Enhanced cascade control using split activator molecules

Abstract

The present disclosure relates to compositions of matter and assay methods used to detect one or more target nucleic acids of interest in a sample. The compositions and methods allow one to control reaction kinetics of a cascade assay to prevent false positives in the absence of a target nucleic acid of interest yet enhance signal production in the presence of a target nucleic acid of interest.

Description

TITLE: ENHANCED CASCADE CONTROL USING SPLIT ACTIVATOR MOLECULESRELATED CASES

[0001] This International PCT application claims priority to U.S. Ser. Nos. 63 / 680,298, filed 07 August 2024, which is incorporated by reference in its entirety.FIELD OF THE INVENTION

[0002] The present disclosure relates to compositions of matter and assay methods used to detect one or more target nucleic acids of interest in a sample. The compositions and methods allow one to control reaction kinetics of a cascade assay to prevent false positives in the absence of a target nucleic acid of interest yet enhance signal production in the presence of a target nucleic acid of interest.BACKGROUND OF THE INVENTION

[0003] In the following discussion, certain articles and methods will be described for background and introductory purposes. Nothing contained herein is to be construed as an “admission” of prior art. Applicant expressly reserves the right to demonstrate, where appropriate, that the articles and methods referenced herein do not constitute prior art under the applicable statutory provisions.

[0004] Rapid and accurate identification of, e.g., infectious agents, microbe contamination, variant nucleic acid sequences that indicate the presence of diseases such as cancer or contamination by heterologous sources is important in order to select correct treatment; identify tainted food, pharmaceuticals, cosmetics and other commercial goods; and to monitor the environment including identification of biothreats. Classic PCR and nucleic acid-guided nuclease or CRISPR (clustered regularly interspaced short palindromic repeats) detection methods rely on preamplification of target nucleic acids of interest to enhance detection sensitivity. However, amplification increases time to detection and may cause changes to the relative proportion of nucleic acids in samples that, in turn, lead to artifacts or inaccurate results. Improved assays that allow very rapid and accurate detection of nucleic acids yet minimize false positive signals are therefore needed for timelyATTORNEY DOCKET NUMBER: VB034PCT diagnosis and treatment of disease, to identify toxins in consumables and the environment, as well as other applications.SUMMARY OF THE INVENTION

[0005] This Summary is provided to introduce a selection of concepts in a simplified form that are further described below in the Detailed Description. This Summary is not intended to identify key or essential features of the claimed subject matter, nor is it intended to be used to limit the scope of the claimed subject matter. Other features, details, utilities, and advantages of the claimed subject matter will be apparent from the following written Detailed Description, including those aspects illustrated in the accompanying drawings and defined in the appended claims.

[0006] The present disclosure provides compositions of matter and assay methods to detect target nucleic acids of interest where reaction kinetics of the assay can be controlled via molecular design of at least one of the reaction components. The “nucleic acid-guided nuclease cascade assays” or “signal boost cascade assays” or “cascade assays” described herein comprise two different ribonucleoprotein complexes and blocked nucleic acid molecules that are configured such that the region of the blocked nucleic acid molecule that is complementary to the guide nucleic acid in the second ribonucleoprotein complex is split into two portions where the split portions are linked by a linker and when unblocked can join to bind and activate the second ribonucleoprotein complex, but may be reconstituted. The blocked split activator molecules keep one of the ribonucleoprotein complexes “locked” unless and until a target nucleic acid of interest activates the other ribonucleoprotein complex. In the context of the cascade assays, “locked” means that the blocked split activator molecules are designed in such a way that they are largely blocked from interacting with second ribonucleoprotein complexes; therefore, the second ribonucleoprotein complexes remain largely inactive (i.e., “locked”) unless and until a target nucleic acid of interest activates the first ribonucleoprotein complex. The trans-cleavage activity of the first ribonucleoprotein complex unblocks the blocked split activator molecules thereby enhancing signal production in the cascade assay. The present nucleic acid-guided nuclease cascade assay can detect one to many to a large number of target nucleic acids of interest (e.g., DNA, RNA and / or cDNA) without the need for amplifying the target nucleic acid(s) of interest, thereby avoiding the drawbacks of multiplex amplification,ATTORNEY DOCKET NUMBER: VB034PCT such as primer-dimerization. A particularly advantageous feature of the cascade assay generally is that, with the exception of the guide nucleic acid(s) in RNPl(s), the cascade assay components can be the same in each assay no matter what target nucleic acid(s) of interest is being detected.

[0007] Thus, there is provided a method for identifying a target nucleic acid of interest in a sample using a signal boost assay comprising the steps of: providing a reaction mixture comprising: first ribonucleoprotein complexes (RNPls) each comprising a first nucleic acid-guided nuclease and a first gRNA, wherein the first gRNA comprises a sequence complementary to the target nucleic acid of interest, and wherein the first nucleic acid-guided nuclease exhibits both cis-cleavage and trans-cleavage activity; second ribonucleoprotein complexes (RNP2s) each comprising a second nucleic acid- guided nuclease and a second gRNA that is not complementary to the target nucleic acid of interest, and wherein the second nucleic acid-guided nuclease exhibits both cisand trans-cleavage activity; a plurality of blocked nucleic acid molecules each comprising from 5' to 3': a block “N” nucleotides in length; a 5' target portion; a linker; and a 3' target portion, wherein the 5' and 3' target portions, when adjacent, are complementary to the second gRNA; and contacting the reaction mixture with the sample under conditions that allow the target nucleic acid of interest in the sample, if present, to bind to RNP1; wherein upon binding of the target nucleic acid of interest, RNP1 becomes active initiating trans-cleavage of the N nucleotides of the block of at least one of the plurality of the blocked nucleic acid molecules thereby unblocking the at least one blocked nucleic acid molecule; allowing the 5' and 3' target portions of the unblocked nucleic acid molecule to bind to the second gRNA in an RNP2 initiating trans-cleavage of the N nucleotides of the block of at least one additional blocked nucleic acid molecule; and detecting the cleavage products, thereby detecting the target nucleic acid of interest in the sample.

[0008] In an alternative embodiment, there is provided a method for identifying a target nucleic acid of interest in a sample using a signal boost assay comprising the steps of: providing a reaction mixture comprising: first ribonucleoprotein complexes (RNPls) each comprising a first nucleic acid-guided nuclease and a first gRNA, wherein the first gRNA comprises a sequence complementary to the target nucleic acid of interest, and wherein the first nucleic acid-guided nuclease exhibits both cis-cleavage and trans- cleavage activity; second ribonucleoprotein complexes (RNP2s) each comprising a second nucleic acid-guided nuclease and a second gRNA that is not complementary toATTORNEY DOCKET NUMBER: VB034PCT the target nucleic acid of interest, and wherein the second nucleic acid-guided nuclease exhibits both cis- and trans-cleavage activity; a plurality of blocked nucleic acid molecules each comprising from 5' to 3': a 5' target portion; a linker; and a 3' target portion, a block “N” nucleotides in length; wherein the 5' and 3' target portions, when adjacent, are complementary to the second gRNA; and contacting the reaction mixture with the sample under conditions that allow the target nucleic acid of interest in the sample, if present, to bind to RNP1; wherein upon binding of the target nucleic acid of interest, RNP1 becomes active initiating trans-cleavage of the N nucleotides of the block of at least one of the plurality of the blocked nucleic acid molecules thereby unblocking the at least one blocked nucleic acid molecule; allowing the 5' and 3' target portions of the unblocked nucleic acid molecule to bind to the second gRNA in an RNP2 initiating trans-cleavage of the N nucleotides of the block of at least one additional blocked nucleic acid molecule; and detecting the cleavage products, thereby detecting the target nucleic acid of interest in the sample.

[0009] In some aspects of these methods, the comprises at least 15 nucleotides or a chemical linker with a length equivalent to at least 15 nucleotides.

[0010] In some aspects the reaction mixture further comprises reporter moieties, wherein the reporter moieties produce a detectable signal upon trans-cleavage activity by the RNP2 to identify the presence of one or more nucleic acid targets of interest in the sample. These aspects and other features and advantages of the invention are described below in more detail.BRIEF DESCRIPTION OF THE DRAWINGS

[0011] The foregoing and other features and advantages of the present invention will be more fully understood from the following detailed description of illustrative embodiments taken in conjunction with the accompanying drawings in which:

[0012] FIG. 1 is an overview of the general principles underlying the nucleic acid- guided nuclease cascade assay described in detail herein where target nucleic acids of interest from a sample do not need to be amplified before detection.

[0013] FIG. 2A is a diagram showing the sequence of steps in an exemplary prior art cascade assay utilizing blocked nucleic acid molecules.

[0014] FIG. 2B is a diagram showing a prior art blocked nucleic acid molecule and a method for unblocking the prior art blocked nucleic acid molecule.ATTORNEY DOCKET NUMBER: VB034PCT

[0015] FIG. 3 is a simplified diagram of the “correct” pathway for unblocking a blocked nucleic acid molecule, as well as a “failure” pathway for unblocking a blocked nucleic acid molecule.

[0016] FIG. 4 is a simplified diagram of an exemplary gRNA2 sequence and three exemplary blocked split activator molecules.

[0017] FIG. 5 is a simplified diagram showing the sequence of steps in an exemplary cascade assay utilizing blocked split activator molecules.

[0018] It should be understood that the drawings are not necessarily to scale, and that like reference numbers refer to like features.DEFINITIONS

[0019] In the following description, numerous specific details are set forth to provide a more thorough understanding of the present invention. However, it will be apparent to one of skill in the art that the present invention may be practiced without one or more of these specific details. In other instances, features and procedures well known to those skilled in the art have not been described in order to avoid obscuring the invention. The terms used herein are intended to have the plain and ordinary meaning as understood by those of ordinary skill in the art.

[0020] All of the functionalities described in connection with one embodiment of the compositions and / or methods described herein are intended to be applicable to the additional embodiments of the compositions and / or methods except where expressly stated or where the feature or function is incompatible with the additional embodiments. For example, where a given feature or function is expressly described in connection with one embodiment but not expressly mentioned in connection with an alternative embodiment, it should be understood that the feature or function may be deployed, utilized, or implemented in connection with the alternative embodiment unless the feature or function is incompatible with the alternative embodiment.

[0021] Note that as used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a cell” refers to one or more cells, and reference to “a system” includes reference to equivalent steps, methods and devices known to those skilled in the art, and so forth. Additionally, it is to be understood that terms such as "left," "right," "top," "bottom," "front," "rear," "side," "height," "length," "width," "upper," "lower," "interior," "exterior," "inner," "outer" that may be used herein merelyATTORNEY DOCKET NUMBER: VB034PCT describe points of reference and do not necessarily limit embodiments of the present disclosure to any particular orientation or configuration. Furthermore, terms such as "first," "second," "third," etc., merely identify one of a number of portions, components, steps, operations, functions, and / or points of reference as disclosed herein, and likewise do not necessarily limit embodiments of the present disclosure to any particular configuration or orientation.

[0022] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. All publications mentioned herein are incorporated by reference for the purpose of describing and disclosing devices, formulations and methodologies that may be used in connection with the presently described invention. Conventional methods are used for the procedures described herein, such as those provided in the art, and demonstrated in the Examples and various general references. Unless otherwise stated, nucleic acid sequences described herein are given, when read from left to right, in the 5' to 3' direction. Nucleic acid sequences may be provided as DNA, as RNA, or a combination of DNA and RNA (e.g., a chimeric nucleic acid).

[0023] Where a range of values is provided, it is understood that each intervening value, between the upper and lower limit of that range and any other stated or intervening value in that stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included in smaller ranges, and are also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.

[0024] The term “and / or” where used herein is to be taken as specific disclosure of each of the multiple specified features or components with or without another. Thus, the term “and / or” as used in a phrase such as “A and / or B” herein is intended to include “A and B,” “A or B,” “A” (alone), and “B” (alone). Likewise, the term “and / or” as used in a phrase such as “A, B, and / or C” is intended to encompass each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0025] In the following description, numerous specific details are set forth to provide a more thorough understanding of the present invention. However, it will be apparent to one of skill in the art given the present description that the present methods may be practiced without one or more of these specific details. In other instances, features andATTORNEY DOCKET NUMBER: VB034PCT procedures well known to those skilled in the art have not been described in order to avoid obscuring the invention. The terms used herein are intended to have the plain and ordinary meaning as understood by those of ordinary skill in the art.

[0026] As used herein, the term "about," as applied to one or more values of interest, refers to a value that falls within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of a stated reference value, unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value).

