Engineered RNA devices in human t-cells to control gene expression externally

Abstract

The invention provides an RNA device comprising a nucleic acid comprising a first domain comprising a drug-sensitive aptamer (APT), a second domain comprising a communication module (CM), and a third domain comprising a ribozyme (RZ), wherein one or more of the following are present: (a) the first domain comprises a tetracycline (Tc)-sensitive APT, (b) the third domain comprises a CM comprising helical base pairs, (c) the second domain comprises an RZ derived from the HHRZ from Schistosoma mansoni (Sm), or (d) a combination of one or more of (a) through (c). The invention further provides genetic constructs, vectors, cells, and populations of such cells comprising the RNA device, as well as compositions and methods for using the RNA device and cells and populations containing such in the treatment of cancer.

Description

Leydig 774292 NIH E-234-2023-0-PC-01 1 ENGINEERED RNA DEVICES IN HUMAN T-CELLS TO CONTROL GENE EXPRESSION EXTERNALLY CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This patent application claims the benefit of U.S. Provisional Patent Application No. 63 / 683,318, filed August 15, 2024, which is incorporated by reference. STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

[0002] This invention was made with Government support under project numbers 001-0383- 732 by the National Institutes of Health, National Cancer Institute. The Government has certain rights in the invention. INCORPORATION-BY-REFERENCE OF MATERIAL SUBMITTED ELECTRONICALLY

[0001] Incorporated by reference in its entirety herein is a computer-readable nucleotide / amino acid sequence listing submitted concurrently herewith and identified as follows: One 41,318 Byte XML file named “774292.XML,” dated August 13, 2025. BACKGROUND OF THE INVENTION

[0002] Immune checkpoint blockade has become one of the most effective approaches in immunotherapy against a broad spectrum of cancers. Some of the most common immune checkpoint inhibitors are those that target PD-1 and cytotoxic T-lymphocyte antigen 4 (CTLA-4) T-cell receptors (TCRs). Currently, therapeutic agents against PD-1 or its ligand (PD-L1) account for approximately 75% of all registered immunotherapy clinical trials around the world.

[0003] However, the longevity of cytotoxic T lymphocytes (T-cells) represents a technical barrier to the therapeutic application of immune checkpoint blockade. Within the tumor microenvironment, multiple cytokines are expressed, which, in turn, trigger the expression of programmed cell death protein 1 (PD-1), a key part of the cellular innate immune response. PD- 1 recognizes PD-L1, which is upregulated in a myriad of cancer types. As a result, T-cells lose their potency against cancer cells, a phenomenon known as “T-cell exhaustion.”Leydig 774292 NIH E-234-2023-0-PC-01 2

[0004] The use of PD-1 knockout (KO) cytotoxic T lymphocytes (CTLs) has been proposed to address this technical barrier. Such CTLs can induce apoptosis (i.e., caspase activation), and xenografted mice treated with PD-1 KO CTLs have demonstrated repressed tumor growth and prolonged survival. However, the use of such PD-1-KO cells presents the risk of serious side- effects. For example, PD-1 deficiency in mice leads to loss of peripheral tolerance, resulting in the augmentation of autoimmune diseases, Lupus-like arthritis, glomerulonephritis, fetal dilated cardiomyopathy, type 1 diabetes, and a graft-versus-host like disease. In human subjects, prolonged clinical trials with PD1 deficiency resulted in the development of acquired and adaptive resistance and autoimmune adverse effects. Thus, approaches involving PD-1 deficiency, such as PD-1-KO cells, may not, therefore, be an ideal solution to the problem posed by the loss of potency of T-cells. Despite several approaches available for cancer treatment by immunotherapy, a major challenge is to keep T cells activated for relatively longer time during the treatment procedure. Hence, the present invention addresses technical barrier. BRIEF SUMMARY OF THE INVENTION

[0005] The invention provides an alternative approach using an engineered RNA (aptazyme) device with PD-1 or CTLA-4 to enhance T-cell therapy by controlling the expression of PD-1 or CTLA-4 at the levels of transcription or co-transcriptional splicing via RNA degradation, thus bypassing interferences from host cell regulatory networks and pathways altogether. The inventive device can regulate PD-1 or CTLA-4 expression in a ligand dose-dependent manner, and PD-1 or CTLA-4 expression is recoverable once the ligand is removed from the growth medium. Additionally, the inventive approach using RNA as a gene control element as opposed to a combination of DNA / proteins or RNA / proteins presents several other advantages: 1) fast regulatory response; 2) modularity and portability; 3) implementable at multiple regulatory levels; 4) small genetic footprint and no immunogenicity; 5) externally tunable via small- molecule drugs; 6) reversible; 7) controlled expression of a targeted gene without perturbing innate host regulatory networks and without the involvement of protein cofactors.

