0203] 54. Rodriguez-Martinez, J. A., Reinke, A. W., Bhimsaria, D., Keating, A. E. & Ansari, A. Z. Combinatorial bZIP dimers display complex DNA-binding specificity landscapes. Elife 6, el 9272 (2017).

[0204] 55. Torcellan, T. et al. Circulating NK cells establish tissue residency upon acute infection of skin and mediate accelerated effector responses to secondary infection. Immunity 57, 124- 14O.e7 (2024).

[0205] 56. Sparano, C. et al. Autocrine TGF-pi drives tissue-specific differentiation and function of resident NK cells. Journal of Experimental Medicine 222, e20240930 (2024).

[0206] 57. Kasai, D. N. & Bendelac, A. Multi-transcription factor reporter mice delineate early precursors to the ILC and LTi lineages. J Exp Med 218, (2021).

[0207] 58. Chen, S., Lei, M., Liu, K. & Min, J. Structural basis for specific DNA sequence recognition by the transcription factor NFIL3. Journal of Biological Chemistry 300, 105776 (2024).

[0208] 59. Mitsui, S., Yamaguchi, S., Matsuo, T., Ishida, Y. & Okamura, H. Antagonistic role of E4BP4 and PAR proteins in the circadian oscillatory mechanism. Genes Dev 15, 995-1006 (2001).

[0209] 60. Ohno, T., Onishi, Y. & Ishida, N. A novel E4BP4 element drives circadian expression of mPeriod2. Nucleic Acids Res 35, 648-655 (2007).

[0210] 61. Takumi, T. et al. A light-independent oscillatory gene mPer3 in mouse SCN and OVLT. The EMBO Journal 17, 4753-4759 (1998).

[0211] 62. Liu, T.-T. et al. Ablation of cDC2 development by triple mutations within the Zeb2 enhancer. Nature 1-7 (2022) doi:10.1038 / s41586-022-04866-z.

[0212] 63. Fang, B. et al. Circadian enhancers coordinate multiple phases of rhythmic gene transcription in vivo. Cell 159, 1140-1152 (2014).

[0213] 64. Mao, A.-P., Ishizuka, I. E., Kasai, D. N., Mandal, M. & Bendelac, A. A shared Runxl- bound Zbtbl6 enhancer directs innate and innate-like lymphoid lineage development. Nat Commun 8, 863 (2017).

[0214] 65. Hosoya-Ohmura, S. et al. An NK and T Cell Enhancer Lies 280 Kilobase Pairs 3' to the Gata3 Structural Gene. Molecular and Cellular Biology 31, 1894-1904 (2011).

[0215] 66. Meers, M. P., Bryson, T. D., Henikoff, J. G. & Henikoff, S. Improved CUT&RUN chromatin profiling tools. eLife 8, e46314 (2019).

Claims

37CLAIMS:

1. An in vitro method for obtaining innate lymphoid precursors cells, said method comprising the step of i) culturing hematopoietic precursors cells in an appropriate culture medium, and ii) manipulating the said hematopoietic precursors cells to increase the expression or function of the Nuclear Factor Interleukin 3 Regulated (NFIL3).

2. The in vitro method of claim 1 wherein the hematopoietic precursors cells have been isolated, or partially purified, from bone marrow (BM) or from blood from GM-CSF treated patients or generated from iPSC or ESC.

3. The in vitro method of claim 1 wherein the innate lymphoid precursors cells are early innate lymphoid progenitors (EILP), or innate lymphoid cell precursors (ILCP).

4. The in vitro method of claim 1 wherein the innate lymphoid precursors cells are provided in a culture medium with irradiated OP9 stromal layers, or any other culture condition known to support innate lymphoid precursors cells survival and proliferation.

5. The in vitro method of claim 1 wherein the culture medium comprises an amount of at least one cytokine selected from Flt3-L, SCF and / or IL-7.

6. The in vitro method of claim 4 wherein the culture medium comprises 30 ng / ml of Flt3 - L, SCF, and IL-7.

7. The in vitro method of claim 1 wherein the duration of the culturing step is in the range of about 2 to 30 days.

8. A population of innate lymphoid precursors cells and / or their innate lymphoid cells progeny obtainable or directly obtained according to claims 1 to 7.

9. Use of a composition comprising Nuclear Factor Interleukin 3 Regulated (NFIL3) or synthetic or natural transcription factors of similar function for implementing a differentiation process, preferably in vitro or ex vivo, of hematopoietic precursors cells into innate lymphoid precursors cells and their innate lymphoid cells progeny.

10. Use of any treatment increasing NFIL3 expression or function for implementing a differentiation process, preferably in vitro or ex vivo, of hematopoietic precursors cells into innate lymphoid precursors cells and / or their innate lymphoid cells progeny.

11. Method of treatment comprising administering to a subject a therapeutically effective amount of a population of innate lymphoid precursors cells and / or and their innate lymphoid cells progeny obtainable or directly obtained according to the method of claims 1 to 7.

12. Method for screening compounds that modulate the differentiation of the hematopoietic precursors cells into innate lymphoid precursors cells or the differentiation of innate lymphoid precursors cells into innate lymphoid cells.

Images