Use of ltpcl6 protein and gene encoding same in regulating pathogenicity, mycelial growth, and stress resistance of lasiodiplodia theobromae

Abstract

The use of an LtPCL6 protein and a gene encoding same in regulating pathogenicity, mycelial growth, and stress resistance of Lasiodiplodia theobromae. The gene encoding LtPCL6 protein is derived from Lasiodiplodia theobromae, and a knockout mutant is obtained by constructing a knockout fragment of a Lasiodiplodia theobromae LtPCL6 gene, and introducing same into a Lasiodiplodia theobromae protoplast. Experiments indicate that the LtPCL6 gene has an effect in the growth, cell wall and cell membrane integrity, and stress resistance of Lasiodiplodia theobromae, and significantly reduces the pathogenicity of the Lasiodiplodia theobromae with regard to a host. Therefore, the LtPCL6, serving as a fungicide target and a key protein of a pathogenic mechanism of diseases, can be used for developing agents for diseases caused by Lasiodiplodia theobromae infection and breeding new resistant varieties, and has broad application prospects in the control of plant pathogenic fungal diseases.

Description

LtPCL6 protein and its encoding gene in regulating pathogenicity, mycelial growth and stress resistance of Lasiodiplodia theobromae TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and particularly relates to LtPCL6 protein and its encoding gene in regulating pathogenicity, mycelial growth and stress resistance of Lasiodiplodia theobromae. BACKGROUND

[0002] Lasiodiplodia theobromae belongs to Eumycetes, Ascomycota, Loculoascomycetes, Botryosphaeriales, Botryosphaeriaceae and Lasiodiplodia. The fungus is widely distributed and has multiple hosts, and can cause diseases of tea, eggplant, kiwi, grape, pitaya, mango and blueberry plants. The pathogen can cause leaf spot, rot, ulcer, branch and / or leaf necrosis and other symptoms on plants (Li D.X., Bao X.T., Ren Y.F., Song B.A., Chen Z. 2018. First report of Lasiodiplodia theobromae causing leaf spot on tea plant in Guizhou Province of China. Plant Dis. 103(2): 374. Vieira J.C.B., M.P.S., Bezerra J.D.P., Motta C.M.S., Machado A.R. 2018. First Report of Lasiodiplodia theobromae causing rot in eggplant fruit in Brazil. Plant Dis. 102(10):2039. Zhou Y., Gong G.S., Cui Y.L., Zhang D.X., Chang X.L., Hu R.P., Liu N., Sun X.F. 2015. Identification of Botryosphaeriaceae species causing kiwifruit rot in Sichuan Province, China. Plant Dis. 99(5):699-708. Xing Q., Zhou X., Cao Y., Peng J., Zhang W., Wang X., Wu J., Li X., Yan J. 2023. The woody plant-degrading pathogen Lasiodiplodia theobromae effector LtCre1 targets the grapevine sugar-signaling protein VvRHIP1 to suppress host immunity. J Exp Bot. 74(8):2768-2785. Ganesan G.S., Kumari N., Sahu S., Pattanaik M., Kishore K. 2023. Identification of Lasiodiplodia species inciting stem rot of dragon fruit in India through polyphasic approach. 3Biotech. 13(10):333. El Komy M.H., Ibrahim Y.E., Al-Saleh M.A. 2022. First report of Lasiodiplodia theobromae causing dieback, a destructive disease on Mango trees in Saudi Arabia. Plant Dis. 107:563.The Lasiodiplodia theobromae strain GZHS-2017-010 (China General Microbiological Culture Collection Center preservation number: CGMCC 3.20151, preservation address: No. 1, Beichen West Road, Chaoyang District, Beijing, preservation time: August 2020) is isolated and identified from tea leaf spot in Qilichong Tea Garden, Huishui County, Guizhou Province by the research group of the present inventors. Since the pathogen can infect tea shoots, tender leaves and mature leaves, it seriously affects the quality and yield of tea leaves, and it is necessary to screen high-activity agents and develop comprehensive prevention and control measures for the disease (Li D.X., Bao X.T., Ren Y.F., Song B.A., Chen Z. 2018. First report of Lasiodiplodia theobromae causing leaf spot on tea plant in Guizhou Province of China. Plant Dis. 103(2): 374. Ren Y.F., Bao X.T., Li D.X., Wang Y., Wang D.L., Song B.A., Chen Z. Identification of Lasiodiplodia theobromae, the pathogen of tea leaf spot. Acta Phytopathologica Sinica, 2019, 49: 857-861. Bao X.T., Yang R., Jiang S.L., Zhao J.P., Wang D.L., Li D.X., Wu X., Song B.A., Chen Z. A novel sulfone derivative controls Lasiodiplodia theobromae in tea leaf spot by reducing the ergosterol content. Mol Plant Microbe Interact. 2021. 34(8): 922-938.). So far, the pathogenic molecular biology of Lasiodiplodia theobromae is still relatively weak at home and abroad, especially the lack of reports on the pathogenic mechanism of the pathogen.