[0006] The invention also provides a method of use for such RNA aptazyme devices in immunotherapy involving checkpoint inhibitors (e.g. PD-1 or CTLA-4), and methods of making such RNA aptazyme devices.Leydig 774292 NIH E-234-2023-0-PC-01 3

[0007] The inventive approach involving cleaving PD-1 transcripts by using the inventive RNA device can reduce its level, thus helping maintaining T cells functional for relatively longer time. This approach is applicable to maintain cellular homeostasis to combat a plethora of diseases. BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWING(S)

[0008] Figure 1 presents schematic representations of the secondary structures of RNA devices described in the Examples.

[0009] Figure 2 presents information and data concerning CRISPR-mediated integration of D43 depletes PD1 levels in EL4 cells. The graphic is a schematic pictorial representation of the strategy for functional activity of the RNA device. D43 is integrated in the 3’ UTR of PD1 by CRISPR-Cas 9 system.

[0010] Figure 3 presents confocal projection images of EL4 wild type or device-KI cells stained with anti-PD1 Ab either in the absence or presence of varying concentration of tetracycline. Cells are counterstained with DAPI. Scale bar in B1 represents 5 ^^M and applies to all images.

[0011] Figure 4 presents an immunoblot of protein lysate from wild type and device KI cells either treated (12.5 ^^M, 25 ^^M and 50 ^^M) or untreated (0 ^^M) with Tc and challenged with anti-PD1 and anti-GAPDH antibodies, with the respective bands as indicated in the image. Lane 1 shows the molecular marker.

[0012] Figure 5 presents a histogram representing the mean (± S.D.) expression level of PD1 protein in device-KI cells treated with Tc along with appropriate controls in three independent biological replicates. The mean values are calculated relative to the level of protein expression in their respective wild type controls.

[0013] Figure 6 presents confocal projection images of EL4 wild type or device-KI cells recovered in regular media for seven days followed by staining with anti-PD1 Ab (top row of images). Cells are counterstained with DAPI (bottom row of images).

[0014] Figure 7 presents a histogram representing (± S.D.) expression of PD1 transcripts assessed by qRT-PCR during first induction (RNA was extracted post 3 days of treatment with varying Tc concentration), recovery (RNA was extracted 7 days post first induction) and secondLeydig 774292 NIH E-234-2023-0-PC-01 4 induction to the recovered cells (RNA was extracted post 3 days of treatment with varying Tc concentration).

[0015] Figure 8 presents NXN plots demonstrating a comparison of the performance of HTP-1, HTP-2, HTP-3 and D43 with controls.

[0016] Figure 9 is a line diagram of flow cytometry data showing the intensity of PD1 signal (Y-axis) and cell count (X-axis) scanned at PE-Cy7 channel. Concentration of the oxidized tetracycline (lymecycline) is given on the left, and the name of the indicated RNA device in each case is at the top of the panel. Oxidized Tc-treated and untreated samples are indicated by black and grey lines, respectively.

[0017] Figure 10 are line diagrams of flow cytometry data showing the intensity of PD1 (Panel A) and CTLA4 (Panel B) (Y-axis) and cell count (X-axis) scanned at PE-Cy7 channel. Oxidized Tc-treated and untreated samples are indicated by grey and black lines, respectively.

[0018] Figure 11 graphically presents data concerning EGFP MFI in Human primary T cell line transduced with lentiviral vectors carrying promoters of interest. The three promoters (EF1α, MSCV, and SFFV) were substituted into lentiviral vectors upstream of the EGFP reporter gene. Three vectors with different promoter were tested in human primary T cell line. MFI was measured with flow cytometry.

[0019] Figure 12 presents schematic maps of the pAG0134-(promoter)-Gene-RNA Device vector. The SFFV & EF1α promoters were substituted into lentiviral vector upstream of the Human PD1 & CTLA4 reporter gene. Each inventive RNA device inserted into the 3′ UTR of Human PD1 & CTLA4 gene. DETAILED DESCRIPTION OF THE INVENTION RNA device

[0020] In one aspect, the invention provides an RNA device, which is an aptazyme, the activity of which is regulated through binding of a ligand (i.e., a drug). The inventive RNA device forms a secondary structure, which comprises a first domain, a drug-sensitive aptamer (APT) (e.g., riboswitch), second catalytic domain, a short communication module (CM), and third domain comprising a ribozyme (RZ). This design enables regulation of enzymatic activityLeydig 774292 NIH E-234-2023-0-PC-01 5 through ligand-induced conformational changes. This secondary structure is outlined in Figure 1.

