Particle-based spatial HASH-tagging method

The method addresses the limitations of current single cell analysis by using barcoded particles to spatially map cells and construct sequencing libraries, enabling high-throughput integration of phenotypic and omics data for advanced cell biology research and drug discovery.

WO2026035501A1PCT designated stage Publication Date: 2026-02-12SCALE BIOSCIENCES INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/039952
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-08-27
Filing Date
2025-07-30
Publication Date
2026-02-12

AI Technical Summary

Technical Problem

Current methods for analyzing single cells in their spatial context within tissue sections are limited by low capture efficiency, low resolution, and loss of spatial information, and lack high-throughput integration of phenotypic and omics technologies to link morphological changes with molecular mechanisms.

Method used

A method for making a spatially hash-tagged single cell sequencing library using barcoded particles associated with cells on a support, allowing for the determination of cell location and identity, followed by dissociation while maintaining particle association, and constructing cell-specifically barcoded sequencing libraries to link omics data with spatial information.

Benefits of technology

Enables integrated insights into cellular heterogeneity, disease mechanisms, and drug discovery by mapping omics data back to specific locations on a support, linking phenotyping data with single cell omics data, and facilitating high-throughput analysis without inducing gradients or using electric fields.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025039952_12022026_PF_FP_ABST
    Figure US2025039952_12022026_PF_FP_ABST
Patent Text Reader

Abstract

Provided herein, among other things, is a method for making a single cell sequencing library. In some embodiments, the method may comprise: providing a population of barcoded particles (e.g., barcoded beads or nucleic acid dendrimers) that are randomly associated with cells on a support, wherein: (i) the barcoded particles comprise tethered oligonucleotides that comprise a particle identifier sequence that varies in the population and (ii) at least some individual cells are uniquely labeled by a barcoded particle or set of barcoded particles, determining: (i) the location and (ii) identity of the barcoded particles on the support by in situ analysis of the particle identifier sequences on the support, dissociating the cells from the support while maintaining their association with the barcoded particles, and making a cell-specifically barcoded sequencing library from the disassociated cells or nuclei.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] PARTICLE-BASED SPATIAL HASH-TAGGING METHOD

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] This application claims the benefit of U.S. provisional application serial nos. 63 / 681,016, filed on August 8, 2024, and 63 / 687,752, filed on August 27, 2024, which applications are incorporated by reference herein.

[0004] INCORPORATION BY REFERENCE OF SEQUENCE LISTING PROVIDED AS A SEQUENCE LISTING XML FILE

[0005] A Sequence Listing is provided herewith as a Sequence Listing XML, “SCBL 017WO_SEQLIST” created on July 29, 2025, and having a size of 1,951 bytes. The contents of the Sequence Listing XML are incorporated by reference herein in their entirety.

[0006] BACKGROUND

[0007] Single cell sequencing has become a standard tool for studying how genes are regulated, cellular states and cellular functions at the single cell level. However, transcription in individual cells is influenced by their localization within a particular tissue. As such, to gain a more complete understanding of a cell, one should obtain information about gene expression in individual cells in their morphological context.

[0008] Current methods for analyzing single cells and their respective analytes in tissue sections or cells / nuclei in their spatial context on a substrate are limited. For example, in situ hybridization provides a way to analyze transcripts in a tissue section, but the number of transcripts that can be analyzed in one experiment is rather limited. Next-generation sequencing approaches have the potential to provide a solution to this problem. However, most sequencing-based approaches require compartmentalization of single cells, which removes the spatial context (e.g., morphologically, context of the cells in the tissue etc.). Other sequencing-based platforms rely on transferring RNA from a tissue section to a microarray (see, e.g., Bergenstrahle et al. BMC Genomics (2020) 21:482). Such array-based methods have low capture efficiency, relatively low resolution, and a certain amount of spatial information is lost when the RNA molecules diffuse from the tissue to the array. As such, array-based methods are unsatisfactory for a number of applications. Additionally, the cost and complexity of making the barcoded arrays is high.

[0009] The ability to spatially map individual cells, characterize their phenotypes, and generate corresponding single-cell omic profiles is critical for numerous applications in cell biology and drug discovery (Stossi et al. 2023). These include immune response profiling, pooled CRISPR screening, and phenotypic drug discovery (PDD). High-content imaging (HCI) techniques, such as Cell Painting, utilize a panel of five to six optimized fluorescent dyes to stain key cellular structures — including the nucleus, nucleoli, endoplasmic reticulum, mitochondria, cytoskeleton, Golgi apparatus, plasma membrane, actin filaments, and both cytoplasmic and nucleolar RNA (Chandrasekaran et al. 2021; Pratapa, Doron, and Caicedo 2021). This multiplexed staining approach enables extraction of over 1,500 morphological features, facilitating the identification of phenotypic signatures, novel drug mechanisms of action, and potential off-target effects (Bray et al. 2016; Swinney and Lee 2020; Way et al. 2023)(Bray et al. 2016; Swinney and Lee 2020; Way et al. 2023).

[0010] Despite the progress in single cell phenotyping, current platforms lack high- throughput integration of phenotypic and omics technologies necessary to link morphological changes with molecular mechanisms. This disclosure provides a solution to address this gap, enabling integrated insights into cellular heterogeneity, disease mechanisms, drug mechanism of action (MO A), and therapeutic responses, significantly advancing cell biology research and drug discovery.

[0011] SUMMARY

[0012] Provided herein, among other things, is a method for making a spatially hash-tagged single cell sequencing library. In some embodiments, the method may comprise: (a) providing a population of barcoded particles (e.g., beads or macromolecules such as a nucleic acid dendrimers) that are randomly associated with cells on a support, wherein: (i) the barcoded particles comprise tethered oligonucleotides that comprise a particle identifier sequence that varies in the population and (ii) at least some individual cells are uniquely labeled by a barcoded particle or set of barcoded particles, (b) determining: (i) the location and (ii) identity of the barcoded particles on the support by in situ analysis of the particle identifier sequences on the support, (c) dissociating the cells from the support while maintaining their association with the barcoded particles, and (d) making cell-specifically barcoded sequencing libraries from the disassociated cells. The one or more libraries may comprise: (i) a cell-specifically barcoded omics sequencing library from the disassociated cells, wherein the omics library comprises a first population of nucleic acids that each comprise an omics polynucleotide and a cell-specific barcode; and (ii) a cell-specifically barcoded particle identifier sequencing library from the disassociated cells, wherein the particle identifier sequencing library comprises a second population of nucleic acids that each comprise particle identifier sequence and a cell-specific barcode.

[0013] In this method, the particle identifier(s) for the uniquely barcoded particles or unique sets of barcoded particles associated with the individual cells combined with the cell-specific barcodes added during the library construction allow one to map omics data (which is obtained by analyzing the sequences of the omics polynucleotides) for individual cells back to a location on the support. Additionally, other information i.e., phenotyping data from single cells collected on the support prior to single cell sequencing can be linked to the single cell omics data using the barcoded particles. In some embodiments, the method may comprise sequencing the cell- specifically barcoded sequencing library, or an amplification product thereof, to obtain sequence reads for the first and second populations of nucleic acids, grouping sequence reads from the first and second populations of nucleic acids that have the same cell-specific barcode, and assigning omics data for a plurality of individual cells with a corresponding plurality of locations on the support using information obtained earlier in the method.

[0014] In any embodiment, the sequencing library may be made without inducing a gradient of a physical property such as an electric field, without depositing single cells into wells, without using different combinations of colored beads, without pre-sequencing the particle identifier sequences of the beads before they are placed in contact with the cells, and without releasing the oligonucleotide from the beads before they are placed in contact with the cells. In a particular embodiment, the cells may be phenotyped on the support and a cell having a particular characteristic may be observed. The present method allows one to identify the omics data from that cell.

[0015] BRIEF DESCRIPTION OF THE FIGURES

[0016] The skilled artisan will understand that the drawings described below are for illustration purposes only. The drawings are not intended to limit the scope of the present teachings in any way.

[0017] Fig. 1 illustrates some of the principles of an embodiment of the present method.

[0018] Fig. 2 illustrates an example of decoding barcoded particles or macromolecule associated with a cell using primer extension. In this example, a single base extension step is used to decode the barcoded oligonucleotide. Fig. 3. illustrates an exemplary workflow for combining spatial cell phenotyping with single cell spatial omics analysis. (A) illustrates high-content cellular phenotyping and cell spatial hashing in multi-well plates. Each well within a plate represents a different experimental condition. Cells within a well may represent different cell types or could represent a pooled perturbation screen in which cells have been transfected with a different CR1SPER / CAS guide RNA perturbation. Multiple spatial hash particles / cell are associated with cells prior to or post phenotypic data collection. In the example shown, Cell 1 is decorated with four different spatial hash particles and Cell 2 is decorated with three different spatial hash particles; the identity and spatial location of the hash particles are determined by in situ analysis and their sequence and associated cellular barcode by NGS sequencing. After pheno typing, or concomitant with phenotyping, the spatial hash particles can be decoded. (B) After Single Cell library prep and NGS sequencing, the cellular barcode is attached to the omic analyte libraries, spatial hash libraries, and the guide RNA libraries, allowing the omic and guide RNA data to be linked to the spatial cell information. (C) In situ decoding process for identifying barcoded hash beads. In this illustration, four rounds of two-color decoding are sufficient to decode the beads shown. Created with BioRender.com.

[0019] Fig. 4 illustrates an exemplary workflow for phenotyping and single cell omics analysis for neighboring / interacting cells. Neighboring single cells are analyzed on a support i.e. phenotyping. Cells can be the same type or different types. Additionally, one or more cells can be stimulated / perturbed and responds on the other cell can be analyzed, (a) cells are phenotyped and dissociated from one another and the support. Next, the cells and associated barcoded particles are analyzed in single cell sequencing, (b) Cells are phenotyped and dissociated from the support. Target molecules, i.e. DNA, RNA, cDNA, or oligonucleotide sequence of the cells are barcoded using split-pool barcoding (e.g. Nolan WO 2012 / 106385 A2 and incorporated in its entirety as reference). Neighboring cells co-migrate through the split-pool barcoding together. Neighboring cells can be dissociated from each other, and split-pool barcoding, or any other single cell method, can be applied to barcode each cell uniquely. For simplicity, only one barcoded oligo per particle or macromolecule is shown. Particles or macromolecules can contain one or more copies of barcoded oligonucleotides.

[0020] Fig. 5 illustrates an example of an affinity binder associated to a (A) cell or (B) nucleus for the capture and detection of small molecules, nucleic acids, or proteins. Fig. 6 illustrates an example of a Poly(A) capture probe (Poly(dT)) associated to a cell for the (A) direct capture of mRNA and subsequent in vitro RT, or for the (B) indirect capture of mRNA and subsequent in vitro RT.

[0021] Fig. 7 illustrates an example of an affinity binder associated to a cell or nucleus for the capture and detection of small molecules or proteins.

[0022] Fig. 8 illustrates an example of a particle, bead, or macromolecule containing affinity binding agents associated to a cell or nucleus for the capture and detection of molecules of interest.

[0023] DETAILED DESCRIPTION

[0024] Unless defined otherwise herein, all technical and scientific terms used in this specification have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are described.

[0025] All patents and publications, including all sequences disclosed within such patents and publications, referred to herein are expressly incorporated by reference.

[0026] Numeric ranges are inclusive of the numbers defining the range. Unless otherwise indicated, nucleic acids are written left to right in 5’ to 3' orientation; amino acid sequences are written left to right in amino to carboxy orientation, respectively.

[0027] The headings provided herein are not limitations of the various aspects or embodiments of the invention. Accordingly, the terms defined immediately below are more fully defined by reference to the specification as a whole.

[0028] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Singleton, et al., DICTIONARY OF MICROBIOLOGY AND MOLECULAR BIOLOGY, 2D ED., John Wiley and Sons, New York (1994), and Hale & Markham, THE HARPER COLLINS DICTIONARY OF BIOLOGY, Harper Perennial, N.Y. (1991) provide one of ordinary skill in the art with the general meaning of many of the terms used herein. Still, certain terms may be defined below for the sake of clarity and ease of reference.

[0029] As used herein, "omics” refers to the analysis of any specific species of cellular analyte, or its surrogate or derivative, or its characteristics that are identified and quantified within a cell or sample. This encompasses a wide range of molecular and macromolecular types, including nucleic acids (genomic DNA, methylated DNA, chromatin, RNA and cDNA, etc.), as well as proteins, lipids, carbohydrates, metabolites, and ions, among others.

[0030] As used herein, a “spatial hash tag” or “spatial tag” is a unique particle identifier sequence(s) (i.e., a single unique particle identifier sequence or a unique combination of particle identifier sequences) that distinguishes between cells on the same support. In the context of the present method, spatial hash tags are delivered using particles at the beginning of the protocol to uniquely identify cells on a support. Spatial hash tags are distinct from the cell-specific barcodes (or cell origination barcodes) that are added later in a protocol. Spatial hash tags may contain an optional cleavable linker (ideally orthogonal to cleavable linker of Cell Paint dyes) for downstream single cell platforms, such as the high throughput analysis platforms such as QuantumScale™. In some embodiments, however, a cell-specific barcode and a hash tag may be present in the same nucleic acid molecule. At the time at which the spatial tagging is done, the cells are on a support and, as such, the cells have tags that uniquely identify the spatial location of individual cells on the support. These tags can be used along with cell-specific barcodes to map data to specific locations on the support.

[0031] As used herein the term “uniquely labeled” in the context of cells that are uniquely labeled refers to cells that can be distinguished from one another by the particles that they are associated with. In other words, the particles associated with the cells uniquely label the cells with: i. a single barcode or ii. a combination of barcodes, where each cell distinguishable from the other cells by the barcode(s) associated with the cells. A cell may be labeled with a single particle (e.g., one particle with multiple barcodes or one particle with a single barcodes) or multiple particles each containing a different barcode, for example. As used herein, the term “spatially addressed” and “spatially addressable” and “spatial” refer to sequences that can be mapped to a site or position on a sample, e.g., by x-y- z coordinates.

[0032] As used herein, the term “cellular sample” is intended to include samples made by, e.g., growing cells on a planar surface, samples that are made by depositing cells on a planar surface, e.g., by centrifugation, and samples that are made by cutting a three-dimensional object that contains cells into sections and mounting the sections onto a planar surface, i.e., producing a tissue section. Cells can be deposited in multi-well plates i.e. 96, 384 or 1536 multi-well plates with wells containing different samples or experimental conditions. The surface of the plates can be coated to immobilize cells (Immobilized Cell, Biotechnology Advances, 2005). The cells can be dissociated from the surface while maintaining association with the barcoded particles using many known methods including but not limited to standard EDTA or proteolytic enzyme treatment (Accutase®, Innovative Cell Technologies). The mild dissociation conditions of EDTA and or Accutase keep the hash beads associated with the cells. The surface upon which a sample may be mounted may be, e.g., glass, metal, ceramic, plastic, etc. If the sample is fixed, it may be fixed using any number of reagents including formalin, methanol, paraformaldehyde, methanol: acetic acid, glutaraldehyde, glyoxal, bifunctional crosslinkers such as bis(succinimidyl)suberate, bis(succinimidyl)polyethyleneglycol, etc.

[0033] A section (e.g., a cryosection) of a tissue sample (e.g., of a fresh frozen tissue sample) that has a thickness in the range of 1-50 um (e.g., in the range of 1-5 um or 5-20 um) is an example of a cellular sample, although there are many alternatives. In some embodiments the cells in the sample may be fixed and / or permeabilized, e.g., using a detergent or a solvent. The cells in the sample may be fixed or non-fixed, live or dead. Tissue samples may include fresh frozen (FF) tissue samples or formalin-fixed paraffin embedded (FFPE) tissues. For single cell omic applications, typically, FF and FFPE tissue sections are ~25 um in depth to improve whole cell yield upon tissue dissociation and single cell library preparation.

[0034] As used herein, the term “tissue section” refers to a piece of tissue that has been obtained from a subject and mounted on a planar surface, e.g., a microscope slide.

[0035] As used herein, the term “formalin-fixed paraffin embedded (FFPE) tissue section” refers to a piece of tissue, e.g., a biopsy sample that has been obtained from a subject, fixed in formaldehyde (e.g., 3%-5% formaldehyde in phosphate buffered saline) or Bouin solution, embedded in wax, cut into thin sections, and then mounted on a microscope slide.

[0036] As used herein, the term “removing” refers to any action that results of the elimination of a compound. Removing may include degrading, inactivating, or washing away, or any combination thereof.