[0003] Studies have shown that Lasiodiplodia theobromae successfully infects tea leaves through multiple pathogenic factors. Therefore, fully excavating the pathogenic related genes of Lasiodiplodia theobromae and carrying out functional research are helpful to fully understand the pathogenic mechanism of Lasiodiplodia theobromae, provide a theoretical basis for the prevention and control of the disease caused by Lasiodiplodia theobromae, and provide guidance for effectively controlling the harm of the disease and breeding disease-resistant varieties. SUMMARY

[0004] In view of this, one of the purposes of the present application is to provide a new use of the LtPCL6 protein derived from Lasiodiplodia theobromae, i.e. the application of the LtPCL6 protein in any one of the following 1)-6):

[0005] 1) modulating the pathogenicity of Colletotrichum cacao;

[0006] 2) modulating the mycelial growth of Colletotrichum cacao;

[0007] 3) modulating the cell wall integrity of Colletotrichum cacao;

[0008] 4) modulating the cell membrane integrity of Colletotrichum cacao;

[0009] 5) modulating the stress tolerance of Colletotrichum cacao;

[0010] 6) designing and screening antifungal drugs;

[0011] The LtPCL6 protein is a protein as shown in A1) or A2) below:

[0012] A1) a protein having an amino acid sequence shown in SEQ ID NO. 3;

[0013] A2) a fusion protein obtained by linking a tag to the N terminus and / or C terminus of a protein shown in SEQ ID NO. 3.

[0014] To solve the above technical problems, the present application further provides a new use of a biological material related to the LtPCL6 protein.

[0015] The second object of the present application is to provide a use of a biological material related to the LtPCL6 protein in any one of 1) to 6) below:

[0016] 1) modulating the pathogenicity of Colletotrichum cacao;

[0017] 2) modulating the mycelial growth of Colletotrichum cacao;

[0018] 3) modulating the cell wall integrity of Colletotrichum cacao;

[0019] 4) modulating the cell membrane integrity of Colletotrichum cacao;

[0020] 5) modulating the stress tolerance of Colletotrichum cacao;

[0021] 6) designing and screening antifungal drugs;

[0022] The biological material is any one of A1) to A8) below:

[0023] A1) a nucleic acid molecule encoding the LtPCL6 protein;

[0024] A2) an expression cassette containing the nucleic acid molecule of A1);

[0025] A3) a recombinant vector containing the nucleic acid molecule of A1);

[0026] A4) a recombinant vector comprising the expression cassette of A2);

[0027] A5) a recombinant microorganism comprising the nucleic acid molecule of A1);

[0028] A6) a recombinant microorganism comprising the expression cassette of A2);

[0029] A7) a recombinant microorganism comprising the recombinant vector of A3);

[0030] A8) a recombinant microorganism comprising the recombinant vector of A4).

[0031] In the above-mentioned applications, the nucleotide sequence of the nucleic acid molecule of A1) is as shown in SEQ ID NO. 1 or as shown in SEQ ID NO. 2. The nucleic acid molecule can be DNA, such as cDNA, genomic DNA or recombinant DNA, or RNA, such as mRNA or hnRNA, etc.