[0021] The first domain of the inventive RNA device comprises a drug-sensitive aptamer, which confers drug- (i.e., ligand-) -sensitivity to the RNA device. In this respect, in use, the RNA device can be activated by supplying the appropriate drug substance and turned off in its absence. While the aptamer can be sensitive to any suitable drug, a preferred agent is a tetracycline (Tc) antibiotic, such as, but not limited to, chlortetracycline, demeclocycline, doxycycline, eravacycline, lymecycline, meclocycline, methacycline, minocycline, omadacycline, oxytetracycline, rolitetracycline, sarecycline, tetracycline, or tigecycline. Tetracycline (Tc), as it is already an FDA-approved drug and has one of the highest known affinities to its aptamer (Kd ~0.8 nM). Moreover, aptamers sensitive to Tc exist (see, e.g., Berens et al. (2001). Bioorg Med Chem 9, 2549-2556, incorporated herein in its entirety) and can be incorporated into the inventive RNA device, as is demonstrated in the working example below. Similarly, other aptamers sensitive to Tc antibiotics or other drug substances can likewise be incorporated into an RNA device according to the present invention.

[0022] The second domain of the inventive RNA device comprises a communication module (CM) CM which forms a short structure between the first and third domains, which enables regulation of enzymatic activity through ligand-induced conformational changes. This CM can comprise fewer than 10 base pairs, and in the working Example herein, the CM comprises four helical base pairs (See Figure 1).

[0023] The third domain of the inventive RNA device comprises a catalytic domain, such as comprising a ribozyme. Any suitable catalytic domain, such as a ribozyme, can be employed to construct the inventive RNA device. One such catalytic domain can be modified from the HHRZ from Schistosoma mansoni (Sm), as is demonstrated in the working Example below. See also Yen et al. (2004) Nature 431, 471-476, incorporated herein in its entirety (describing “the N79 HHRZ”). N79 HHRZ was selected due to its high catalytic efficiency in human cells under a low Mg2+concentration. In its active state, N79 HHRZ undergoes self-cleavage (presumably via acid-base catalysis), in which an invariant guanine serves a primary role in deprotonating the 2′OH (nucleophile) of a nearby cytosine.Leydig 774292 NIH E-234-2023-0-PC-01 6

[0024] It will be observed that the sequence of the inventive RNA device can vary depending on the specific components of the first, second, and third domain. Preferably, the inventive RNA device comprises at least one of: (a) the first domain comprises a tetracycline (Tc)-sensitive APT, (b) the second domain comprises a CM comprising four helical base pairs, (c) the third domain comprises an RZ derived from the HHRZ from Schistosoma mansoni (Sm). As revealed by the working Examples below, a functioning RNA device comprises each of these three elements. The structure and sequence (SEQ ID NO:1) of one of which is presented in Figure 1. Thus, in an embodiment, the inventive RNA device can have a sequence of nucleotides comprising, consisting essentially of, or consisting of SEQ ID NO:1 (D43), SEQ ID NO:2 (HTP- 1), SEQ ID NO:3 (HTP-3), or SEQ ID NO:4 (HTP-3) or highly identical to such, such as at least 80% identical, or at least 80% identical, or at least 90% identical, or at least 95% identical, or at least 99% identical to SEQ ID NOs:1-4. In other embodiments, the inventive RNA device can have a sequence of nucleotides comprising, consisting essentially of, or consisting of SEQ ID NOs:1-23 or highly identical to such, such as at least 80% identical, or at least 80% identical, or at least 90% identical, or at least 95% identical, or at least 99% identical to one or more of SEQ ID NOs: 1-23.

[0025] The inventive RNA device can be prepared by any method, such as by synthesizing the RNA device (e.g., solid-state synthesis or polymerase chain reaction (PCR) or by expressing a DNA sequence encoding the RNA device sequence in chromosome using CRISPR or viral vectors transfected in a cell). Nucleic Acids

[0026] The invention also provides a nucleic acid molecule comprising the RNA device or comprising a DNA sequence encoding the inventive RNA device or its complement. The inventive nucleic acid molecule can comprise or encode the inventive RNA device or its complement alone or as part of a fusion sequence or larger sequence comprising the inventive RNA device or its complement. Persons of ordinary skill are able to deduce the coding sequence of a nucleic acid when given the sequence of the encoded RNA device.

[0027] The inventive nucleic acid comprising or encoding the inventive RNA device or its complement can be provided as part of a construct comprising the inventive nucleic acidLeydig 774292 NIH E-234-2023-0-PC-01 7 molecule and elements that enable delivery of the nucleic acid molecule to a cell, and / or expression of the nucleic acid molecule in a cell. Such elements include, for example, expression vectors, promoters, and transcription and / or translation control sequences. Such constructs can also be referred to as “recombinant nucleic acid molecules.” Suitable vectors, promoters, transcription / translation sequences, and other elements, as well as methods of preparing such nucleic acid molecules and constructs, are known in the art.