[0027] As used herein, the terms “binding affinity” or “dissociation constant” or “Kd” refer to the tendency of a molecule to bind (covalently or non-covalently) to a different molecule. A high Kd (which in the context of the present disclosure refers to blocked split activator molecules binding to the second ribonucleoprotein complex (RNP2)) indicates the presence of more unbound molecules, and a low Kd (which in the context of the present disclosure refers to unblocked split activator molecules binding to RNP2) indicates the presence of more bound molecules. In the context of the present disclosure and the binding of blocked or unblocked split activator molecules to RNP2, low Kd values are in a range from about 100 fM to about 1 aM or lower (e.g., 100 zM) and high Kd values are in the range of 100 nM - 100 pM (10 mM) and thus are about 105- to 1010-fold or higher as compared to low Kd values.

[0028] As used herein, the terms “binding domain” or “binding site” refer to a region on a protein, DNA, or RNA, to which specific molecules and / or ions (ligands) may form a covalent or non-covalent bond. By way of example, a polynucleotide sequence present on a nucleic acid molecule may serve as a binding domain for a different nucleic acid molecule. Characteristics of binding sites are chemical specificity, a measure of the types of ligands that will bond, and affinity, which is a measure of the strength of the chemical bond.

[0029] As used herein, the term “blocked split activator molecule” refers to nucleic acid molecules that cannot bind to the first or second ribonucleoprotein complex (RNP) (i.e., RNP1 or RNP2) of the cascade assay to activate cis- or trans-cleavage. “Unblocked split activator molecule” refers to a formerly blocked split activator molecule that can bind to the second RNP complex (RNP2) to activate trans-cleavage of additional blocked split activator molecules; that is, an “unblocked split activator molecule” is the target nucleic acid for RNP2.ATTORNEY DOCKET NUMBER: VB034PCT

[0030] The terms “Cas RNA-guided endonuclease” or “CRISPR nuclease” or “nucleic acid-guided nuclease” refer to a CRISPR-associated protein that is an RNA-guided endonuclease suitable for assembly with a sequence-specific gRNA to form a ribonucleoprotein (RNP) complex.

[0031] As used herein, the terms “cis-cleavage”, “cis-endonuclease activity”, “cismediated endonuclease activity”, “cis-nuclease activity”, “cis-mediated nuclease activity”, and variations thereof refer to sequence- specific cleavage of a target nucleic acid of interest, including an unblocked split activator molecule, by a nucleic acid- guided nuclease in an RNP complex. Cis-cleavage is a single turn-over cleavage event in that only one substrate molecule is cleaved per event.

[0032] The term "complementary" as used herein refers to Watson-Crick base pairing between nucleotides and specifically refers to nucleotides hydrogen-bonded to one another with thymine or uracil residues linked to adenine residues by two hydrogen bonds and cytosine and guanine residues linked by three hydrogen bonds. In general, a nucleic acid includes a nucleotide sequence described as having a "percent complementarity" or “percent homology” to a specified second nucleotide sequence. For example, a nucleotide sequence may have 80%, 90%, or 100% complementarity to a specified second nucleotide sequence, indicating that 8 of 10, 9 of 10, or 10 of 10 nucleotides of a sequence are complementary to the specified second nucleotide sequence. For instance, the nucleotide sequence 3'-TCGA-5' is 100% complementary to the nucleotide sequence 5'-AGCT-3'; and the nucleotide sequence 3'-ATCGAT-5' is 100% complementary to a region of the nucleotide sequence 5'-GCTAGCTAG-3'.

[0033] As used herein, the term “contacting” refers to placement of two moieties in direct physical association, including in solid or liquid form. Contacting can occur in vitro with isolated cells (for example in a tissue culture dish or other vessel) or in samples or in vivo by administering an agent to a subject.

[0034] A “control” is a reference standard of a known value or range of values.

[0035] The terms “guide nucleic acid” or “guide RNA” or “gRNA” refer to a polynucleotide comprising 1) a crRNA region or guide sequence capable of hybridizing to the target strand of a target nucleic acid of interest, and 2) a scaffold sequence capable of interacting or complexing with a nucleic acid-guided nuclease. The crRNA region of the gRNA is a customizable component that enables specificity in every nucleic acid- guided nuclease reaction. A gRNA can include any polynucleotide sequence having sufficient complementarity with a target nucleic acid of interest to hybridize with theATTORNEY DOCKET NUMBER: VB034PCT target nucleic acid of interest and to direct sequence-specific binding of a ribonucleoprotein complex (RNP) containing the gRNA and nucleic acid-guided nuclease to the target nucleic acid.

[0036] ‘ ‘Modified” refers to a changed state or structure of a molecule. Molecules may be modified in many ways including chemically, structurally, and functionally. In one embodiment, a nucleic acid molecule (for example, a blocked split activator molecule) may be modified by the introduction of non-natural nucleosides, nucleotides, and / or internucleoside linkages. In another embodiment, a modified protein (e.g., a nucleic acid-guided nuclease) may refer to any polypeptide sequence alteration which is different from the wildtype.

[0037] The terms “percent sequence identity”, “percent identity”, or “sequence identity” refer to percent (%) sequence identity with respect to a reference polynucleotide or polypeptide sequence following alignment by standard techniques. Alignment for purposes of determining percent sequence identity can be achieved in various ways that are within the capabilities of one of skill in the art, for example, using publicly available computer software such as BLAST, BLAST-2, PSLBLAST, or MEGALIGN™ software. In some embodiments, the software is MUSCLE (Edgar, Nucleic Acids Res., 32(5): 1792-1797 (2004)). Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. For example, in embodiments, percent sequence identity values are generated using the sequence comparison computer program BLAST (Altschul, et al., J. Mol. Biol., 215:403-410 (1990)).

[0038] As used herein, the terms “preassembled ribonucleoprotein complex”, “ribonucleoprotein complex”, “RNP complex”, or “RNP” refer to a complex containing a guide RNA (gRNA) and a nucleic acid-guided nuclease, where the gRNA is integrated with the nucleic acid-guided nuclease. The gRNA, which includes a sequence complementary to a target nucleic acid of interest, guides the RNP to the target nucleic acid of interest and hybridizes to it. The hybridized target nucleic acid- gRNA units are cleaved by the nucleic acid-guided nuclease. In the cascade assays described herein, a first ribonucleoprotein complex (RNP1) includes a first guide RNA (gRNA) specific to a nucleic acid target nucleic acid of interest, and a first nucleic acid- guided nuclease, such as, for example, casl2a or casl4a for a DNA target nucleic acid, or casl3a for an RNA target nucleic acid. A second ribonucleoprotein complex (RNP2)ATTORNEY DOCKET NUMBER: VB034PCT for signal amplification includes a second guide RNA specific to an unblocked nucleic acid, and a second nucleic acid-guided nuclease, which may be different from or the same as the first nucleic acid-guided nuclease.

[0039] As used herein, the terms "protein" and "polypeptide" are used interchangeably. Proteins may or may not be made up entirely of amino acids.

[0040] As used herein, the term “sample” refers to tissues; cells or component parts; body fluids, including but not limited to peripheral blood, serum, plasma, ascites, urine, cerebrospinal fluid (CSF), sputum, saliva, bone marrow, synovial fluid, aqueous humor, amniotic fluid, cerumen, breast milk, broncheoalveolar lavage fluid, semen, prostatic fluid, cowper's fluid or pre-ejaculatory fluid, sweat, fecal matter, hair, tears, cyst fluid, pleural and peritoneal fluid, pericardial fluid, lymph, chyme, chyle, bile, interstitial fluid, menses, pus, sebum, vomit, vaginal secretions, mucosal secretion, stool water, pancreatic juice, lavage fluids from sinus cavities, bronchopulmonary aspirates, blastocyl cavity fluid, and umbilical cord blood. “Sample” may also refer to specimen or aliquots from food; agricultural products; pharmaceuticals; cosmetics, nutraceuticals; personal care products; environmental substances such as soil, water, air, or sewer sample; industrial sites and products; and chemicals and compounds. A sample further may include a homogenate, lysate or extract. A sample further refers to a medium, such as a nutrient broth or gel, which may contain cellular components, such as proteins or nucleic acid molecules.

[0041] The terms "target DNA sequence", “target RNA sequence”, “target sequence”, “target nucleic acid of interest”, “target molecule of interest”, “target nucleic acid”, or “target of interest” refer to any locus that is recognized by a gRNA sequence in vitro or in vivo. The “target strand” of a target nucleic acid of interest is the strand of a doublestranded target nucleic acid that is complementary to a gRNA. The spacer sequence of a gRNA may be 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, 98%, 99% or more complementary to the target nucleic acid of interest. Optimal alignment can be determined with the use of any suitable algorithm for aligning sequences. Full complementarity is not necessarily required provided there is sufficient complementarity to cause hybridization and trans-cleavage activation of an RNP complex. A target nucleic acid of interest can include any polynucleotide, such as DNA (ssDNA or dsDNA) or RNA polynucleotides. A target nucleic acid of interest may be located in the nucleus or cytoplasm of a cell such as, for example, within an organelle of a eukaryotic cell, such as a mitochondrion or a chloroplast, or it can be exogenous toATTORNEY DOCKET NUMBER: VB034PCT a host cell, such as a eukaryotic cell or a prokaryotic cell. The target nucleic acid of interest may be present in a sample, such as a biological or environmental sample, and it can be a viral nucleic acid molecule, a bacterial nucleic acid molecule, a fungal nucleic acid molecule, or a polynucleotide of another organism, such as a coding or a non-coding sequence, and it may include single-stranded or double-stranded DNA molecules, such as a cDNA or genomic DNA, or RNA molecules, such as pre-mRNA, mRNA, tRNA, and rRNA. The target nucleic acid of interest may be associated with a protospacer adjacent motif (PAM) sequence, which may include a 2-5 base pair sequence adjacent to the protospacer. In some embodiments 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more target nucleic acids can be detected by the disclosed method.

[0042] As used herein, the terms “trans-cleavage”, “trans-endonuclease activity”, “trans-mediated endonuclease activity”, “trans-nuclease activity”, “trans-mediated nuclease activity” and variations thereof refer to indiscriminate, non-sequence-specific cleavage of a nucleic acid molecule by an endonuclease (such as by a Casl2, Casl3, and Casl4) which is triggered by cis- (sequence-specific) cleavage. Trans-cleavage is a “multiple turn-over” event, in that more than one substrate molecule is cleaved after initiation by a single turn-over cis-cleavage event.

[0043] Type V CRISPR / Cas nucleic acid-guided nucleases are a subtype of Class 2 CRISPR / Cas effector nucleases such as, but not limited to, engineered Casl2a, Casl2b, Casl2c, C2c4, C2c8, C2c5, C2cl0, C2c9, CasX (Casl2e), CasY (Casl2d), Cas 13a nucleases or naturally-occurring proteins, such as a Casl2a isolated from, for example, Francisella tularensis subsp. novicida (Gene ID: 60806594), Candidatus Methanoplasma termitum (Gene ID: 24818655), Candidatus Methanomethylophilus alvus (Gene ID: 15139718), and Eubacterium eligens ATCC 27750 (Gene ID: 41356122), and an artificial polypeptide, such as a chimeric protein.

[0044] The term "variant" refers to a polypeptide or polynucleotide that differs from a reference polypeptide or polynucleotide but retains essential properties. A typical variant of a polypeptide differs in amino acid sequence from another reference polypeptide. Generally, differences are limited so that the sequences of the reference polypeptide and the variant are closely similar overall and, in many if not most regions, identical. A variant and reference polypeptide may differ in amino acid sequence by one or more modifications (e.g., substitutions, additions, and / or deletions). A variant of a polypeptide may be a conservatively modified variant. A substituted or inserted amino acid residue may or may not be one encoded by the genetic code (e.g., a non-naturalATTORNEY DOCKET NUMBER: VB034PCT amino acid). A variant of a polypeptide may be naturally occurring, such as an allelic variant, or it may be a variant that is not known to occur naturally. Variants include modifications-including chemical modifications-to one or more amino acids that do not involve amino acid substitutions, additions or deletions.

[0045] A “vector” is any of a variety of nucleic acids that comprise a desired sequence or sequences to be delivered to and / or expressed in a cell. Vectors are typically composed of DNA, although RNA vectors are also available. Vectors include, but are not limited to, plasmids, fosmids, phagemids, virus genomes, synthetic chromosomes, and the like.DETAILED DESCRIPTION

[0046] The present disclosure provides compositions of matter and signal boost assay methods for detecting target nucleic acids of interest in a sample without the need for amplifying the target nucleic acids of interest. The compositions and methods provide for massive multiplexing, high fidelity, low background, high signal-to-noise ratios, low cost, minimum workflow, with results at ambient temperatures.