[0032] In the above-mentioned applications, the vector can be a plasmid, cosmid, bacteriophage or viral vector; the microorganism can be yeast, bacteria, algae or fungi, such as Agrobacterium.

[0033] A third object of the present application is to provide the use of the above-mentioned LtPCL6 protein as a target in the design and screening of antifungal drugs.

[0034] A fourth object of the present application is to provide the use of the above-mentioned LtPCL6 protein or the above-mentioned biological material in the cultivation of transgenic Colletotrichum gloeosporioides with reduced pathogenicity and / or reduced hyphal growth ability and / or reduced cell wall integrity and / or reduced cell membrane integrity and / or reduced stress resistance.

[0035] A fifth object of the present application is to provide a method for cultivating transgenic Colletotrichum gloeosporioides with reduced pathogenicity and / or reduced hyphal growth ability and / or reduced cell wall integrity and / or reduced cell membrane integrity and / or reduced stress resistance, comprising the step of reducing the expression amount and / or activity of the above-mentioned LtPCL6 protein in a recipient Colletotrichum gloeosporioides, to obtain the transgenic Colletotrichum gloeosporioides. The pathogenicity and / or hyphal growth ability and / or cell wall integrity and / or cell membrane integrity and / or stress resistance of the transgenic Colletotrichum gloeosporioides are lower than those of the recipient Colletotrichum gloeosporioides.

[0036] Preferably, the method for reducing the expression amount and / or activity of the LtPCL6 protein in the recipient Colletotrichum gloeosporioides is achieved by knocking out or inhibiting or silencing the expression of the gene encoding the LtPCL6 protein in the recipient Colletotrichum gloeosporioides.

[0037] Preferably, the gene encoding the LtPCL6 protein in the recipient Lasiodiplodia theobromae can be knocked out by a method of homologous recombination.

[0038] Preferably, the method of knocking out the gene encoding the LtPCL6 protein in the recipient Lasiodiplodia theobromae by a method of homologous recombination is introducing a homologous recombination fragment for homologous recombination into protoplasts of the recipient Lasiodiplodia theobromae.

[0039] The sixth object of the present application is to provide the use of the above method in the prevention and treatment of diseases caused by Lasiodiplodia theobromae.

[0040] The present application provides the use of the LtPCL6 protein and its encoding gene derived from Lasiodiplodia theobromae in regulating the pathogenicity, mycelial growth, cell wall integrity, cell membrane integrity and stress resistance of the plant pathogenic fungus Lasiodiplodia theobromae. It is found that the pathogenicity, mycelial growth, cell wall integrity, cell membrane integrity and stress resistance of the Lasiodiplodia theobromae after knocking out the gene encoding the LtPCL6 protein in the wild type Lasiodiplodia theobromae are significantly reduced. Therefore, the LtPCL6 can be used as a fungicide target and a key protein in the pathogenic mechanism of diseases to develop fungicides and cultivate new varieties resistant to diseases caused by Lasiodiplodia theobromae, and has a broad application prospect in the prevention and treatment of plant pathogenic fungal diseases. BRIEF DESCRIPTION OF DRAWINGS

[0041] Fig. 1 is a schematic diagram of the knockout and mutant screening strategy of the LtPCL6 gene of Lasiodiplodia theobromae according to the present application;

[0042] Fig. 2 is a map of the plasmid pct74 according to the present application;

[0043] Fig. 3 is a schematic diagram of the observation of the protoplasts prepared according to the present application under a microscope;

[0044] Fig. 4 is a PCR electropherogram (amplification P1) for verification of the transformants according to the present application;

[0045] Fig. 5 is a PCR electropherogram (amplification P2) for verification of the transformants according to the present application;

[0046] Fig. 6 is a PCR electropherogram (amplification P3) for verification of the transformants according to the present application;

[0047] Fig. 7 is a PCR electropherogram (amplification P4) for verification of the transformants according to the present application;

[0048] Fig. 8 is a diagram of the colony growth of the wild type and mutant ΔLtPCL6 on PDA according to the present application;