[0028] The inventive nucleic acid molecule can be made by any suitable method, such as solid-state synthesis or PCR, known to persons or ordinary skill. Vectors

[0029] The invention further provides a vector comprising the inventive nucleic acid sequence encoding or complementary to the inventive RNA device. Examples of suitable vectors include plasmids (e.g., DNA plasmids), bacteria, yeast, listeria, and viral vectors, including poxvirus, retrovirus, adenovirus, adeno-associated virus (AAV), herpes virus, lentivirus, polio virus, alphavirus, and baculorvirus, Sindbis virus. Of the viral vectors, lentiviral platforms are of interest in light of the future prospects of using such system for clinical trials. However, perhaps due to the large vector size and inappropriate packaging of virus, some lentiviral systems may not be efficient in the context of the present invention. Retroviral / AAV vector systems are a preferred alternative to lentiviral systems, if the latter prove unsuitable for a particular application.

[0030] Where the vector is a plasmid, the plasmid can be complexed with one or more agents for facilitating transfection of cells or enhancing stability, e.g., chitosan.

[0031] In the case of a viral vector, the nucleic acid encoding the inventive RNA device or its complement, as well as any other exogenous gene(s), preferably is / are inserted into a site or region (insertion region) in the vector that does not affect virus viability of the resultant recombinant virus. Such regions can be readily identified by testing segments of virus DNA for regions that allow recombinant formation without seriously affecting virus viability of the recombinant virus and are generally known to those of skill in the art. For example, a thymidine kinase (TK) gene, such as is present in many viruses, can serve as an insertion region. In other embodiments, the nucleic acid encoding the inventive RNA device can be inserted into the 3′Leydig 774292 NIH E-234-2023-0-PC-01 8 untranslated region (UTR) of, for example, PD-1 or CTLA-4 genes. For example, insertion into the 3’ UTR of PD-1 is expected to allow normal protein synthesis in the absence of the drug (e.g., Tc) and tunable down-regulation of PD-1 expression in the presence of the drug by initiating RZ self-cleavage and subsequent degradation of the RNA transcript. Insertion of selected devices (particularly, HTP1) alco can be in either the 5’ UTR or in tandem in both 3’ UTR and 5’ UTR. In this approach two copies of the device can be included with a short linker between them.

[0032] The inventive vector can include suitable promoters and regulatory elements, such as a transcriptional regulatory element or an enhancer. Suitable promoters include the SV40 early promoter, an RSV promoter, the retrovirus LTR, the adenovirus major late promoter, the human CMV immediate early I promoter, and various poxvirus promoters, such as the Pr7.5K promoter, 30K promoter, 40K promoter, I3 promoter, Prs promoter, PrsSynIIm promoter, PrLE1 promoter, synthetic early / late (sE / L) promoter, HH promoter, 11K promoter, and Pi promoter. Other suitable promoters include the SFFV promoter, which is an artificially strong promoter that results in an artificial hyperexpression of PD-1, likely resulting in an artificially high level of PD-1 mRNA production. However, when the PD-1 mRNA production rate is much higher than the degradation rate mediated by the inventive RNA device, it can lead to accumulation of the PD-1 mRNA for production of the PD-1 protein. A preferred promoter for clinical applications, therefore, is the EF1α promoter, and another is the MSCV promoter (Figure 11). While the promoters typically will be constitutive promoters, inducible promoters also can be used in the inventive vectors. Such inducible systems allow regulation of gene expression.

[0033] The vector can be constructed by any suitable method, typically by cloning the desired elements into a vector backbone. Moreover, the vector can, in some embodiments, be used to construct cells according to the invention, as well as in therapeutic applications or for research. Cells

[0034] In one aspect of the invention, a cell (e.g., isolated cell) comprising (1) an inventive RNA device, (2) an inventive nucleic acid sequence encoding or complementary to the inventiveLeydig 774292 NIH E-234-2023-0-PC-01 9 RNA device, and / or (3) a vector comprising an inventive nucleic acid molecule also is provided herein. Typically, the cell is a mammalian cell and can be a human cell.

[0035] In a particularly useful embodiment, the cell can be a lymphocyte or a T cell, which, when the inventive RNA device is expressed therein, can be employed for T cell therapy, such as for the prophylaxis and treatment of cancer, particularly in human patients. Indeed, where the inventive cell is a recombinant T cell or human primary T cell, such can facilitate employing the invention for the treatment of cancers, including solid tumors. For example, GPC3 CAR T and CD19 CAR T cells are under investigation in humans for assessing safety and efficacy against hepatocellular carcinoma. Integrating the inventive RNA devices into such cells can assist therapeutical applications, for example by mitigating exhaustion and thus increase their efficacy However, other cell types can be employed and are within the scope of the present invention. For example, HEK cells and cell lines such as KOPN-8 (ACC 552, B cell precursor leukemia) and other can usefully be constructed to harbor the inventive RNA device, which are useful for ongoing research into the inventive technology.