[0047] The cascade assays described herein comprise first and second ribonucleoprotein complexes and blocked split activator molecules. The blocked split activator molecules by and large keep the second ribonucleoprotein complexes “locked” unless and until a target nucleic acid of interest activates the first ribonucleoprotein complex. By “locked” it is meant that the blocked split activator molecules are designed in such a way that they are largely blocked from interacting with the ribonucleoprotein complexes; therefore, the ribonucleoprotein complexes remain largely inactive (i.e., “locked”) unless and until a target nucleic acid of interest activates the first ribonucleoprotein complex. The improvement to the prior art cascade assay methods described herein involves a specially-configured blocked split activator molecule that does not activate the second ribonucleoprotein complex prematurely, thereby minimizing false positive signals. The methods comprise the steps of providing cascade assay components comprising the blocked split activator molecules, contacting the cascade assay components with a sample, and detecting a signal that is generated only when a target nucleic acid of interest is present in the sample.

[0048] Early and accurate identification of, e.g., infectious agents, microbe contamination, variant nucleic acid sequences that indicate the presence of such diseases such as cancer or contamination by heterologous sources is important in orderATTORNEY DOCKET NUMBER: VB034PCT to select correct treatment; identify tainted food, pharmaceuticals, cosmetics and other commercial goods; and to monitor the environment. However, currently available state-of-the-art nucleic acid detection such as quantitative PCR (also known as real time PCR or qPCR) relies on DNA amplification, which requires time and may lead to changes to the relative proportion of nucleic acids, particularly in multiplexed nucleic acid assays. The lack of rapidity for qPCR assays is due to the fact that there is a significant lag phase early in the amplification process where fluorescence above background cannot be detected. That is, there is a lag until the cycle threshold or Ct value, which is the number of amplification cycles required for the fluorescent signal to exceed the background level of fluorescence, is achieved and can be quantified.

[0049] The present disclosure describes a signal boost cascade assay and improvements thereto that can detect one or more target nucleic acids of interest (e.g., DNA, RNA and / or cDNA) without the need for amplifying the target nucleic acid(s) of interest, thereby avoiding the drawbacks of multiplex amplification, such as primerdimerization. As described in detail below, the cascade assays utilize a signal amplification mechanism comprising various components including nucleic acid- guided nucleases, guide RNAs (gRNAs) incorporated into ribonucleoprotein complexes (RNPs), specially-configured blocked split activator molecules, and reporter moieties. A particularly advantageous feature of the cascade assay is that with the exception of the gRNA (gRNAl) in RNP1 the cascade assay components can be essentially identical, if desired, no matter what target nucleic acid(s) of interest are being detected, and gRNAl is easily programmable.

[0050] The improvement to the signal amplification or signal boost cascade assay described herein is drawn to being able to employ blocked split activator molecules are complementary to the guide nucleic acid in the second ribonucleoprotein complex (RNP2. Each blocked split activator molecule when unblocked is capable of activating RNP2 and thus the trans-cleavage activity of RNP2.

[0051] As noted above, the downside to currently available nucleic acid-guided nuclease detection assays is that they rely on DNA amplification, which, in addition to issues with multiplexing, significantly hinders the ability to perform rapid point-of-care testing. The lack of rapidity is, at least in-part, due to cis-cleavage of a target nucleic acid of interest being a single turnover event in which the number of activated enzyme complexes is, at most, equal to the number of copies of the target nucleic acids of interest in the sample; thus, PCR amplification affects the rapidity of currently availableATTORNEY DOCKET NUMBER: VB034PCT nucleic acid-guided nuclease detection systems. Once the ribonucleoprotein complex is activated after completion of cis-cleavage, trans-cleavage activity of the reporter moieties that are initially quenched is generated. However, the turnover (Kcat) of, e.g., activated Casl2a complex is 17 / sec and 3 / sec for dsDNA and ssDNA targets, respectively. Therefore, for less than 10,000 target copies, the number of reporters cleaved is not sufficient to generate a signal in less than 30-60 minutes.

[0052] FIG. 1 provides a simplified diagram demonstrating a method (100) of a prior art cascade assay details of which are provided in USPNs 11,693,520; 11,702,686; 11,821,025; 11,970,730; 11,987,839; 11,884,921; 11,820,983; 11,859,182; 11,884,922; and 11,946,052. The cascade assay is initiated when the target nucleic acid of interest (104) binds to and activates a first pre-assembled ribonucleoprotein complex (RNP1) (102). A ribonucleoprotein complex comprises a guide RNA (gRNA) and a nucleic acid-guided nuclease, where the gRNA is integrated with the nucleic acid-guided nuclease. The gRNA, which includes a sequence complementary to the target nucleic acid of interest, guides an RNP complex to the target nucleic acid of interest and hybridizes to it. Typically, preassembled RNP complexes are employed in the reaction mixture — as opposed to separate nucleic acid-guided nucleases and gRNAs — to facilitate rapid detection of the target nucleic acid(s) of interest, if desired.

[0053] ‘ ‘Activation” of RNP1 (106) in the context of the cascade assay refers to activating trans-cleavage activity of the nucleic acid-guided nuclease in RNP1 (106) by first initiating cis-cleavage where the target nucleic acid of interest is cleaved by the nucleic acid-guided nuclease, or at least upon specific binding of N nucleotide bases of a target nucleic acid of interest to the ribonucleoprotein complex. This cis-cleavage activity then initiates trans-cleavage activity (i.e., multi-turnover activity) of the nucleic acid-guided nuclease, where trans-cleavage is indiscriminate, leading to non-sequence- specific cutting of nucleic acid molecules by the nucleic acid-guided nuclease of RNP1 (102). This trans-cleavage activity triggers activation of blocked ribonucleoprotein complexes (RNP2s) (108) via blocked nucleic acid molecules, which are described in detail below. Each newly activated RNP2 (110) activates more RNP2s (108 110), which in turn cleave reporter moieties (112). The reporter moieties (112) may be a synthetic molecule linked or conjugated to a quencher (114) and a fluorophore (116) such as, for example, a probe with a dye label (e.g., FAM or FITC) on the 5' end and a quencher on the 3' end. The quencher (114) and fluorophore (116) can be about 20-30ATTORNEY DOCKET NUMBER: VB034PCT bases apart or less for effective quenching via fluorescence resonance energy transfer (FRET).

[0054] As more RNP2s are activated (108 110), more trans-cleavage activity is activated and more reporter moieties (118) are unquenched; thus, the binding of the target nucleic acid of interest (104) to RNP1 (102) initiates what becomes a cascade of signal production (120), which increases exponentially, hence, the terms signal amplification or signal boost. The cascade assay thus comprises a single turnover event that triggers a multi-turnover event that then triggers another multi-turnover event. The reporter moieties (112) may be provided as molecules that are separate from the other components of the nucleic acid-guided nuclease cascade assay, or the reporter moieties may be covalently or non-covalently linked to the blocked nucleic acid molecules.Target Nucleic Acids of Interest

[0055] The target nucleic acid of interest may be a DNA, RNA, or cDNA molecule. Target nucleic acids of interest may be isolated from a sample or organism by standard laboratory techniques or may be synthesized by standard laboratory techniques (e.g., RT-PCR). The target nucleic acids of interest are identified in a sample, such as a biological sample from a subject (including non-human animals or plants), items of manufacture, or an environmental sample (e.g., water or soil). Non-limiting examples of biological samples include blood, serum, plasma, saliva, mucus, a nasal swab, a buccal swab, a cell, a cell culture, and tissue. The source of the sample could be any mammal, such as, but not limited to, a human, primate, monkey, cat, dog, mouse, pig, cow, horse, sheep (and other livestock), and bat. Samples may also be obtained from any other source, such as air, water, soil, surfaces, food, beverages, nutraceuticals, clinical sites or products, industrial sites and products, plants and grains, cosmetics, personal care products, pharmaceuticals, medical devices, agricultural equipment and sites, and commercial samples.

[0056] In some embodiments, the target nucleic acid of interest is from an infectious agent (e.g., a bacteria, protozoan, insect, worm, virus, or fungus) that affects mammals. As a non-limiting example, the target nucleic acid of interest could be one or more nucleic acid molecules from bacteria, such as Bordetella parapertussis, Bordetella pertussis, Chlamydia pneumoniae, Legionella pneumophila, Mycoplasma pneumoniae, Acinetobacter calcoaceticus-baumannii complex, Bacteroides fragilis, Enterobacter cloacae complex, Escherichia coli, Klebsiella aerogenes, Klebsiella oxytoca, KlebsiellaATTORNEY DOCKET NUMBER: VB034PCT pneumoniae group, Moraxella catarrhalis, Proteus sp., Salmonella enterica, Serratia marcescens, Haemophilus influenzae, Neisseria meningitidis, Pseudomonas aeruginosa, Stenotrophomonas maltophilia, Enterococcus faecalis, Enterococcus faecium, Listeria monocytogenes, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus lugdunensis, Streptococcus agalactiae, Streptococcus pneumoniae, Streptococcus pyogenes, Chlamydia tracomatis, Neisseria gonorrhoeae, Syphilis (Treponema pallidum), Ureaplasma urealyticum, Mycoplasma genitalium, and / or Gardnerella vaginalis.

[0057] As a non-limiting example, the target nucleic acid of interest could be one or more nucleic acid molecules from a virus, such as adenovirus, coronavirus HKU1, coronavirus NL63, coronavirus 229E, coronavirus OC43, severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), human metapneumovirus, human rhinovirus, enterovirus, influenza A, influenza A / Hl, influenza A / H3, influenza A / Hl-2009, influenza B, parainfluenza virus 1, parainfluenza virus 2, parainfluenza virus 3, parainfluenza virus 4, respiratory syncytial virus, herpes simplex virus 1, herpes simplex virus 2, human immunodeficiency virus (HIV), human papillomavirus, hepatitis A virus (HAV), hepatitis B virus (HBV), hepatitis C virus (HCV), and / or human parvovirus B19 (B19V).

[0058] Also, as a non-limiting example, the target nucleic acid of interest could be one or more nucleic acid molecules from a fungus, such as Candida albicans, Candida auris, Candida glabrata, Candida krusei, Candida parapsilosis, Candida tropicalis, Cryptococcus neoformans, and / or Cryptococcus gattii. As another non-limiting example, the target nucleic acid of interest could be one or more nucleic acid molecules from a protozoan, such as Trichomonas vaginalis, Bonamia exitiosa, Bonamia ostreae, Leishmania amazonensis, Leishmania braziliensis, Leishmania donovani, Leishmania infantum, Leishmania major, Leishmania mexicana, Leishmania tropica, Marteilia refringens, Perkinsus marinus, Perkinsus olseni, Theileria annulata, Theileria equi, Theileria parva, Tritrichomonas foetus, Trypanosoma brucei, Trypanosoma congolense, Trypanosoma equiperdum, Trypanosoma evansi and, Trypanosoma vivax.

[0059] Additionally, the target nucleic acid of interest may originate in an organism such as a bacterium, virus, fungus or other pest that infects livestock or agricultural crops. Such organisms include avian influenza viruses, mycoplasma and other bovine mastitis pathogens, Clostridium perfringens, Campylobacter sp., Salmonella sp., Pospirivoidae, Avsunvirodiae, Panteoea stewartii, Mycoplasma genitalium,ATTORNEY DOCKET NUMBER: VB034PCTSprioplasma sp., Pseudomonas solanacearum, Erwinia amylovora, Erwinia carotovora, Pseudomonas syringae, Xanthomonas campestris, Agrobacterium tumefaciens, Spiroplasma citri, Phytophthora infestans, Endothia parasitica, Ceratocysis ulmi, Puccinia graminis, Hemilea vastatrix, Ustilage maydis, Ustilage nuda, Guignardia bidwellii, Uncinula necator, Botrytis cincerea, Plasmopara viticola, or Botryotinis fuckleina.

[0060] In some embodiments, other target nucleic acids of interest may be for non- infectious conditions, e.g., to be used for genotyping, including non-invasive prenatal diagnosis of, e.g, trisomies, other chromosomal abnormalities, and known genetic diseases such as Tay Sachs disease and sickle cell anemia. Other target nucleic acids of interest and samples are described herein. Target nucleic acids of interest may include engineered biologies, including cells such as chimeric antigen receptor T (CAR-T) cells, or target nucleic acids of interest from very small or rare samples, where only small volumes are available for testing.

[0061] The cascade assays described herein are particularly well-suited for simultaneous testing of multiple targets. Pools of two to 10,000 target nucleic acids of interest may be employed, e.g., 2-1000, 2-100, 2-50, or 2-10. Further testing may be used to identify the specific member of the pool, if warranted.