[0049] Fig. 9 is a diagram of the colony growth of the wild type and mutant ΔLtPCL6 under different stress conditions according to the present application;

[0050] Figure 10 is a plot of colony growth inhibition rate of wild type and mutant ΔLtPCL6 of the application under different stress conditions;

[0051] Figure 11 is a result of pathogenicity determination of wild type and mutant ΔLtPCL6 of the application on tea leaves. DETAILED DESCRIPTION

[0052] The application will be described in detail below with reference to the examples, which are merely illustrative and not restrictive of the application. The application is not limited to the following embodiments or examples, and any modification and variation made without departing from the spirit of the application shall be included in the scope of the application. The experimental materials used in the following examples are commercially available unless otherwise specified.

[0053] In the following examples, the cocoa hairy two-spotted wild strain GZHS-2017-010 was isolated and identified from tea leaf spot in a tea garden in Huishui County, Guizhou Province, and was deposited with the China General Microbiological Culture Collection Center, with the strain preservation number CGMCC3.20151 and the preservation address No. 1 Beichen West Road, Chaoyang District, Beijing. The genomic DNA sequence of the LtPCL6 gene in the strain is shown in SEQ ID NO. 1, the CDS sequence of the LtPCL6 gene is shown in SEQ ID NO. 2, and the amino acid sequence of the LtPCL6 protein encoded by the LtPCL6 gene is shown in SEQ ID NO. 3.

[0054] Example 1 Knockout of the LtPCL6 gene of cocoa hairy two-spotted

[0055] The schematic diagram of the knockout and mutant screening strategy of the LtPCL6 gene of cocoa hairy two-spotted is shown in Figure 1, and the specific construction and screening method is as follows:

[0056] 1. Construction of knockout gene fragment

[0057] 1) Amplification of upstream and downstream homologous sequences of the target gene: design primers based on SEQ ID NO. 1, use the genomic DNA of the cocoa hairy two-spotted wild strain CGMCC3.20151 as the template, and use primers 1F and 2R to amplify the upstream A fragment, and use primers 3F and 4R to amplify the downstream B fragment. A reverse complementary sequence of primer HYGF is added to the 5' end of primer 2R, and a reverse complementary sequence of primer HYGR is added to the 5' end of primer 3F. The sequences (from 5' end to 3' end) of primers 1F, 2R, 3F, 4R, HYGF and HYGR are as follows:

[0058] 1F: CTGCTACGACAACAAGGACAT

[0059] 2R: ACCTCCACTAGCTCCAGCCAAGGAGGCGGGAGGACAAAGAT

[0060] 3F: GAATAGAGTAGATGCCGACCGGGAGTGGGCGGGTTTCGATACA

[0061] 4R: TAATTCGAATGCGTGAAGGT

[0062] HYG-F: CTTGGCTGGAGCTAGTGGAGGT

[0063] HYG-R: CCCGGTCGGCATCTACTCTATTC

[0064] 2) Amplification of the hygromycin resistance gene hph: the first half of the hygromycin resistance gene H1 (1094 bp) was amplified using primers HYG-F and HYG-1R with plasmid pct74 (the map is shown in Figure 2) as the template; the second half of the hygromycin resistance gene H2 (748 bp) was amplified using primers HYG-1F and HYG-R. The sequences of primers HYG-1F and HYG-1R (from 5' end to 3' end) are:

[0065] HYG-1F: CGTTGCAAGACCTGCCTGAA

[0066] HYG-1R: GGATGCCTCCGCTCGAAGTA

[0067] 3) Fusion of the upstream and downstream fragments of the target gene with the hygromycin resistance gene: Overlapping PCR was used to overlap the recovered A fragment and B fragment with H1 fragment and H2 fragment respectively to obtain A-H1 ligation fragment and H2-B ligation fragment. Primers 1F / HYG-1R and HYG-1F / 4R were used to amplify A-H1 and H2-B fragments respectively, and the knockout fragment was purified to a concentration of 500 ng / μL.

