Oligonucleotide for controlling liquid-liquid phase separation

Oligonucleotides with specific sequences regulate FUS LLPS and inhibit aggregation, offering a targeted therapeutic solution for ALS and FTLD by normalizing FUS localization and reducing RNA granules.

WO2026034442A1PCT designated stage Publication Date: 2026-02-12NAT UNIV CORP SHIGA UNIV OF MEDICAL SCI +7
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
PCT/JP2025/027573
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-08-05
Filing Date
2025-08-04
Publication Date
2026-02-12

AI Technical Summary

Technical Problem

Current treatments for neurodegenerative diseases such as ALS and FTLD, particularly those targeting FUS protein aggregates, are nonspecific and lack effective therapeutic methods to regulate liquid-liquid phase separation (LLPS) and inhibit FUS aggregation.

Method used

Development of oligonucleotides with specific base sequences that can regulate FUS LLPS, suppress RNA granule formation, and normalize cytoplasmic localization of FUS to its nuclear localization, thereby inhibiting FUS aggregation.

Benefits of technology

The oligonucleotides effectively transition FUS from a droplet to a solution state, reducing RNA granules and enhancing nuclear localization, providing a targeted therapeutic approach for ALS and FTLD.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure JPOXMLDOC01-APPB-C000001
    Figure JPOXMLDOC01-APPB-C000001
  • Figure JPOXMLDOC01-APPB-C000002
    Figure JPOXMLDOC01-APPB-C000002
  • Figure JPOXMLDOC01-APPB-T000003
    Figure JPOXMLDOC01-APPB-T000003
Patent Text Reader

Abstract

Disclosed is an oligonucleotide which is any of the following (a)-(c): (a) an oligonucleotide which comprises a base sequence represented by any of SEQ ID NOs: 1-5; (b) an oligonucleotide which has not less than 90% identity with a base sequence represented by any of SEQ ID NOs: 1-5, which can bind to FUS, and which has activity that normalizes one or more of FUS liquid-liquid phase separation, RNA granule formation, and FUS cytoplasmic localization; and (c) an oligonucleotide which comprises a base sequence obtained by deletion, substitution, insertion, and / or addition of 1-3 bases in a base sequence represented by any of SEQ ID NOs: 1-5, which can bind to FUS, and which has activity that normalizes one or more of FUS liquid-liquid phase separation, RNA granule formation, and FUS cytoplasmic localization. Also disclosed are an FUS aggregation inhibitor, a neuroprotective agent, and a pharmaceutical composition which each comprise said an oligonucleotide.
Need to check novelty before this filing date? Find Prior Art

Description

Oligonucleotides that control liquid-liquid phase separation

[0001] The present invention relates to an oligonucleotide, an FUS aggregation inhibitor, a neuronal protective agent, and a pharmaceutical composition each containing the oligonucleotide.

[0002] In recent years, the average life expectancy has been significantly extended, especially in developed countries. However, accompanying this, various functional declines, diseases, and pathologies caused by brain aging, which were not a problem in the past, have become major social issues, with dementia in particular being a major problem. Symptoms of dementia range widely, including memory impairment, visual impairment, speech impairment, problematic behavior, sleep disorders, and depression. Known brain degenerative diseases that cause dementia include Alzheimer's disease, frontotemporal lobar degeneration (FTLD), dementia with Lewy bodies, vascular dementia, progressive supranuclear palsy (PSP), and corticobasal degeneration (CBD).

[0003] Dementia due to FTLD is the second most common progressive dementia in Europe and the United States after Alzheimer's disease. A key feature of FTLD is the degeneration of the frontal and temporal lobes. Histopathological findings are classified into three types: frontal lobe degeneration, Pick's disease, and motor neuron disease. Symptoms include behavioral abnormalities due to higher brain dysfunction, such as personality disorders and social behavior disorders. However, the pathology of FTLD is highly complex, and research into diagnostic and therapeutic methods has not progressed sufficiently to date, so a fundamental treatment has not yet been established. FTLD is known to share a disease spectrum similar to amyotrophic lateral sclerosis (ALS). The present inventors have conducted research, focusing on the functional analysis of FUS (fused in sarcoma), a genetic and pathological factor common to these diseases. Patent Document 1, related to the present inventors' research, reports that increasing the protein SynGAPα2 present in the postsynaptic density is effective in treating FLTD. Furthermore, Patent Document 2 reports that 2'-O,4'-C-ethylene-bridged nucleic acid-modified antisense oligonucleotides that target a specific region within exon 10 of tau mRNA precursor or the adjacent intron 10 have a high ability to regulate tau splicing, making it possible to treat FLTD. Patent Document 3 reports antisense oligonucleotides that regulate the expression level of TDP-43, and their use as therapeutic agents for amyotrophic lateral sclerosis and frontotemporal dementia.

[0004] Liquid-liquid phase separation (LLPS) is a phenomenon in which certain polymers form membrane-free aggregates and organelles. Recent research has demonstrated a strong correlation between this phenomenon and the pathology of neurodegenerative diseases, including ALS. In particular, FUS, a causative gene for familial ALS and a pathogenic molecule involved in sporadic ALS and FTLD, is an RNA-binding protein primarily localized in the nucleus, and has been shown to be involved in pathology via LLPS. For example, LLPS reversibly transitions between a solution state and a liquid droplet state under various conditions, such as mutation, phosphorylation, and RNA concentration. When the liquid droplet state takes on an aggregated structure due to some change, it becomes energetically stable and irreversibly accumulates as aggregates. This is thought to be the cause of the aggregates observed within neurons in neurodegenerative diseases.

[0005] 1,6-hexanediol is a well-known drug that can control LLPS, but it is not suitable as a treatment because it affects a wide range of molecules nonspecifically. Furthermore, there have been reports of attempts to develop small molecules that target the LLPS of TDP-43, but these compounds are not specifically targeted to specific molecules.

[0006] Regarding the treatment of FLTD, Patent Document 4 reports that the FUS protein has an excellent preventive or therapeutic effect against FLTD, and therefore the FUS protein, a DNA molecule encoding the FUS protein, and / or a substance that promotes the production of the FUS protein are useful as a preventive or therapeutic agent for FLTD. Additionally, Patent Document 5 describes knocking down human RACK1 with an antisense oligonucleotide or the like for the treatment of FTLD.