[0037] As used herein, the term “5’ or 3’ tail”, in the context of a tailed oligonucleotide, refers to a 5’ or 3 ’part of an oligonucleotide that is not complementary to a target and does not hybridize to the target that the 3’ or 5’ hybridizes to, respectively. A tail can be as long as needed, e.g., in the range of 20-100 bases, as desired.

[0038] As used herein, the term “oligonucleotide” refers to a multimer of at least 2 nucleotides, e.g., at least 5, at least 10, at least 15 or at least 30 nucleotides. In some embodiments, an oligonucleotide may be in the range of 15-200 nucleotides in length, or more. An oligonucleotide may be 10 to 20, 21 to 30, 31 to 40, 41 to 50, 51to 60, 61 to 70, 71 to 80, 80 to 100, 100 to 150 or 150 to 200 nucleotides in length, for example. The term “binding” or “bind” refers to a process in which a molecule (e.g., nucleic acid strand, a polypeptide, etc.) or particle, binds to an analyte of a cell or part of the cell, or cell compartments, structure, backbone, organelle etc. The binding can be specific, nonspecific, or random. The binding can be maintained during cell lysis, cellular sample dissociation, or single cell or nuclei suspension formation. The binding can be to cellular analytes or non-analytes (e.g., cell wall, cell structure etc.). In some cases, different spatial tags bind to different molecules, analytes, or cellular compartments, cell structures, cells or nuclei of the same cell of the cellular sample.

[0039] The term “sequencing”, as used herein, refers to a method by which the identity of at least 2 consecutive nucleotides (e.g., the identity of at least 5, at least 10, at least 50 or at least 100 or more consecutive nucleotides) of a polynucleotide are obtained.

[0040] The term “next-generation sequencing” refers to the so-called parallelized sequencing -by-synthesis or sequencing-by-ligation platforms currently employed by, e.g., Illumina, Life Technologies, BGI Genomics (Complete Genomics technology), PacBio, Oxford Nanopore, Ultima Genomics, and Roche etc.

[0041] The term “duplex,” or “duplexed,” as used herein, describes two complementary polynucleotides that are base-paired, i.e., hybridized together.

[0042] The terms “determining,” “measuring,” “evaluating,” “assessing,” “assaying,” and “analyzing” are used interchangeably herein to refer to forms of measurement and include determining if an element is present or not. These terms include both quantitative and / or qualitative determinations. Assessing may be relative or absolute.

[0043] The term “ligating”, as used herein, refers to the enzymatically or chemically catalyzed joining of the terminal nucleotide at the 5’ end of a first DNA molecule to the terminal nucleotide at the 3’ end of a second DNA molecule.

[0044] The terms “plurality”, “set” and “population” are used interchangeably to refer to something that contains at least 2 members. In certain cases, a plurality may have at least 10, at least 100, at least 100, at least 10,000, or at least 100,000 members.

[0045] A “primer binding site” refers to a site to which an oligonucleotide hybridizes in a target polynucleotide or fragment. If an oligonucleotide “provides” a binding site for a primer, then the primer may hybridize to that oligonucleotide or its complement.

[0046] The term “strand” as used herein refers to a nucleic acid made up of nucleotides covalently linked together by covalent bonds, e.g., phosphodiester bonds.

[0047] The term “extending”, as used herein, refers to the extension of a nucleic acid by the addition of nucleotides using a polymerase or by a chemical reaction. The term “fixation” refers to a process that preserves cells or nuclei or tissues in a specific state, typically to prepare them for single cell sequencing or microscopic examination or other analysis. Examples of fixation methods include chemical fixation using formaldehyde, glutaraldehyde, dithiobis(succinimidyl propionate (DSP), glyoxal, or alcohol (e.g. methanol), as well as physical methods like heat fixation and freezing. Any suitable homo-bifunctional N-hydroxysuccimide ester (NHS ester) can be used for fixation, including DSP.

[0048] The term “affinity reagent”” refers to a reagent that can covalently or non-covalently bind or interact with a target molecule. Affinity reagent can be an antibody, Ab-fragments, aptamer, oligonucleotide, DNA, RNA, and the like.

[0049] The term “single cell sequencing” refers to any method of single cell sequencing, and can be adapted to a variety of single-cell barcoding technologies including: Scale Biosciences, lOx Genomics’ Chromium or FLEX platforms, Fluent Biosciences PIPseq platform, BD Biosciences’ Rhapsody system, Scipio Biosciences’ Asteria platform, CS Genetics’ SimpleCell technology, Parse Biosciences, and a number of other related single cell technologies such as described by De Jonghe et al. 2024. (De Jonghe et al. 2024).

[0050] The terms “UMP’ and “unique molecular identifier” as used herein refer to relatively short sequences (4-30 bases) or "tags" that are added to DNA fragments to identify input molecules. These tags are added before PCR amplification, and can be used to reduce errors and quantitative bias introduced by the amplification, and enable input molecules to be counted. A UMI may have a degenerate (e.g., random) sequence of 4-20 bases. This ensures accurate quantification or counting of the original nucleic acid molecules after amplification by enabling all sequencing reads to be traced back to their source template, effectively preventing duplicate counting and improving data reliability.

[0051] In some embodiments, a UMI may be used to determine the number of initial target polynucleotide molecules that have been analyzed, i.e., to “count” the number of initial target polynucleotide molecules that have been analyzed. PCR amplification of molecules that have been tagged with a barcode can result in multiple sub-populations of products that are clonally related in that each of the different sub-populations is amplified from a single tagged molecule. As would be apparent, even though there may be several thousand or millions or more of molecules in any of the clonally-related sub-populations of PCR products and the number of target molecules in those clonally-related sub-populations may vary greatly, the number of molecules tagged in the first step of the method can be estimated by counting the number of molecule index sequences associated with a target sequence that is represented in the population of PCR products. This number is useful because, in certain embodiments, the population of PCR products made using this method may be sequenced to produce a plurality of sequences. The number of different barcode sequences that are associated with the sequences of a target polynucleotide can be counted, and this number can be used (along with, e.g., the sequence of the fragment, the sequence of the ends of the fragment, and / or the site of insertion of the molecule index into the fragment) to estimate the number of initial template nucleic acid molecules that have been sequenced. Such tags can also be useful in correcting sequencing errors.

[0052] The term "spatially associated cells" is intended to refer to a sample in which the cells are held in place relative to one another, e.g., by an extracellular matrix. Tissue sections and pieces of tissue are examples of samples that contain spatially associated cells. A suspension of cells does not contain cells that are held in place relative to one another. As such, a suspension of cells does not contain spatially associated cells. A sample containing spatially associated cells can be substantially planar (e.g., a tissue section or a sheet of cultured cells, etc.) or three-dimensional, e.g., a piece of tissue or a whole tissue.

[0053] For clarity, the term “barcoded particles” or “spatial hash particles” is intended to refer to both beads and macromolecules (e.g., dendrimers such as branched polymeric poly (amidoamine) (PAMAM) dendrimers, poly(propyleneimine) (PPI) dendrimers, liquid crystalline, core shell (tecto), chiral, peptide, glycodendrimers, hybrid, and PAMAM- organosilicon (PAMAMOS) dendrimers, RCA products and the like) that comprise multiple copies of a one or more nucleic acid barcodes that vary in the population. In general, barcode particles are intrinsically “optically inert”, wherein they do not exhibit significant optical fluorescence, luminescence, plasmon resonance, or lasing properties; and as a population of barcode particles, do not differ in their optical fluorescence, luminescence, plasmon resonance, or lasing properties between barcode particles. Individual barcoded particles may be associated with a barcode that uniquely identifies the particle or multiple barcodes that, together, uniquely identify the particle. These barcodes are referred to as “barcode identifier sequences” or “particle identifier sequence” herein. The nucleic acid in which a barcode identifier sequence exists i.e., the tethered oligonucleotide, may be longer than the barcode identifier sequence and it may contain other types of barcodes, e.g., a sample-specific barcode, a well-specific barcode, a unique molecular identifier (UMI), etc. A “uniquely barcoded particle” may be associated with a single barcode sequence that is unique, or a combination of barcoded sequences that, collectively, is unique. As would be apparent, such particles need to be smaller than the cells under study in order for the method to work. In some embodiments, barcoded particles are attached to a binding agent such as an antibody that facilitates binding to cells. As explained below, barcoded particles have tethered oligonucleotides that comprise a particle identifier sequence. In some embodiments, the particles may contain binding elements to enable their binding to cells, e.g., via cellular molecules.

[0054] Other definitions of terms may appear throughout the specification.

[0055] Fig. 1 illustrates certain principles of the present method. As illustrated in Fig. 1, in some embodiments the method may comprise: providing a population of barcoded particles (e.g., beads or macromolecules such as dendrimers) that are randomly associated with cells on a support. This step may be done by associating the barcoded particles either before, after or while the cells are added to the support. In other words, in some embodiments, the cells may be pre-labeled with the barcoded particles before they are immobilized on the support. In these embodiments, the method may comprise randomly associating barcoded particles with cells and then immobilizing the cells (with their associated particles) on a support. In other embodiments (and as illustrated in Fig. 1), the cells may be labeled with the barcoded particles after they are immobilized on the support. In these latter embodiments, the method may comprise randomly associating a population of barcoded particles 2 with cells that are immobilized on a support 4.

[0056] In these embodiments, the barcoded particles comprise tethered oligonucleotides that comprise a particle identifier sequence that varies in the population, meaning that the individual particles are each associated with a unique particle sequence or unique set of particle sequences and that the composite sequence of the barcode varies in the population.

[0057] In this method, at least some individual cells are uniquely labeled by a barcoded particle or set of barcoded particles. In this context, the term “uniquely labeled” is intended to mean that the individual cells are independently labeled by a single particle that has a single particle identifier sequence that is unique to the cell and discriminates that cell from other cells, ii. a single particle that has a combination of particle identifier sequences, where the combination of particle identifier sequences is unique to the cell and discriminates that cell from other cells, and / or iii. multiple particles each having a single particle identifier sequence, where the combination of particle identifier sequences is unique to the cell and discriminates that cell from other cells, and any combination thereof.

[0058] The particle identifier sequences do not need to be unique to each particle, but they may be in some circumstances. The total number of barcoded particles added to the cells may comprise at least 1,000, at least 10,000, at least 100,000, or at least 1 M barcoded particles and the population may have a complexity of at least 10, at least 20, at least 50, at least 100, at least 1,000, a least 10,000 or at least 100,000, or more, where the term “complexity” refers to the number of different particle identifier sequences represented in the population. In some embodiments the population of barcoded particles has a complexity of no more than 10, no more than 20, no more than 50, no more than 100, no more than 1,000, no more than 10,000, or no more than 100,000. As will be apparent from the discussion that follows below, the barcode identifier sequences do not need to be unique to each particle because in many cases the cells are be tagged by multiple particles, where the combination of barcodes uniquely tags the cell. In these embodiments, each barcoded particle may comprise a defined (i.e. , not random) barcode sequence (typically of 1-40 nucleotides, e.g., 5-40 nucleotides, in length) that varies in the population.

[0059] In some embodiments, the population of particles may be distributed across and / or through the sample randomly, meaning that the number of barcoded particles that bind to a particular cell or nuclei as well as the identity of the barcode identifier sequences of the barcoded particles that bind to the cell or nuclei are not pre-determined. In some embodiments, phenotypic data is collected on cells and the omics data is collected on cells or nuclei. In these embodiments, the barcoded particles may be randomly associated with the cells by (a) applying a solution comprising the population of barcoded particles to the cells on the support and (b) allowing the barcoded particles to bind to the cells. Alternatively, the barcoded particles may be randomly associated with the cells by (a) applying a solution comprising the population of barcoded particles to the cells that are not immobilized on a support and (b) allowing the barcoded particles to bind to the cells, and then (c) immobilizing the cells and the associated particles on the support. In some embodiments, the cells that are associated with the barcoded particles may be associated with an average number of barcoded particles per cell. The barcoded particles may become associated with the cells via non-covalent binding interactions (e.g., via an antibody or some other type of binding agent that is tethered to the particles) or via a covalent binding interaction.

[0060] Barcoded particles can be associated with cells or nuclei using several mechanisms as partly described in WO2020 / 236846A1 herein incorporated by reference: 1) Antibody or ligand mediated binding wherein barcoded particles are coated with antibodies or ligands that specifically bind to cell surface antigens. This can be cell-type specific, using cell typespecific antigens, or pan-cell, using a universal cell surface marker such as beta2 microglobulin or a lectin protein like concanavalin A, which binds carbohydrate moieties on cell surface proteins; 2) Electrostatic mediated binding wherein barcoded particles with a charged surface attaches to a cell through electrostatic forces. Positively charged particles can bind to negatively charged cell surfaces and vice versa, making this method suitable for general cell or nuclei association / labeling; 3) Click chemistry mediated binding wherein cells or nuclei are labeled with biorthogonal chemical groups, and beads are functionalized with complementary reactive groups, enabling specific and efficient binding; and 4) Endocytosis mediated labeling wherein small barcoded particles (50-200 nm) are naturally internalized through endocytosis, allowing for spatially tracking cells for spatial and multi- omic analysis.

[0061] The particles may be bound to any suitable part of the cell, e.g., the cell membrane, cell surface proteins, or even intracellular components, e.g., the nucleus.

[0062] Embodiments include the use of concanavalin A for broad cell surface binding, beta2 microglobulin for pan-cell labeling, and specific antibodies for targeted cell types. For ligand-receptor interactions, ligands such as biotin can be used with streptavidin functionalized beads. Positively charged beads are preferred for general labeling due to the typically negative charge of cell surfaces. Click chemistry utilizes azide-alkyne reactions for specific and efficient bead attachment. Small hash beads for endocytosis provide a non- invasive method for cell tracking without surface modifications.

[0063] The barcoded particle association with cells or nuclei can occur prior or after cell phenotyping, prior or after cell immobilization on a surface, and before single cell decoding and sequencing. Barcoded particles may be associated with the cells, nuclei in cells, or nuclei pre or post cell immobilization on a surface i.e. cell plating in microwell plates. In some embodiments, the average number of different barcoded particles that bind to cell (where the term “different” is intended to mean that the barcoded particles have different barcode identifier sequences) may be in the range of 2-100, e.g., 2-50 or 2-10. Illustrated by example, seven cells can become distinguishably labeled using a population of barcoded particles that contains only three different particles, X, Y and Z. In this hypothetical example, some cells of the sample may bind to only one particle (e.g., having identifier X, Y or Z), other cells may bind to exactly two different particles (e.g., having identifiers X and Y, X and Z, or Y and Z), and other cells may bind to exactly three different particles (e.g., having identifiers X, Y and Z) and so on. In this example, a cell that is bound to only one particle may be distinguishably labeled because that is the only cell that is bound to only that particle (e.g., it is the only cell associated with particle X alone, i.e., without Y or Z); a cell that is bound by two different particles (e.g., having identifiers X and Y) may be distinguishably labeled because that is the only cell that is bound by identifiers X and Y (and not identifier Z). Finally, a cell that is bound to all three particles may be distinguishably labeled because it is the only cell that is bound to all three identifiers but not any others (e.g., it is the only cell associated with identifiers X, Y and Z). In this example seven cells can, in theory, be distinguishably labeled using only three different particles. In practice, a higher complexity of particles may be used and, as such, thousands, several hundred thousand, or millions of cells can be distinguishably labeled using the same principle. The complexity of the population of particles required for tagging a sample can be readily determined. As noted above, in some embodiments, the cells may be associated with a ‘unique set’ of barcoded particles. In this context, the term "unique set" refers to cells that are distinguishable from all other cells by the tags to which they are bound by the barcoded particles that are bound to them. A cell may be associated with a ‘unique set’ of barcoded particles if it is associated with a single particle (which may have a single, unique, barcode associated therewith or multiple barcodes that are collectively unique) that is unique to the cell, a unique combination of particles (i.e., a combination of particles that is not bound to other cells).

[0064] In some embodiments, the barcodes on the barcoded particles can be cleaved postparticle barcoding and the barcodes associated directly with cell components such as the nucleus to elicit cell or nuclear hashing.

[0065] Consistent with the above and as illustrated in Fig. 1 and Fig. 2, at least some individual cells become associated with a unique set of barcoded particles 8. As illustrated in Fig. 1, a first cell becomes associated with particles A and B, a second cell becomes associated with particle C, and a third cell becomes associated with particles A, B and E, where the identity of a particle (i.e., A, B, C, etc.,) refers to the particle identifier sequence tethered to the particles. As would be apparent, the method may optionally involve removing any unbound or reacted barcoded particles after this step has been performed by, e.g., washing the unbound particles from the sample, degrading unbound oligonucleotides or inactivating the unbound oligonucleotides. Enriching for cells or nuclei associated with particles is another method to separate unbound particles from cells or nuclei associated with particles.