[0068] 2, Preparation of Colletotrichum gloeosporioides protoplasts

[0069] 1) Colletotrichum gloeosporioides was inoculated on potato glucose agar medium and cultured at 28°C for 36 h, 2-3 mL of sterile water was added dropwise on the surface of the colony, and the mycelium was broken with an inoculation loop. The bacterial suspension was transferred to CM liquid medium and shaken for 24 h, and fresh mycelium of Colletotrichum gloeosporioides was collected by filtration;

[0070] 2) 10 mL 0.7 mol / L sodium chloride solution as osmotic pressure stabilizer, configuration of disintegration enzyme (Drislase) and snailase mixed enzyme solution, lysis of suspended mycelium 5 g, 28 ℃, 120 rpm enzymolysis 4 h;

[0071] 3) 2-3 layers of sterilized mirror paper (fiber mesh aperture 45 ± 12 μm) filtration, 1.2 mol / L sodium chloride rinse, collect the filtrate, the resulting filtrate at 4 ℃, 4000 rpm centrifugation 6 min. Resuspended with 15 mL 1.2 mol / L sorbitol buffer (STC) solution;

[0072] 4) Discard the supernatant, resuspend the protoplast with 1 mL STC buffer, make a concentration of 1 × 10 7 Protoplast suspension (protoplast microscope observation schematic diagram as shown in Figure 3), ice for standby.

[0073] 3, cocoa hair color two spore protoplast transformation

[0074] 1) Take 200 μL of protoplast suspension into a 50 mL centrifuge tube, add 10-20 μg of A-H1 and H2-B knock-out transformation fragment, mix gently, and stand on ice for 20 min.

[0075] 2) Add 200 μL, 200 μL, 800 μL of 60% polyethylene glycol 3350 buffer (PTC) in turn, mix gently, stand at room temperature for 20 min, add 5 mL TB3 liquid medium, mix, and stand for 8-12 h.

[0076] 3) Room temperature, 4000 rpm / min centrifugation 6 min, discard the supernatant, resuspend the remaining 1 mL with the regenerated protoplast.

[0077] 4) Add 50 mL of warm TB3 regeneration solid medium, mix, and prepare a plate. After 10 h of inverted culture at 28 ℃, cover with PDA medium containing 50 μg / mL hygromycin B, and culture at 28 ℃ for 3-4 days, until the transformants grow, and then subculture for 3 generations.

[0078] 4, transformant PCR verification

[0079] After subculturing for 3 generations on PDA medium containing hygromycin, 7 transformants of ΔLtPCL6 were obtained, and the transformants were numbered 1-7, and corresponded to lanes 2-8 of the electrophoretic map of PCR amplification below. DNA was extracted from the transformant colonies by CTAB method, and four pairs of primers were used for PCR amplification. Primer pair HYGF / HYGR was used to amplify fragment P1 to detect the presence of hph gene (as shown in Figure 4, lane 1: 2kb Plus II DNA Marker, lanes 2-8: amplification of P1 in the transformants; lane 9: amplification of P1 in wild type strain of Colletotrichum gloeosporioides CGMCC 3.20151 wild type). Primer pair 5F / 6R was used to amplify fragment P2 to detect whether the target gene was knocked out (as shown in Figure 5, lane 1: 2kb Plus II DNA Marker, lanes 2-8: amplification of P2 in the transformants; lane 9: amplification of P2 in wild type strain of Colletotrichum gloeosporioides CGMCC 3.20151 wild type). Primer pair 7F / HYG-1R was used to amplify fragment P3 to detect the occurrence of homologous recombination at the upstream (as shown in Figure 6, lane 1: 2kb Plus II DNA Marker, lanes 2-8: amplification of P3 in the transformants; lane 9: amplification of P3 in wild type strain of Colletotrichum gloeosporioides CGMCC 3.20151 wild type). Primer pair HYG-1F / 8R was used to amplify fragment P4 to detect the occurrence of homologous recombination at the downstream (as shown in Figure 7, lane 1: 2kb Plus II DNA Marker, lanes 2-8: amplification of P4 in the transformants; lane 9: amplification of P4 in wild type strain of Colletotrichum gloeosporioides CGMCC 3.20151 wild type). As shown in Figures 4-7, 2 positive transformants were obtained. The sequences of primers 5F, 6R, 7F and 8R (from 5' end to 3' end) are as follows:

[0080] 5F: ATGGGCTCCATCGTGATTACGAGCAGCGA

[0081] 6R: TCAGGAAGGCGCAGCAGCCTGCTGTG

[0082] 7F: ATCGGAGTGCTGGGTGAAGG

[0083] 8R: TGACCCATACTCCAGTGACCGAG

[0084] Using the homologous recombination method, the gene knockout fragment was introduced into the Colletotrichum gloeosporioides protoplast, and 7 hygromycin positive transformants (No. 1-7) were obtained. The positive transformants were analyzed by PCR using hph gene specific primers, and the results are shown in Figures 4-7. The hph gene, the occurrence of homologous recombination upstream and the occurrence of homologous recombination downstream were detected in the 7 transformants, but the LtPCL6 gene was not amplified in No. 1 and 2, so 2 positive transformants were obtained, i.e. ΔLtPCL6 knockout mutants.

[0085] Example 2 Phenotype observation and stress resistance analysis of Colletotrichum gloeosporioides wild type and ΔLtPCL6 knockout mutants

[0086] 1. Colony morphology observation and growth rate determination

[0087] The Colletotrichum gloeosporioides wild type and knockout mutant ΔLtPCL6 were inoculated on PDA medium and cultured at 28°C in the dark. The colony diameter was measured using the cross method at 3d, and the colony morphology was observed. Four replicates were set for each treatment.

[0088] The results of colony morphology observation and growth rate determination of Colletotrichum gloeosporioides wild type and knockout mutant ΔLtPCL6 on PDA medium are shown in Figure 8, wherein Figure 8A is the growth of Colletotrichum gloeosporioides wild type and mutant strain ΔLtPCL6 inoculated on PDA medium for 24h, and the scale is 1cm; Figure 8B is the colony growth rate of Colletotrichum gloeosporioides wild type and mutant strain ΔLtPCL6 inoculated on PDA medium for 24h, and the vertical coordinate is the lesion measurement diameter. The values are the mean values based on 4 independent experiments, and the data were analyzed by Duncan's new multiple range method (p<0.05). As shown in Figure 8, the colony morphology and growth rate of Colletotrichum gloeosporioides knockout mutant ΔLtPCL6 on PDA medium were significantly lower than those of the wild type, indicating that the LtPCL6 gene had a significant effect on the growth of Colletotrichum gloeosporioides.

[0089] 2. Stress resistance analysis

[0090] 1) Oxidative stress analysis: Colletotrichum gloeosporioides wild type and knockout mutant ΔLtPCL6 were inoculated on PDA medium containing 0.06% H2O2, and cultured in an inverted incubator at 28°C for 2-3d. The colony growth of knockout mutant ΔLtPCL6 and wild type was observed.

[0091] 2) Cell wall integrity analysis

[0092] Colletotrichum gloeosporioides wild type and knockout mutant ΔLtPCL6 were inoculated on PDA medium containing 120 μg / mL Congo red respectively, and then incubated at 28°C for 2-3 days. The growth of the colonies of knockout mutant ΔLtPCL6 and wild type strain were observed.

[0093] 3) Cell membrane integrity analysis

[0094] Colletotrichum gloeosporioides wild type and knockout mutant ΔLtPCL6 were inoculated on PDA medium containing 0.05% sodium dodecyl sulfate (SDS) respectively, and then incubated at 28°C for 2-3 days. The growth of the colonies of knockout mutant ΔLtPCL6 and wild type strain were observed.

[0095] 4) High osmotic stress analysis

[0096] Colletotrichum gloeosporioides wild type and knockout mutant ΔLtPCL6 were inoculated on PDA medium containing 0.6 mol / L NaCl and PDA medium containing 0.5 mol / L sorbitol respectively, and then incubated at 28°C for 2-3 days. The growth of the colonies of knockout mutant ΔLtPCL6 and wild type strain were observed.