[0062] While the methods described herein do not require the target nucleic acid of interest to be DNA — and in fact it is specifically contemplated that the target nucleic acid of interest may be RNA — it is understood by those in the field that a reverse transcription step to convert target RNA to cDNA may be performed prior to or while contacting the biological sample with the composition. Alternatively, RNA target nucleic acids of interest can be detected directly via RNA-specific nucleic acid-guided nucleases such as Casl3a or Casl2g.Nucleic Acid-Guided Nucleases

[0063] The cascade assays comprise nucleic acid-guided nucleases in the reaction mixture, either provided as a protein, a coding sequence for the protein, or, in most embodiments, in a pre-assembled ribonucleoprotein (RNP) complex. In some embodiments, the one or more nucleic acid-guided nucleases in the reaction mixture may be, for example, a Cas endonuclease. Any nucleic acid-guided nuclease having both cis- and trans-endonuclease activity may be employed, and the same nucleic acid- guided nuclease may be used for both RNP complexes or different nucleic acid-guidedATTORNEY DOCKET NUMBER: VB034PCT nucleases may be used in RNP1 and RNP2. Note that trans-cleavage activity is not triggered unless and until cis-cleavage activity (i.e., sequence-specific activity) is initiated. Nucleic acid-guided nucleases include Type V and Type VI nucleic acid- guided nucleases, as well as nucleic acid-guided nucleases that comprise a RuvC nuclease domain or a RuvC-like nuclease domain but lack an HNH nuclease domain. Nucleic acid-guided nucleases with these properties are reviewed in Makarova and Koonin, Methods Mol. Biol., 1311:47-75 (2015) and Koonin, et al., Current Opinion in Microbiology, 37:67-78 (2020) and updated databases of nucleic acid-guided nucleases and nuclease systems that include newly-discovered systems include BioGRID ORCS (orcs:thebiogrid.org); GenomeCRISPR (genomecrispr.org); Plant Genome Editing Database (plantcrispr.org) and CRISPRCasFinder (crispercas.i2bc.paris-saclay.fr).

[0064] The type of nucleic acid-guided nuclease utilized in the method of detection depends on the type of target nucleic acid of interest to be detected. For example, a DNA-cleaving nucleic acid-guided nuclease (e.g., a Casl2a, Casl4a, or Cas3) should be utilized if the target nucleic acid of interest is a DNA molecule, and an RNA-cleaving nucleic acid-guided nuclease (e.g., Casl3a or Casl2g) should be utilized if the target nucleic acid of interest is an RNA molecule. Exemplary nucleic acid-guided nucleases include, but are not limited to, Cas RNA-guided DNA endonucleases, such as Cas3, Casl2a (e.g., AsCasl2a, EbCasl2a), Casl2b, Casl2c, Casl2d, Casl2e, Casl4, Casl2h, Casl2i, and Casl2j; Cas RNA-guided RNA endonucleases, such as Casl3a (EbaCasl3, EbuCasl3, EwaCasl3), Casl3b (e.g., CccaCasl3b, PsmCasl3b), and Casl2g; and any other nucleic acid (DNA, RNA, or cDNA) targeting nucleic acid-guided nuclease with cis-cleavage activity and collateral trans-cleavage activity. In some embodiments, the nucleic acid-guided nuclease is a Type V CRISPR-Cas nuclease, such as a Cas 12a, Casl3a, or Casl4a. In some embodiments, the nucleic acid-guided nuclease is a Type I CRISPR-Cas nuclease, such as Cas3. Type II and Type VI nucleic acid-guided nucleases may also be employed.Guide RNA (gRNA)

[0065] The present disclosure detects a target nucleic acid of interest via a reaction mixture containing at least two different guide RNAs (gRNAs) each incorporated into an RNP complex (i.e., RNP1 or RNP2). Suitable gRNAs each include at least one crRNA region to enable specificity in every reaction. The gRNA of RNP1 is specific to a target nucleic acid of interest and the gRNA of RNP2 is specific an unblocked splitATTORNEY DOCKET NUMBER: VB034PCT activator molecule (described in detail below). Like the nucleic acid-guided nuclease, the gRNA in most embodiments is provided in the cascade assay reaction mixture in a preassembled RNP but may also be provided as an RNA molecule or as a DNA sequence to be transcribed, in, e.g., a vector backbone. Providing the gRNA in a preassembled RNP complex (i.e., RNP1 or RNP2) is preferred if rapid assay kinetics are preferred. If provided as a gRNA molecule, the gRNA sequence may include multiple endoribonuclease recognition sites (e.g., Csy4) for multiplex processing. Alternatively, if provided as a DNA sequence to be transcribed, an endoribonuclease recognition site is encoded between neighboring gRNA sequences and more than one gRNA can be transcribed in a single expression cassette. Direct repeats can also serve as endoribonuclease recognition sites for multiplex processing. Guide RNAs are generally about 20 nucleotides to about 300 nucleotides in length and may contain a spacer sequence containing a plurality of bases and complementarity to a protospacer sequence in the target sequence (or unblocked split activator molecule). The gRNA spacer sequence may be 50%, 60%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 97.5%, 98%, 99%, or more complementary to its intended target nucleic acid of interest.

[0066] The gRNA of RNP1 is capable of complexing with the nucleic acid-guided nuclease of RNP1 to perform cis-cleavage of a target nucleic acid of interest (i.e., a DNA or RNA), which triggers non-sequence-specific trans-cleavage of other molecules in the reaction mixture. Guide RNAs include any polynucleotide sequence having sufficient complementarity with a target nucleic acid of interest in the case of gRNAl or unblocked split activator molecules in the case of gRNA2. Target nucleic acids of interest may include a protospacer-adjacent motif (PAM), and, following gRNA binding, the nucleic acid-guided nuclease induces a double-stranded break either inside or outside the protospacer region of the target nucleic acid of interest.

[0067] In any of the foregoing embodiments, the gRNA may be a modified or non- naturally occurring nucleic acid molecule. In some embodiments, the gRNAs of the disclosure may further contain a locked nucleic acid (LNA), a bridged nucleic acid (BNA), and / or a peptide nucleic acid (PNA). By way of further example, a modified nucleic acid molecule may contain a modified or non-naturally occurring nucleoside, nucleotide, and / or internucleoside linkage, such as a 2'-O-methyl (2'-0-Me) modified nucleoside, a 2'-fluoro (2'-F) modified nucleoside, and a phosphorothioate (PS) bond, or any other nucleic acid molecule modifications described herein.ATTORNEY DOCKET NUMBER: VB034PCTRibonucleoprotein (RNP) Complex

[0068] As described above, although the assay “reaction mixture” may comprise separate nucleic acid-guided nucleases and gRNAs (or coding sequences therefor), the cascade assay reaction mixtures preferably comprise preassembled ribonucleoprotein complexes (RNPs), allowing for faster detection kinetics. The present cascade assay employs at least two types of RNP complexes, RNP1 and RNP2, each type containing a nucleic acid- guided nuclease and a gRNA. RNP1 and RNP2 may comprise the same nucleic acid-guided nuclease or may comprise different nucleic acid-guided nucleases; however, the gRNAs in RNP1 and RNP2 are different and are configured to detect different nucleic acids. In some embodiments, the reaction mixture contains about 1 fM to about 10 pM of a given RNP1, or about 1 pM to about 1 M of a given RNP1, or about 10 pM to about 500 pM of a given RNP1. In some embodiments the reaction mixture contains about 6 x 104to about 6 x 1012complexes per microliter (pl) of a given RNP1, or about 6 x 106to about 6 x 1010complexes per microliter (pl) of a given RNP1. In some embodiments, the reaction mixture contains about 1 fM to about 500 pM of a given RNP2, or about 1 pM to about 250 pM of a given RNP2, or about 10 pM to about 100 pM of a given RNP2. In some embodiments the reaction mixture contains about 6 x 104to about 6 x 1012complexes per microliter (pl) of a given RNP2 or about 6 x 106to about 6 x 1012complexes per microliter (pl) of a given RNP2.

[0069] In any of the embodiments of the disclosure, the reaction mixture includes 1 to about 1,000 different RNPls (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 27, 28, 19, 20, 21, 22, 23, 24, 25, 50, 75, 100, 125, 150, 175, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, or 1,0000 RNPls), where different RNPls comprise a different gRNA (or crRNA thereof) polynucleotide sequence. For example, a reaction mixture designed for environmental or oncology testing comprises more than one unique RNPl-gRNA (or RNPl-crRNA) ribonucleoprotein complex for the purpose of detecting more than one target nucleic acid of interest. That is, more than one RNP1 may be present for the purpose of targeting one target nucleic acid of interest from many sources or more than one RNP1 may be present for targeting more than one target nucleic acid of interest from a single organism or condition.

[0070] In any of the foregoing embodiments, the gRNA of RNP1 may be homologous or heterologous, relative to the gRNA of other RNPl(s) present in the reaction mixture. A homologous mixture of RNP1 gRNAs has a number of gRNAs with the same nucleotide sequence, whereas a heterologous mixture of RNP1 gRNAs has multipleATTORNEY DOCKET NUMBER: VB034PCT gRNAs with different nucleotide sequences (e.g., gRNAs targeting different loci, genes, variants, and / or microbial species). Therefore, the disclosed methods of identifying one or more target nucleic acids of interest may include a reaction mixture containing more than two heterologous gRNAs, more than three heterologous gRNAs, more than four heterologous gRNAs, more than five heterologous gRNAs, more than six heterologous gRNAs, more than seven heterologous gRNAs, more than eight heterologous gRNAs, more than nine heterologous gRNAs, more than ten heterologous gRNAs, more than eleven heterologous gRNAs, more than twelve heterologous gRNAs, more than thirteen heterologous gRNAs, more than fourteen heterologous gRNAs, more than fifteen heterologous gRNAs, more than sixteen heterologous gRNAs, more than seventeen heterologous gRNAs, more than eighteen heterologous gRNAs, more than nineteen heterologous gRNAs, more than twenty heterologous gRNAs, more than twenty-one heterologous gRNAs, more than twenty-three heterologous gRNAs, more than twenty-four heterologous gRNAs, or more than twenty-five heterologous gRNAs. Such a heterologous mixture of RNP1 gRNAs in a single reaction enables multiplex testing.

[0071] As a first non-limiting example of a heterologous mixture of RNP1 gRNAs, the reaction mixture may contain: a number of RNPls having a gRNA targeting parainfluenza virus 1; a number of RNPls having a gRNA targeting human metapneumo virus; a number of RNPls having a gRNA targeting human rhinovirus; a number of RNPls having a gRNA targeting human enterovirus; a number of RNP1 having a gRNA targeting respiratory syncytial virus; and a number of RNPls having a gRNA targeting coronavirus HKU1. As a second non-limiting example of a heterologous mixture of RNP1 gRNAs, the reaction mixture may contain: a number of RNPls containing a gRNA targeting two or more SARS-Co-V-2 variants, e.g., B.1.1.7, B.1.351, P.l, B.1.617.2, BA.l, BA.2, BA.2.12.1, BAA, and BA.5 and subvariants thereof.

[0072] As another non-limiting example of a heterologous mixture of RNP1 gRNAs, the reaction mixture may contain RNPls targeting two or more target nucleic acids of interest from, e.g., organisms that infect vineyards, such as Guignardia bidwellii, Uncinula necator, Botrytis cincerea, Plasmopara viticola, and Botryotinis fuckleina.ATTORNEY DOCKET NUMBER: VB034PCTReporter Moieties

[0073] The cascade assay in many embodiments detects a target nucleic acid of interest via detection of a signal generated in the reaction mixture by a reporter moiety. Depending on the type of reporter moiety used, trans- and / or cis-cleavage by the nucleic acid-guided nuclease in RNP2 releases a signal. In some embodiments, trans-cleavage of stand-alone (e.g., not bound to any blocked split activator molecules) reporter moieties may generate signal changes at rates that are proportional to the cleavage rate, as new RNP2s are activated over time (shown at bottom in FIG. 2A). Trans-cleavage by either an activated RNP1 or an activated RNP2 may release a signal; thus, when the reporter moiety is a separate molecule, the reporter moieties are activated quickly by the trans-cleavage activity. The reporter moiety can comprise DNA, RNA, a chimera of DNA and RNA, or an oligonucleotide with modified nucleic acids. The reporter moiety also can comprise both single- and double-stranded portions.

[0074] In alternative embodiments, the reporter moiety may be bound to the blocked split activator molecule, where trans-cleavage of the blocked split activator molecule and conversion to an unblocked split activator molecule may generate signal changes at rates that are proportional to the cleavage rate, as new RNP2s are activated over time, thus allowing for real time reporting of results. In this embodiment, the reaction kinetics of signal generation match that of the cascade assay reaction rate. The signal is generated as the blocked split activator molecule is unblocked, whether quickly or slowly.