[0007] International Publication No. 2018 / 012497 International Publication No. 2020 / 009151 International Publication No. 2019 / 013141 Japanese Patent No. 6959632 Japanese Patent Publication No. 2023-522622

[0008] An object of the present invention is to provide an oligonucleotide capable of regulating FUS LLPS, as well as a FUS aggregation inhibitor, a neuronal protective agent, and a pharmaceutical composition containing the oligonucleotide.

[0009] As a result of intensive research to achieve the above object, the inventors have designed oligonucleotides that can control the LLPS behavior of FUS from a droplet to a solution state, and have found that oligonucleotides with specific base sequences can suppress the liquid-liquid phase separation of mutant FUS, suppress the formation of RNA granules, and normalize the cytoplasmic localization of FUS to its nuclear localization. These results indicate that the above oligonucleotides can control the dynamics of LLPS and are applicable to the treatment of ALS and FTLD.

[0010] The present invention was completed based on these findings and through further investigation, and provides the following oligonucleotides, FUS aggregation inhibitors, neuronal protective agents, pharmaceutical compositions, etc.

[0011] Item 1. Any one of the following oligonucleotides (a) to (c): (a) an oligonucleotide consisting of a nucleotide sequence represented by any one of SEQ ID NOs: 1 to 5, (b) an oligonucleotide having 90% or more identity to a nucleotide sequence represented by any one of SEQ ID NOs: 1 to 5, capable of binding to FUS, and having activity to normalize one or more of liquid-liquid phase separation of FUS, RNA granule formation, and cytoplasmic localization of FUS, (c) an oligonucleotide consisting of a nucleotide sequence represented by any one of SEQ ID NOs: 1 to 5 in which 1 to 3 bases have been deleted, substituted, inserted, and / or added, and capable of binding to FUS, and having activity to normalize one or more of liquid-liquid phase separation of FUS, RNA granule formation, and cytoplasmic localization of FUS. Item 3. The oligonucleotide according to Item 1, which is any one of the following (a-1) to (c-1): (a-1) an oligonucleotide consisting of a base sequence represented by any one of SEQ ID NOs: 1 to 3, (b-1) an oligonucleotide which has 90% or more identity to a base sequence represented by any one of SEQ ID NOs: 1 to 3, which is capable of binding to FUS, and has the activity of normalizing one or more of liquid-liquid phase separation of FUS, RNA granule formation, and cytoplasmic localization of FUS, (c-1) an oligonucleotide consisting of a base sequence represented by any one of SEQ ID NOs: 1 to 3 in which 1 to 3 bases have been deleted, substituted, inserted, and / or added, which is capable of binding to FUS, and has the activity of normalizing one or more of liquid-liquid phase separation of FUS, RNA granule formation, and cytoplasmic localization of FUS. The oligonucleotide according to Item 1, which is any one of the following (a-2) to (c-2): (a-2) an oligonucleotide consisting of the base sequence represented by SEQ ID NO: 1; (b-2) an oligonucleotide which has 90% or more identity to the base sequence represented by SEQ ID NO: 1, is capable of binding to FUS, and has the activity of normalizing one or more of the liquid-liquid phase separation of FUS, RNA granule formation, and cytoplasmic localization of FUS; (c-2) an oligonucleotide consisting of the base sequence represented by SEQ ID NO: 1 in which one to two bases have been deleted, substituted, inserted, and / or added, and is capable of binding to FUS, and has the activity of normalizing one or more of the liquid-liquid phase separation of FUS, RNA granule formation, and cytoplasmic localization of FUS.Item 4. The oligonucleotide according to Item 1, which is an oligonucleotide consisting of the base sequence represented by SEQ ID NO: 1. Item 5. The oligonucleotide according to any one of Items 1 to 4, which comprises at least one modified nucleotide. Item 6. The oligonucleotide according to Item 5, which comprises at least one 2'-O,4'-C-ethylene-bridged nucleic acid as the modified nucleotide. Item 7. The oligonucleotide according to Item 4, in which the nucleotides at positions 1, 6, 8, 10, 12, and 17 in the base sequence represented by SEQ ID NO: 1 are 2'-O,4'-C-ethylene-bridged nucleic acids. Item 8. An FUS aggregation inhibitor comprising the oligonucleotide according to any one of Items 1 to 7. Item 9. A neuroprotective agent comprising the oligonucleotide according to any one of Items 1 to 7. Item 10. A pharmaceutical composition comprising the oligonucleotide according to any one of Items 1 to 7. Item 11. The pharmaceutical composition according to Item 10, which is used to treat or prevent amyotrophic lateral sclerosis or frontotemporal lobar degeneration. Item 12. Item 12. A method for treating or preventing amyotrophic lateral sclerosis or frontotemporal lobar degeneration, comprising the step of administering to a mammal an effective amount of the oligonucleotide according to any one of Items 1 to 7. Item 13. Use of the oligonucleotide according to any one of Items 1 to 7 in the manufacture of a pharmaceutical composition, FUS aggregation inhibitor, or neuronal protective agent for treating or preventing amyotrophic lateral sclerosis or frontotemporal lobar degeneration.

[0012] An oligonucleotide capable of regulating the LLPS of FUS is provided. This oligonucleotide can specifically regulate the LLPS transition state of FUS and inhibit RNA granule formation and cytoplasmic localization of FUS. Therefore, the oligonucleotide of the present invention can inhibit FUS aggregation and treat or prevent amyotrophic lateral sclerosis or frontotemporal lobar degeneration.