[0097] The colony diameters of all strains were measured (cross method) and photographed. The growth inhibition rate of strains = (colony diameter of control strain - colony diameter of treated strain) / colony diameter of control strain * 100%.

[0098] The growth of the cocoa hairy metulae LtPCL6 gene knockout mutant ΔLtPCL6 and the wild type under different stress conditions is shown in Figure 9 (wherein A-E are the growth of the cocoa hairy metulae wild type strain CGMCC 3.20151 on the medium under different stress conditions; F-J are the growth of the cocoa hairy metulae mutant strain ΔLtPCL6 on the medium under different stress conditions; 120 μg / mL Congo red: containing a final concentration of 120 μg / mL Congo red; 0.5 mol / L sorbitol: containing a final concentration of 0.5 mol / L sorbitol; 0.05% SDS: containing a final concentration of 0.05% SDS; 0.06% H2O2: containing a final concentration of 0.06% H2O2; 0.6 mol / L NaCl: containing a final concentration of 0.6 mol / L NaCl; the scale is 1 cm); and the relative growth inhibition rate of the colonies under different stress conditions is shown in Figure 10, wherein the vertical coordinate is the relative growth inhibition rate, the numerical value is the mean value based on 4 independent experiments, and the data is analyzed by Duncan's new multiple range method (p<0.05). From left to right in Figure 10 are the relative growth inhibition rates of the colonies of the wild type and the knockout mutant under Congo red, sorbitol, SDS, H2O2 and NaCl stress; the data is analyzed by Duncan's new multiple range method (p<0.05). As shown in Figure 9, the growth rate of the knockout mutant ΔLtPCL6 on different media is significantly lower than that of the wild type; as shown in Figure 10, the relative growth inhibition rate of the colonies of the knockout mutant ΔLtPCL6 is significantly lower than that of the wild type in the PDA medium containing 120 μg / mL Congo red, 0.5 mol / L sorbitol, 0.05% SDS and 0.6 mol / L NaCl, indicating that the knockout of the LtPCL6 gene reduces the sensitivity to Congo red, sorbitol, SDS and NaCl; the relative growth inhibition rate of the colonies of the knockout mutant ΔLtPCL6 is significantly higher than that of the wild type in the PDA medium containing 0.06% H2O2, indicating that the knockout of the LtPCL6 gene increases the sensitivity to H2O2.

[0099] In summary, the knockout of the LtPCL6 gene reduces the growth rate, cell wall integrity, cell membrane integrity and tolerance to high salt and high osmotic stress and oxidative stress of the cocoa hairy metulae.

[0100] Example 3 Pathogenicity analysis of the cocoa hairy metulae knockout mutant

[0101] The cocoa hairy metulae wild type and the knockout mutant ΔLtPCL6 were inoculated on PDA medium, respectively, and incubated in an incubator at 28°C for 24 h, and then several bacterial cakes were punched at the edge of the colonies with a sterilized puncher with a diameter of 4 mm, and then inoculated on the surface of tea leaves, and the incidence of tea leaves was investigated after 3 days.

[0102] The pathogenicity of the cocoa hairy metulae two-spotted mutant ΔLtPCL6 on tea leaves is shown in Figure 11, wherein Figure 11A is a plot of lesions of the cocoa hairy metulae two-spotted wild type strain and mutant strain ΔLtPCL6 inoculated on tea leaves after 3 days; Figure 11B is a plot of lesion diameter measurement results of the cocoa hairy metulae two-spotted wild type strain and mutant strain ΔLtPCL6 inoculated on tea leaves after 3 days, the vertical coordinate is the lesion measurement diameter, the numerical value is the mean value based on 30 independent experiments, and the data is analyzed by Duncan's new multiple range method (p<0.05). As can be seen from Figure 11, compared with the wild type, the lesion diameter of the knockout mutant ΔLtPCL6 is smaller on tea leaves, indicating that after knocking out the LtPCL6 gene, the pathogenicity of the cocoa hairy metulae two-spotted strain is significantly reduced.