[0075] The reporter moiety may be a synthetic molecule linked or conjugated to a reporter and quencher such as, for example, a TAQMAN® probe with a dye label (e.g., FAM or FITC) on the 5' end and a quencher on the 3' end. The reporter and quencher may be about 20-30 bases apart or less for effective quenching via fluorescence resonance energy transfer (FRET). Alternatively, signal generation may occur through different mechanisms. Other detectable moieties, labels, or reporters can also be used to detect a target nucleic acid of interest as described herein. Reporter moieties can be labeled in a variety of ways, including direct or indirect attachment of a detectable moiety such as a fluorescent moiety, hapten, or colorimetric moiety.

[0076] Examples of detectable moieties include various radioactive moieties, enzymes, prosthetic groups, fluorescent markers, luminescent markers, bioluminescent markers, metal particles, and protein-protein binding pairs, e.g., protein- antibody binding pairs. Examples of fluorescent moieties include, but are not limited to, yellow fluorescentATTORNEY DOCKET NUMBER: VB034PCT protein (YFP), green fluorescence protein (GFP), cyan fluorescence protein (CFP), umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, cyanines, dansyl chloride, phycocyanin, and phycoerythrin. Examples of bioluminescent markers include, but are not limited to, luciferase (e.g., bacterial, firefly, click beetle and the like), luciferin, and aequorin. Examples of enzyme systems having visually detectable signals include, but are not limited to, galactosidases, glucorinidases, phosphatases, peroxidases, and cholinesterases. Identifiable markers also include radioactive elements such as1251,35S,14C, or3H. Reporters can also include a change in pH or charge of the cascade assay reaction mixture.

[0077] The methods used to detect the generated signal will depend on the reporter moiety or moieties used. For example, a radioactive label can be detected using a scintillation counter, photographic film as in autoradiography, or storage phosphor imaging. Fluorescent labels can be detected by exciting the fluorochrome with the appropriate wavelength of light and detecting the resulting fluorescence. The fluorescence can be detected visually, by means of photographic film, by the use of electronic detectors such as charge coupled devices (CCDs) or photomultipliers and the like. Enzymatic labels can be detected by providing the appropriate substrates for the enzyme and detecting the resulting reaction product. Simple colorimetric labels can be detected by observing the color associated with the label. When pairs of fluorophores are used in an assay, fluorophores are chosen that have distinct emission patterns (wavelengths) so that they can be easily distinguished. In some embodiments, the signal can be detected by lateral flow assays (LFAs). Lateral flow tests are simple devices intended to detect the presence or absence of a target nucleic acid of interest in a sample. LFAs can use nucleic acid molecules conjugated nanoparticles (often gold, e.g., RNA-AuNPs or DNA-AuNPs) as a detection probe, which hybridizes to a complementary target sequence. The classic example of an LFA is the home pregnancy test.

[0078] For example, the method of detecting a target nucleic acid molecule in a sample using a cascade assay as described herein can involve contacting the reaction mixture with a labeled detection ssDNA containing a fluorescent resonance energy transfer (FRET) pair, a quencher / phosphor pair, or both. A FRET pair consists of a donor chromophore and an acceptor chromophore, where the acceptor chromophore may be a quencher molecule. FRET pairs (donor / acceptor) suitable for use include, but are notATTORNEY DOCKET NUMBER: VB034PCT limited to, EDANS / fluorescein, lAEDANS / fluorescein, fluorescein / tetramethylrhodamine, fluorescein / Cy 5, IEDANS / DABCYL, fluorescein / QSY™ (succinimidyl ester) -7, fluorescein / LC Red 640, fluorescein / Cy 5.5, Texas Red / DABCYL, BODIPY™ (4,4-difluoro-4-bora-3A,4A-diaza-s- indacene) / DABCYL, Lucifer yellow / DABCYL, coumarin / DABCYL, and fluorescein / LC Red 705. In addition, a fluorophore / quantum dot donor / acceptor pair can be used. EDANS is (5-((2-Aminoethyl)amino)naphthalene-l-sulfonic acid); IAEDANS is 5-({2-[(iodoacetyl)amino]ethyl}amino)naphthalene-l-sulfonic acid); DABCYL is 4-(4- dimethylaminophenyl) diazenylbenzoic acid. Useful quenchers include, but are not limited to, DABCYL, QSY™ (succinimidyl ester) 7 and QSY™ (succinimidyl ester) 33.

[0079] In any of the foregoing embodiments, the reporter moiety may comprise one or more modified nucleic acid molecules, containing a modified nucleoside or nucleotide. In some embodiments the modified nucleoside or nucleotide is chosen from 2'-O- methyl (2'-0-Me) modified nucleoside, a 2'-fluoro (2'-F) modified nucleoside, and a phosphorothioate (PS) bond, or any other nucleic acid molecule modifications described below.Nucleic Acid Modifications

[0080] For any of the nucleic acid molecules described herein (e.g., blocked split activator molecules, gRNAs, and / or reporter moieties), the nucleic acid molecules may be used in a wholly or partially modified form and it is contemplated that in many embodiments the blocked split activator molecules will comprise nucleic acid modifications to prevent trans-cleavage in specific regions of the blocked nucleic acid molecules. Typically, modifications to the blocked split activator molecules, gRNAs, and / or reporter moieties described herein are introduced to optimize the molecule’s biophysical properties, for example, to increase endonuclease resistance and / or increase thermal stability. Modifications typically are achieved by the incorporation of, for example, one or more alternative nucleosides, alternative sugar moieties, and / or alternative internucleoside linkages.

[0081] For example, one or more of the cascade assay components may include one or more of the following nucleoside modifications: 5-methylcytosine (5-me-C), 5- hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and otherATTORNEY DOCKET NUMBER: VB034PCT alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (-C=C-CH ?) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4- thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5 -trifluoromethyl and other 5- substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7- deazaadenine, and / or 3 -deazaguanine and 3-deazaadenine. The nucleic acid molecules described herein (i.e., blocked split activator molecules, gRNAs, and / or reporter moieties) may also include nucleobases in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2- aminopyridine, and / or 2-pyridone. Further modification of the nucleic acid molecules described herein may include nucleobases disclosed in USPN 3,687,808; Kroschwitz, ed., The Concise Encyclopedia of Polymer Science and Engineering, New York, John Wiley & Sons, 1990, pp. 858-859; Englisch, et al., Angewandte Chemie, 30:613 (1991); and Sanghvi, Chapter 16, Antisense Research and Applications, CRC Press, Gait, ed., 1993, pp. 289-302.

[0082] In addition to or as an alternative to nucleoside modifications, the cascade assay components may comprise 2' sugar modifications, including 2'-O-methyl (2’-0-Me), 2'-methoxyethoxy (2'-O-CH2CH2OCH3, also known as 2'-O-(2-methoxyethyl) or 2'- MOE), 2'-dimethylaminooxyethoxy, i.e., a O(CH2)2ON(CH3)2 group, also known as 2'- DMAOE, and / or 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O- dimethylamino-ethoxy-ethyl or 2'-DMAE0E), i.e., 2'-O-CH2OCH2N(CH3)2- Other possible 2'-modifications that can modify the nucleic acid molecules described herein (i.e., blocked split activator molecules, gRNAs, and / or reporter moieties) may include all possible orientations of OH; F; O-, S-, or N-alkyl (mono- or di-); O-, S-, or N-alkenyl (mono- or di-); O-, S- or N-alkynyl (mono- or di-); or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted Cl to CIO alkyl or C2 to CIO alkenyl and alkynyl. Other potential sugar substituent groups include, e.g., aminopropoxy (-OCH2CH2CH2NH2), allyl 1-CH2-CH=CH2). -O-allyl (-O-CH2- CH=CH2) and fluoro (F). 2'-sugar substituent groups may be in the arabino (up) position or ribo (down) position. In some embodiments, the 2'-arabino modification is 2'-F. Similar modifications may also be made at other positions on the interfering RNAATTORNEY DOCKET NUMBER: VB034PCT molecule, particularly the 3' position of the sugar on the 3' terminal nucleoside or in 2'- 5' linked oligonucleotides and the 5' position of 5' terminal nucleotide. Oligonucleotides may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar.

[0083] Finally, modifications to the cascade assay components may comprise internucleoside modifications such as phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates, 5'-alkylene phosphonates, phosphinates, phosphoramidates including 3 '-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, selenophosphates, and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein one or more internucleotide linkages is a 3' to 3', 5' to 5' or 2' to 2' linkage.The Signal Boosting Cascade Assay Employing Blocked Nucleic Acids

[0084] Before getting to the details relating to blocked split activator molecules and use of the blocked split activator molecules in a cascade assay, understanding the cascade assay itself is key. FIG. 1, described above, depicts the cascade assay generally. A specific embodiment of the cascade assay utilizing blocked nucleic acids is depicted in FIG. 2A. In this embodiment, a blocked nucleic acid is used to prevent the activation of RNP2 in the absence of a target nucleic acid of interest. The method (200) in FIG. 2 A begins with providing the cascade assay components RNP1 (201), RNP2 (202) and blocked nucleic acid molecules (203). RNP1 (201) comprises a gRNA specific for a target nucleic acid of interest and a nucleic acid-guided nuclease (e.g., Cas 12a or Cas 14 for a DNA target nucleic acid of interest or a Cas 13a for an RNA target nucleic acid of interest) and RNP2 (202) comprises a gRNA specific for an unblocked nucleic acid molecule and a nucleic acid-guided nuclease (again, Cas 12a or Cas 14 for a DNA unblocked nucleic acid molecule or a Cas 13a for an RNA unblocked nucleic acid molecule). As described above, the nucleic acid-guided nucleases in RNP1 (201) and RNP2 (202) can be the same or different depending on the type of target nucleic acid of interest and unblocked nucleic acid molecule. What is key, however, is that the nucleic acid-guided nucleases in RNP1 and RNP2 may be activated to have transcleavage activity following initiation of cis-cleavage activity.ATTORNEY DOCKET NUMBER: VB034PCT

[0085] In a first step, a sample comprising a target nucleic acid of interest (204) is added to the cascade assay reaction mixture. The target nucleic acid of interest (204) combines with and activates RNP1 (205) but does not interact with or activate RNP2(202). Once activated, RNP1 cuts the target nucleic acid of interest (204) via sequencespecific cis-cleavage, which then activates non-specific trans-cleavage of other nucleic acids present in the reaction mixture, including the blocked nucleic acid molecules(203). At least one of the blocked nucleic acid molecules (203) becomes an unblocked nucleic acid molecule (206) when the blocking moiety (207) is removed. “Blocking moiety” typically refers to one or more nucleoside modifications, topographical configurations such as secondary structures, and / or structural modifications such as 5' or 3' extensions on the target strand segment.

[0086] Once at least one of the blocked nucleic acid molecules (203) is unblocked, the unblocked nucleic acid molecule (206) can then interact with and activate an RNP2 (208). Because the nucleic acid-guided nucleases in the RNPls (205) and RNP2s (208) have both cis- and trans-cleavage activity, more blocked nucleic acid molecules (203) become unblocked nucleic acid molecules (206) triggering activation of more RNP2s (208) and more trans-cleavage activity in a cascade. FIG. 2A at bottom depicts the concurrent activation of reporter moieties. Intact reporter moieties (209) comprise a quencher (210) and a fluorophore (211) linked by a nucleic acid sequence. As described above in relation to FIG. 1, the reporter moieties are also subject to trans-cleavage by activated RNP1 (205) and RNP2 (208). The intact reporter moieties (209) become activated reporter moieties (212) when the quencher (210) is separated from the fluorophore (211), emitting a fluorescent signal (213). Signal strength increases rapidly as more blocked nucleic acid molecules (203) become unblocked nucleic acid molecules (206) triggering cis-cleavage activation of more RNP2s (208) and thus more trans-cleavage activity of the reporter moieties (209). Again, here the reporter moieties are shown as separate molecules from the blocked nucleic acid molecules, but other configurations may be employed.

[0087] FIG. 2B is a diagram showing an exemplary prior art blocked nucleic acid molecule (220) and an exemplary technique for unblocking the blocked nucleic acid molecules as described in, e.g., USPNs 11,693,520; 11,702,686; 11,821,025; 11,970,730; 11,987,839; 11,884,921; 11,820,983; 11,859,182; 11,884,922; and 11,946,052. A blocked single-stranded or double-stranded, circular or linear, DNA or RNA molecule (220) comprising a target strand (222) may contain a partialATTORNEY DOCKET NUMBER: VB034PCT hybridization with a complementary non-target strand nucleic acid molecule (224) containing unhybridized and cleavable secondary loop structures (226) (e.g., hairpin loops, tetraloops, pseudoknots, junctions, kissing hairpins, internal loops, bulges, and multibranch loops). Trans-cleavage of the loops by, e.g., activated RNPls or RNP2s, generates short strand nucleotide sequences (228) which, because of the short length and low melting temperature Tm, can dehybridize at room temperature (e.g., 15°-25°C), thereby unblocking the blocked nucleic acid molecule (220) to create an unblocked nucleic acid molecule (230), enabling the internalization of the unblocked nucleic acid molecule (230) (target strand) into an RNP2, leading to RNP2 activation.The Signal Boosting Cascade Assay Employing Blocked Split Activator Molecules

[0088] The present disclosure provides reaction mix compositions and methods for a signal boost cascade assay that reduces false positive signals resulting from undesired, non-specific unblocking of blocked nucleic acid molecules by configuring them as blocked split activator molecules. Non-specific unblocking of the blocked nucleic acid molecules leads to non-specific activation of RNP2 in the absence of a target nucleic acid of interest as shown in FIG. 3.