[0066] This part of the method results in cells being differentially labeled with a unique barcode identifier sequence or a combination of barcode identifier sequences, wherein different cells are associated with different barcode identifier sequences.

[0067] After the particles have become associated with the cells, the method comprises determining (i) the location and (ii) identity of the barcoded particles on the support by in situ analysis of the particle identifier sequences on the support. This step should be performed while the particles are attached to the cells and prior to disassociating the cells from the support. This step can be done by variety of different methods, including in situ sequencing, or using a hybridization-based method in which probes that hybridize to the particle identifier sequences are used. In some embodiments, the identity and positions of the barcodes may be done by multiple rounds of hybridizing decoder probes to the barcode on the particles, washing, imaging, and removing the decoders probes. See, e.g., Gbransson (Nucleic Acids Res. 2009 37:e7). In some embodiments, the decoder probes may differentially hybridize to the barcode and, in some embodiments, may be fluorescently labeled, thereby allowing the different barcodes to be distinguished from one another. In some embodiments, the sequence decoded can be different then the barcode sequence analyzed in single cell sequencing. In some embodiments, the relationship between the sequence decoded and the barcode sequence analyzed in single cell sequencing is known. Alternative methods for determining (i) the location and (ii) identity of the particle identifier sequences of the barcoded particles on the support will be apparent and may be described below.

[0068] Once the location and identity of the barcoded particles on the support has been determined (and the information stored in a file), the method comprises disassociating the cells from the support (and, if necessary, from one another if the cells are spatially- associated with one another on the support) while maintaining their association with the barcoded particles. This step results in a single cell suspension in which at least some of the cells are associated with a uniquely barcoded particle or unique set of barcoded particles. This step can be done enzymatically by digesting the cells with trypsin, collagenase and / or dispase, etc., or non-enzymatically, which should disassociate the cells and make a suspension of single cells. As illustrated in Fig. 1, this results in cells 10.

[0069] Next, the method comprises making a cell-specifically barcoded omics (“sc-omics”) sequencing library from the disassociated cells, where the term “omics sequencing library” is a sequencing library that provides a global read out (e.g., the presence, absence or abundance of multiple components) of a cell’s genome, epigenome, transcriptome, proteome and / or metabolome, or a selected part thereof. For example, a sc-RNA-seq (single cell RNA-seq) library provides a read out of the transcriptome on a cell-by-cell basis. The present method may involve making: (i) a cell-specifically barcoded omics sequencing library from the disassociated cells, wherein the omics library comprises a first population of nucleic acids that each comprise an omics polynucleotide and a cell-specific barcode; and (ii) a cell- specifically barcoded particle identifier sequencing library from the disassociated cells, wherein the particle identifier sequencing library comprises a second population of nucleic acids that each comprise particle identifier sequence and a cell-specific barcode. These libraries may be made in the same workflow (resulting in a mixed sequencing library) or in different workflows. In the latter embodiment, the libraries may be combined. In either embodiment, the libraries may exist in the same container and, in some cases, may have the same flaking sequences (for PCR and / or sequencing). In such methods, cell-specific barcodes are added to omics molecules and the barcode identifier sequences from the cells such that the sequences from the same cell receive the same barcode. This, in turn, allows one to identify sequence reads that come from the same cell. A cell-specifically barcoded sequencing library can be made by compartmentalizing single cells in droplets, wells, microvolumes, microwells, microbubbles, or emulsions, and adding cell-specific barcodes to analytes in the compartments. Alternatively, the method may be done by a split-pool barcoding method. Cell-specific barcodes can be added using a variety of different methods. Some methods compartmentalize single cells into compartments and assign cell-specific barcodes to each cell to label them uniquely. Alternatively, single cell combinatorial indexing methods can be used, which label cells through a split-pool indexing protocol See, e.g., (Cao et al. Science 2017, 357: 661-667 and WO2012106385A2), for example. In some embodiments, the library may have PCR primer binding sites, thereby facilitating amplification of the nucleic acids in the library. In some embodiments, the library may have a sequencing primer site and / or cluster amplification site, thereby facilitating sequencing of the library. Alternatively, the barcoded nucleic acids may have an affinity tag, thereby facilitating their enrichment. In some embodiments, a subset of the barcoded nucleic acids may be enriched and sequenced, e.g., by enriching for barcoded nucleic acids that have a particular barcode or nucleic acid sequence.

[0070] As illustrated in Fig. 1, in some embodiments, the method may comprise sequencing the cell-specifically barcoded sequencing library, or an amplification product thereof, to obtain sequence reads for the first and second populations of nucleic acids. In some embodiments, the first and second populations of nucleic acids may be sequenced separately. The barcoded nucleic acids including the barcoded single cell libraries and barcoded spatial tags may be sequenced by any suitable system, e.g., Illumina’s reversible terminator method, Roche’s pyrosequencing method (454), Life Technologies’ sequencing by ligation (the SOLiD platform), Life Technologies’ Ion Torrent platform or Pacific Biosciences’ fluorescent base-cleavage method and any other platform, e.g. Oxford Nanopore, Element Bio, etc.. Examples of such methods are described in the following references: Margulies et al (Nature 2005 437: 376-80); Ronaghi et al (Analytical Biochemistry 1996 242: 84-9); Shendure (Science 2005 309: 1728); Imelfort et al (Brief Bioinform. 2009 10:609-18); Fox et al (Methods Mol Biol. 2009 553:79-108); Appleby et al (Methods Mol Biol. 2009 513:19- 39) English (PLoS One. 2012 7: e47768) and Morozova (Genomics. 2008 92:255-64), which are incorporated by reference for the general descriptions of the methods and the particular steps of the methods, including all starting products, reagents, and final products for each of the steps.

[0071] The sequencing step may be done using any convenient next generation sequencing method and may result in at least 10,000, at least 100,000, at least 500,000, at least IM at least 10M at least 100M, at least IB or at least 10B sequence reads per reaction. In some cases, the reads may be paired-end reads.

[0072] After sequencing, the data obtained from sequencing the first population of nucleic acids (i.e., the “omics data”) can be mapped to locations on the support using the sequences of the second population of nucleic acids. In other words, the sequences of the second population of nucleic acids should link each cell-specific barcode to a corresponding unique particle identifier sequence or unique set of particle identifier sequences. Because the particle identifier sequences have been mapped to locations on the support earlier in the protocol, the omics data can be mapped on the support. In some embodiments, this step may be done by grouping sequence reads from the first and second populations of nucleic acids that have the same cell-specific barcode and, on a cell-by-cell basis, assigning omics data for a plurality of cells with a corresponding plurality of locations on the support using the location information obtained earlier in the method. Other bioinformatics pipelines could be used. In other words, the first and second populations of polynucleotides may be sequenced en masse, and the omics sequences may be mapped to a spatial location in the sample using the correlation between the cell-specific barcodes and the particle identifier sequences, which have been mapped. The cell-specific barcodes may serve as a spatial address for omics data via a correlation with the particle identifier sequences. In some embodiments, the sequences from a particular cell in the sample can be resolved from sequences from other cells in the sample. In these embodiments, the method may further comprise sequencing the cell-specific barcodes and mapping the sequenced nucleic acid molecules to a site in or on the cellular sample using that barcode.

[0073] In some embodiments, after the omics data has been linked to locations on the support, the method may comprise reconstructing an image showing the abundance of at least some of the omics polynucleotides across at least part of the support. This image may be color coded in some cases.

[0074] Phenotyping

[0075] In any embodiment, the method may further comprise phenotyping the cells on the support, e.g., by assaying or staining the cells on the support and producing an image of the assayed or stained cells. In these embodiments, the method may further comprise overlaying the image of the assayed or stained cells with the omics data (i.e., the omics data) for at least some of the stained cells. In a preferred embodiment, the cell sample is comprised of adherent cells or affixed cells attached to a planar substrate (e.g., slide, microwell plate, tissue culture plate, etc.).

[0076] Phenotyping information includes cell cycle, apoptosis, cell shape, G-protein, cytoskeletal reorganization, cell morphology, membrane texture, nuclear foci - nucleoli, neurite outgrowth, angiogenic tube formation, mitochondria mass, cytoplasmic foci - e.g. autophagosomes, colony formation, cell migration, chemotactic assays, trans-well assays, 3D cell invasion, and protein localization and quantification. Example features that can be analyzed with cell painting include the nucleus, nucleolus, ER / Golgi, mitochondria, actin cytoskeleton, and plasma membrane. Cell painting data can measure cell number, hypertrophy, DNA damage, apoptosis, and steatosis among many other things.

[0077] In these embodiments, the cells may be assayed or stained using a cytological stain, either before, during, or after becoming associated with the particles. In these embodiments, the stain may be, for example, phalloidin, gadodiamide, acridine orange, Bismarck brown, barmine, Coomassie blue, bresyl violet, brystal violet, DAPI, hematoxylin, eosin, ethidium bromide, acid fuchsine, haematoxylin, Hoechst stains, iodine, malachite green, methyl green, methylene blue, neutral red, Nile blue, Nile red, osmium tetroxide (formal name: osmium tetraoxide), rhodamine, safranin, phosphotungstic acid, ruthenium tetroxide, ammonium molybdate, cadmium iodide, carbohydrazide, ferric chloride, hexamine, indium trichloride, lanthanum nitrate, lead acetate, lead citrate, lead(II) nitrate, periodic acid, phosphomolybdic acid, potassium ferricyanide, potassium ferrocyanide, ruthenium red, silver nitrate, silver proteinate, sodium chloroaurate, thallium nitrate, thiosemicarbazide, uranyl acetate, uranyl nitrate, vanadyl sulfate, or any derivative thereof. The stain and / or spatial tag may be specific for any feature of interest, such as a protein or class of proteins, phospholipids, DNA (e.g., dsDNA, ssDNA), RNA, an organelle (e.g., cell membrane, mitochondria, endoplasmic reticulum, golgi body, nuclear envelope, and so forth), or a compartment of the cell (e.g., cytosol, nuclear fraction, and so forth). The stain may enhance contrast or imaging of intracellular or extracellular structures. In some embodiments, the sample may be stained with haematoxylin and eosin (H&E). In these embodiments, the sample may be analyzed by microscopy to produce one or more images of the sample, prior to, during, or after adding spatial tags to the sample. A plethora of assays could also be employed.

[0078] Exemplary instrument that can be used in this step include Opera Phenix Plus High- Content Screening System, High-content imaging (HC1) systems (Revvity) and ImageXpress Micro Confocal High-Content Imaging System (Molecular Devices). Exemplary methods that can be used include, but are not limited to those described in Kwok et al (Light Sci Appl 2019 8, 74), Feldman et al (Cell 2019 179, 787-799), Seal et al (bioRxiv.org 2024 doi: 10.1101 / 2024.05.04.592531), Tsubouchi et al (Cell Rep Methods 2024 4, 100737), Chandrasekaran et al (Nat. Methods (2024) doi: 10.1038 / s41592-024-02241-6), Bray et al (Nat. Protoc. 2016 11, 1757-1774), Cross-Zamirski et al (Sci. Rep. 2022 12: 10001), Pratapa et al (Carr Opin. Chem. Biol. 2021 65, 9-17), Kudo et al (Cell Syst 13 2022 376-387.e8), Rovira-Clave, X. et al. (Cancer Cell 2022 40: 1423-1439. ell), Kudo et al bioRxiv 2023.12.26.573143), Wang et al Proc. Natl. Acad. Sci. U. S. A. 2019 116, 10842-10851, among many others.

[0079] Omics

[0080] The single cell readout of the current method can range from epigenetics, genomics, proteomics, transcriptomics, metabolomics or any combination thereof (referred to as multi- omics). The method can be used to examine transcriptomics or to map an epigenomics state. Examples include, but are not limited, methylation, open-chromatin state (e.g., ATAC-seq), DNA-protein binding etc. Analytes can be pre-processed before barcode synthesis. For example, DNA can be modified with transposon sequences using a process called transposition (e.g., transposases) enabling ATAC-seq, cut-and-tag assays, whole-genome, multi-omics (e.g., ATAC + RNA) etc. The analyte of interest can be DNA, RNA, cDNA, protein, carbohydrate, small molecule, large molecule, drug, or any combination of analytes etc.

[0081] See, e.g., Integrative single-cell analysis Stuart et al. Nature Reviews Genetics volume 20, pages257-272 (2019). Many single assays have been developed including RNA-seq, ATAC-seq, RNA+ATACseq, ASAP-Seq (Mimitou et al. 2021), TEA- Seq (Swanson et al. 2021), Multi-seq, Ab-seq, CITE-seq etc. Exemplary assays include the following: 2b-RAD Wang S et al. (2012) Nat Methods 9:808-810 3C Duan Z. et al. (2012) Methods 58: 277-288 4-C Zhao Z. et al. (2006) Nat Genet 38: 1341-1347 5-C Dostie J. et al. (2007) Nat Protoc 2: 988-1002 Aba-seq Sun Z. et al. (2013) Cell Rep 3: 567-576 ATAC-Seq Buenrostro J. D. et al. (2013) Nat Methods 10: 1213-1218 BisChlP-Seq Statham A. L. et al. (2012) Genome Res 22: 1120-1127 Bisulfite-seq Berman B. P. et al. (2012) Nat Genet 44: 40-46 BLESS Crosetto, N. et al. Nat. Methods 10, 361-365 (2013). Break-seq Hoffman E.

[0082] A. et al. (2015) Genome Res 25: 402-412 BSAS Masser D. R. et al. (2013) Epigenetics Chromatin 6: 33 BSPP Deng J. et al. (2009) Nat Biotechnol 27: 353-360 BS-Seq Lister R. et al. (2009) Nature 462: 315-322 Bubble-Seq Mesner L. D. et al. (2013) Genome Res 23: 1774-1788 CAB-Seq Lu X. et al. (2013) J Am Chem Soc 135: 9315-9317 caMAB-seq Wu H et al. (2016) Nat Protoc 11:1081-100 CAP-seq Illingworth R. S. et al. (2010) PLoS Genet 6: el001134 Capture-C Hughes J. R. et al. (2014) Nat Genet 46: 205-212 CATCH-IT Deal R.