[0103] In summary, the LtPCL6 gene or LtPCL6 protein provided by the present application can be used for the prevention and control of diseases caused by cocoa hairy metulae two-spotted, and can be used as a target for plant disease prevention and control drugs. Those skilled in the art can follow the teachings and inspirations of the present specification to develop a drug for preventing and controlling plant diseases, especially diseases caused by cocoa hairy metulae two-spotted.

[0104] The conventional techniques and schemes not described in detail in the above embodiments are well known in the art, and therefore will not be described in detail here. The above embodiments and / or experimental examples describe the preferred embodiments of the present application in detail, however, the present application is not limited to the specific details in the above embodiments, and within the technical concept of the present application, various simple modifications can be made to the technical solutions of the present application, and these simple modifications all belong to the protection scope of the present application.

Claims

1. Use of a LtPCL6 protein in any one of 1) to 6) below: 1) modulating pathogenicity of Colletotrichum cacao; 2) modulating mycelium growth of Colletotrichum cacao; 3) modulating cell wall integrity of Colletotrichum cacao; 4) modulating cell membrane integrity of Colletotrichum cacao; 5) modulating stress tolerance of Colletotrichum cacao; 6) designing and screening antifungal drugs; said LtPCL6 protein is a protein as shown in A1) or A2) below: A1) a protein having an amino acid sequence as shown in SEQ ID NO. 3; A2) a fusion protein obtained by linking a tag to the N-terminus and / or C-terminus of a protein as shown in SEQ ID NO.

3.

2. Use of a biological material related to the LtPCL6 protein as described in claim 1 in any one of 1) to 6) below: 1) modulating pathogenicity of Colletotrichum cacao; 2) modulating mycelium growth of Colletotrichum cacao; 3) modulating cell wall integrity of Colletotrichum cacao; 4) modulating cell membrane integrity of Colletotrichum cacao; 5) modulating stress tolerance of Colletotrichum cacao; 6) designing and screening antifungal drugs; said biological material is any one of A1) to A8) below: A1) a nucleic acid molecule encoding the LtPCL6 protein; A2) an expression cassette containing the nucleic acid molecule of A1); A3) a recombinant vector containing the nucleic acid molecule of A1); A4) a recombinant vector containing the expression cassette of A2); A5) a recombinant microorganism containing the nucleic acid molecule of A1); A6) a recombinant microorganism containing the expression cassette of A2); A7) a recombinant microorganism containing the recombinant vector of A3); A8) a recombinant microorganism containing the recombinant vector of A4).

3. The use according to claim 2, wherein the compound is ###0002### The nucleotide sequence of the nucleic acid molecule of A1) is as shown in SEQ ID NO. 1 or as shown in SEQ ID NO.

2.

4. Use of the LtPCL6 protein as described in claim 1 as a target in designing and screening antifungal drugs.

5. Use of the LtPCL6 protein as described in claim 1 in cultivating transgenic Colletotrichum cacao having reduced pathogenicity and / or reduced mycelium growth and / or reduced cell wall integrity and / or reduced cell membrane integrity and / or reduced stress tolerance.

6. A method for breeding a transgenic Colletotrichum gloeosporioides having reduced pathogenicity and / or reduced mycelial growth and / or reduced cell wall integrity and / or reduced cell membrane integrity and / or reduced stress tolerance, characterized in that, The step of reducing the expression amount and / or activity of the LtPCL6 protein as described in claim 1 in a recipient Colletotrichum cacao to obtain the transgenic Colletotrichum cacao.

7. The method of claim 6, wherein, The method of reducing the expression amount and / or activity of the LtPCL6 protein as described in claim 1 in a recipient Colletotrichum cacao is achieved by knocking out or inhibiting or silencing expression of the gene encoding the protein as described in claim 1 in the recipient Colletotrichum cacao.

8. The method of claim 7, wherein, The method of knocking out the gene encoding the protein as described in claim 1 in the recipient Colletotrichum cacao by homologous recombination is introducing a homologous recombination fragment for homologous recombination into protoplasts of the recipient Colletotrichum cacao.

9. The method of claim 8, wherein, ​ 10. The use of a method according to claim 9 for controlling diseases caused by Mycosphaerella cruenta.

Images