[0089] FIG. 3 at top is a simplified diagram of the “correct” pathway for unblocking a blocked nucleic acid molecule, where the unblocking is due to trans-cleavage of single-strand regions of a blocked nucleic acid molecule leading to activation of RNP2 (see, e.g., FIG. 2B). FIG. 3 at bottom illustrates a “failure” pathway, where the unblocking of the blocked nucleic acid molecule is due not to trans-cleavage of the blocked nucleic acid molecule and dissociation of the non-target strand oligonucleotide segments from the target strand, but instead is due to erroneous enzyme-mediated unwinding of the blocked nucleic acid molecule. In the failure pathway, the unblocking is due not to trans-cleavage of the blocked nucleic acid molecule, but instead is due to enzyme-mediated unwinding of the blocked nucleic acid molecule by the nucleic acid- guided nuclease in RNP2.

[0090] The unwinding of the blocked nucleic acid molecule may be triggered by the presence of a PAM in the blocked nucleic acid molecule, if present; however, even in blocked nucleic acid molecules lacking a PAM sequence unwinding can take place simply by the sequence complementarity between the blocked nucleic acid molecule (i.e., target molecule for RNP2) and gRNA2 which leads to DNA unpairing of the blocked nucleic acid molecule, R-loop formation, and subsequent activation of RNP2.ATTORNEY DOCKET NUMBER: VB034PCTThis erroneous activation of RNP2 triggers trans-cleavage activity of RNP2 and subsequent signal generation. In this failure pathway, a target nucleic acid of interest is not present and RNP1 trans-cleavage activity has not been activated, yet RNP2 becomes activated leading to a false positive signal. A solution, as described herein, involves configuring the blocked nucleic acid molecule as a blocked split activator molecule to maintain a tight “lock” on RNP2 in the absence of trans-cleavage activity triggered by the binding of a target nucleic acid of interest to RNP1 — thereby circumventing the failure pathway — but then to “reconstitute” the target portion of the unblocked split activator molecule once 3', 5', or 3' and 5' extensions of the target portion of the split activator has been trans-cleaved and removed.

[0091] FIG. 4 is a simplified diagram of an exemplary gRNA2 sequence and three exemplary blocked split activator molecules. At top of FIG. 4 is a gRNA with a crRNA sequence: 5' - CTCAGGGCGGACTGGGTGCTC - 3' [SEQ ID NO: 1]; and an unblocked “reconstituted” split activator sequence: 5' - CAGTCCCGCCTGAG - A(i8>- GAGCACC - 3' [SEQ ID NO:2]. The An8)here serves as a linker between the split portions of the target portion of the unblocked split activator molecule. There are three exemplary blocked split activator molecules in the center of FIG. 4, each split with fourteen nucleotides at the 5' end of the blocked split activator molecule and with seven nucleotides at the 3' end of the blocked split activator molecule.

[0092] The first exemplary blocked split activator molecule (400) is blocked with adenine nucleotides at the 5' end, comprising the sequence 5' - AAA<N> - CAGTCCCGCCTGAG - A(I8)- GAGCACC - 3' [SEQ ID NO:3]; the second exemplary blocked split activator molecule (410) is blocked with adenine nucleotides at the 3' end, comprising the sequence 5' - CAGTCCCGCCTGAG - A(I8)- GAGCACC- AAA(N) - 3' [SEQ ID NO:4]; and the third exemplary blocked split activator molecule (420) is blocked with adenine nucleotides at both the 5' and the 3' end, comprising the sequence 5' - AAA(N)- CAGTCCCGCCTGAG - A(I8)- GAGCACC - AAA(N)- 3' [SEQ ID NO:5]. In addition, simplified cartoons of these exemplary blocked split activator molecules are shown at left in FIG. 4. The first blocked split activator molecule (400) comprises four regions: a 5' target portion (402); a 3' target portion (403); a linker (404); and a 5' block (405). The second blocked split activator molecule (410) comprises four regions: a 5' target portion (402); a 3' target portion (403); a linker (404); and a 3' block (406). The third blocked split activator molecule (420) comprises five regions: a 5'ATTORNEY DOCKET NUMBER: VB034PCT target portion (402); a 3' target portion (403); a linker (404); a 5' block (405); and a 3' block (406).

[0093] The blocking moiety on each exemplary blocked split activator molecule shown is a sequence of adenine nucleotides. It has been determined that even one additional nucleotide at the 5' or 3' end of the split activator molecules will prevent activation of RNP2. Here, “AAA<N)” is used as an exemplary block; however, even one nucleotide A, T, U, C, or G may be used, and up to eight additional nucleotides of any sequence may be used, with the caveat that ribonucleotides should be used if the nucleic acid- guided nucleases in RNP1 and RNP2 are RNA-cleaving nucleic acid-guided nucleases, deoxyribonucleotides should be used if the nucleic acid-guided nucleases in RNP1 and RNP2 are DNA-cleaving nucleic acid-guided nucleases, and a mix of ribonucleotides and deoxyribonucleotides should be used if one of the nucleic acid-guided nucleases in RNP1 or RNP2 is an RNA-cleaving nucleic acid-guided nuclease and the other nucleic acid-guided nuclease is a DNA-cleaving nucleic acid-guided nuclease. Note that use of an additional nucleotide at the 5' or 3' end of the split activator molecule will prevent activation of RNP2; however, in some embodiments, it may be desired to used one or more additional nucleotides at both the 5' and 3' end of the blocked split activator molecules.

[0094] In this example, the target portion of the blocked split activator molecules are 21 nucleotides in length and have been split 14 / 7; however, the target portion may vary from 20 to 30 nucleotides in length and be split, e.g., 14 / 6, 13 / 7, 12 / 8, 11 / 9, 10 / 10, 9 / 11, 8 / 12, 7 / 13, or 6 / 14; or 14 / 7, 13 / 8, 12 / 9, 11 / 10, 10 / 11, 9 / 12, 8 / 13, 7 / 14, or 6 / 15; or 14 / 8, 13 / 9, 12 / 10, 11 / 11, 10 / 12, 9 / 13, 8 / 14, 7 / 15, or 6 / 16; or 14 / 9, 13 / 10, 12 / 11, 11 / 12, 10 / 13, 9 / 14, 8 / 15, 7 / 16, or 6 / 17; or 14 / 10, 13 / 11, 12 / 12, 11 / 13, 10 / 14, 9 / 15, 8 / 16, 7 / 17, or 6 / 18; or 14 / 11, 13 / 12, 12 / 13, 11 / 14, 10 / 15, 9 / 16, 8 / 17, 7 / 18, or 6 / 19; or 14 / 12, 13 / 13, 12 / 14, 11 / 15, 10 / 16, 9 / 17, 8 / 18, 7 / 19, or 6 / 20; or 14 / 13, 13 / 14, 12 / 15, 11 / 16, 10 / 17, 9 / 18, 8 / 19, 7 / 20, or 6 / 21; or 14 / 14, 13 / 15, 12 / 16, 11 / 17, 10 / 18, 9 / 19, 8 / 20, 7 / 21, or 6 / 22; or 14 / 15, 13 / 16, 12 / 17, 11 / 18, 10 / 19, 9 / 20, 8 / 21, 7 / 22, or 6 / 23; or 14 / 16, 13 / 17, 12 / 18, 11 / 19, 10 / 20, 9 / 21, 8 / 22, 7 / 23, or 6 / 24. It has been found that having a 5' portion of the split exceeding 14 nucleotides compromises the block (data not shown), suggesting that the first 15 or so 5' nucleotides is sufficient to activate RNP2. In addition, having less than six 5' nucleotides in a split may compromise hybridization stability.

[0095] Also in this example, the linker is shown as A(i8>; however, as with the exemplary 5' and 3' AAA<N) blocks, A(ig) is exemplary only. The linker that isATTORNEY DOCKET NUMBER: VB034PCT employed should be a linker that is resistant to trans-cleavage by both the nucleic acid- guided nuclease in both RNP1 and RNP2. Thus, if both RNP1 and RNP2 comprise a DNA-cleaving nucleic acid-guided nuclease, a linker employing ribonucleotides or a chemical linker should be employed. If both RNP1 and RNP2 comprise an RNA- cleaving nucleic acid-guided nuclease, a linker employing deoxyribonucleotides or a chemical linker should be employed. If one of RNP1 or RNP2 comprises a DNA- cleaving nucleic acid-guided nuclease and the other comprises an RNA-cleaving nucleic acid-guided nuclease, a chemical linker should be employed. The length of the linker typically ranges from 15 to 50 nucleotides in length, or the equivalent thereof, or from 20 to 40 nucleotides in length.

[0096] FIG. 5 is a simplified diagram showing the sequence of steps in an exemplary cascade assay utilizing blocked split activator molecules and is very similar to the cascade assay utilizing blocked nucleic acids depicted in FIG. 2A. In this embodiment, blocked split activator molecules are used to prevent the activation of RNP2 in the absence of a target nucleic acid of interest. The method (500) in FIG. 5 begins with providing the cascade assay components RNP1 (501), RNP2 (502) and blocked split activator molecules (503). RNP1 (501) comprises a gRNA specific for a target nucleic acid of interest and a nucleic acid-guided nuclease (e.g., Cas 12a or Cas 14 for a DNA target nucleic acid of interest or a Cas 13a for an RNA target nucleic acid of interest) and RNP2 (502) comprises a gRNA specific for an unblocked split activator molecule and a nucleic acid-guided nuclease (again, Cas 12a or Cas 14 for a DNA unblocked nucleic acid molecule or a Cas 13a for an RNA unblocked nucleic acid molecule). As described above, the nucleic acid-guided nucleases in RNP1 (501) and RNP2 (502) can be the same or different depending on the type of target nucleic acid of interest and unblocked nucleic acid molecule. What is key, however, is that the nucleic acid-guided nucleases in RNP1 and RNP2 may be activated to have trans-cleavage activity following initiation of cis-cleavage activity.

[0097] In a first step, a sample comprising a target nucleic acid of interest (504) is added to the cascade assay reaction mixture. The target nucleic acid of interest (504) combines with and activates RNP1 (505) but does not interact with or activate RNP2(502). Once activated, RNP1 cuts the target nucleic acid of interest (504) via sequencespecific cis-cleavage, which then activates non-specific trans-cleavage of other nucleic acids present in the reaction mixture, including the blocked split activator molecules(503). At least one of the blocked split activator molecules (503) becomes an unblockedATTORNEY DOCKET NUMBER: VB034PCT split activator molecule (506) when the blocking moiety (507) is removed. “Blocking moiety” in this context refers to one to eight additional nucleotides on the 5' or 3' end — or on both the 5' and 3' ends — of the blocked split activator molecules as depicted and described in relation to FIG. 4.

[0098] Once at least one of the blocked split activator molecules (503) is unblocked, the unblocked split activator molecule (506) can then interact with and activate an RNP2 (508). Because the nucleic acid-guided nucleases in the RNPls (505) and RNP2s (508) have both cis- and trans-cleavage activity, more blocked split activator molecules (503) become unblocked split activator molecules (506) triggering activation of more RNP2s (508) and more trans-cleavage activity in a cascade. FIG. 5 at bottom depicts the concurrent activation of reporter moieties. Intact reporter moieties (509) comprise a quencher (510) and a fluorophore (511) linked by a nucleic acid sequence. As described above in relation to FIG. 1, the reporter moieties are also subject to trans- cleavage by activated RNP1 (505) and RNP2 (508). The intact reporter moieties (509) become activated reporter moieties (512) when the quencher (510) is separated from the fluorophore (511), emitting a fluorescent signal (513). Signal strength increases rapidly as more blocked split activator molecules (503) become unblocked split activator molecules (506) triggering cis-cleavage activation of more RNP2s (508) and thus more trans-cleavage activity of the reporter moieties (509).Applications of the Cascade Assay

[0099] The present disclosure describes cascade assays for detecting one or more target nucleic acids of interest in a sample. The cascade assays allow for massive multiplexing and minimum workflow yet provide accurate results at low cost. Moreover, the various embodiments of the cascade assay are notable in that, with the exception of the gRNA in RNP1, the cascade assay components can stay the same no matter what target nucleic acid(s) of interest are being detected and RNP1 is easily reprogrammed.