[0036] The inventive cell can be made using standard techniques, which are known to those of ordinary skill. In general, a source cell (or population of cells) is obtained and then can be transduced with a vector (i.e., comprising an open reading frame (ORF) that encodes the inventive RNA device) to introduce the genetic construct into the cell (or population of cells). Thereafter, the cell is cultured under conditions suitable for expression of the ORF to produce the inventive RNA device within the cell. Typically, the protocol also involves culturing the cell to proliferate it into a population of cells. The population then can be purified, if desired, and then transduced with a vector, such as described herein, encoding the inventive RNA device.

[0037] While a vector can be employed as described, and as is often employed for engineering recombinant T cells, a preferred method of introducing the inventive RNA device into the genome of a cell involves site-specific mutagenesis. Insertion using site-specific mutagenesis gene editing is desirable because it is difficult to achieve a proper control condition in the case of transient transfection, as differences in vector copy number per cell may alter the Tc-dependent response and convolute data interpretation. Insertion of the inventive RNA device into the 3′UTR of PD-1 or CTLA-4 within the genome of the cell is expected to allow normal protein synthesis in the absence of Tc and tunable down-regulation of PD-1 or CTLA-4Leydig 774292 NIH E-234-2023-0-PC-01 10 expression in the presence of Tc by initiating RZ self-cleavage and subsequent degradation of the RNA transcript.

[0038] Methods for achieving site-specific mutagenesis to “knock in” the sequence of the inventive RNA device are known in the art. Such include, for example CRISPR / Cas9 gene editing, Zinc-finger gene editing, and TALEN. Such methods are known to those of ordinary skill in the art and, as demonstrated in the working Example herein, for CRISPR / Cas9, can successfully introduce the inventive RNA device into the genome of T lymphocytes at a desired location (i.e., into the 3′UTR of PD-1 or CTLA-4 within the genome of the cell). The cell lines created by lentiviral approach or CRISPR mediated approach are capable of stably expressing the devices over unlimited generations.

[0039] However the inventive RNA device is introduced into the genome of cells, standard production protocols can be employed for obtaining such cells and populations, such as those described in Ping et al., Protein Cell, 9(3) 254-266 (2018) (incorporated herein in its entirety). For example, Leukocytes can, for example, be isolated using standard apheresis protocols, following which cells such as peripheral blood mononuclear cells (PBMCs) can be further isolated. Typically, T cells are then stimulated (often with IL-2 and anti-CD3 Igs or anti- CD3 / CD28 Igs), which leads to their proliferation and expansion into a population. The T cells can be transformed (e.g., using a plasmid or viral vector or gene editing with CRISPR / Cas9 and the like) either before or after activation and the corresponding proliferative phase, as desired. Moreover, successful production of T cells without the activation step and corresponding proliferative phase has been demonstrated and proposed as a cost-effective approach (see generally Ghassemi et al., Nat. Biomed. Engineer., 6, 118-128 (2022), which is incorporated herein in its entirety).

[0040] Whichever protocol is employed, the inventive cell of course can be proliferated to generate a population of like cells (or a heterogenous population comprising the inventive cell). Accordingly, the invention provides a population comprising a plurality of cells as described above. Such a population of cells can include, for example, at least 105cells / ml, such as at least 106cells / ml, such as at least 107cells / ml, such as at least 109cells / ml, or even greater densities, if desired. It will be observed that the inventive cell (or population thereof) can be used in immunological research in vitro or, in some applications, therapeutically.Leydig 774292 NIH E-234-2023-0-PC-01 11 Compositions

[0041] The inventive RNA device, nucleic acid, vector, or cell (or population thereof) can be formulated as a composition (e.g., pharmaceutical preparation) comprising the inventive RNA device, nucleic acid, vector, or cell (or population thereof), and a carrier (e.g., a pharmaceutically or physiologically acceptable carrier). Furthermore, the inventive RNA device, nucleic acid, vector, cell, or composition of the invention can be used in the methods described herein alone or as part of a pharmaceutical formulation.

[0042] The composition (e.g., pharmaceutical preparation) can comprise more than inventive RNA device, nucleic acid, vector, or cell (or population thereof) of the invention. Vectors and compositions of the invention can further include or can be administered with (concurrently, sequentially, or intermittently with) any other agents or compositions or protocols that are useful for inhibiting, preventing, or treating a disease or clinical condition. For example, the composition can comprise one or more other pharmaceutically active agents or drugs. Examples of such other pharmaceutically active agents or drugs that may be suitable for use in the pharmaceutical composition include anticancer agents (e.g., chemotherapeutic or radiotherapeutic agents), antimetabolites, hormones, hormone antagonists, antibiotics, antiviral drugs, antifungal drugs, cyclophosphamide, and combinations thereof.