[0013] Figure 1 is a graph showing the turbidity (595 nM) when candidate nucleic acids (#1 to #15) were added to a purified FUS-R495X solution. The results are shown before addition (0 h), after addition (4 hours), and overnight (ON). (-) Ve Cont: control nucleic acid (randomized sequence), W / O Oligo: no oligonucleotide added. Figure 1 shows changes in the localization of FUS mutants when candidate nucleic acids were added to cultured motor neurons (NSC34 cells) expressing the FUS mutant (FUS-R495X). (a) Experimental schedule. (b) Graph showing the localization (nucleus / cytoplasm) of FUS mutants upon addition of candidate nucleic acids. W / O Oligo: no oligonucleotide added. Scheffe post hoc test compared with W / O Oligo; **<0.01 n=3. Figure 1 shows the ability of candidate nucleic acids to reduce RNA aggregates in cultured motor neurons (NSC34 cells) expressing a FUS mutant (FUS-R495X). (a) Fluorescence microscope images when each candidate nucleic acid was added, (b) a graph showing the average number of RNA aggregates per cell when the candidate nucleic acid was added, (c) a graph showing the average area of ​​RNA aggregates per cell when the candidate nucleic acid was added, SA: Sodium arsenite, Scheffe post hoc test compared with (+) SA(-) Oligo; *<0.05, **<0.01 n=3. This figure shows changes in the localization of FUS mutants when ENA-modified candidate nucleic acids were added to cultured motor neurons (NSC34 cells) expressing the FUS mutant (FUS-R495X). (a) Fluorescence microscope image upon addition of each candidate nucleic acid, (b) graph showing the localization (nucleus / cytoplasm) of FUS mutants upon addition of candidate nucleic acids, W / O Oligo: no oligonucleotide added, Scheffe post hoc test compared with W / O Oligo; *<0.05, **<0.01 n=3. Figure 1 shows the results of immunostaining FUS and its complex component SFPQ using motor neurons (ALS-3) derived from iPS cells of a human ALS patient carrying the H517D mutation in FUS and motor neurons (Isogenic Control) derived from isogenic iPS cells in which FUS had been reverted to wild-type by genome editing, followed by fluorescence microscope imaging.ENA-oligo#3-1 and control ENA-oligo (ENA nucleic acid of random sequence) were added to motor neurons derived from human ALS patient iPS cells (ALS-3). This graph shows the localization of FUS (proportion of nucleus and cytoplasm) when ENA-oligo#3-1 was added to the motor neurons derived from human ALS patient iPS cells shown in Figure 5. Bonferroni post hoc test compared with control-3; ****p<0.0001 n=6. This graph shows the intranuclear microcolocalization of FUS / SFPQ when ENA-oligo#3-1 was added to the motor neurons derived from human ALS patient iPS cells shown in Figure 5. Cont-3 (n = 5); ALS-3 (-) Oligo (n = 5); ALS-3 (+) Cont oligo (n = 4); ALS-3 (+) Oligo3-1 (n = 4). Bonferroni post hoc test compared with cont-3; * p < 0.05; ** p < 0.01. Fluorescence microscopy images showing improvement in neurite length reduction when ENA-oligo #3-1 was added to motor neurons (ALS-1) derived from human ALS patient iPS cells and motor neurons (Cont-1) derived from isogenic iPS cells in which FUS was reverted to wild-type by genome editing. This is a graph showing the neurite length when ENA-oligo#3-1 was added to motor neurons (ALS-1) derived from iPS cells of a human ALS patient using control oligo (ENA nucleic acid with a random sequence) (days 21 and 28). Bonferroni post hoc test compared with control-1; *p<0.05; NS=not significant, n=3.

[0014] Hereinafter, embodiments of the present invention will be described in detail.

[0015] (1) Definition: "Identity" of a base sequence refers to the degree of match between the base sequences of two or more comparable base sequences. Thus, the greater the match between two base sequences, the greater the identity of those sequences. The level of identity of base sequences is determined, for example, using sequence analysis tools such as FASTA and BLAST with default parameters.

[0016] In the present invention, unless otherwise specified, the term "gene" includes double-stranded DNA, single-stranded DNA (sense strand or antisense strand), and fragments thereof. Furthermore, in the present invention, unless otherwise specified, the term "gene" refers to a regulatory region, a coding region, exons, and introns without distinction.

[0017] In the present invention, the terms "nucleic acid" and "nucleotide" have the same meaning, and include both DNA and RNA, which may be double-stranded or single-stranded.

[0018] In this specification, "FUS" refers to a protein unless otherwise specified, but when it is appropriate to interpret it as a gene, it refers to a gene.

[0019] The RefSeq IDs shown below are registered on the NCBI website.

[0020] FUS is an RNA-binding protein, also known as ALS6, ETM4, HNRNPP2, POMP75, TLS, etc. The common structure of FUS proteins is that they have a transcription activation domain at the N-terminus and an RNA-binding motif and a zinc finger domain at the C-terminus. The FUS gene is widely present in nematodes, fish such as zebrafish, amphibians such as frogs, rodents such as rats, mice, and guinea pigs, and higher mammals such as rabbits, dogs, cats, pigs, sheep, goats, cows, horses, monkeys, and humans. Nucleotide sequence information for the FUS gene in each animal is available from public gene information databases (e.g., Genbank). The FUS in the present invention is usually derived from an animal, preferably from a mammal, and particularly preferably from a human.

[0021] The amino acid sequences of human-derived FUS have been registered as RefSeq Accession Nos. NP_001164105 (SEQ ID NO: 6), NP_001164408 (SEQ ID NO: 7), and NP_004951 (SEQ ID NO: 8). Genes encoding human-derived FUS proteins have been registered as RefSeq Accession Nos. NM_001170634 (SEQ ID NO: 9), NM_001170937 (SEQ ID NO: 10), and NM_004960 (SEQ ID NO: 11). "FUS" in the present invention is not limited to the sequences of SEQ ID NOs: 6 to 11, and may be a mutant thereof as long as it retains biological activity equivalent to that of FUS, with no limitations on the number or site of mutations in amino acids and nucleic acids. Examples of proteins with equivalent biological activity include proteins derived from other organisms.

[0022] Examples of the mutant include: (I) a protein consisting of an amino acid sequence registered in the aforementioned database in which one or two or more, for example, 1 to 50, 1 to 25, 1 to 12, 1 to 9, or 1 to 5 amino acids have been substituted, deleted, inserted, and / or added; and (II) a protein consisting of an amino acid sequence having 70% or more, 80% or more, 90% or more, or 95% or more identity to an amino acid sequence registered in the aforementioned database.