[0083] B. et al. (2010) Science 328: 1161-1164 Chem-Seq Anders L. et al. (2014) Nat Biotechnol 32: 92-96 Chia-PET Li G. et al. (2010) Genome Biol 11: R22 ChlP-BS-seq Brinkman A. B. et al. (2012) Genome Res 22: 1128-1138 ChlP-exo Yen K. et al. (2013) Cell 154: 1246-1256 ChlPmentation Schmidl C et al. (2015) Nat Methods 12:963-5 ChlP-Seq Barski A. et al. (2007) Cell 129: 823-837 CPT-seq Amini S. et al. (2014) Nat Genet 46: 1343-1349 DamID Vogel M. J. et al. (2007) Nat Protoc 2: 1467-1478 ddRADseq Peterson B. K. et al. (2012) PLoS One 7: e37135 Digenome-seq Kim D et al. (2015) Nat Methods 12:237-43 DIP-seq Shen L. et al. (2013) Cell 153: 692-706 Dnase I SIM Cumbie JS et al. (2015) Plant Methods 11:42 DNasel-Seq Hesselberth J. R. et al. (2009) Nat Methods 6: 283-289 DNase-Seq Boyle A. P. et al. (2008) Cell 132: 311-322 Drop-ChIP Rotem A et al. (2015) Nat Biotechnol 33:1165-72 DR-Seq Dey SS et al. (2015) Nat Biotechnol 33:285-9 DSB-seq Baranello L et al. (2014) Int J Mol Sci 15:13111-22 Duplex-Seq Schmitt M. W. et al. (2012) Proc Natl Acad Sci U S A 109: 14508-14513 EC-seq Parkinson N. J. et al. (2015) Genome Res 25: 226-234 EpiRADSeq Schield DR et al. (2016) Methods in Ecology and Evolution 7:60-69 FAIRE-Seq Gaulton K. J. et al. (2010) Nat Genet 42: 255-259 fCAB-Seq Song C. X. et al. (2013) Cell 153: 678-691 fC-CET Xia B et al. (2015) Nat Methods 12:1047-50 fC-Seal Song

[0084] C. X. et al. (2013) Cell 153: 678-691 FiT-Seq Cejas P et al. (2016) Nat Med G&T-seq Macaulay I. C. et al. (2015) Nat Methods 12: 519-522 G4-seq Chambers V. S. et al. (2015) Nat Biotechnol 33: 877-881 GUIDE-seq Tsai SQ et al. (2015) Nat Biotechnol 33:187-97 HELP-Seq Oda M. et al. (2009) Nucleic Acids Res 37: 3829-3839 Hi-C Lieberman- Aiden E. et al. (2009) Science 326: 289-293 Histone meth. Barski A. et al. (2007) Cell 129: 823-837 HiTS-Flip Nutiu R. et al. (2011) Nat Biotechnol 29: 659-664 hMeDIP-seq Xu Y et al. (2011) Mol Cell 42:451-64 HT-ChIP Blecher-Gonen R. et al. (2013) Nat Protoc 8: 539-554 HTGTS Chiarle, R. et al. (2011 ) Cell 147, 107-119 HT-SELEX Jolma A. et al. (2010) Genome Res 20: 861-873 HydEn-seq Clausen A. R. et al. (2015) Nat Struct Mol Biol 22: 185-191 hyRAD Suchan T et al. (2016) PLoS One 1 l:e0151651 Ig-Seq Vollmers C. et al. (2013) Proc Natl Acad Sci U S A 110: 13463-13468 IMS-MDA Seth-Smith H. M. et al. (2013) Nat Protoc 8: 2404-2412 INSeq Goodman AL et al. (2009) Cell Host Microbe 6:279-89 JBPl-seq Cui L. et al. (2014) Genomics LAM-HTGTS Hu J et al. (2016) Nat. Protocols 11:853-871 MAB- seq Wu H. et al. (2014) Nat Biotechnol MAF Khan TA et al. (2016) Sci Adv 2:el501371 MAINE-Seq Ponts N. et al. (2010) Genome Res 20: 228-238 MALBAC Zong C. et al. (2012) Science 338: 1622-1626 MBDCap-Seq de Assis S. et al. (2012) Nat Commun 3: 1053 MBD-Seq Nair S. S. et al. (2011) Epigenetics 6: 34-44 MDA Dean F. B. et al. (2001) Genome Res 11: 1095-1099 MeDIP-Seq Down T. A. et al. (2008) Nat Biotechnol 26: 779- 785 MethylCap-Seq Brinkman A. B. et al. (2010) Methods 52: 232-236 Methyl-seq Brunner A. L. et al. (2009) Genome Res 19: 1044-1056 MIDAS Gole J et al. (2013) Nat Biotechnol 31:1126-32 MiGS Serre D. et al. (2010) Nucleic Acids Res 38: 391-399 MINCE-seq Ramachandran S et al. (2016) Cell 165:580-92 Mint-ChIP van Galen P et al. (2016) Mol Cell 61: 170-80 MIPSTR Carlson K. D. et al. (2015) Genome Res 25: 750-761 MIRA Rauch T. A. et al. (2010) Methods 52: 213-217 MNase-Seq Schones D. E. et al. (2008) Cell 132: 887-898 MPE-seq Ishii H et al. (2015) Proc Natl Acad Sci U S A 112:E3457-65 MRE-Seq Maunakea A. K. et al. (2010) Nature 466: 253-257 NG Capture-C Davies JOJ et al. (2016) Nat Meth 13:74-80 NOME-Seq Han H. et al. (2011) Hum Mol Genet 20: 4299-4310 NSCR Kunnev D. et al. (2015) Genome Res 25: 558-569 NS-seq Foulk MS et al. (2015) Genome Res 25:725-35 Nucleo-Seq Valouev A. et al. (2011) Nature 474: 516-520 nuc-seq Wang Y. et al. (2014) Nature 512: 155-160 ORGANIC Zentner G. E. et al. (2013) PLoS Genet 9: el003317 OS-Seq Myllykangas S. et al. (2011) Nat Biotechnol 29: 1024-1027 oxBS-Seq Booth M. J. et al. (2012) Science 336: 934-937 PAT-ChIP Fanelli M et al. (2011) Nat Protoc 6: 1905-19 PBAT Miura F. et al. (2012) Nucleic Acids Res 40: el36 PB-seq Guertin M. J. et al. (2012) PLoS Genet 8: el002610 PD-Seq Arango D. et al. (2013) Proc Natl Acad Sci U S A 110: E2153-2162 PDZ-Seq Ernst A. et al. (2010) Mol Biosyst 6: 1782-1790 PE RAD-Seq Willing E. M. et al. (2011) Bioinformatics 27: 2187-2193 ProP-PD Ivarsson Y. et al. (2014) Proc Natl Acad Sci U S A 111: 2542-2547 Pu-seq Daigaku Y. et al. (2015) Nat Struct Mol Biol 22: 192-198 RAD Baird N. A. et al. (2008) PLoS One 3: e3376 Rapture Ali OA et al. (2016) Genetics 202:389-400 RBBS Meissner A et al. (2008) Nature 454:766-70 RC-Seq Baillie J. K. et al. (2011) Nature 479: 534-537 RedBS-Seq Booth M. J. et al. (2014) Nat Chem 6: 435-440 Repli-Seq Hansen R. S. et al. (2010) Proc Natl Acad Sci U S A 107: 139-144 Rep-Seq Benichou J. et al. (2012) Immunology 135: 183-191 Ribose-seq Koh K. D. et al. (2015) Nat Methods 12: 251-257 RRBS Meissner A. et al. (2008) Nature 454: 766-770 RRMAB-seq Neri F. et al. (2015) Cell Rep 10: 674-683 Safe-SeqS Kinde I et al. (2011) Proc Natl Acad Sci U S A 108:9530-5 scABA-seq Mooijman D et al. (2016) Nat Biotechnol advance online publication scATAC-seq Cusanovich DA et al. (2015) Science 348:910-4 (Cell index) scATAC-seq Buenrostro J. D. et al. (2015) Nature 523: 486-490 (Microfluidics) scBS-seq Smallwood S. A. et al. (2014) Nat Methods 11: 817-820 scChlP-seq Rotem A et al. (2015) Nat Biotechnol 33:1165-72 scM&T-seq Angermueller C et al. (2016) Nat Methods advance online publication scMT-Seq Hu Y et al. (2016) Genome Biol 17:88 scRC-Seq Upton KR et al. (2015) Cell 161:228-39 scRRBS Guo H. et al. (2015) Nat Protoc 10: 645-659 scTrio-seq Hou Y et al. (2016) Cell Res 26:304-19 SELEX Jolma A. et al. (2010) Genome Res 20: 861-873 SELEX-seq Slattery M. et al. (2011) Cell 147: 1270-1282 SLAF-Seq Sun X et al. (2013) PLoS One 8:e58700 SMDB Lan F et al. (2016) Nat Commun 7:11784 smMIP Hiatt J. B. et al. (2013) Genome Res 23: 843-854 SNES Leung M. L. et al. (2015) Genome Biol 16: 55 Sono-Seq Auerbach R. K. et al. (2009) Proc Natl Acad Sci U S A 106: 14926-14931 SSB-Seq Baranello L et al. (2014) Int J Mol Sci 15: 13111-22 TAB-Seq Yu M. et al. (2012) Cell 149: 1368-1380 TAmC-Seq Zhang L. et al. (2013) Nat Commun 4: 1517 TC-Seq Klein I. A. et al. (2011) Cell 147: 95-106 THS-seq Sos BC et al. (2016) Genome Biol 17:20 TN-Seq van Opijnen T. et al. (2013) Nat Rev Microbiol 11: 435-442 T- WGBS Wang Q. et al. (2013) Nat Protoc 8: 2022-2032 UMI-4C Schwartzman O et al. (2016) Nat Methods advance online publication WGBS Lister R. et al. (2009) Nature 462: 315-322 X-ChlP-seq Skene P. J. et al. (2014) Elife 3: e02042

[0085] Decoding

[0086] The spatial tags can be detected and identified in the spatial context using a variety of methods including microscopy and fluorescence decoding (i.e. Gunderson et al Decoding Randomly Ordered DNA Arrays Genome Res. 2004 May; 14(5): 870-877 and Vickovic, S. et al. High-definition spatial transcriptomics for in situ tissue profiling. Nat. Methods 16, 987-990 (2019).). In some cases, decoding of the spatial tags occurs through sequential hybridization of fluorescent decoders, removing unbound decoders, imaging, removing the fluorescent decoders, and repeating the process multiple times with different sets of decoders to determine the identity and location of the spatial tags. In some embodiments, the spatial tags are decoded using sequencing.

[0087] The structure of the spatial tag on the bead can be comprised of a co-linear assembly of subwords, such as generated by split-pool synthesis of barcoded beads as described by Nolan et al., US 11932902 B2 and Delley et al., 2021 (Delley and Abate 2021), herein both incorporated by reference. Alternatively, the oligonucleotide barcodes comprised of a co- linear assembly of subwords can be both synthesized individually and immobilized individually on beads to form a collection of spatial barcode beads. In another embodiment, multiple barcode oligos can be co-immobilized to the bead such that the different subwords are on independent oligonucleotides rather than co-linear on the same oligonucleotide.

[0088] As an example, a barcoded particle oligonucleotide sequence can be comprised of a single encoding nucleotide position. 10 different barcoded oligonucleotides with a single degenerate site comprised of a 1 or 2 base degeneracy as follows: {A, C, G, T, A / C, A / G, A / T, C / G, C / T, G / T} (allowing up to 4 base degeneracy increases the number of states to 15). The 10 different barcoded particles made from these 10 different degenerate oligonucleotides can be decoded / sequenced using four standard color channels. The detection modes can employ 4-color fluorescent allele- specific oligonucleotide (ASO) hybridization or 4-color single base extension (SBE). In one embodiment, the barcoded bead detection step can be performed concomitantly with the Oligo Paint high content imaging step. Alternatively, the in situ analysis of the barcoded particles can be performed after the Oligo Paint assay. In a preferred embodiment, the Oligo Paints are removed from the cellular sample prior to in situ analysis of the barcoded particles.

[0089] Technologies related to single molecule FISH can also be used for the detection and identification of the spatial tags (e.g., single- molecule Fluorescence in situ Hybridization (smFISH) for RNA Detection in Adherent Animal Cells, Haimovich et al. Bio Protoc. 2018 Nov 5; 8(21)). In some embodiments, Z-probes, pre-amplifiers or amplifiers (amplification schemes) can be used to visualize and detect the spatial tags, e.g., using single molecule mRNA fluorescent in situ hybridization (RNA-FISH) to quantify mRNAs in individual murine oocytes and embryos (Xie et al. Scientific Reports volume 8, Article number: 7930 (2018) and references cited herein).

[0090] In some embodiments, not all barcoded particles (e.g., spatial tags) present in the sample are decoded or analyzed in single cell sequencing. The spatial tags or combination of all decoded spatial tags (e.g., combination of barcoded particles per cell) are unique or substantially unique from cell to cell. Other methods of introducing spatial tags including various methods of cell hashing and analyte tagging have been previously described (Hashing with barcoded antibodies enables multiplexing and doublet detection for single cell genomics, Stoeckius et al. Genome Biology vol. 19, Article number: 224 (2018), Comparative analysis of antibody- and lipid-based multiplexing methods for single-cell RNA-seq Mylka et al. Genome Biology volume 23, 55 (2022) and references cited herein). Various spatial methods have been described and can be used for the visualization and identification of the spatial tags described in this invention (for example, see Museum of spatial transcriptomics Moses et al. Nature Methods volume 19, pages534-546 (2022)). For example, the nCounter Analysis System from Nanostring can detect 800+ target analytes (see, e.g., Goytain et al. NanoString nCounter Technology: High-Throughput RNA Validation Methods Mol Biol 2020;2079:125-139). In some cases, this process can be repeated with different pools of decoders.

[0091] In the method, the positions of cells in the sample and / or the particle identifier sequences that are bound to the cells may be analyzed using any of a variety of methods, e.g., by hybridizing fluorescent probes to the barcode sequence and then detecting a signal. The sample may also be stained, e.g., using a cytological stain so that other features of the cells or extracellular matrix can be observed. Ideally, the tags should be detected using a method with single molecule resolution (so that single binding events can be optically resolved from one another), e.g., smFISH, seqFISH, or the like (see, e.g., Tingey et al, Cells 2022, 11, 3079), although other methods can be used.

[0092] In another embodiment, in addition to the spatial particle barcode hashing and as an alternative to well-specific barcode particles, a sample well hash oligo can be employed in which each well receives a different sample hash oligo (e.g., all cells in the same well receive the same hash barcode). In this way, all the cells from an assay plate can be pooled and processed in bulk through a single cell analysis protocol. In some embodiments, each well of a multi-well plate receives a unique barcoded particle pool e.g. 96, 384, or 1526 different unique barcoded bead pools, each pool consisting of multiple barcoded particles. Each particle pool can be used for sample (well) barcoding and labeling the cells for that sample or well.

[0093] In another embodiment, dissociated cells undergo a scATAC-Seq assay using digitonin permeabilization allowing transpososome entry into the cell and access to the chromatin gDNA within the nucleus. In addition, DNA-tagged antibodies also have access to intracellular proteins for a ASAP-Seq like assay (Mimitou et al. 2021). Typical concentrations of digitonin are ~ 0.001-0.01% (10-100 ug / ml) as described by Chen et al. 2018, Swanson et al. 2021, and Mimitou et al. 2021 (Chen et al. 2018; Swanson et al. 2021; Mimitou et al. 2021; Paramasivam et al. 2022).

[0094] Cell-specific barcodes

[0095] As used herein, the term “cell-specific barcode” refers to a polynucleotide or combination of polynucleotides with any suitable length, e.g., a nucleic acid molecule of about 2 bases to about 100 bases, including any integer including 2 and 100 and in between, that comprises identifying information for each single cell. The cell-specific barcode can contain one or more subunits of oligonucleotides (see for example, WO 2012 / 106385 A2). The cell-specific barcode is unique for each cell and can be sequenced (see, e.g., Niu et al., 2013, Nat. Chem. 5:282-292; Roy et al., 2015, Nat. Commun. 6:7237; Lutz, 2015, Macromolecules 48:4759-4767; each of which are incorporated by reference in its entirety). A cell-specific barcode may comprise a random sequence which may be used to count starting molecules. A cell-specific barcode may also contain an optional sample barcode, primer, or sequencing primer. A cell-specific barcode may be single stranded or double stranded. A double stranded cell-specific barcode may comprise blunt ends, overhanging ends, or both. In certain embodiments, a cell-specific barcode may further comprise a unique molecular identifier, a universal priming site, or any combination thereof. In some cases, the cell-specific barcode has a branched structure, assembly of multiple components, bound through a molecular assembly, or as a single structure, to which multiple decoders can hybridize to improve detection of the cell-specific barcode. In some embodiments, the cellspecific barcode is different than the decoder sequence. In some embodiments, the cellspecific barcode and the decoder sequence are the same.

[0096] Samples

[0097] Cells from any organism, e.g., from bacteria, yeast, plants, and animals, such as fish, birds, reptiles, amphibians, and mammals may be used in the subject methods. In certain embodiments, mammalian cells, i.e., cells from mice, rabbits, primates, or humans, or cultured derivatives thereof, may be used. Samples can refer to a collection of cellular samples from many individuals. Samples can refer to a set of cell subpopulations derived from different experimental treatment or perturbation conditions often associated with different wells in a multi-well plate. Samples can refer to a collection of different cell subpopulations derived by selective isolation of a subset of cells from a parent sample (e.g., immune cells displaying a particular immunophenotype, cells selected by laser capture microdissection, etc.). Cells can be adherent or non-adherent. Exemplar non-adherent cells include Peripheral Blood Mononuclear Cells (PMBCs) comprised of T cells, B cells, Natural Killer (NK) cells, and monocytes. Other non-adherent cells include lymphocytes from lymphoid tissue (e.g., spleen, lymph nodes) and lymphoblastoid cell lines such as Jurkat (T cell leukemia), Raji (B cell lymphoma), Daudi (Burkitt’s lymphoma, B cell), NK-92 (NK cell line), and etc. Non-adherent cells can be affixed / attached to specially coated surfaces that promote adherence to a surface or solid support. Examples include, but not limited, CelLTak (Agilent) can be used to immobilize cells on a surface or coated multi-well plates. poly(ethylene-glycol)-lipid-modified surfaces or substrates can be used to immobilize cells (Yamaguchi et al, Methods Mol Biol. 2011:706:151-7. Immobilized culture and transfection microarray of non-adherent cells). The immobilization can be reversed, or immobilization can be temporary. Reversible and Photoresponsive Immobilization of Nonadherent Cells by Spiropyran-Conjugated PEG-Lipids Shin Izuta et al. ACS Appl. Bio Mater. 2019, 2, 1, 33- 38, 2019. See also Method for immobilization of living and synthetic cells for high- resolution imaging and single-particle tracking Lukasz Syga et al. Scientific Reports volume 8, Article number: 13789 (2018) and references cited herein.