[0043] Particularly for applications in which the inventive composition is used for the treatment of cancer, in addition to the inventive RNA device, nucleic acid, vector, or cell (or population thereof) of the invention, the composition can comprise one or more additional anti- cancer agents. Suitable anticancer agents include, without limitation, alkylating agents, folate antagonists, purine antagonists, pyrimidine antagonists, spindle poisons, topoisomerase inhibitors, apoptosis inducing agents, angiogenesis inhibitors, podophyllotoxins, nitrosoureas, cisplatin, carboplatin, interferon, asparginase, tamoxifen, leuprolide, flutamide, megestrol, mitomycin, bleomycin, doxorubicin, irinotecan, taxol, geldanamycin (e.g., 17-AAG), and various anti-cancer peptides and antibodies known in the art. Non-limiting examples of additional anti- cancer peptides that can be used in combination with the inventive cell or other reagents include those disclosed in International Patent Publication WO 2021 / 150694, which is incorporated herein in its entirety.Leydig 774292 NIH E-234-2023-0-PC-01 12

[0044] Exemplary alkylating agents include, but are not limited to, nitrogen mustards (e.g., mechlorethamine, cyclophosphamide, melphalan, uracil mustard, or chlorambucil), alkyl sulfonates (e.g., busulfan), nitrosoureas (e.g., carmustine, lomustine, semustine, streptozocin, or dacarbazine). Exemplary antimetabolites include, but are not limited to, folic acid analogs (e.g., methotrexate), pyrimidine analogs (e.g., 5-fluorouracil (5-FU) or cytarabine), and purine analogs (e.g., mercaptopurine or thioguanine). Exemplary hormones and hormone antagonists include, but are not limited to, adrenocorticosteroids (e.g., prednisone), progestins (e.g., hydroxyprogesterone caproate, medroxyprogesterone acetate, and magestrol acetate), estrogens (e.g., diethylstilbestrol and ethinyl estradiol), antiestrogens (e.g., tamoxifen), and androgens (e.g., testosterone proprionate and fluoxymesterone). Other exemplary agents include, but are not limited to, vinca alkaloids (e.g., vinblastine, vincristine, or vindesine), epipodophyllotoxins (e.g., etoposide or teniposide), antibiotics (e.g., dactinomycin, daunorubicin, doxorubicin, bleomycin, plicamycin, or mitocycin C), enzymes (e.g., L-asparaginase), platinum coordination complexes (e.g., cis-diamine-dichloroplatinum II also known as cisplatin), substituted ureas (e.g., hydroxyurea), methyl hydrazine derivatives (e.g., procarbazine), and adrenocortical suppressants (e.g., mitotane and aminoglutethimide).

[0045] Chemotherapeutics that can be concurrently, sequentially or intermittently administered with the inventive RNA device, nucleic acids, vectors, cell (or populations thereof), and compositions disclosed herein include Adriamycin, Alkeran, Ara-C, Busulfan, CCNU, Carboplatinum, Cisplatinum, Cytoxan, Daunorubicin, DTIC, 5-FU, Fludarabine, Hydrea, Idarubicin, Ifosfamide, Methotrexate, Mithramycin, Mitomycin, Mitoxantrone, Nitrogen Mustard, Taxol (or other taxanes, such as docetaxel), Velban, Vincristine, VP-16, Gemcitabine (Gemzar), Herceptin, Irinotecan (Camptosar, CPT-11), Leustatin, Navelbine, Rituxan STI-571, Taxotere, Topotecan (Hycamtin), Xeloda (Capecitabine), Zevelin, Enzalutamide (MDV-3100 or XTANDITM), and calcitriol. Exemplary immunomodulators and / or cytokines include, but are not limited to, AS-101 (Wyeth-Ayerst Labs.), bropirimine (Upjohn), gamma interferon (Genentech), GM-CSF (granulocyte macrophage colony stimulating factor; Genetics Institute), IL-2 (Cetus or Hoffman-LaRoche), human immune globulin (Cutter Biological), IMREG (from Imreg of New Orleans, La.), SK&F 106528, tumor necrosis factor (TNF)-α, and TNF-β.Leydig 774292 NIH E-234-2023-0-PC-01 13

[0046] Other agents, compositions or protocols (e.g., therapeutic protocols) that are useful for the treatment of cancer in conjunction with the inventive RNA device, nucleic acids, vectors, cells (or populations thereof), and compositions of the invention include, but are not limited to, surgical resection of a tumor, radiation therapy, immunotherapy (such as, but not limited to allogeneic or autologous stem cell transplantation, adoptive T cell transfer, chimeric antigen receptor (CAR) T-cell therapy, tumor-infiltrating lymphocytes (TIL), and the like), and / or targeted cancer therapies (e.g., small molecule drugs, biologics, or monoclonal antibody therapies that specifically target molecules involved in tumor growth and progression, including, but not limited to, selective estrogen receptor modulators (SERMs), aromatase inhibitors, tyrosine kinase inhibitors, serine / threonine kinase inhibitors, histone deacetylase (HDAC) inhibitors, retinoid receptor activators, apoptosis stimulators, angiogenesis inhibitors, poly (ADP-ribose) polymerase (PARP) inhibitors, or immunostimulators). Additionally, or alternatively, the agent can be a cancer vaccine, such as PANVAC, PROSTVAC, MVA- Brachyury TRICOM, yeast-Brachyury, AdCEA Avelumab (Avel) Folfox, CEA-MUC-TRICOM CV301, or Bacillus Calmette-Guerin (BCG) alone or combined with PANVAC.