[0100] Target nucleic acids of interest are derived from samples as described in more detail above. Suitable samples for testing include, but are not limited to, any environmental sample, such as air, water, soil, surface, food, clinical sites and products, industrial sites and products, pharmaceuticals, medical devices, nutraceuticals, cosmetics, personal care products, agricultural equipment and sites, and commercial samples, and any biological sample obtained from an organism or a part thereof, such as a plant, animal, or microbe. In some embodiments, the biological sample is obtainedATTORNEY DOCKET NUMBER: VB034PCT from an animal subject, such as a human subject. A biological sample is any solid or fluid sample obtained from, excreted by or secreted by any living organism, including, without limitation, single celled organisms, such as bacteria, yeast, protozoans, and amoebas among others, multicellular organisms including plants or animals, including samples from a healthy or apparently healthy human subject or a human patient affected by a condition or disease to be diagnosed or investigated, such as an infection with a pathogenic microorganism, such as a pathogenic bacteria or virus.

[0101] For example, a biological sample can be a biological fluid obtained from a human or non-human (e.g., livestock, pets, wildlife) animal, and may include but is not limited to blood, plasma, serum, urine, stool, sputum, mucous, lymph fluid, synovial fluid, bile, ascites, pleural effusion, seroma, saliva, cerebrospinal fluid, aqueous or vitreous humor, or any bodily secretion, a transudate, an exudate (for example, fluid obtained from an abscess or any other site of infection or inflammation), or fluid obtained from a joint (for example, a normal joint or a joint affected by disease, such as rheumatoid arthritis, osteoarthritis, gout or septic arthritis), or a swab of skin or mucosal membrane surface (e.g., a nasal or buccal swab).

[0102] In some embodiments, the sample can be a viral or bacterial sample or a biological sample that has been minimally processed, e.g., only treated with a brief lysis step prior to detection. In other embodiments, minimal processing can include thermal lysis at an elevated temperature to release nucleic acids. Suitable methods are contemplated in USPN 9,493,736, among other references. Common methods for cell lysis involve thermal, chemical, enzymatic, or mechanical treatment of the sample or a combination of those (see, e.g., Example I below). In some embodiments, minimal processing can include treating the sample with chaotropic salts such as guanidine isothiocyanate or guanidine HC1. Suitable methods are contemplated in USPN 8,809,519 and USPN 7,893,251, among other references. In some embodiments, minimal processing may include contacting the sample with reducing agents such as DTT or TCEP and EDTA to inactivate inhibitors and / or other nucleases present in the crude samples. In other embodiments, minimal processing for biofluids may include centrifuging the samples to obtain cell-debris free supernatant before applying the reagents. Suitable methods are contemplated in USPN 8,809,519, among other references. In still other embodiments, minimal processing may include performing DNA / RNA extraction to get purified nucleic acids before applying CRISPR Cascade reagents.ATTORNEY DOCKET NUMBER: VB034PCT

[0103] Table 1 below lists exemplary commercial sample processing kits, and Table 2 below lists point of care processing techniques.TABLE 1: Exemplary Commercial Sample and Nucleic Acid Processing KitsATTORNEY DOCKET NUMBER: VB034PCTTABLE 2: Point of Care Sample Processing Techniques

[0104] The components of the cascade assay may be provided in various kits for testing at, e.g., point of care facilities, in the field, pandemic testing sites, and the like. In one aspect, the kit for detecting a target nucleic acid of interest in a sample includes: first ribonucleoprotein complexes (RNPls), second ribonucleoprotein complexes (RNP2s), blocked nucleic acid molecules, a polymerase having 3'ATTORNEY DOCKET NUMBER: VB034PCT exonuclease activity, dNTPs, and reporter moieties. The first complex (RNP1) comprises a first nucleic acid-guided nuclease and a first gRNA, where the first gRNA includes a sequence complementary to the target nucleic acid(s) of interest. Binding of the first complex (RNP1) to the target nucleic acid(s) of interest activates trans-cleavage activity of the first nucleic acid-guided nuclease. The second complex (RNP2) comprises a second nucleic acid-guided nuclease and a second gRNA that is not complementary to the target nucleic acid of interest. The blocked nucleic acid molecule comprises a sequence complementary to the second gRNA, where trans-cleavage of the blocked nucleic acid molecule may result in an unblocked nucleic acid molecule and the unblocked nucleic acid molecule can bind to the second complex (RNP2), thereby activating the trans-cleavage activity of the second nucleic acid-guided nuclease. However, inclusion of the polymerase having 3' exonuclease activity improves performance of the assay by allowing for use of blocked nucleic acid molecules with tight “locks” to avoid false positives yet aids in the unblocking of the blocked nucleic acid molecules. Activating trans-cleavage activity in RNP2 results in an exponential increase in unblocked nucleic acid molecules and in active reporter moieties, where reporter moieties are nucleic acid molecules and / or are operably linked to the blocked nucleic acid molecules and produce a detectable signal upon cleavage by RNP2.

[0105] Any of the kits described herein may further include a sample collection device, e.g., a syringe, lancet, nasal swab, or buccal swab for collecting a biological sample from a subject, and / or a sample preparation reagent, e.g., a lysis reagent. Each component of the kit may be in separate container or two or more components may be in the same container. The kit may further include a lateral flow device used for contacting the biological sample with the reaction mixture, where a signal is generated to indicate the presence or absence of the target nucleic acid molecule of interest. In addition, the kit may further include instructions for use and other information.EXAMPLES

[0106] The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the present invention and are not intended to limit the scope of what the inventors regard as their invention, nor are they intended to represent or imply that the experiments below are all of or the only experiments performed. It will be appreciated by persons skilled in the art that numerous variations and / or modifications may be made to theATTORNEY DOCKET NUMBER: VB034PCT invention as shown in the specific aspects without departing from the spirit or scope of the invention as broadly described. The present aspects are, therefore, to be considered in all respects as illustrative and not restrictive.Example I: Preparation of Nucleic Acids of Interest

[0107] Mechanical lysis: Nucleic acids of interest may be isolated by various methods depending on the cell type and source (e.g., tissue, blood, saliva, environmental sample, etc.). Mechanical lysis is a widely-used cell lysis method and may be used to extract nucleic acids from bacterial, yeast, plant and mammalian cells. Cells are disrupted by agitating a cell suspension with “beads” at high speeds (beads for disrupting various types of cells can be sourced from, e.g., OPS Diagnostics (Lebanon NJ, US) and MP Biomedicals (Irvine, CA, USA)). Mechanical lysis via beads begins with harvesting cells in a tissue or liquid, where the cells are first centrifuged and pelleted. The supernatant is removed and replaced with a buffer containing detergents as well as lysozyme and protease. The cell suspension is mixed to promote breakdown of the proteins in the cells and the cell suspension then is combined with small beads (e.g., glass, steel, or ceramic beads) that are mixed (e.g., vortexed) with the cell suspension at high speeds. The beads collide with the cells, breaking open the cell membrane with shear forces. After “bead beating”, the cell suspension is centrifuged to pellet the cellular debris and beads, and the supernatant may be purified via a nucleic acid binding column (such as the MagMAX™ Viral / Pathogen Nucleic Acid Isolation Kit from ThermoFisher (Waltham, MA, USA) and others from Qiagen (Hilden, Germany), TakaraBio (San Jose, CA, USA), and Biocomma (Shenzen, China)) to collect the nucleic acids (see the discussion of solid phase extraction below).

[0108] Solid phase extraction (SPE): Another method for capturing nucleic acids is through solid phase extraction. SPE involves a liquid and stationary phase, which selectively separate the target analyte (here, nucleic acids) from the liquid in which the cells are suspended based on specific hydrophobic, polar, and / or ionic properties of the target analyte in the liquid and the stationary solid matrix. Silica binding columns and their derivatives are the most commonly used SPE techniques, having a high binding affinity for DNA under alkaline conditions and increased salt concentration; thus, a highly alkaline and concentrated salt buffer is used. The nucleicATTORNEY DOCKET NUMBER: VB034PCT acid sample is centrifuged through a column with a highly porous and high surface area silica matrix, where binding occurs via the affinity between negatively charged nucleic acids and positively charged silica material. The nucleic acids bind to the silica matrices, while the other cell components and chemicals pass through the matrix without binding. One or more wash steps typically are performed after the initial sample binding (i.e., the nucleic acids to the matrix), to further purify the bound nucleic acids, removing excess chemicals and cellular components non- specifically bound to the silica matrix. Alternative versions of SPE include reverse SPE and ion exchange SPE, and use of glass particles, cellulose matrices, and magnetic beads.

[0109] Thermal lysis: Thermal lysis involves heating a sample of mammalian cells, virions, or bacterial cells at high temperatures thereby damaging the cellular membranes by denaturizing the membrane proteins. Denaturizing the membrane proteins results in the release of intracellular DNA. Cells are generally heated above 90°C, however time and temperature may vary depending on sample volume and sample type. Once lysed, typically one or more downstream methods, such as use of nucleic acid binding columns for solid phase extraction as described above, are required to further purify the nucleic acids.

[0110] Physical lysis: Common physical lysis methods include sonication and osmotic shock. Sonication involves creating and rupturing of cavities or bubbles to release shockwaves, thereby disintegrating the cellular membranes of the cells. In the sonication process, cells are added into lysis buffer, often containing phenylmethylsulfonyl fluoride, to inhibit proteases. The cell samples are then placed in a water bath and a sonication wand is placed directly into the sample solution. Sonication typically occurs between 20-50kHz, causing cavities to be formed throughout the solution as a result of the ultrasonic vibrations; subsequent reduction of pressure then causes the collapse of the cavity or bubble resulting in a large amount of mechanical energy being released in the form of a shockwave that propagates through the solution and disintegrates the cellular membrane. The duration of the sonication pulses and number of pulses performed varies depending on cell type and the downstream application. After sonication, the cell suspension typically is centrifuged to pellet the cellular debris and the supernatant containing the nucleic acids may be further purified by solid phase extraction as described above.

[0111] Another form of physical lysis is osmotic shock, which is most typically used with mammalian cells. Osmotic shock involves placing cells in Dl / distilled waterATTORNEY DOCKET NUMBER: VB034PCT with no salt added. Because the salt concentration is lower in the solution than in the cells, water is forced into the cell causing the cell to burst, thereby rupturing the cellular membrane. The sample is typically purified and extracted by techniques such as e.g., solid phase extraction or other techniques known to those of skill in the art.

[0112] Chemical lysis: Chemical lysis involves rupturing cellular and nuclear membranes by disrupting the hydrophobic-hydrophilic interactions in the membrane bilayers via detergents. Salts and buffers (such as, e.g., Tris-HCl pH8) are used to stabilize pH during extraction, and chelating agents (such as ethylenediaminetetraacetic acid (EDTA)) and inhibitors (e.g., Proteinase K) are also added to preserve the integrity of the nucleic acids and protect against degradation. Often, chemical lysis is used with enzymatic disruption methods (see below) for lysing bacterial cell walls. In addition, detergents are used to lyse and break down cellular membranes by solubilizing the lipids and membrane proteins on the surface of cells. The contents of the cells include, in addition to the desired nucleic acids, inner cellular proteins and cellular debris. Enzymes and other inhibitors are added after lysis to inactivate nucleases that may degrade the nucleic acids. Proteinase K is commonly added after lysis, destroying DNase and RNase enzymes capable of degrading the nucleic acids. After treatment with enzymes, the sample is centrifuged, pelleting cellular debris, while the nucleic acids remain in the solution. The nucleic acids may be further purified as described above.

[0113] Another form of chemical lysis is the widely-used procedure of phenolchloroform extraction. Phenol-chloroform extraction involves the ability for nucleic acids to remain soluble in an aqueous solution in an acidic environment, while the proteins and cellular debris can be pelleted down via centrifugation. Phenol and chloroform ensure a clear separation of the aqueous and organic (debris) phases. For DNA, a pH of 7-8 is used, and for RNA, a more acidic pH of 4.5 is used.

[0114] Enzymatic lysis: Enzymatic disruption methods are commonly combined with other lysis methods such as those described above to disrupt cellular walls (bacteria and plants) and membranes. Enzymes such as lysozyme, lysostaphin, zymolase, and protease are often used in combination with other techniques such as physical and chemical lysis. For example, one can use cellulase to disrupt plant cell walls, lysosomes to disrupt bacterial cell walls and zymolase to disrupt yeast cell walls.ATTORNEY DOCKET NUMBER: VB034PCTExample II : RNP Formation

[0115] Master reaction buffer mixes were prepared with NaCl, MgCh, TCEP, MnCh, BSA, and other components, as required, with at least 300 pL excess volume in sterile RNase-free tubes. Reaction diluent comprising ROX, reporter and target was prepared and kept at room temperature.