[0023] As used herein, "mutant FUS" refers to FUS that has been modified by amino acid substitution, deletion, insertion, or addition, resulting in a protein mutation that causes it to fold into a structure different from its native structure, particularly FUS with a pathogenic structure associated with ALS or FTLD. Mutant FUS may be the result of a mutation in the protein sequence or other modifications. Mutant FUS may be either a sporadic mutation or a familial mutation, particularly a FUS with a familial mutation.

[0024] In the present invention, "binding" refers to an interaction between molecules that results in the formation of a complex. The interaction may be a non-covalent interaction, including, for example, hydrogen bonding, ionic bonding, hydrophobic interactions, and / or van der Waals interactions. The binding of FUS to an oligonucleotide can be detected using known methods.

[0025] (2) Oligonucleotides In one embodiment, the present invention relates to any one of the following oligonucleotides (a) to (c) (sometimes referred to herein as "oligonucleotides of the present invention"). These are explained below. (a) an oligonucleotide consisting of a nucleotide sequence represented by any one of SEQ ID NOs: 1 to 5; (b) an oligonucleotide having 90% or more identity to a nucleotide sequence represented by any one of SEQ ID NOs: 1 to 5, capable of binding to FUS, and having activity to normalize one or more of the liquid-liquid phase separation of FUS, RNA granule formation, and cytoplasmic localization of FUS; (c) an oligonucleotide consisting of a nucleotide sequence represented by any one of SEQ ID NOs: 1 to 5 in which 1 to 3 bases have been deleted, substituted, inserted, and / or added, capable of binding to FUS, and having activity to normalize one or more of the liquid-liquid phase separation of FUS, RNA granule formation, and cytoplasmic localization of FUS.

[0026] The base sequences represented by SEQ ID NOs: 1 to 5 are as follows: SEQ ID NO: 1: AAAATATTCTTACTTTT SEQ ID NO: 2: AGATTACAATTCTATTT SEQ ID NO: 3: GGCATTGAATTTGGTGTATTTGGCC SEQ ID NO: 4: TATCTTTAACTACTCAAGATA SEQ ID NO: 5: TTTCCACATATTCAAGTCAAAAGCCTTCTGTGTGAA (In the above nucleotide sequences, thymine may be uracil. Furthermore, the constituent units of the oligonucleotide may be either ribonucleotides or deoxyribonucleotides.)

[0027] Preferred embodiments of the oligonucleotide of the present invention are any one of the following (a-1) to (c-1): (a-1) an oligonucleotide consisting of a nucleotide sequence represented by any one of SEQ ID NOs: 1 to 3, (b-1) an oligonucleotide having 90% or more identity to a nucleotide sequence represented by any one of SEQ ID NOs: 1 to 3, capable of binding to FUS, and having the activity of normalizing one or more of the liquid-liquid phase separation of FUS, RNA granule formation, and cytoplasmic localization of FUS, and (c-1) an oligonucleotide consisting of a nucleotide sequence represented by any one of SEQ ID NOs: 1 to 3 in which 1 to 3 bases have been deleted, substituted, inserted, and / or added, capable of binding to FUS, and having the activity of normalizing one or more of the liquid-liquid phase separation of FUS, RNA granule formation, and cytoplasmic localization of FUS.

[0028] More preferred embodiments of the oligonucleotide of the present invention are any one of the following (a-2) to (c-2): (a-2) an oligonucleotide consisting of the nucleotide sequence represented by SEQ ID NO: 1, (b-2) an oligonucleotide that has 90% or more identity to the nucleotide sequence represented by SEQ ID NO: 1 and is capable of binding to FUS and has the activity of normalizing one or more of the liquid-liquid phase separation of FUS, RNA granule formation, and cytoplasmic localization of FUS, and (c-2) an oligonucleotide consisting of the nucleotide sequence represented by SEQ ID NO: 1 in which one to two bases have been deleted, substituted, inserted, and / or added, and is capable of binding to FUS and has the activity of normalizing one or more of the liquid-liquid phase separation of FUS, RNA granule formation, and cytoplasmic localization of FUS.

[0029] A particularly preferred embodiment of the oligonucleotide of the present invention is an oligonucleotide consisting of the base sequence shown in SEQ ID NO:1.

[0030] The oligonucleotide of the present invention is characterized by having the ability to bind to FUS (particularly mutant FUS) in a droplet state during liquid-liquid phase separation, thereby transitioning the liquid-liquid phase separation to a solution state.

[0031] "Normalizing the liquid-liquid phase separation of FUS" means increasing the transition to the solution state and reducing droplet formation compared to when no oligonucleotide is used.

[0032] "Normalizing RNA granule formation" refers to reducing the number of RNA granules in cells compared to when no oligonucleotide is used.

[0033] "Normalizing the cytoplasmic localization of FUS" refers to increasing the ratio of nuclear / cytoplasmic localization of FUS compared to when no oligonucleotide is used.

[0034] In the "normalization of one or more of the liquid-liquid phase separation of FUS, RNA granule formation, and cytoplasmic localization of FUS," it is desirable to normalize two or more of (1) liquid-liquid phase separation of FUS, (2) RNA granule formation, and (3) cytoplasmic localization of FUS, and it is more desirable to normalize all three.

[0035] Examples of the identities to the base sequences represented by SEQ ID NOs: 1 to 5 in (b), (b-1) and (b-2) above include 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, etc. Techniques for deleting, substituting, inserting and adding bases in a specific base sequence are known.

[0036] The number of bases deleted, substituted, inserted and / or added in the base sequences represented by SEQ ID NOs: 1 to 5 in (c), (c-1) and (c-2) above can be, for example, 1 to 2, or 1. Techniques for deleting, substituting, inserting and adding bases in specific base sequences are known.

[0037] The structural units of the oligonucleotide of the present invention include, for example, ribonucleotides and deoxyribonucleotides, with ribonucleotides being preferred. These nucleotides may be modified (modified nucleotides) or unmodified (unmodified nucleotides).