[0047] The additional active agent (e.g., chemotherapeutic agent, radiation, immunotherapy, etc.) can be administered before, concurrently with (including simultaneously), alternating with, sequentially, or after administration with the inventive composition. In certain embodiments, one or more (e.g., 2, 3, 4, or 5) chemotherapeutic agents is / are administered in combination with the inventive composition.

[0048] The composition additionally or alternatively can comprise one or more immunostimulatory / regulatory molecules. Any suitable immunostimulatory / regulatory molecule can be used, such as interleukin (IL)-2, IL-4, IL-6, IL-12, IL-15, IL-15 / IL-15Ra, IL-15 / IL-15Ra- Fc, interferon (IFN)-γ, tumor necrosis factor (TNF)-α, B7.1, B7.2, ICAM-1, ICAM-2, LFA-1, LFA-2, LFA-3, CD70, CD-72, RANTES, G-CSF, GM-CSF, OX-40L, 41 BBL, anti-CTLA-4, IDO inhibitor, anti-PDL1, anti-PD1, and combinations thereof. In one embodiment, the IL-12 is NHS-IL12, which is an immunocytokine composed of two IL-12 heterodimers fused to the NHS76 antibody (see Strauss et al., Clinical Cancer Research, 25(1): 99-109 (2019)). In an embodiment, the composition can include a combination of B7.1, ICAM-1, and LFA-3 (also referred to as TRICOM). The one or more immunostimulatory / regulatory molecules can beLeydig 774292 NIH E-234-2023-0-PC-01 14 administered in the form of a vector (e.g., a recombinant viral vector, such as those discussed herein or otherwise known to those of skill in the art) comprising a nucleic acid encoding one or more immunostimulatory / regulatory molecules. For example, the one or more immunostimulatory / regulatory molecules (e.g., IL-12) can be administered in the form of a DNA plasmid with or without chitosan. Alternatively, the one or more immunostimulatory / regulatory molecules can be administered as a protein (e.g., recombinant protein), such as a protein (e.g., recombinant IL-12) with or without being admixed with chitosan.

[0049] The carrier used in the inventive composition can be any of those conventionally used and is limited only by physio-chemical considerations, such as solubility and lack of reactivity with the active compound(s), and by the route of administration. The pharmaceutically acceptable carriers described herein, for example, vehicles, adjuvants, excipients, and diluents, are well-known to those skilled in the art and are readily available to the public. It is preferred that the pharmaceutically acceptable carrier be one which is chemically inert to the active agent(s) and one which has no detrimental side effects or toxicity under the conditions of use.

[0050] The choice of carrier and manner of formulation of the inventive composition will be determined in part by the particular cell, or composition thereof of the invention and other active agents or drugs used, as well as by the particular method used to administer the inventive composition. A variety of suitable formulations of the pharmaceutical composition, thus, can be employed in the inventive compositions, and in carrying out the inventive methods described herein. The following formulations for parenteral, subcutaneous, intravenous, intramuscular, and intraperitoneal administration are exemplary and are in no way limiting. One skilled in the art will appreciate that these routes of administering the RNA device, nucleic acids, vectors, cells, and compositions of the invention are known, and, although more than one route can be used to administer a particular compound, a particular route can provide a more immediate and more effective response than another route.

[0051] Injectable formulations are among those formulations that are preferred in accordance with the present invention. The requirements for effective pharmaceutical carriers for injectable compositions are well-known to those of ordinary skill in the art (see, e.g., Pharmaceutics and Pharmacy Practice, J.B. Lippincott Company, Philadelphia, PA, Banker and Chalmers, eds.,Leydig 774292 NIH E-234-2023-0-PC-01 15 pages 238-250 (1982), and ASHP Handbook on Injectable Drugs, Toissel, 4th ed., pages 622- 630 (1986)).

[0052] Formulations suitable for parenteral administration include aqueous and non-aqueous, isotonic sterile injection solutions, which can contain anti-oxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the intended recipient, and aqueous and non-aqueous sterile suspensions that can include suspending agents, solubilizers, thickening agents, stabilizers, and preservatives. The inventive RNA device, nucleic acid, vector, cell, and composition can be administered in a physiologically acceptable diluent in a pharmaceutical carrier, such as a sterile liquid or mixture of liquids, including water, saline, aqueous dextrose and related sugar solutions, an alcohol, such as ethanol, isopropanol, or hexadecyl alcohol, glycols, such as propylene glycol or polyethylene glycol, dimethylsulfoxide, glycerol ketals, such as 2,2-dimethyl-1,3-dioxolane-4-methanol, ethers, such as poly(ethylene glycol) 400, an oil, a fatty acid, a fatty acid ester or glyceride, or an acetylated fatty acid glyceride with or without the addition of a pharmaceutically acceptable surfactant, such as a soap or a detergent, suspending agent, such as pectin, carbomers, methylcellulose, hydroxypropylmethylcellulose, or carboxymethylcellulose, or emulsifying agents and other pharmaceutical adjuvants.