[0098] Cell picking and selection

[0099] In some cases, cell picking, and selection can be used together with the methods described herein. Cell picking and selection is the process of isolating individual cells or cell colonies from a population. It can be done manually or with an automated system. For example, once a cell or cells have been identified with phenotyping and decoding of its associated barcoded particles, the cell or cells can be picked and isolated and analyzed using single cell sequencing. In some embodiments, the selected cell or cells can be selectively released from the surface. For example, the selected cell can be exposed to light (or chemical) breaking the binding of the cell with the surface thereby releasing the cell from the surface. In some cases, the cell selection can be dome through selective polymerization and selection as described in Devices and methods for analyzing biological samples, Patent number: 11554370 and is incorporated by reference.

[0100] Utility

[0101] The methods described herein find general use in a wide variety of applications for analysis of any sample (e.g., in the analysis of cell lines, adherent and non-adherent cells, tissue sections, sheets of cells, spun-down cells, etc.). Further, the method has a variety of clinical applications, including, but not limited to, diagnostics, prognostics, disease stratification, personalized medicine, clinical trials, and drug accompanying tests.

[0102] In a preferred embodiment, the sample may be adherent or affixed cell line cells. In another embodiment, the sample may be a section of any tissue, including skin (melanomas, carcinomas, etc.), soft tissue, bone, breast, colon, liver, kidney, adrenal, gastrointestinal, pancreatic, gall bladder, salivary gland, cervical, ovary, uterus, testis, prostate, lung, thymus, thyroid, parathyroid, pituitary (adenomas, etc.), brain, spinal cord, ocular, nerve, and skeletal muscle, etc. In some embodiments, the sample may be a tissue biopsy obtained from a patient. Biopsies of interest include both tumor and non-neoplastic biopsies of any tissue. The above-described method can be used to analyze cells from a subject to determine, for example, whether the cell is normal or not or to determine whether the cells are responding to a treatment. In one embodiment, the method may be employed to determine the degree of dysplasia in cancer cells. In these embodiments, the cells may be a sample from a multicellular organism. A biological sample may be isolated from an individual, e.g., from a soft tissue. In particular cases, the method may be used to identify cancer cells in a sample.

[0103] In some embodiments, the method may involve obtaining data (an image) as described above (an electronic form of which may have been forwarded from a remote location), and the image may be analyzed by a doctor or other medical professional to determine whether a patient has abnormal cells (e.g., cancerous cells) or which type of abnormal cells are present. The image may be used as a diagnostic to determine whether the subject has a disease or condition, e.g., a cancer. In certain embodiments, the method may be used to determine the stage of a cancer, to identify metastasized cells, or to monitor a patient’ s response to a treatment, for example.

[0104] The compositions and methods described herein can be used to diagnose a patient with a disease. In some cases, the presence or absence of a biomarker in the patient’s sample can indicate that the patient has a particular disease (e.g., a cancer). In some cases, a patient can be diagnosed with a disease by comparing a sample from the patient with a sample from a healthy control. In this example, a level of a biomarker, relative to the control, can be measured. A difference in the level of a biomarker in the patient’s sample relative to the control can be indicative of disease. In some cases, one or more biomarkers are analyzed to diagnose a patient with a disease. The compositions and methods of the disclosure are particularly suited for identifying the presence or absence of, or determining expression levels, of a plurality of biomarkers in a sample.

[0105] In some cases, the compositions and methods herein can be used to determine a treatment plan for a patient. The presence or absence of a biomarker may indicate that a patient is responsive to or refractory to a particular therapy. For example, a presence or absence of one or more biomarkers may indicate that a disease is refractory to a specific therapy, and an alternative therapy can be administered. In some cases, a patient is currently receiving the therapy and the presence or absence of one or more biomarkers may indicate that the therapy is no longer effective.

[0106] In some cases, the method may be employed in a variety of diagnostic, drug discovery, and research applications that include, but are not limited to, diagnosis or monitoring of a disease or condition (where the image identifies a marker for the disease or condition), discovery of drug targets (where a marker in the image may be targeted for drug therapy), drug screening (where the effects of a drug are monitored by a marker shown in the image), determining drug susceptibility (where drug susceptibility is associated with a marker) and basic research (where is it desirable to measure the differences between cells in a sample).

[0107] In certain embodiments, two or more different samples may be compared using the above methods. The different samples may be composed of an “experimental” sample, i.e., a sample of interest, and a “control” sample to which the experimental sample may be compared. In many embodiments, the different samples are pairs of cell types or fractions thereof, one cell type being a cell type of interest, e.g., an abnormal cell, and the other a control, e.g., a normal cell. Exemplary cell type pairs include, for example, cells isolated from a tissue biopsy (e.g., from a tissue having a disease such as colon, breast, prostate, lung, skin cancer, or infected with a pathogen, etc.) and normal cells from the same tissue, usually from the same patient; cells grown in tissue culture that are immortal (e.g., cells with a proliferative mutation or an immortalizing transgene), infected with a pathogen, or treated (e.g., with environmental or chemical agents such as peptides, hormones, altered temperature, growth condition, physical stress, cellular transformation, etc.), and a normal cell (e.g., a cell that is otherwise identical to the experimental cell except that it is not immortal, infected, or treated, etc.); a cell isolated from a mammal with a cancer, a disease, a geriatric mammal, or a mammal exposed to a condition, and a cell from a mammal of the same species, preferably from the same family, that is healthy or young; and differentiated cells and non-differentiated cells from the same mammal (e.g., one cell being the progenitor of the other in a mammal, for example). In one embodiment, cells of different types, e.g., neuronal and non-neuronal cells, or cells of different status (e.g., before and after a stimulus on the cells) may be employed. In another embodiment of the invention, the experimental material contains cells that are susceptible to infection by a pathogen such as a virus, e.g., human immunodeficiency virus (HIV), etc., and the control material contains cells that are resistant to infection by the pathogen. In another embodiment, the sample pair is represented by undifferentiated cells, e.g., stem cells, and differentiated cells. In some embodiments, two or more samples (either different tissue samples or areas of the same sample) can be processed and analyzed simultaneously. Many single cell analysis systems provide input for 2 or more samples. In another embodiment of the invention, the sample may be susceptible to CRISPR editing, editing system, stimuli, or perturbation. In some embodiments, the perturbation can be a chemical compound, drug etc. The perturbation may be marked with a barcode tag or spatial tag, and the perturbation or edit information can be captured in single cell sequencing (see Cell. 2016, 167(7): 1853-1866.el7. Dixit et al. Perturb-seq: Dissecting molecular circuits with scalable single cell RNA profiling of pooled genetic screens).

[0108] The images produced by the method may be viewed side-by-side or, in some embodiments, the images may be superimposed or combined. In some cases, the images may be in color, where the colors used in the images may correspond to the sequences of the nucleic acids.

[0109] Cell-to cell interactions

[0110] In some embodiments, the methods and compositions can be used to analyze cell-to- cell interactions and the single cell omics of those interacting cells (see Fig. 4). Interacting cells can be imaged and phenotypic data for the interacting cells can be collected. In the preferred embodiment, each cell of the interacting cells is uniquely labeled with uniquely barcoded particle or a unique set of barcoded particles. In some embodiments, the interacting cells can be dissociated while maintaining the association with the barcoded particles and individual cells or nuclei thereof can be sequenced, i.e. single cell sequencing or split-pool barcoding. As they co-migrate through the split-pool barcoding process, the interacting cells will receive identical single cell barcodes. In a preferred embodiment, the cells are crosslinked with a reversible cross-linker prior to split-pool barcoding. In the latter steps of the split-pool barcoding process, the cell-to-cell interaction can be reversed, or cross-links removed, resulting in the interacting cells to be dissociated from one another. Subsequent barcoding rounds of the individual cells will now barcode the target molecules of the cell and associated barcoded particles uniquely in single cell sequencing. The initial splitbarcode cycles label the linked cells identically as they co-migrate through barcoding compartments. An additional barcoding cycle after reversing the cell-cell crosslinks uniquely labels the previously linked cells. This approach enables assigning / linking single cell phenotypic and omics data for the cells that are interacting with one another.

[0111] In another embodiment, barcoded particles can be associated with both non- migratory and migratory cells, providing a means to track and analyze cell populations with high precision. Non-migratory cells can be labeled with specific barcode particles before the assay, allowing researchers to identify and quantify them post-assay, distinguishing them from migratory cells. During the assay, cells that migrate through the trans-well membrane can be captured and associated with different barcode particles, allowing for separate analysis. In summary, barcoded particles enable the tracking of individual cells, providing detailed insights into the migration patterns and behavior of each cell. By sampling at different time points, researchers can monitor the progression of cell migration and invasion over time, gaining insights into the dynamics of cellular responses. This method allows for precise quantification of both non-migratory and migratory cells, enhancing the accuracy of migration and invasion assays.

[0112] A kit for performing the method is also provided. A kit may comprise any combination the components listed above, including one or more of the following components: barcoded beads, fluorescent nucleotides or fluorescent probes, polymerase (for fluorescent nucleotides), a sequence to connect a cell origination barcode to the barcoded oligonucleotide, reagents to dissociate cells from the surface (but maintain association of particles with cells).

[0113] EMBODIMENTS

[0114] Embodiment 1. A method for making a sequencing library, comprising: (a) providing a population of barcoded particles that are randomly associated with cells on a support, wherein: (i) the barcoded particles have tethered oligonucleotides that comprise one or more particle identifier sequences that vary in the population; and (ii) at least some individual cells are uniquely labeled by a barcoded particle or set of barcoded particles; (b) determining: (i) the location and (ii) identity of the barcoded particles on the support by in situ analysis of the particle identifier sequences on the support; (c) dissociating the cells from the support while maintaining their association with the barcoded particles; and (d) making: (i) a cell- specifically barcoded omics sequencing library from the disassociated cells, wherein the omics library comprises a first population of nucleic acids that each comprise an omics polynucleotide and a cell-specific barcode; and (ii) a cell-specifically barcoded particle identifier sequencing library from the disassociated cells, wherein the particle identifier sequencing library comprises a second population of nucleic acids that each comprise particle identifier sequence and a cell-specific barcode.

[0115] Embodiment 2. The method of embodiment 1, wherein the method further comprises: (e) sequencing the cell-specifically barcoded sequencing libraries of (d)(i) and (ii), or an amplification product thereof, to obtain sequence reads for the first and second populations of nucleic acids; (f) grouping sequence reads from the first and second populations of nucleic acids that have the same cell-specific barcode; (g) assigning omics data for a plurality of individual cells with a corresponding plurality of locations on the support using information determined in step (b).

[0116] Embodiment 3. The method of embodiment 2, wherein step (g) comprises reconstructing an image showing the presence, absence or abundance of at least some omics polynucleotides across at least part of the support.

[0117] Embodiment 4. The method of any prior embodiment, further comprising phenotyping the cells on the support.

[0118] Embodiment 5. The method of embodiment 4, wherein the method comprises assaying or staining the cells on the support and producing an image of the assayed or stained cells.

[0119] Embodiment 6. The method of embodiment 5, further comprising overlaying the image of the assayed or stained cells with omics data for at least some of the cells.

[0120] Embodiment 7. The method of any prior embodiment, wherein in (a) the cells are spatially-associated and step (c) comprises dissociating the cells from one another to make a single cell suspension in which at least some of the cells are associated with a uniquely barcoded particle or unique set of barcoded particles.

[0121] Embodiment 8. The method of any prior embodiment, wherein the randomly associating of step (a) comprises: (i) applying a solution comprising the population of barcoded particles to cells that are immobilized on the support; and (ii) allowing the barcoded particles to bind to the cells; or (i) mixing a solution comprising the population of barcoded particles with cells that are not immobilized on a support, (ii) allowing the barcoded particles to bind to the cells, and (iii) immobilizing the cells and the associated particles on the support

[0122] Embodiment 9. The method of any prior embodiment, wherein cells that are associated with the barcoded particles are associated with an average in the range of 2-10 barcoded particles per cell.

[0123] Embodiment 10. The method of any prior embodiment, wherein the barcoded particles become associated with the cells or nuclei thereof via non-covalent binding interactions.

[0124] Embodiment 11. The method of embodiment 10, wherein the interactions are mediated by an antibody that is tethered to the particles.

[0125] Embodiment 12. The method of any of embodiments 1-9, wherein the barcoded particles become associated with the cells or nuclei thereof via a covalent binding interaction. Embodiment 13. The method of any prior embodiment, wherein the population of barcoded particles employed in step (a) comprise at least 1,000 different barcoded particles.

[0126] Embodiment 14. The method of any prior embodiment, wherein step (b) is performed by microscopy using fluorescent decoder probes that hybridize to the barcode on the particles.

[0127] Embodiment 15. The method of embodiment 14, wherein step (b) is done by multiple rounds of hybridizing decoder probes to the barcode on the particles, washing, imaging, and removing the decoders probes.

[0128] Embodiment 16. The method of any of embodiments 1-13, wherein step (b) is done by one or more rounds of primer extension on the particles using fluorescent nucleotides and imaging.

[0129] Embodiment 17. The method of any prior embodiment, wherein the omics polynucleotides comprise sequences from genomic DNA, RNA, cDNA or copies of oligonucleotides that are associated with cells via a binding agent or hybridization, or complements thereof.

[0130] Embodiment 18. The method of any prior embodiment, wherein step (d) comprises compartmentalizing single cells in droplets, wells, microvolumes, microwells, microbubbles, or emulsions.

[0131] Embodiment 19. The method of any prior embodiment, wherein step (d) is done by a split-pool barcoding method.

[0132] Embodiment 20. A kit comprising one or more of the following components: barcoded particles, fluorescent nucleotides or fluorescent probes, polymerase (for fluorescent nucleotides), a sequence to connect a cell origination barcode to the barcoded oligonucleotide, reagents to dissociate cells from the surface (but maintain association of particles with cells).

[0133] Embodiment 21. A library made from the method of any of embodiments 1-19.

[0134] ALTERNATIVE EMBODIMENTS

[0135] Affinity binder attached to cells or nuclei for the capture of target molecules

[0136] Also provided is a method in which target-specific binding agents (e.g., antibodies, reverse transcription primers such as a random primer or an oligo(dT) primer, etc.) are attached to biological particles (i.e., cells or nuclei) in a way that the binding agent can still bind to its target. For example, if the binding agent is an antibody then it could be attached to the biological particles via its constant region. Likewise, if the binding agent is a primer then it could be attached to the biological particles via its 5 ’ end. This attachment could be done covalently or non-covalently, and could be done via a cell surface protein, a cell-surface carbohydrate, or by attaching a lipid anchor to the binding agent. Nuclei have a natural affinity for oligonucleotides and, as such, primer embodiments may not need to be anchored to a specific type of molecule. In some cases, the binding agents may be cross-linked to the particles (using, e.g., a bifunctional crosslinker) to keep them in place. If the particles are not already permeabilized from an earlier step in the process, the particles may be permeabilized such that the target molecules are free to diffuse in, through, and / or out of the particles. The diffusing target molecules are captured by the binding agents (which are affixed to the particles), and a cell-specifically barcoded omics sequencing library can be made from the permeabilized particles and then analyzed. The method may comprise: (a) attaching a targetspecific capture agent to cells or nuclei that comprises target molecules, wherein: (i) the capture agent comprises a target- specific binding domain that binds to the target molecules in the cells or nuclei; and (ii) after attachment to the cells or nuclei the target- specific binding domain can still bind to the target molecules; (b) permeabilizing the cells with the capture agent attached thereto or optionally permeabilizing the nuclei with the capture agent attached thereto if the nuclei are not already permeable; (c) incubating the permeabilized cells or nuclei under conditions by which the target- specific capture agent binds to the target molecules; and (d) making a cell-specifically barcoded omics sequencing library from the permeabilized cells or nuclei, wherein the omics library comprises nucleic acids that each comprise a cell-specific barcode and a copy of the target molecules, complement of the same, and / or a barcode indicating the identity of the same.