[0038] The nucleotide residues constituting the oligonucleotides of the present invention contain a sugar, a base, and a phosphate as constituent elements. Ribonucleotides have a ribose residue as a sugar and adenine (A), guanine (G), cytosine (C) (which can be replaced with 5-methylcytosine (5MeC)), and uracil (U) (which can be replaced with thymine (T)) as bases, while deoxyribonucleotide residues have a deoxyribose residue as a sugar and adenine (A), guanine (G), cytosine (C) (which can be replaced with 5-methylcytosine (5MeC)), and thymine (T) (which can be replaced with uracil (U)) as bases.

[0039] The unmodified nucleotide residue has each component identical or substantially identical to that present in nature (e.g., humans). The modified nucleotide residue may be one in which any of the components of the unmodified nucleotide residue has been modified. "Modification" includes, for example, substitution, addition, and deletion of the components, and substitution, addition, and deletion of atoms and functional groups in the components.

[0040] The modification of the nucleotide residue includes a modification of the sugar-phosphate backbone (sugar phosphate backbone). When the sugar in the sugar phosphate backbone is ribose, for example, the ribose residue can be modified. The ribose residue can be modified, for example, at the 2' carbon; specifically, the hydroxyl group attached to the 2' carbon can be modified with a methyl group or a methoxyethyl group, or the hydroxyl group can be substituted with a halogen such as fluoro. The ribose residue can be substituted with, for example, a stereoisomer; specifically, it may be substituted with an arabinose residue. Herein, a nucleic acid in which the hydroxyl group attached to the 2' carbon of the sugar is modified with a methoxy group is sometimes referred to as a 2'-O-methyl-modified nucleic acid.

[0041] The sugar phosphate backbone may be substituted with a non-ribose phosphate backbone having, for example, a non-ribose residue (including a non-deoxyribose residue) and / or a non-phosphate, and such substitutions are also included in the sugar phosphate backbone modifications. Examples of non-ribose phosphate backbones include uncharged versions of the sugar phosphate backbone. Examples of nucleotide substitutes substituted with a non-ribose phosphate backbone include morpholino, cyclobutyl, pyrrolidine, etc.

[0042] In addition to the above, alternatives to nucleotides include artificial nucleic acids. Specific examples of artificial nucleic acids include PNA (peptide nucleic acid) and bridged artificial nucleic acid (BNA: Bridged Nucleic Acid). Examples of BNA include locked artificial nucleic acid (LNA: Locked Nucleic Acid) and 2'-O,4'-C-ethylene bridged nucleic acid (ENA: 2'-O,4'-C-Ethylenebridged Nucleic Acid). Specific examples of BNA include the nucleic acids described in International Publication No. 2016 / 006697. Such nucleic acids can be prepared by methods described in Japanese Patent Application Laid-Open Nos. 2002-241393 and 2000-297097.

[0043] The oligonucleotide of the present invention preferably contains at least one modified nucleotide. By containing modified nucleotides, the metabolic stability of the oligonucleotide in vivo can be improved. The number of modified nucleotides contained in the nucleotide of the present invention can be, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, etc.

[0044] The modified nucleotide in the oligonucleotide of the present invention preferably contains at least one 2'-O,4'-C-ethylene-bridged nucleic acid. By containing such a 2'-O,4'-C-ethylene-bridged nucleic acid, the bridged structure can increase the binding strength to FUS and metabolic stability in the body, making it possible to maintain the effect for years. Preferably, the oligonucleotide of the present invention contains, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 2'-O,4'-C-ethylene-bridged nucleic acids. The 2'-O,4'-C-ethylene-bridged nucleic acid is a nucleic acid having the following structure:

[0045] (wherein Base represents a base)

[0046] When the oligonucleotide of the present invention is an oligonucleotide consisting of the base sequence represented by SEQ ID NO: 1, it is preferable that any of the nucleotides at positions 1, 6, 8, 10, 12, and 17 is a 2'-O,4'-C-ethylene-bridged nucleic acid, and it is more preferable that the nucleotides at positions 1, 6, 8, 10, 12, and 17 are 2'-O,4'-C-ethylene nucleotides.

[0047] Oligonucleotides containing at least one 2'-O,4'-C-ethylene-bridged nucleic acid as described above can be synthesized, for example, using 2'-O,4'-C-ethylene nucleoside phosphoramidites using the method described in WO 2000 / 47599.

[0048] Furthermore, when the oligonucleotide of the present invention contains at least one 2'-O,4'-C-ethylene-bridged nucleic acid, it is preferable that the nucleotide other than the 2'-O,4'-C-ethylene-bridged nucleic acid is a 2'-O-methyl-modified nucleic acid. In such an oligonucleotide, the ratio of the 2'-O,4'-C-ethylene-bridged nucleic acid to the 2'-O-methyl-modified nucleic acid can be appropriately set taking into consideration the binding strength to FUS, the liquid-liquid phase separation of FUS, RNA granule formation, and the ability to inhibit the cytoplasmic localization of FUS. The 2'-O-methyl-modified nucleic acid is a nucleic acid having the following structure:

[0049] (wherein Base represents a base)

[0050] The phosphate group in the sugar phosphate backbone can also be modified. In the sugar phosphate backbone, the phosphate group closest to the sugar residue is called the α-phosphate group. The α-phosphate group is preferably modified, for example, to become uncharged or to have asymmetric charge distribution at the two oxygen atoms (non-bonding oxygens) that are not bonded to the sugar residue.

[0051] Modification of the phosphate group can be exemplified by substituting non-bonded oxygen. The oxygen can be substituted with any of the following atoms: S (sulfur), Se (selenium), B (boron), C (carbon), H (hydrogen), N (nitrogen), and OR (R is an alkyl group or an aryl group), preferably S. Either or both of the non-bonded oxygens may be substituted, preferably either or both are substituted with S. More specifically, modified phosphate groups include, for example, phosphorothioate, phosphorodithioate, phosphoroselenate, boranophosphate, boranophosphate ester, phosphonate hydrogen, phosphoramidate, alkyl or aryl phosphonate, phosphotriester, etc., with phosphorothioate and phosphorodithioate being preferred.