[0116] Enzymes were diluted on ice in reaction buffer, as were guide RNAs. RNP1 formations were set up by adding water, buffer, enzyme and gRNAs together, mixing and then heating to 23°C for 30 minutes. After 30 minutes, the tubes were removed and kept at room temperature until ready to use. RNP1 formations were diluted (on ice) to final reaction concentrations. RNP2 formations were transferred wells in a 96-well plate and kept on ice at least 5 minutes before moving onto the final assembly step.Example III: Blocked Nucleic Acid Molecule Formation

[0117] Blocked targets (i.e., blocked nucleic acid molecules) containing ribonucleotides were stored dehydrated and required resuspension in buffer at pH 7.5 at 100 pM concentration. Blocked targets comprising only DNA were frozen and thawed for use, then suspended in lx STE buffer (Sigma, St. Louis MO, US). 25 pL of each target was dispensed into a PCR strip tube and placed into a BioRad (Hercules CA, USA) thermocycler, protocol Hyb0325). After the protocol ended (~ 40 minutes), the hybridized blocked targets were stored overnight at room temperature. After ~ 16 hours at room temperature, the blocked targets were stored at -20°C. For RNA blocked targets, after hybridization, the hybridized targets were stored at room temperature for 1 hour, then stored at -80°C.Example IV: Reporter Moiety Formation

[0118] The reporter moieties used in the reactions herein were single-stranded DNA oligonucleotides 5-10 bases in length (e.g., with sequences of TTATT, TTTATTT, ATT AT, ATTTATTTA, AAAAA, or AAAAAAAAA) with a fluorophore and a quencher attached on the 5' and 3' ends, respectively. In one example using a Casl2a cascade, the fluorophore was FAM-6, and the quencher was IOWA BLACK® (Integrated DNA Technologies, Coralville, IA). In another example using a Casl3ATTORNEY DOCKET NUMBER: VB034PCT cascade, the reporter moieties were single stranded RNA oligonucleotides 5-10 bases in length (e.g., r(U)n, r(UUAUU)n, r(A)n).Example V: Cascade Assay

[0119] Reaction plates were chilled to 4°C for at least 5 minutes and the reactions were assembled in a place on ice. RNP1, RNP2, targets and blocked targets were added to wells according to experimental design. QuantStudio (Thermo Fisher Scientific, Waltham MA, USA) was set up according to the manufacturer’s instructions and was pre-heated to the desired reaction temperature prior to the reaction and the reaction parameters were set and run according to a program.

[0120] While certain embodiments have been described, these embodiments have been presented by way of example only and are not intended to limit the scope of the present disclosures. Indeed, the novel methods, apparatuses, modules, instruments and systems described herein can be embodied in a variety of other forms; furthermore, various omissions, substitutions and changes in the form of the methods, apparatuses, modules, instruments and systems described herein can be made without departing from the spirit of the present disclosures. The accompanying claims and their equivalents are intended to cover such forms or modifications as would fall within the scope and spirit of the present disclosures.

Claims

ATTORNEY DOCKET NUMBER: VB034PCTWe Claim:

1. A method for identifying a target nucleic acid of interest in a sample using a signal boost assay comprising the steps of: providing a reaction mixture comprising: first ribonucleoprotein complexes (RNPls) each comprising a first nucleic acid- guided nuclease and a first gRNA, wherein the first gRNA comprises a sequence complementary to the target nucleic acid of interest, and wherein the first nucleic acid-guided nuclease exhibits both cis-cleavage and transcleavage activity; second ribonucleoprotein complexes (RNP2s) each comprising a second nucleic acid-guided nuclease and a second gRNA that is not complementary to the target nucleic acid of interest, and wherein the second nucleic acid-guided nuclease exhibits both cis- and trans-cleavage activity; a plurality of blocked nucleic acid molecules each comprising from 5' to 3': a block “N” nucleotides in length; a 5' target portion; a linker; and a 3' target portion, wherein the 5' and 3' target portions, when adjacent, are complementary to the second gRNA; and contacting the reaction mixture with the sample under conditions that allow the target nucleic acid of interest in the sample, if present, to bind to RNP1; wherein upon binding of the target nucleic acid of interest, RNP1 becomes active initiating trans- cleavage of the N nucleotides of the block of at least one of the plurality of the blocked nucleic acid molecules thereby unblocking the at least one blocked nucleic acid molecule; allowing the 5' and 3' target portions of the unblocked nucleic acid molecule to bind to the second gRNA in an RNP2 initiating trans-cleavage of the N nucleotides of the block of at least one additional blocked nucleic acid molecule; and detecting the cleavage products, thereby detecting the target nucleic acid of interest in the sample.

2. The method of claim 1, wherein the linker is a non-nucleotide chemical linker or a nucleotide linker.ATTORNEY DOCKET NUMBER: VB034PCT3. The method of claim 2, wherein the linker comprises a length equivalent to 20 to 40 nucleotides.

4. The method of claim 1, wherein the first and second nucleic acid nucleases are RNA- cleaving nucleic acid-guided nucleases and the linker comprises deoxyribonucleo tides.

5. The method of claim 1, wherein the first and second nucleic acid nucleases are DNA- cleaving nucleic acid-guided nucleases and the linker comprises ribonucleotides.

6. The method of claim 1, wherein the block is one to eight nucleotides in length.

7. The method of claim 6, wherein the block is three to six nucleotides in length.

8. The method of claim 6, wherein first and second nucleic acid nucleases are DNA- cleaving nucleic acid-guided nucleases and the linker comprises deoxyribonucleo tides.

9. The method of claim 6, wherein first and second nucleic acid nucleases are RNA- cleaving nucleic acid-guided nucleases and the linker comprises ribonucleotides.

10. The method of claim 6, wherein one of the first and second nucleic acid nucleases is an RNA-cleaving nucleic acid-guided nuclease and the other of the first and second nucleic acid nucleases is a DNA-cleaving nucleic acid-guided nuclease and the linker comprises both deoxyribonucleotides and ribonucleotides.

11. The method of claim 1, wherein the 5' target portion is from six to fifteen nucleotides in length and the 3' target portion is from five to fourteen nucleotides in length and the combined length of the 5' and 3' target portions is from 20 to 30 nucleotides in length.

12. The method of claim 1, wherein the first and / or second nucleic acid-guided nuclease is a Type V nucleic acid-guided nuclease or a Type VI nucleic acid-guided nuclease.

13. The method of claim 1, wherein the first and / or second nucleic acid-guided nuclease is a Cas3, Casl2a, Casl2b, Casl2c, Casl2d, Casl2e, Casl4, Casl2h, Casl2i, Casl2j, Casl3a, Casl3b nuclease.

14. The method of claim 1, wherein the reaction mixture further comprises reporter moieties, wherein the reporter moieties produce a detectable signal upon trans-cleavage activity by the RNP2 to identify the presence of one or more nucleic acid targets of interest in the sample.

15. The method of claim 14, wherein the reporter moiety is a synthetic molecule conjugated to a reporter and a quencher.

16. The method of claim 1, wherein the reaction mixture comprises about 1 fM to about 10 pM of the first ribonucleoprotein complexes.

17. The method of claim 16, wherein the reaction mixture comprises from about 1 pM to about 1 pM of the first ribonucleoprotein complexesATTORNEY DOCKET NUMBER: VB034PCT18. The method of claim 1, wherein the reaction mixture comprises about 1 fM to about 1 mM of the second ribonucleoprotein complexes.

19. The method of claim 18, wherein the reaction mixture comprises about 1 pM to about 250 pM of the second ribonucleoprotein complexes.

20. The method of claim 1, wherein the reaction mixture comprises at least ten different first ribonucleoprotein complexes, wherein different first ribonucleoprotein complexes comprise different gRNA sequences.

21. A method for identifying a target nucleic acid of interest in a sample using a signal boost assay comprising the steps of: providing a reaction mixture comprising: first ribonucleoprotein complexes (RNPls) each comprising a first nucleic acid- guided nuclease and a first gRNA, wherein the first gRNA comprises a sequence complementary to the target nucleic acid of interest, and wherein the first nucleic acid-guided nuclease exhibits both cis-cleavage and transcleavage activity; second ribonucleoprotein complexes (RNP2s) each comprising a second nucleic acid-guided nuclease and a second gRNA that is not complementary to the target nucleic acid of interest, and wherein the second nucleic acid-guided nuclease exhibits both cis- and trans-cleavage activity; a plurality of blocked nucleic acid molecules each comprising from 5' to 3': a 5' target portion; a linker; and a 3' target portion, a block “N” nucleotides in length; wherein the 5' and 3' target portions, when adjacent, are complementary to the second gRNA; and contacting the reaction mixture with the sample under conditions that allow the target nucleic acid of interest in the sample, if present, to bind to RNP1; wherein upon binding of the target nucleic acid of interest, RNP1 becomes active initiating trans- cleavage of the N nucleotides of the block of at least one of the plurality of the blocked nucleic acid molecules thereby unblocking the at least one blocked nucleic acid molecule; allowing the 5' and 3' target portions of the unblocked nucleic acid molecule to bind to the second gRNA in an RNP2 initiating trans-cleavage of the N nucleotides of the block of at least one additional blocked nucleic acid molecule; and detecting the cleavage products, thereby detecting the target nucleic acid of interest in the sample.ATTORNEY DOCKET NUMBER: VB034PCT22. The method of claim 21, wherein the linker is a non- nucleotide chemical linker or a nucleotide linker.

23. The method of claim 22, wherein the linker comprises a length equivalent to 20 to 40 nucleotides.

24. The method of claim 21, wherein the first and second nucleic acid nucleases are RNA- cleaving nucleic acid-guided nucleases and the linker comprises deoxyribonucleo tides.

25. The method of claim 21, wherein the first and second nucleic acid nucleases are DNA- cleaving nucleic acid-guided nucleases and the linker comprises ribonucleotides.

26. The method of claim 21, wherein the block is one to eight nucleotides in length.

27. The method of claim 26, wherein the block is three to six nucleotides in length.

28. The method of claim 26, wherein first and second nucleic acid nucleases are DNA- cleaving nucleic acid-guided nucleases and the linker comprises deoxyribonucleo tides.

29. The method of claim 26, wherein first and second nucleic acid nucleases are RNA- cleaving nucleic acid-guided nucleases and the linker comprises ribonucleotides.

30. The method of claim 26, wherein one of the first and second nucleic acid nucleases is an RNA-cleaving nucleic acid-guided nuclease and the other of the first and second nucleic acid nucleases is a DNA-cleaving nucleic acid-guided nuclease and the linker comprises both deoxyribonucleotides and ribonucleotides.

31. The method of claim 21, wherein the 5' target portion is from six to fifteen nucleotides in length and the 3' target portion is from five to fourteen nucleotides in length and the combined length of the 5' and 3' target portions is from 20 to 30 nucleotides in length.

32. The method of claim 21, wherein the first and / or second nucleic acid-guided nuclease is a Type V nucleic acid-guided nuclease or a Type VI nucleic acid-guided nuclease.

33. The method of claim 21, wherein the first and / or second nucleic acid-guided nuclease is a Cas3, Casl2a, Casl2b, Casl2c, Casl2d, Casl2e, Casl4, Casl2h, Casl2i, Casl2j, Casl3a, Casl3b nuclease.

34. The method of claim 21, wherein the reaction mixture further comprises reporter moieties, wherein the reporter moieties produce a detectable signal upon trans-cleavage activity by the RNP2 to identify the presence of one or more nucleic acid targets of interest in the sample.

35. The method of claim 34, wherein the reporter moiety is a synthetic molecule conjugated to a reporter and a quencher.

36. The method of claim 21, wherein the reaction mixture comprises about 1 fM to about 10 pM of the first ribonucleoprotein complexes.ATTORNEY DOCKET NUMBER: VB034PCT37. The method of claim 36, wherein the reaction mixture comprises from about 1 pM to about 1 pM of the first ribonucleoprotein complexes38. The method of claim 21, wherein the reaction mixture comprises about 1 fM to about 1 mM of the second ribonucleoprotein complexes.

39. The method of claim 38, wherein the reaction mixture comprises about 1 pM to about 250 pM of the second ribonucleoprotein complexes.

40. The method of claim 21, wherein the reaction mixture comprises at least ten different first ribonucleoprotein complexes, wherein different first ribonucleoprotein complexes comprise different gRNA sequences.

Images