[0137] The biological particles (e.g., nuclei or cells) may be in solution. For example, the cells could be, e.g., cultured cells that have been grown as a cell suspension, or nuclei isolated from the same. In other embodiments, disassociated cells (which cells may have been produced by disassociating cultured cells or cells that are in a solid tissue, e.g., a soft tissue such as liver or spleen, etc. using trypsin or the like) or nuclei isolated from the same may be used. In particular embodiments, the sample may contain blood cells, e.g., whole blood or a sub-population of cells thereof. Sub-populations of cells in whole blood include platelets, red blood cells (erythrocytes), platelets and white blood cells (i.e., peripheral blood leukocytes, which are made up of neutrophils, lymphocytes, eosinophils, basophils, and monocytes), or nuclei isolated from the same.

[0138] Many of the protocols and reagents described in other sections of this disclosure (e.g., binding agents, methods for adding cell-specific barcodes to cells / nuclei, labeling conditions, sequencing methods, bioinformatics analysis, etc.) may be incorporated into the alternative embodiment. For example, in some embodiments, the method may further comprise sequencing the cell- specifically barcoded omics sequencing library to produce sequence reads. As would be apparent, the sequence reads can be analyzing to determine the presence, absence or abundance of the target molecules on a nucleus-by-nucleus or cell-by- cell basis. Similar to the above, the cell-specific barcodes are added via a single cell or nuclei compartmentalization approach, or a split-pool barcoding approach, for example.

[0139] The various reagents may be selected based on how the method is going to be performed. For example, in some embodiments, the permeabilization may done using NP40 and / or digitonin. In another example, the target- specific capture agent may a reverse transcription primer (e.g., an oligo(dT) primer), in which case the sequencing library may be a cell- specifically barcoded cDNA library that comprises nucleic acids that each comprise a cell-specific barcode and a cDNA sequence. In some cases, the target-specific capture agent may be aminated, in which case the method may comprise a fixation step that crosslinks the capture agent to the cells or nuclei (e.g., via a bifunctional cross-linking agent).

[0140] In any embodiment, the method comprises a fixation step that crosslinks cellular components. This fixation may be mild fixation in some cases.

[0141] In any embodiment, the target- specific capture agent does not comprise a cellspecific barcode. Specifically, the target-specific capture agent does not contain, is not conjugated to, and is not in a complex with a cell-specific barcode in step (a) and, in some cases, the same target-specific capture agent may be added to all cells. The cell-specific barcode is added much later in the method.

[0142] In any embodiment, the method may comprise: attaching the target- specific capture agent to the surface of cells; permeabilizing the cells; incubating the permeabilized cells under conditions by which the target-specific capture agent binds to the target molecules as they diffuse out of the cells; and making the cell- specifically barcoded omics sequencing library from the cells. In these embodiments, the target-specific capture agent could be a reverse transcription primer (e.g., an oligo(dT) primer); in which case the reverse transcription primer binds to RNA molecules as they diffuse out of the cells and the omics sequencing library will be a cell-specifically barcoded cDNA library, wherein the cDNA library comprises nucleic acids that each comprise a cell-specific barcode and a cDNA sequence. In these embodiments, the method comprises fixing the cells either before or after permeabilization. e.g., in formaldehyde such as 0.5-5% formaldehyde. Tn these embodiments, the reverse transcription primer could be aminated, in which case the cells may be fixed with a bi-functional crosslinker before permeabilization, thereby cross-linking the primer to the cells.

[0143] Alternatively, the method may be done by incubating nuclei with a reverse transcription primer and then fixing the nuclei. In these embodiments, the method may comprise comprises optionally permeabilizing the nuclei (if the nuclei are not already permeable), incubating the permeabilized nuclei under conditions by which a reverse transcription primer (e.g., oligo(dT) primer) binds to RNA molecules in the nuclei. In these embodiments, the omics sequencing library may a cell-specifically barcoded cDNA library, wherein the cDNA library comprises nucleic acids that each comprise a cell-specific barcode and a cDNA sequence. In these embodiments, the nuclei may be fixed in 0.5-5.0% formaldehyde, e.g., using a homobifunctional cross-linking reagent, e.g., homo-bifunctional N-hydroxysuccimide ester (NHS ester) such as DSP. As with the above, in some embodiments, the reverse transcription primer is aminated, and the fixation may cross-link the reverse transcription to the nuclei. In these embodiments, the nuclei may be isolated nuclei or nuclei that are within permeabilized cells (and therefore accessible to the reagents being used.

[0144] Certain details of this method are described in greater detail below.

[0145] In some cases, traditional fixation and processing methods for single cells can lead to substantial loss of target molecules. This issue is particularly pronounced in single-cell assays like combinatorial indexing, where individual cells serve as compartments rather than being physically isolated in droplets or wells, making them vulnerable to target molecule loss. For example, permeabilization steps may result in losing 30-50% of cytoplasmic mRNA molecules, as these molecules can leak out of cells and diffuse away before analysis. Previously described methods, such as affinity tagging of viable cells for capturing secreted cytokines (Rezk, Li, and Bar-Or 2020), rely exclusively on live, non-fixed cells and avoid permeabilization, making them unsuitable for applications involving fixed cells or nuclei.

[0146] This analyte loss can be especially prominent with in situ single cell assays, where a cell is used as the container and methods like split-pool barcoding of single cells (e.g. Nolan WO 2012 / 106385 A2). Additionally, permeabilization can result in target molecules leaking out of the cell. A potential solution is to attach affinity binders to cells or cell organelles that can capture target molecules of interest before they leak out and are lost (see Fig. 5, Fig. 6, and Fig. 7). Affinity binder can be an oligonucleotide, antibody, peptide, ligand, binding partner, antibody fragment, FAB fragment, synthetic antibodies, monoclonal antibody, aptamer, and the like. Association of affinity binder to cell or nucleus can be covalent, non- covalent, specific, non-specific, direct or indirectly bound to the cell or nucleus. For example, Concanavalin A (ConA), a lectin that binds to carbohydrate moieties on cell / nuclear surface proteins, can be used to associate oligonucleotides with cells / nuclei using biotinylated-ConA, streptavidin or traptavidin, and biotinylated oligonucleotides (Fang et al. 2021). In Fang et al. 2021, they demonstrated quantitative labeling of cell surfaces with over 50,000 oligonucleotides and nuclear surfaces with over 120,000 oligonucleotides providing ample capture sites for diffusing mRNAs which typically are expressed at around a few hundred thousand transcripts per cell (Fang et al. 2021). Affinity binders can be immobilized on macromolecules or particles. The affinity binder can be immobilized on a solid-phase prior to applying to the cell or nucleus (see Fig. 8). The solid phase can be a particle, a bead, a polymer matrix, a macromolecule, dendrimer and the like. Cell membrane- anchored DNA oligonucleotides using cholesterol or lipids is another way to immobilize affinity binders to cells or cell organelles. Poly-L-lysine is a nonspecific attachment factor for cells and is useful in promoting cell adhesion to solid substrates, particles, beads, or macromolecules.

[0147] In some embodiments, the cell or cell organelle can be modified through in situ polymerization and subsequent associating an affinity agent (Zhong, 2023). In some embodiments, the cell or cell organelle can be chemically or metabolic labeled for the purpose of associating affinity binder. In some embodiments, the target molecules associated with the affinity binder can be barcoded in single cell sequencing.

[0148] In some embodiments, the affinity binding reagents or capture probes immobilized on or within cells or nuclei include sequences specifically complementary to cellular or nuclear analytes such as gene-specific sequences or poly(T) sequences targeting mRNA (see Fig. 6). Upon hybridization, these affinity reagents form stable complexes with their respective targets. The association of affinity binders with cells or organelles may be covalent or non-covalent, direct or indirect, specific or non-specific. Examples include Concanavalin A (ConA)-modified oligonucleotides that bind glycoproteins on cell surfaces. Affinity binders may also be immobilized on solid phases like beads, particles, polymer matrices, or dendrimers. Alternatively, membrane- anchored DNA oligonucleotides using cholesterol or lipid modifications, or non-specific attachment factors such as poly-L-lysine, can be used.

[0149] In certain embodiments, cells or organelles are modified by in situ polymerization or labeled chemically or metabolically to facilitate affinity binder attachment (Zhong et al. 2023). Oligonucleotides may also be immobilized via cell membrane anchoring (e.g., phosphorylated lipid conjugates (Jin et al. 2019); or chemical reactions like click chemistry (Agard, Prescher, and Bertozzi 2004).

[0150] Methods disclosed here may incorporate cell hashing techniques for multiplexing and doublet detection in single-cell genomics (Stoeckius et al. 2018; Srivatsan et al. 2020). Hash tags may either be integral to the affinity probes or separately immobilized. Target molecules can be captured post-fixation after crosslink reversal or during fixation via functionalized affinity capture agents (e.g., amine-functionalized oligonucleotides attached via formaldehyde crosslinking).

[0151] In some embodiments, the methods and composition described herein can be used to analyze proteins. Affinity reagents targeting proteins include antibodies, antibody fragments, aptamers, nanobodies, DARPins, affibodies, and tailored peptides can be employed (see Fig. 7). In some embodiments, target molecules may remain cross-linked or trapped within cells, while others are specifically bound to affinity binders. Crowding agents or volume excluders (e.g., PEG, dextran, sucrose, Ficoll, albumin proteins) can enhance target molecule transfer efficiency to immobilized affinity reagents.

[0152] For single-cell sequencing applications, standard barcoding platforms (e.g., Scale Biosciences’ QuantumBarcoding™, lOx Genomics Chromium / FLEX, BD Rhapsody, Fluent Biosciences PIPseq, Scipio Biosciences Asteria, CS Genetics SimpleCell, and combinatorial indexing methods such as described by Martin et al. 2021 are compatible (Martin et al. 2021). These platforms support various assay formats including RNA (3’ and 5’), ATAC- seq, multi-omics, and SMART-seq.

[0153] The described methods also extend to multi-omics analyses by employing multiple affinity binders targeting distinct analyte classes, such as RNA and protein, from the same single cell or organelle. These multi-omics methods can be adapted for analysis of DNA, RNA, proteins, kinases, small molecules, metabolites, or secreted products.

[0154] Resulting single-cell libraries are adaptable for sequencing on standard NGS platforms (e.g., Illumina, Element, Ultima, MGI, PacBio, Roche, Singular Genomics), following appropriate PCR adapterization. Sequencing and subsequent analysis facilitate detailed characterization of captured target molecules(Metzker 2010; Satam et al. 2023). Library preparation can involve hybridization, ligation, extension, gap-fill ligation, or reverse transcription steps and can be performed either with target molecules bound to affinity probes or following their release.

[0155] Exemplary Affinity Binding protocol for enhancing single cell analysis:

[0156] (1) Obtain cells or cell organelles e.g. Nuclei (2) Associate affinity binder to cells or Nuclei e.g. ConA -oligonucleotide

[0157] (3) Optionally remove excess affinity binder

[0158] (4) Cell fixation and permeabilization

[0159] (5) Bind target molecule to affinity binder

[0160] (6) Barcode target molecule associated with the affinity binder and target molecule associated with the cell e.g. fixation.

[0161] Option A: partition cell or cell organelle in volume and associate single cell origination barcode with target molecule

[0162] Option B: barcode target molecule using split-pool barcoding.

[0163] (7) Single cell sequencing.

[0164] ALTERNATIVE EMBODIMENTS

[0165] Alternative embodiment 1. A method comprising: (a) attaching a target-specific capture agent to cells or nuclei that comprises target molecules, wherein: (i) the capture agent comprises a target- specific binding domain that binds to the target molecules in the cells or nuclei; and (ii) after attachment to the cells or nuclei the target-specific binding domain can still bind to the target molecules; (b) permeabilizing the cells with the capture agent attached thereto or optionally permeabilizing the nuclei with the capture agent attached thereto if the nuclei are not already permeable; (c) incubating the permeabilized cells or nuclei under conditions by which the target- specific capture agent binds to the target molecules; and (d) making a cell-specifically barcoded omics sequencing library from the permeabilized cells or nuclei, wherein the omics library comprises nucleic acids that each comprise a cell-specific barcode and a copy of the target molecules, complement of the same, and / or a barcode indicating the identity of the same.

[0166] Alternative embodiment 2. The method of alternative embodiment 1, further comprising: (e) sequencing the cell-specifically barcoded omics sequencing library to produce sequence reads.

[0167] Alternative embodiment 3. The method of alternative embodiment 2, further comprising: (f) analyzing the sequence reads to determine the presence, absence or abundance of the target molecules on a nucleus-by-nucleus or cell-by-cell basis,

[0168] Alternative embodiment 4. The method of any prior alternative embodiment, wherein in (d) the cell-specific barcodes are added using a single-cell compartmentalization method that comprises: (i) compartmentalizing the cells or nuclei, wherein at least some compartments receive a single nucleus or single cell of the cells or nuclei; and (ii) adding cell-specific barcodes to the copy of the target molecules, a complement of the same, and / or a barcode indicating the identity of the same in the compartments.

[0169] Alternative embodiment 5. The method of any of alternative embodiments 1-3, wherein in (d) the cell-specific barcodes are added using a split-and-pool barcoding method comprising: (i) compartmentalizing the nuclei or cells, wherein at least some compartments receive multiple cells; and (ii) adding cells-specific barcodes to the copy of the target molecules, a complement of the same, and / or a barcode indicating the identity of the same using a split-and-pool barcoding method.

[0170] Alternative embodiment 6. The method of any prior alternative embodiment, wherein the permeabilization is done using NP40 and / or digitonin

[0171] Alternative embodiment 7. The method of any prior alternative embodiment, wherein the target- specific capture agent is a reverse transcription primer, and the sequencing library is a cell-specifically barcoded cDNA library, wherein the cDNA library comprises nucleic acids that each comprise a cell-specific barcode and a cDNA sequence

[0172] Alternative embodiment 8. The method of alternative embodiment 7, wherein the reverse transcription primer is an oligo(dT) primer.

[0173] Alternative embodiment 9. The method of any prior alternative embodiment, wherein the target- specific capture agent is aminated, and the method comprises a fixation step that crosslinks the capture agent to the cells or nuclei.

[0174] Alternative embodiment 10. The method of any prior alternative embodiment, wherein the method comprises a fixation step that crosslinks cellular components.

[0175] Alternative embodiment 11. The method of any prior alternative embodiment, wherein the target-specific capture agent of (a) does not comprise a cell-specific barcode.

[0176] Alternative embodiment 12. The method of any prior alternative embodiment, wherein the method comprises: (a) attaching the target- specific capture agent to the surface of cells; (b) permeabilizing the cells; (c) incubating the permeabilized cells under conditions by which the target- specific capture agent binds to the target molecules as they diffuse out of the cells; and (d) making the cell-specifically barcoded omics sequencing library from the cells.

[0177] Alternative embodiment 13. The method of alternative embodiment 12, wherein: the target- specific capture agent of (a) is a reverse transcription primer; in (c) the reverse transcription primer binds to RNA molecules as they diffuse out of the cells; and in (d) the omics sequencing library is a cell-specifically barcoded cDNA library, wherein the cDNA library comprises nucleic acids that each comprise a cell-specific barcode and a cDNA sequence.

[0178] Alternative embodiment 14. The method of alternative embodiment 12 or 13, wherein the method comprises fixing the cells either before or after permeabilization. e.g., in in formaldehyde such as 0.5-5% formaldehyde.

[0179] Alternative embodiment 15. The method of any of alternative embodiments 12-14, wherein the reverse transcription primer is aminated, and the cells are fixed before permeabilization, thereby cross-linking the primer to the cells.

[0180] Alternative embodiment 16. The method of any of alternative embodiments 12-15, wherein the reverse transcription primer is an oligo(dT) primer.

[0181] Alternative embodiment 17. The method of any of alternative embodiments 1-11, wherein: step (a) is done by incubating nuclei with a reverse transcription primer and then fixing the nuclei; step (b) comprises optionally permeabilizing the nuclei if the nuclei are not already permeable; step (c) comprises incubating the permeabilized nuclei under conditions by which reverse transcription primer binds to RNA molecules in the nuclei; and in step (d) the omics sequencing library is a cell-specifically barcoded cDNA library, wherein the cDNA library comprises nucleic acids that each comprise a cell-specific barcode and a cDNA sequence.

[0182] Alternative embodiment 18. The method of alternative embodiment 17 wherein the reverse transcription primer is an oligo(dT) primer.

[0183] Alternative embodiment 19. The method of any of alternative embodiments 17 or 18, wherein the nuclei are fixed in 0.5-5.0% formaldehyde.