[0052] The phosphate group can also be substituted with a non-phosphorus-containing linker. Examples of such linkers include a methylenecarbonylamino group and a methylenemethylimino group. Additionally, the oligonucleotide of the present invention can be modified, for example, at least one of the nucleotide residues at the 3'-end and the 5'-end. The modification can be, for example, at either the 3'-end or the 5'-end, or both.

[0053] The oligonucleotides of the present invention can be prepared by standard methods such as PCR, chemical synthesis, biochemical cleavage / recombination, etc. Examples of chemical synthesis methods include the phosphoramidite method and the H-phosphonate method. Such chemical synthesis methods can be carried out, for example, using a commercially available automated nucleic acid synthesizer.

[0054] The oligonucleotides of the present invention can be used in their free form or in their salt form. Examples of salts include salts with inorganic bases such as sodium salt, potassium salt, calcium salt, magnesium salt, and aluminum salt; salts with organic bases such as methylamine salt, ethylamine salt, and ethanolamine salt; salts with basic amino acids such as lysine salt, arginine salt, and ornithine salt, and ammonium salt. The salts may be acid addition salts, including salts with mineral acids such as hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, nitric acid, and phosphoric acid; organic acids such as formic acid, acetic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, tartaric acid, citric acid, methanesulfonic acid, and ethanesulfonic acid; and acidic amino acids such as aspartic acid and glutamic acid. The oligonucleotides of the present invention also include their hydrates, solvates, and crystalline polymorphs.

[0055] (3) FUS Aggregation Inhibitor In one embodiment, the present invention relates to an FUS aggregation inhibitor comprising the oligonucleotide of the present invention (also referred to herein as the "FUS aggregation inhibitor of the present invention"). This will be described below.

[0056] The oligonucleotides of the present invention can specifically control the LLPS transition state of FUS, thereby causing FUS to transition to a solution state, thereby suppressing the formation of FUS aggregates.

[0057] The FUS aggregation inhibitor of the present invention can be introduced into a subject by contacting the oligonucleotide of the present invention alone or together with a pharmacologically acceptable carrier. Furthermore, when the subject is a culture of cells, tissues, or organs derived from an animal, the FUS aggregation inhibitor of the present invention can be introduced into the subject by adding the inhibitor to the culture medium.

[0058] To promote the introduction of the oligonucleotide of the present invention into target cells, the FUS aggregation inhibitor of the present invention may further contain a nucleic acid introduction reagent, such as liposomes, atelocollagen, nanoparticles (e.g., lipid nanoparticles (LNPs)), and cationic lipids such as lipofectin, lipofectamine, DOGS (transfectam), DOPE, DOTAP, DDAB, DHDEAB, HDEAB, polybrene, and poly(ethyleneimine) (PEI).

[0059] (4) Neuroprotective Agent In one embodiment, the present invention relates to a neuroprotective agent (sometimes referred to herein as the "neuronprotective agent of the present invention") comprising the oligonucleotide of the present invention. This will be described below.

[0060] The oligonucleotides of the present invention can suppress the formation of FUS aggregates and therefore can protect nerve cells from the toxicity of FUS aggregates.

[0061] The neuroprotective agent of the present invention can be introduced into a subject by contacting the oligonucleotide of the present invention alone or together with a pharmacologically acceptable carrier. When the subject is a culture of cells, tissues, or organs derived from an animal, the neuroprotective agent of the present invention can be introduced into the subject by adding the neuroprotective agent of the present invention to the culture medium.

[0062] To promote the introduction of the oligonucleotide of the present invention into target cells, the neuronal protective agent of the present invention may further contain a nucleic acid introduction reagent, such as those described above.

[0063] (5) Pharmaceutical Composition In one embodiment, the present invention relates to a pharmaceutical composition (sometimes referred to herein as the "pharmaceutical composition of the present invention") comprising the oligonucleotide of the present invention. This is described below.

[0064] The pharmaceutical composition of the present invention is administered to mammals, including humans, and is characterized by containing the oligonucleotide of the present invention. It can specifically control the LLPS transition state of FUS and suppress RNA granule formation and cytoplasmic localization of FUS, and therefore can be used particularly for the treatment and / or prevention of amyotrophic lateral sclerosis (ALS) or frontotemporal lobar degeneration (FTLD).

[0065] The subjects to which the pharmaceutical composition of the present invention is administered are, for example, humans or non-human animals. Specific examples of non-human animals include primates such as monkeys, rodents such as mice, rats, and guinea pigs, rabbits, dogs, cats, pigs, cows, sheep, and horses.

[0066] In order to promote the introduction of the oligonucleotide of the present invention into target cells, the pharmaceutical composition of the present invention may further contain a nucleic acid introduction reagent, and such a nucleic acid introduction reagent can be the same as those described above.

[0067] The pharmaceutical composition of the present invention may optionally contain biologically acceptable carriers, excipients, etc. depending on the form of use. The pharmaceutical composition of the present invention can be manufactured by conventional means. For example, it can be used orally in the form of tablets, capsules, elixirs, microcapsules, etc., optionally sugar-coated or enteric-coated, topical preparations such as ointments and plasters, transdermally, nasally, or transtracheally in the form of sprays, inhalants, etc., or parenterally in the form of injections such as sterile solutions or suspensions with water or other pharmaceutically acceptable liquids.

[0068] The content of the oligonucleotide, which is the active ingredient in the pharmaceutical composition of the present invention, is appropriately selected depending on the dosage form, route of administration, etc., and may be, for example, 0.00001 to 100% by mass of the total amount of the pharmaceutical composition. The upper or lower limit of this range is, for example, 0.0001% by mass, 0.001% by mass, 0.01% by mass, 0.1% by mass, 1% by mass, 5% by mass, 10% by mass, 20% by mass, 30% by mass, 40% by mass, 50% by mass, 60% by mass, 70% by mass, 80% by mass, 90% by mass, 95% by mass, 99% by mass, or 99.9% by mass.