[0184] Alternative embodiment 20. The method of any of alternative embodiments 17 or 18, wherein the nuclei are fixed with a homobifunctional cross-linking reagent, e.g., homobifunctional N-hydroxysuccimide ester (NHS ester) such as DSP.

[0185] Alternative embodiment 21. The method of any of alternative embodiments 17-20, wherein the reverse transcription primer is aminated, and the fixation cross-links the reverse transcription to the nuclei.

[0186] Alternative embodiment 22. The method of any of alternative embodiments 17-21, wherein the nuclei are isolated nuclei.

[0187] Alternative embodiment 23. The method of any of alternative embodiments 17-21, wherein the nuclei are within permeabilized cells. International patent application serial no. PCT / US2024 / 019242, filed on March 8, 2024, is incorporated by reference herein for all purposes, including barcode design, single cell barcoding, molecular biology and other method steps. WO2022243609 is also incorporated by reference for all purposes.

[0188] EXAMPLES

[0189] The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the present invention, and are not intended to limit the scope of what the inventors regard as their invention nor are they intended to represent that the experiments below are all or the only experiments performed. Efforts have been made to ensure accuracy with respect to numbers used (e.g. amounts, temperature, etc.) but some experimental errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, molecular weight is weight average molecular weight, temperature is in degrees Celsius, and pressure is at or near atmospheric. Standard abbreviations may be used, e.g., bp, base pair(s); kb, kilobase(s); pl, picoliter(s); s or sec, second(s); min, minute(s); h or hr, hour(s); aa, amino acid(s); kb, kilobase(s); bp, base pair(s); nt, nucleotide(s); i.m., intramuscular(ly); i.p., intraperitoneally ); s.c., subcutaneous(ly); and the like.

[0190] Example 1

[0191] Generation of barcoded particles for spatial cell hashing

[0192] Barcoded particles for spatial cell hashing are created using NHS-activated polymeric particles ranging from 0.05 to 5 pm in diameter. NHS-activated beads are derivatized with trans-cyclooctene (TCO) through a coupling reaction with NH2-PEG24-trans-cyclooctene (TCO). The density of TCO moieties on the beads' surface can be precisely controlled by adjusting the ratio of NH2-PEG24-TCO to NH2-mPEG during the coupling process. This customization ensures optimal barcode density to support assay performance. Next, oligonucleotide barcodes are derivatized with methyltetrazine (mTet) to facilitate their attachment to the TCO-functionalized beads. This is achieved by converting 5’ dT-allyl oligonucleotides with DBCO-PEG-mTet, creating mTet oligo barcodes. These barcodes, at a concentration of 100 M, are then immobilized onto the TCO beads through an inverse electron demand Diels-Alder (iEDDA) reaction. This reaction occurs efficiently by incubating the mTet oligo barcodes with the TCO-functionalized beads in a IX PBS buffer supplemented with 30% formamide at room temperature for one hour. Following barcode immobilization, any remaining TCO groups on the beads are quenched to prevent nonspecific binding. This is done by incubating the beads with 1 mM mPEG-TCO for 30 minutes at room temperature. This quenching step is crucial to ensure that all reactive sites are blocked, thereby enhancing the specificity of the barcode attachment. After quenching, the beads undergo a series of washes to remove unbound oligonucleotides and any residual reagents. The first wash is performed in a 95% formamide buffer / 5% TE solution, which is effective in stripping away any loosely attached molecules. This is followed by two additional washes with IX PBS buffer to further wash the beads for downstream applications.

[0193] Example 2 Preparation of plated (adherent or affixed) tissue culture cells and cell compound screen, pheno typing, and spatial single cell analysis (see Fig. 3).

[0194] Tissue culture cells are plated in 96, 384, or 1536 well microwell plates, by harvesting cells from a confluent culture flask using standard trypsinization or cell scraping techniques, counting the cells, and diluting the cells into cell culture media at appropriate density for subsequent single cell imaging. In general, a 96-well plate supports about 1000- 10,000 cells per well (100 ul per well); a 384-well plate supports 500-5000 cells per well (50 ul per well), and a 1536-well plate supports 100-1000 cells per well (10 ul per well). Cells are evenly distributed in the well by gently tapping the plate and swirling it in a circular motion during plating. After cell distribution, the plates are placed in a cell culture incubator at 37°C with 5% CO2, and the cells are allowed to attach and grow for 1-2 hours.

[0195] Cellular Compound Screen : Plated cells undergo a compound screening protocol as described by Chandrasekaran et al, 2024. After compound screen, cells are fixed by incubation in 1-4% (vol / vol) paraformaldehyde (PFA) at RT for 20 min or alternatively glyoxal solution (2-4% glyoxal, 1% acetic acid, 20% ethanol in ddH2O) for 20 min (Richter et al. 2018). After quenching in 0.125 M glycine solution, and washing 3 times in PBS, barcoded particles (beads) are added to fixed cells and incubated at room temperature for 20 min for beads to attach to cell surface. A second fixation step using 1-3% PFA / 0.1% glutaraldehyde or 1-3 mM solution of a homobifunctional NHS crosslinker (e.g., DSS, BS3, BS(PEG9), etc.) in PBS for 30 min is used to covalently fix barcode hash beads to cells. Some beads may be sensitive to PFA “melting” so a homobiftmctional NHS crosslinker is a good alternative. The reaction is quenched in 0.125 M glycine solution, and washed three times in PBS (Kudo et al. 2024). Alternatively, the beads can be associated with the cells prior to the drug screening, and only a single fixation step is required.

[0196] For downstream scRNA-Seq assays based on reverse transcription (RT) of mRNA, formaldehyde fixation may be deleterious to RT; in contrast, probe-based scRNA-Seq assays are more tolerant to fixation. Alternatively, adherent cells can be fixed in methanol by incubating cells in ice cold methanol for 20 minutes; optionally ~2-3 mM DSP crosslinking reagent can be included to crosslink RNA and proteins (Martin et al. 2022). In another alternative to the formaldehyde fixation, cells can be fixed with a reversible crosslinking agents such as DSP (disulfide containing amine-amine crosslinker) and SPDP (disulfide containing amine- thiol crosslinker). In particular, milder cell fixation can be accomplished by incubating cells with 2.5 mM DSP (Thermo Scientific) and 2.5 mM SPDP (Thermo Scientific) for ~45 minutes in Sodium Phosphate Buffered Saline pH 8.4 (Gerlach et al. 2019). The use of cleavable crosslinking agents, such as DSP and SPDP, allows for crosslink reversal before the reverse transcription step, thereby improving mRNA accessibility to the reverse transcriptase enzyme used in subsequent scRNA-Seq assays. After fixative quenching with [100 mM Tris-HCl pH 7.5, 150 mM NaCl], the cells are blocked and permeabilized using 0.5 X Protein Free Blocking Buffer (Thermo scientific) in PBS, supplemented with 100 pg / ml of pre-boiled tRNA (Roche), 0.5 U / ul RNAsin Plus (Promega) and 0.1% Triton X-100 or alternatively 0.001-0.01% Digitonin (Gerlach et al. 2019). In general, 0.1% Triton X-100 provides greater exogenous access to the cytoplasm, but may also lead to greater leakage of cytosolic analytes such as mRNA from the cell; in contrast, permeabilization with 0.001-0.01% digitonin leads to greater retention of mRNA as described by Paramasivam et al. 2022 (Paramasivam et al. 2022).

[0197] Cellular Painting-. After compound screen, fixation, and barcoded particle association with cells, a Cell Painting protocol is performed as described by Bray et al. and Cimini et al. (Bray et al. 2016; Cimini et al. 2022) herein incorporated by reference. Namely, staining & permeabilizing solution containing PerkinElmer PhenoVue dyes Hoechst 33342, Fluor 488 Concanavalin A, 512 Nucleic Acid Stain, Fluor 555 WGA, and Fluor 568 Phalloidin in IX PhenoVue Dye Diluent A with 0.1% Triton is added to the wells and incubated in the dark at RT for 30 min. (Cimini et al. 2022). After staining and washing, cells are imaged on a compatible microplate-based high content imaging system. After imaging, images are analyzed to assess cell viability, morphology, and relevant cellular responses to drug treatments. In some embodiments, the barcoded hash particles (i.e. associated spatial tags) are simultaneously decoded and imaged during the cell painting protocol. Alternatively, in a preferred embodiment, barcoded hash particles are decoded after Cell Paint imaging and removal of Cell Paint dyes.

[0198] Cellular Paint Removal'. Prior to in situ sequencing of the barcoded hash particles, the Cell Paints are removed using a special set of “removable” Cell Paints designed with a disulfide linker between the binding moiety and the fluorophore by which incubation with a reducing agent such as TCEP easily removes the fluorescent signal (Ramezani et al. 2023). Alternatively, using a method described by von Coburg et al. 2025, standard Cell Paint dyes (except for Mito dye - ) can be removed using a specifically selected elution buffer (0.5 M L- Glycine, 1% SDS, pH 2.5) prior to ISS analysis of barcoded beads (von Coburg et al. 2025). Both Ramezani et al. 2023 and von Coburg et al. 2025 are herein enclosed by reference.

[0199] Decoding of barcoded hash particles: Cell-associated barcoded beads are decoded on a high-content imaging system. A set of decoding dyes compatible with the existing Cell Paint imaging channels is employed. Decoding employs four color channel using fluorescent dyes compatible with 4 of 5 of the Cell Paint imaging channels, namely CF405S (Biotium), FAM / Alexa 488, CF543 (Biotium), and Alexa 555. The fifth channel is not used for decoding since it is difficult to remove the MitoTracker Deep Red dye which is used to stain the cells prior to fixation and is covalently cross-linked to the mitochondria during the fixation step.

[0200] Dissociation of adherent cells into single cell suspension : Fixed adherent cells in a multi-well plate are dissociated into a single-cell suspension using an enzyme-free dissociation buffer (0.5-2 mM EDTA in PBS) and gentle mechanical agitation. To begin, aspirate the culture medium, rinse cells twice with PBS, then add the dissociation buffer and incubate at 37°C for 10-30 minutes, gently tapping the plate every 3-5 minutes to facilitate detachment. Once cells begin to lift, use a multichannel or robotic pipettor to gently pipette the buffer up and down 5-20 times per well to complete dissociation. Pool cells from all wells (if well-barcoded or hashed), centrifuge at 300-500 x g for 5 minutes, and resuspend the pellet in PBS. If necessary, filter the suspension to remove clumps, confirm a single-cell suspension under a microscope, and proceed to downstream single-cell library preparation. scRNA-Seq analysis'. Following Cell Paint and Decode / ISS imaging of adherent or affixed cells, dissociated cells are converted to single cell libraries using a scRNA-Seq assay. Any number of single cell systems can be employed including a microfluidic droplet barcoding platform such as from 10X Genomics or a split-pool barcode system such as from Scale Biosciences. These single cell library assay systems attach cellular barcodes to both omic analytes (or DNA representations thereof) and the particle identifier sequences. Subsequent NGS sequencing data, comprised of cellular barcode information coupled to omic sequences and particle identifier sequences (spatial tags) and combined with in situ sequencing / decoding information of the cell-associated barcoded particles, enables mapping of the cellular omic information directly onto its single cell spatial context. Additionally, the phenotype information is also overlayed on this spatial context to provide single cell spatial information on combined phenotype and omic information across the adherent cell population.

[0201] Example 3 In situ analysis of cell-associated barcoded particles

[0202] Barcoded hash particles (i.e. ) associated with cells are decoded, in situ, by performing several rounds of oligonucleotide decoder pool hybridization as described by Gunderson et al. 2004 and Vickovic et al., 2019. For efficient decoding, the structure of the barcode on the bead should be comprised of a co-linear assembly of subwords, such as generated by split-pool synthesis of barcoded beads as described by Nolan et al., US 11932902 B2 and Delley et al., 2021 (Delley and Abate 2021), herein both incorporated by reference. Decoding is performed by hybridizing pools of fluorescently labeled oligonucleotides (e.g., FAM, CY3) at 10 nM at room temp, in decode buffer (600 mM NaCl, 60 mM potassium phosphate, 0.06% Tween- 20, and 40% formamide at pH 7.6) to the cell associated barcoded hash beads. After imaging, the decoder oligos were stripped from the particle barcodes by incubation in 95% formamide / 5% TE for 1 min at room temperature and then neutralized in decode buffer. After stripping, the next round of decoding is performed. After the final decoding round, the decoding signature for each bead is used to deconvolute the identity of the bead.

[0203] Example 4 (see Fig. 6)

[0204] Immobilization of Poly(dT) [oligo(dT)] primers to cell surface and in vitro RT

[0205] Using an approach adapted from Fang et al. 2021, biotinylated oligonucleotides are immobilized to cells using a biotin-ConA, streptavidin / traptavidin, biotin Poly(dT) [oligo(dT)] sandwich complex (Fang et al. 2021). Adherent or dissociated cells, including fixed cells, are incubated with biotinylated concanavalin A (ConA), which binds specifically to cell-surface glycoproteins (Fang et al. 2021). Cells undergo multiple washes with IX PBS between each binding step (DEPC is used to treat buffers to inactivate RNases; DEPC is inactivated by autoclaving solutions after treatment). Following this, cells are incubated with traptavidin (Kerafast, Inc.), an engineered streptavidin variant exhibiting higher affinity for biotin (Chivers et al. 2010). Subsequently, traptavidin-coated cells are incubated with biotinylated adapter-oligo(dT) reverse transcription (RT) primers (see Fig. 6) to create Poly(A) affinity capture agents (e.g., comprised of oligo(dT) sequence) associated with the cells. Alternatively, a pre-assembled ConA-streptavidin-Poly(dT) oligonucleotide complex can be used to stain the cell surface. The surface immobilized Poly(dT) | oligo(dT) ] primer (see Fig. 6A) optionally contains a cleavable linker for downstream processing in the single cell library protocol. Alternatively, an indirect capture method can be utilized by associating a DNA capture sequence with the cell, which then hybridizes to an oligo(dT) "splint" sequence designed to capture poly(A) mRNA (see Fig. 6B). Oligo(dT)-associated cells are then permeabilized using 0.1% Triton X-100 in IX PBS supplemented with 0.5 U / pL SUPERase (AM2696, ThermoFisher) for 1 hour at room temperature, followed by three washes in IX PBS. Freely diffusible mRNA molecules that diffuse out of the cell can be captured by the oligo(dT) primers associated with the cell surface. After permeabilization oligo (dT) primers (comprised of appropriate adapter sequences) are annealed to intracellular mRNA.

[0206] RT Primer hybridization to cytoplasmic mRNA is performed by incubating the adherent cellular sample with a solution containing 2.5 pM anchored oligo(dT)-adapter reverse transcription primer in 2xSSC, supplemented with 0.5 U / pL SUPERase, for 1 hour at room temperature. The sample is subsequently washed once with IxPBS and placed on ice. The reverse transcription (RT) reaction buffer without enzymes, containing DEPC-treated water, lx M-MuLV RT buffer (P7040L, Enzymatics), 250 pM dNTP mixture is prepared on ice. After removing the oligo(dT)-adapter primer solution, the sample is incubated with this enzyme-free RT reaction buffer on ice for 15 minutes. The buffer is removed, and an enzyme-supplemented RT reaction buffer — containing the previously listed components plus 5 U / pL M-MuLV RT enzyme and 0.5 U / pL SUPERase — is added. The sample undergoes sequential incubation: first 15 minutes on ice, then 15 minutes at 25 °C, and finally Ihr at 37°C. The resulting cDNA product is further barcoded with single cell barcodes using, for example, droplet-based methods (Macosco, 2015) or single cell combinatorial indexing (Martin, 2023).

[0207] For optional genomic DNA digestion, prior to Oligo(dT) hybridization, a mixture comprising 175 pL nuclease-free water, 20 pL of lOx TURBO DNA-free buffer, and 5 pL TURBO DNase (AM1907, ThermoFisher) is prepared and applied to the tissue, then incubated at 37°C for 1 hour. To inactivate DNase, TURBO DNA-free DNase Inactivation Reagent (ThermoFisher) at 20% of the reaction volume is added and incubated for 30 minutes at room temperature on a shaker. The cells are washed twice in 2X SSC the exposed to Oligo (dT) primer hybridization and RT as described above.

[0208] Example 5 (see Fig. 5B)

[0209] Immobilization of poly(dT) primers to nuclei for the capture of mRNA.

[0210] Nuclei were labeled with a poly(dT) DNA tag using a method adapted from Srivatsan et al. 2019 (Srivatsan et al. 2020; Kim et al. 2022). In this method, adherent cells are processed by aspirating media from wells, then wash each well with 100 pL of cold lx PBS. Aspirate again to remove PBS, add 50 pL of TrypLE per well, and incubate at 37°C for 10- 20 minutes depending on the cell line. Once cells detach, quench with 150 pL of culture medium, then transfer the entire 200 pL to a V-bottom 96-well plate with fresh tips. Centrifuge at 300 x g for 5 minutes at 4°C to pellet cells, then aspirate the supernatant. Wash each well again with 100 pL cold lx PBS and centrifuge at 300 x g for 5 minutes at 4°C. Always keep samples cold. To lyse cells and harvest nuclei, add 50 pL of ice-cold CLB solution (lOmM Tris-HCl (pH 7.4), lOmM NaCl, 3mM MgC12, 0.1% NP40 -add fresh, 0.1% Tween20 -add fresh) per well using wide-bore tips, mixing gently by pipetting 3-5 times, and discard tips immediately. For oligonucleotide immobilization, add 1 pL of 10 pM 5'-amine-modified poly(A) capture oligonucleotide (comprised of oligo(dT) sequence) per well (typically, 0.5 pmol per 1,000 cells). The Oligo(dT) oligonucleotide sequence is: 5'- amine-

[0211] GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGXXXXXXXXXXBTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 3,(SEQID N0_where <x,represents a 1Q nt weU_ specific barcode. Mix gently by stirring briefly (avoid pipetting) and incubate on ice for 5 minutes.

[0212] Next, add 108 pL Fixation Buffer (1-3% Formaldehyde, 1.25X PBS) to each well (fixed oligo(dT) primer to nuclei), gently mix with three strokes using wide-bore tips, and incubate on ice for 15 minutes. Centrifuge at 500 x g for 5 minutes at 4°C. Combine all fixed nuclei into a 15 mL conical tube and centrifuge again at 500 x g for 5 minutes at 4°C. Resuspend pellet in 1 mL of Nuclei Buffer (lOmM Tris-HCl - pH 7.4, lOmM NaCl, 3 mM MgCh) containing 0.1% Tween-20, incubate on ice for 3 minutes, and centrifuge again at 500 x g. Wash once more with 1 mL Nuclei Buffer, centrifuge at 500 x g, and finally resuspend the nuclei pellet in 0.5 mL Nuclei Buffer for counting. Mix a small volume with trypan blue for counting and adjust the concentration to 2.5 x 10A6 nuclei / ml.

[0213] Alternatively, oligo(dT) primers can be immobilized to nuclei using the ConA- traptavidin-oligo(dT) approach described in Example 4 except starting with nuclei rather than cells.

[0214] REFERENCES

[0215] Agard, Nicholas J., Jennifer A. Prescher, and Carolyn R. Bertozzi. 2004. “A Strain- Promoted [3 + 2] Azide- Alkyne Cycloaddition for Covalent Modification of Biomolecules in Living Systems.” Journal of the American Chemical Society 126 (46): 15046-47.

[0216] Bray, Mark- Anthony, Shantanu Singh, Han Han, Chadwick T. Davis, Blake Borgeson, Cathy Hartland, Maria Kost- Alimova, Sigrun M. Gustafsdottir, Christopher C. Gibson, and Anne E. Carpenter. 2016. “Cell Painting, a High-Content Image-Based Assay for Morphological Profiling Using Multiplexed Fluorescent Dyes.” Nature Protocols 11 (9): 1757-74.

[0217] Chandrasekaran, Srinivas Niranj, Hugo Ceulemans, Justin D. Boyd, and Anne E. Carpenter. 2021. “Image-Based Profiling for Drug Discovery: Due for a Machine-Learning Upgrade?” Nature Reviews. Drug Discovery 20 (2): 145-59.

[0218] Chen, Xingqi, Ulrike M. Litzenburger, Yuning Wei, Alicia N. Schep, Edward L. LaGory, Hani Choudhry, Amato J. Giaccia, William J. Greenleaf, and Howard Y. Chang. 2018. “Joint Single-Cell DNA Accessibility and Protein Epitope Profiling Reveals Environmental Regulation of Epigenomic Heterogeneity.” Nature Communications 9 (1): 4590.

[0219] Chivers, Claire E., Estelle Crozat, Calvin Chu, Vincent T. Moy, David J. Sherratt, and Mark Howarth. 2010. “A Streptavidin Variant with Slower Biotin Dissociation and Increased Mechanostability.” Nature Methods 7 (5): 391-93.

[0220] Coburg, Elena von, Marlene Wedler, Jose M. Muino, Christopher Wolff, Nils Kbrber, Sebastian Dunst, and Shu Liu. 2025. “Cell Painting PLUS: Expanding the Multiplexing Capacity of Cell Painting-Based Phenotypic Profiling Using Iterative Staining- Elution Cycles.” Nature Communications 16 (1): 3857.

[0221] De Jonghe, Joachim, James W. Opzoomer, Amaia Vilas-Zomoza, Benedikt S. Nilges, Peter Crane, Marco Vicari, Hower Lee, et al. 2024. “ScTrends: A Living Review of Commercial Single-Cell and Spatial ’omic Technologies.” Cell Genomics 4 (12): 100723. Gerlach, Jan P., Jessie A. G. van Buggenum, Sabine E. J. Tanis, Mark Hogeweg, Branco M. H. Heuts, Mauro J. Muraro, Lisa Elze, et al. 2019. “Combined Quantification of Intracellular (Phospho-)Proteins and Transcriptomics from Fixed Single Cells.” Scientific Reports 9 (1): 1469.

[0222] Jin, Cheng, Jiaxuan He, Jianmei Zou, Wenjing Xuan, Ting Fu, Ruowen Wang, and Weihong Tan. 2019. “Phosphorylated Lipid-Conjugated Oligonucleotide Selectively Anchors on Cell Membranes with High Alkaline Phosphatase Expression.” Nature Communications 10 (1): 2704.

[0223] Kim, Hyeon-Jin, Greg Booth, Lauren Saunders, Sanjay Srivatsan, Jose L. McFaline- Figueroa, and Cole Trapnell. 2022. “Nuclear Oligo Hashing Improves Differential Analysis of Single-Cell RNA-Seq.” Nature Communications 13 (1): 2666.

[0224] Kudo, Takamasa, Ana M. Meireles, Reuben Moncada, Yushu Chen, Ping Wu, Joshua Gould, Xiaoyu Hu, et al. 2024. “Multiplexed, Image-Based Pooled Screens in Primary Cells and Tissues with PerturbView.” Nature Biotechnology, October, 1-10.

[0225] Martin, Beth K., Chengxiang Qiu, Eva Nichols, Melissa Phung, Rula Green- Gladden, Sanjay Srivatsan, Ronnie Blecher-Gonen, et al. 2021. “An Optimized Protocol for Single Cell Transcriptional Profiling by Combinatorial Indexing.” ArXiv [q-Bio.GNJ. arXiv. http: / / arxiv.org / abs / 2110.15400.

[0226] Metzker, Michael L. 2010. “Sequencing Technologies - the next Generation.” Nature Reviews. Genetics 11 (1): 31-46.

[0227] Mimitou, Eleni P., Caleb A. Lareau, Kelvin Y. Chen, Andre L. Zorzetto-Fernandes, Yuhan Hao, Yusuke Takeshima, Wendy Luo, et al. 2021. “Scalable, Multimodal Profiling of Chromatin Accessibility, Gene Expression and Protein Levels in Single Cells.” Nature Biotechnology 39 (10): 1246-58.

[0228] Paramasivam, Prasath, Martin Stoter, Eloina Corradi, Irene Dalia Costa, Andreas Hoijer, Stefano Bartesaghi, Alan Sabirsh, et al. 2022. “Quantitative Intracellular Retention of Delivered RNAs through Optimized Cell Fixation and Immunostaining.” RNA 28 (3): 433- 46.

[0229] Pratapa, Aditya, Michael Doron, and Juan C. Caicedo. 2021. “Image-Based Cell Phenotyping with Deep Learning.” Current Opinion in Chemical Biology 65 (December): 9- 17.

[0230] Ramezani, Meraj, J. Bauman, Avtar Singh, Erin Weisbart, John Yong, Maria Lozada, G. Way, et al. 2023. “A Genome-Wide Atlas of Human Cell Morphology.” BioRxiv, August. https: / / doi.org / 10.1101 / 2023.08.06.552164. Rezk, Ayman, Rui Li, and Amit Bar-Or. 2020. “Multiplexed Detection and Isolation of Viable Low-Frequency Cytokine-Secreting Human B Cells Using Cytokine Secretion Assay and Flow Cytometry (CSA-Flow).” Scientific Reports 10 (1): 14823.

[0231] Richter, Katharina N., Natalia H. Revelo, Katharina J. Seitz, Martin S. Helm, Deblina Sarkar, Rebecca S. Saleeb, Elisa D’Este, et al. 2018. “Glyoxal as an Alternative Fixative to Formaldehyde in Immunostaining and Super-Resolution Microscopy.” The EMBO Journal 37 (1): 139-59.

[0232] Russell, Andrew J. C., Jackson A. Weir, Naeem M. Nadaf, Matthew Shabet, Vipin Kumar, Sandeep Kambhampati, Ruth Raichur, et al. 2024. “Slide-Tags Enables SingleNucleus Barcoding for Multimodal Spatial Genomics.” Nature 625 (7993): 101-9.

[0233] Satam, Heena, Kandarp Joshi, Upasana Mangrolia, Sanober Waghoo, Gulnaz Zaidi, Shravani Rawool, Ritesh P. Thakare, et al. 2023. “Next-Generation Sequencing Technology: Current Trends and Advancements.” Biology 12 (7). https : / / doi.org / 10.3390 / biology 12070997.

[0234] Srivatsan, Sanjay R., Jose L. McFaline-Figueroa, Vijay Ramani, Lauren Saunders, Junyue Cao, Jonathan Packer, Hannah A. Pliner, et al. 2020. “Massively Multiplex Chemical Transcriptomics at Single-Cell Resolution.” Science 367 (6473): 45-51.

[0235] Stoeckius, Marlon, Shiwei Zheng, Brian Houck-Loomis, Stephanie Hao, Bertrand Z. Yeung, William M. Mauck 3rd, Peter Smibert, and Rahul Satija. 2018. “Cell Hashing with Barcoded Antibodies Enables Multiplexing and Doublet Detection for Single Cell Genomics.” Genome Biology 19 (1): 224.

[0236] Stossi, Fabio, Pankaj K. Singh, Kazem Safari, Michela Marini, Demetrio Labate, and Michael A. Mancini. 2023. “High Throughput Microscopy and Single Cell Phenotypic Image-Based Analysis in Toxicology and Drug Discovery.” Biochemical Pharmacology 216 (October): 115770.

[0237] Swanson, Elliott, Cara Lord, Julian Reading, Alexander T. Heubeck, Palak C. Genge, Zachary Thomson, Morgan D. A. Weiss, et al. 2021. “Simultaneous Trimodal Single-Cell Measurement of Transcripts, Epitopes, and Chromatin Accessibility Using TEA-Seq.” ELife 10 (April): e63632.

[0238] Swinney, David C., and Jonathan A. Lee. 2020. “Recent Advances in Phenotypic Drug Discovery.” FlOOOResearch 9 (August). https: / / doi.org / 10.12688 / fl000research.25813.!. Way, Gregory P., Heba Sailem, Steven Shave, Richard Kasprowicz, and Neil O. Carragher.

[0239] 2023. “Evolution and Impact of High Content Imaging.” SLAS Discovery 28 (7): 292-305.

[0240] Zhong, Yihong, Lijia Xu, Chen Yang, Le Xu, Guyu Wang, Yuna Guo, Songtao Cheng, et al. 2023. “Site-Selected in Situ Polymerization for Living Cell Surface Engineering.”

[0241] Nature Communications 14 (1): 7285

[0242] While the present invention has been described with reference to the specific embodiments thereof, it should be understood by those skilled in the art that various changes may be made and equivalents may be substituted without departing from the true spirit and scope of the invention. In addition, many modifications may be made to adapt a particular situation, material, composition of matter, process, process step or steps, to the objective, spirit and scope of the present invention. All such modifications are intended to be within the scope of the claims appended hereto.

Claims

CLAIMSWhat is claimed is:

1. A method for making a sequencing library, comprising:(a) providing a population of optically inert barcoded particles that are randomly associated with cells on a support, wherein:(i) the barcoded particles have tethered oligonucleotides that comprise one or more particle identifier sequences that vary in the population; and(ii) at least some individual cells are uniquely labeled by a barcoded particle or set of barcoded particles;(b) determining: (i) the location and (ii) identity of the barcoded particles on the support by in situ analysis of the particle identifier sequences on the support;(c) dissociating the cells from the support while maintaining their association with the barcoded particles; and(d) making:(i) a cell-specifically barcoded omics sequencing library from the disassociated cells, wherein the omics library comprises a first population of nucleic acids that each comprise an omics polynucleotide and a cell-specific barcode; and(ii) a cell-specifically barcoded particle identifier sequencing library from the disassociated cells, wherein the particle identifier sequencing library comprises a second population of nucleic acids that each comprise particle identifier sequence and a cell-specific barcode.

2. The method of claim 1, wherein the method further comprises:(e) sequencing the cell-specifically barcoded sequencing libraries of (d)(i) and (ii), or an amplification product thereof, to obtain sequence reads for the first and second populations of nucleic acids;(f) grouping sequence reads from the first and second populations of nucleic acids that have the same cell-specific barcode;(g) assigning omics data for a plurality of individual cells with a corresponding plurality of locations on the support using information determined in step (b).

3. The method of claim 2, wherein step (g) comprises reconstructing an image showing the presence, absence or abundance of at least some omics polynucleotides across at least part of the support.

4. The method of any prior claim, further comprising phenotyping the cells on the support.

5. The method of claim 4, wherein the method comprises assaying or staining the cells on the support and producing an image of the assayed or stained cells.

6. The method of claim 5, further comprising overlaying the image of the assayed or stained cells with omics data for at least some of the cells.

7. The method of any prior claim, wherein in (a) the cells arc spatially-associated and step (c) comprises dissociating the cells from one another to make a single cell suspension in which at least some of the cells are associated with a uniquely barcoded particle or unique set of barcoded particles.

8. The method of any prior claim, wherein the randomly associating of step (a) comprises:(i) applying a solution comprising the population of optically inert barcoded particles to cells that are immobilized on the support; and(ii) allowing the barcoded particles to bind to the cells; or(i) mixing a solution comprising the population of barcoded particles with cells that are not immobilized on a support,(ii) allowing the barcoded particles to bind to the cells, and(iii) immobilizing the cells and the associated particles on the support9. The method of any prior claim, wherein cells that are associated with the barcoded particles are associated with an average in the range of 2-10 barcoded particles per cell.

10. The method of any prior claim, wherein the barcoded particles become associated with the cells or nuclei thereof via non-covalcnt binding interactions.

11. The method of claim 10, wherein the interactions are mediated by an antibody that is tethered to the particles.

12. The method of any of claims 1-9, wherein the barcoded particles become associated with the cells or nuclei thereof via a covalent binding interaction.

13. The method of any prior claim, wherein the population of barcoded particles employed in step (a) comprise at least 1,000 different barcoded particles.

14. The method of any prior claim, wherein step (b) is performed by microscopy using fluorescent decoder probes that hybridize to the barcode on the particles.

15. The method of claim 14, wherein step (b) is done by multiple rounds of hybridizing decoder probes to the barcode on the particles, washing, imaging, and removing the decoders probes.

16. The method of any of claims 1-13, wherein step (b) is done by one or more rounds of primer extension on the particles using fluorescent nucleotides and imaging.

17. The method of any prior claim, wherein the omics polynucleotides comprise sequences from genomic DNA, RNA, cDNA or copies of oligonucleotides that are associated with cells via a binding agent or hybridization, or complements thereof.

18. The method of any prior claim, wherein step (d) comprises compartmentalizing single cells in droplets, wells, microvolumes, microwells, microbubbles, or emulsions.

19. The method of any prior claim, wherein step (d) is done by a split-pool barcoding method.

20. A kit comprising one or more of the following components: barcoded particles, fluorescent nucleotides or fluorescent probes, polymerase (for fluorescent nucleotides), a sequence to connect a cell origination barcode to the barcoded oligonucleotide, reagents to dissociate cells from the surface (but maintain association of particles with cells).

21. A library made from the method of any of claims 1-19.