[0069] The pharmaceutical composition of the present invention may be administered locally or systemically. There are no particular limitations on the administration method, and the composition may be administered orally or parenterally. Parenteral administration routes include subcutaneous, intraperitoneal, intrathecal, cerebral ventricle, brain parenchyma, vein, artery, or spinal fluid injection or infusion, and transdermal administration. Among these administration methods, intravascular injection, administration using a catheter to the diseased site, intrathecal administration, intraventricular administration, and brain parenchyma injection are preferred, since the target site of the pharmaceutical composition of the present invention is mainly the diseased site of the brain.

[0070] The dosage of the pharmaceutical composition of the present invention can ultimately be appropriately determined by a physician, taking into consideration the type of dosage form, the method of administration, the age and weight of the patient, the patient's symptoms, etc. The single dose of the oligonucleotide of the present invention is, for example, typically 2 nmol / kg to 50 nmol / kg when administered systemically to an adult, and typically 1 pmol / kg to 10 nmol / kg when administered locally. Such amounts can be administered, for example, at intervals of 1 to 6 months, 2 to 4 months, or about 3 months.

[0071] The oligonucleotides of the present invention can specifically control the LLPS transition state of FUS, and therefore can be used as pharmaceutical compositions with reduced side effects. Furthermore, because the oligonucleotides of the present invention have excellent in vivo stability, they can exert therapeutic and / or preventive effects with a small dose and frequency of administration, thereby improving the patient's quality of life and suppressing the occurrence of adverse events.

[0072] The pharmaceutical composition of the present invention can also be used in combination with other therapeutic agents for ALS and FTLD. These concomitant drugs can be formulated together with the pharmaceutical composition of the present invention and administered as a single formulation, or can be formulated and administered separately from the pharmaceutical composition of the present invention.

[0073] In this specification, the term "comprising" includes "consisting essentially of" and "consisting of." Furthermore, the present invention encompasses all arbitrary combinations of the constituent elements described in this specification.

[0074] Furthermore, the various characteristics (properties, structures, functions, etc.) described in each embodiment of the present invention may be combined in any way to specify the subject matter encompassed by the present invention, i.e., the present invention encompasses all subject matter consisting of any combination of the combinable characteristics described herein.

[0075] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these examples.

[0076] MBP-FUS-R495X was expressed in E. coli BL21 DE3 cells. Bacterial cultures were grown at 37°C until an OD of 0.7 was reached. Protein expression was induced with 1 mM IPTG and further cultured at 25°C for 16-18 hours. E. coli cells were then collected by centrifugation and stored at -80°C. Frozen pellets were thawed on ice, resuspended in ice-cold phosphate-buffered saline supplemented with protease inhibitors, and sonicated. 1% Triton™ X was added to the lysate, and the mixture was centrifuged at 5800 x g for 7 minutes at 4°C. The supernatant was then mixed with TALON metal affinity resin (Takara Bio Inc.) and incubated overnight at 4°C. After washing with PBS containing 20 mM imidazole, the protein was eluted with 300 mM NaCl, 50 mM sodium phosphate, 150 mM imidazole, pH 7.6. The fraction containing the target protein was dialyzed and replaced with a solution of 200 mM Tris-HCl, 200 mM NaCl, 1 mM DTT, pH 7.5. Finally, the fraction was concentrated using a filter (10 kDa MWCO, Vivaspin), and the protein concentration was quantified and stored at -80°C.

[0077] In the following test examples, the oligonucleotides listed in Table 1 were designed and sequenced by predicting the stem and loop portions using secondary structure prediction software from an approximately 20-base RNA sequence that binds to the FUS RNA recognition motif (candidate sequence for the stem loop structure, candidate sequence for GU Rich). These oligonucleotides were produced by chemical synthesis. They were synthesized using commercially available 5'-dimethoxytrityl-2'-O-methyl (OME)-3' cyanoethyl phosphoramidite on an automated nucleic acid synthesizer (H6: Nippon Techno Service Co., Ltd.). The resulting oligonucleotides were excised and deprotected from the solid support containing the synthetic oligonucleotides according to standard procedures, followed by purification by reverse-phase C18-HPLC, followed by salt exchange to the sodium salt using a centrifugal filtration device (MCP001C41: Nippon Pall Co., Ltd.). The identity of the resulting oligonucleotides was confirmed by molecular weight confirmation using LC-mass (XevoG2-XS QTof: Waters).

[0078]

[0079] Statistical analysis graphs are expressed as mean ± SD, and multiple comparisons were performed in post-hoc tests.

[0080] Test Example 1: The phase separation characteristics of FUS-R495X were evaluated using a turbidity assay, which is an indicator of phase separation. The FUS-R495X protein was expressed in Escherichia coli, disrupted, and purified from the supernatant after ultracentrifugation. The purified FUS-R495X solution was observed to exhibit an increase in turbidity. To this solution, 100 nM of each of the candidate nucleic acids (#1 to #15) was added. The turbidity was measured using a spectrophotometer (595 nM) before addition (0 hour), 4 hours after addition, and 16 hours (overnight). A decrease in turbidity was observed in #3, #4, and #9 (Figure 1).

[0081] Test Example 2 Next, the FUS mutant (FUS-R495X) was expressed in cultured motor neurons (NSC34 cells) (culture conditions: DMEM medium supplemented with 10% FBS, 37°C, 5% CO 2We performed in vivo screening using the normalization of the abnormal localization (change from cytoplasmic to nuclear localization) by adding oligonucleotides to the cells. The results showed that Oligos #1, #3, #4, and #5 normalized the cytoplasmic localization of FUS R495X to the nuclear localization (Figure 2).

[0082] Test Example 3: Furthermore, using the ability to reduce RNA aggregates formed when a FUS mutant (FUS-R495X) was expressed as an index, in vivo screening was performed by adding oligonucleotides under conditions that promote aggregate formation (the same conditions as Test Example 2, but with the addition of low-concentration sodium arsenite (0.25 mM) for 15 minutes). As a result, it was found that Oligos #1, #3, #4, #5, and #9 normalized RNA aggregate formation caused by FUS R495X (Figure 3).

[0083] Test Example 4 Based on these results, a total of eight oligonucleotides were designed in which the sequences #3, #4, and #9 were ENA-modified at different positions and frequencies, and these were synthesized using 5'-dimethoxytrityl-ENA(2'-O,4'-C-Ethylenebridged)-3' cyanoethyl sulfoamidite in the same manner as for SEQ ID NOs: 1-15 (Table 2).

[0084]

[0085] Using these ENA oligos, we again tested the normalization of FUS localization (change from cytoplasmic to nuclear localization) when the FUS mutant (FUS-R495X) was expressed in cultured neurons. The results showed that ENA-oligo#3-1 was the most effective in normalizing FUS localization (Figure 4).

[0086] Test Example 5 Next, the effect of ENA-oligo#3-1 was verified in motor neurons derived from human ALS patient iPS cells. Using a pair of motor neurons derived from ALS patient iPS cells with a mutation in FUS (H517D) and an isogenic control in which FUS was converted to wild-type by genome editing, the effect of ENA-oligo#3-1 was verified using the nuclear and cytoplasmic localization of FUS, colocalization of FUS / SFPQ in the nucleus, and improvement in neurite length as indicators. Then, verification was performed by quantifying the signals captured under a microscope after fluorescent immunostaining of FUS and SFPQ (Figure 5). As a result, it was revealed that ENA-oligo#3-1 normalized the abnormal localization of mutant FUS in the cytoplasm in iPSC-derived motor neurons (Figure 6).

[0087] Test Example 6 Furthermore, the inventors have discovered that intranuclear micro-colocalization changes of FUS / SFPQ are one of the pathological indicators of ALS / FTLD from neuropathological analysis using autopsy brains (Ishigaki, S., et al. (2020). "Aberrant interaction between FUS and SFPQ in neurons in a wide range of FTLD spectrum diseases." Brain 143(8):2398-2405; Riku, Y., et al. (2022). "Motor neuron TDP-43 proteinopathy in progressive Regression analysis of FUS and SFPQ signals in ALS iPSC-derived motor neurons was performed using R. 2 Comparison of these values ​​using this as an index revealed that FUS / SFPQ colocalization was impaired in motor neurons with mutant FUS. Furthermore, it was confirmed that this colocalization was normalized by ENA-oligo#3-1 (Figure 7).

[0088] Test Example 7 Furthermore, neurite length was quantified as an index of viability. Specifically, neurites of ALS iPSC-derived motor neurons were photographed under a microscope on days 21 and 28 of culture, and the images were quantified using software. This revealed that ENA-oligo#3-1 improved viability ( Figures 8 and 9 ).

[0089] This application is based on patent application No. 2024-129200 filed in Japan (filing date: August 5, 2024), the contents of which are incorporated in their entirety herein.

Claims

1. Any one of the following oligonucleotides (a) to (c): (a) an oligonucleotide consisting of a base sequence represented by any one of SEQ ID NOs: 1 to 5; (b) an oligonucleotide having 90% or more identity to the base sequence represented by any one of SEQ ID NOs: 1 to 5, capable of binding to FUS, and having the activity of normalizing one or more of the liquid-liquid phase separation of FUS, RNA granule formation, and cytoplasmic localization of FUS; (c) an oligonucleotide consisting of a base sequence represented by any one of SEQ ID NOs: 1 to 5 in which 1 to 3 bases have been deleted, substituted, inserted, and / or added, and capable of binding to FUS, and having the activity of normalizing one or more of the liquid-liquid phase separation of FUS, RNA granule formation, and cytoplasmic localization of FUS.

2. The oligonucleotide according to claim 1, which is any one of the following (a-1) to (c-1): (a-1) an oligonucleotide consisting of a base sequence represented by any one of SEQ ID NOs: 1 to 3; (b-1) an oligonucleotide which has 90% or more identity with the base sequence represented by any one of SEQ ID NOs: 1 to 3, is capable of binding to FUS, and has the activity of normalizing one or more of the liquid-liquid phase separation of FUS, RNA granule formation, and cytoplasmic localization of FUS; (c-1) an oligonucleotide consisting of a base sequence represented by any one of SEQ ID NOs: 1 to 3 in which 1 to 3 bases have been deleted, substituted, inserted, and / or added, and is capable of binding to FUS, and has the activity of normalizing one or more of the liquid-liquid phase separation of FUS, RNA granule formation, and cytoplasmic localization of FUS.

3. The oligonucleotide according to claim 1, which is any one of the following (a-2) to (c-2): (a-2) an oligonucleotide consisting of the base sequence represented by SEQ ID NO: 1; (b-2) an oligonucleotide which has 90% or more identity with the base sequence represented by SEQ ID NO: 1 and is capable of binding to FUS and has the activity of normalizing one or more of the liquid-liquid phase separation of FUS, RNA granule formation, and cytoplasmic localization of FUS; (c-2) an oligonucleotide consisting of the base sequence represented by SEQ ID NO: 1 in which one to two bases have been deleted, substituted, inserted, and / or added, and which is capable of binding to FUS and has the activity of normalizing one or more of the liquid-liquid phase separation of FUS, RNA granule formation, and cytoplasmic localization of FUS.

4. The oligonucleotide according to claim 1, which is an oligonucleotide consisting of the base sequence represented by SEQ ID NO:

1.

5. The oligonucleotide of claim 1, comprising at least one modified nucleotide.

6. The oligonucleotide of claim 5, which comprises at least one 2'-O,4'-C-ethylene-bridged nucleotide as the modified nucleotide.

7. The oligonucleotide according to claim 4, wherein the nucleotides at positions 1, 6, 8, 10, 12 and 17 in the base sequence represented by SEQ ID NO: 1 are 2'-O,4'-C-ethylene-bridged nucleic acids.

8. An FUS aggregation inhibitor comprising the oligonucleotide according to any one of claims 1 to 7.

9. A neuroprotective agent comprising the oligonucleotide according to any one of claims 1 to 7.

10. A pharmaceutical composition comprising an oligonucleotide according to any one of claims 1 to 7.

11. The pharmaceutical composition according to claim 10, for use in the treatment or prevention of amyotrophic lateral sclerosis or frontotemporal lobar degeneration.

Citation Information

Patent Citations

  • Compounds and methods for reducing SNCA expression

    JP2021502095A