[0053] Oils, which can be used in parenteral formulations, include petroleum, animal, vegetable, and synthetic oils. Specific examples of oils include peanut, soybean, sesame, cottonseed, corn, olive, petrolatum, and mineral. Suitable fatty acids for use in parenteral formulations include oleic acid, stearic acid, and isostearic acid. Ethyl oleate and isopropyl myristate are examples of suitable fatty acid esters.

[0054] Suitable soaps for use in parenteral formulations include fatty alkali metal, ammonium, and triethanolamine salts, and suitable detergents include (a) cationic detergents such as, for example, dimethyl dialkyl ammonium halides, and alkyl pyridinium halides, (b) anionic detergents such as, for example, alkyl, aryl, and olefin sulfonates, alkyl, olefin, ether, and monoglyceride sulfates, and sulfosuccinates, (c) nonionic detergents such as, for example, fatty amine oxides, fatty acid alkanolamides, and polyoxyethylenepolypropylene copolymers, (d) amphoteric detergents such as, for example, alkyl-b-aminopropionates, and 2-alkyl-imidazoline quaternary ammonium salts, and (e) mixtures thereof.Leydig 774292 NIH E-234-2023-0-PC-01 16

[0055] Preservatives and buffers may be used. In order to minimize or eliminate irritation at the site of injection, such compositions may contain one or more nonionic surfactants having a hydrophile-lipophile balance (HLB) of from about 12 to about 17. The quantity of surfactant in such formulations will typically range from about 5% to about 15% by weight. Suitable surfactants include polyethylene sorbitan fatty acid esters, such as sorbitan monooleate and the high molecular weight adducts of ethylene oxide with a hydrophobic base, formed by the condensation of propylene oxide with propylene glycol.

[0056] The parenteral formulations can be presented in unit-dose or multi-dose sealed containers, such as ampoules and vials, and can be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid excipient, for example, water, for injections, immediately prior to use. Extemporaneous injection solutions and suspensions can be prepared from sterile powders, granules, and tablets. Uses

[0057] Using the inventive reagents (the inventive RNA device, nucleic acid, vector, cell, population, and composition), the invention provides the therapeutic (including prophylactic) use of such in methods for treatment or prophylaxis of disease, particularly in a human patient. One particularly contemplated type of disease particularly amenable to prophylaxis or therapy using the inventive reagents includes cancers. Accordingly, the invention provides methods of treating a subject suffering from or susceptible to a tumor and / or enhancing an immune response against cancer and / or inhibiting a cancer. The inventive reagents and methods also can be applicable in the treatment of various other diseases, including HIV or other viral infections.

[0058] In addition, this approach can address various neurological disorders occurring due to either misexpression of genes or due to polyglutamine repeats. Tetracycline-dependent aptazyme insertion in 3′UTR converts a gene into inducible segment. This approach can be utilized, for example, for the spatial and temporal expression of a poly-glutamine stretch which forms inclusion bodies to augment neurological disorder in Huntington’s disease. This type of stable integration is independent of any regulatory protein and hence may be improved further for potential therapeutic applications. In this way, a Huntington’s disease model generated in C. elegans could be useful by utilizing the inventive aptazyme as a tool to understand diseaseLeydig 774292 NIH E-234-2023-0-PC-01 17 pathogenesis. Similarly, the inventive device can be engineered into any cell type to generate new cell types whose gene expressions could be externally tuned for biological studies.

[0059] In practice, the inventive method comprises administering a therapeutically effective amount of one or more of the inventive RNA device, nucleic acid, vector, cell, population, and composition to a subject, particularly the inventive cell, cell population, or composition. Thereafter, the subject is treated with the drug to which the APT within the inventive RNA device is sensitive.

[0060] The drug with which the subject is treated is selected to one for which the APT within the inventive RNA device is sensitive. For example, when the APT is sensitive to Tc, a suitable drug can be a tetracycline antibiotic, such as, but not limited to, chlortetracycline, demeclocycline, doxycycline, eravacycline, lymecycline, meclocycline, methacycline, minocycline, omadacycline, oxytetracycline, rolitetracycline, sarecycline, tetracycline, or tigecycline, or any suitable derivatives of them. Preferably, a tetracycline antibiotic for use as the drug in accordance with the inventive method is tetracycline or lymecycline or derivatives of them, such as an oxidized derivative. Oxidized derivatives can be synthesized by air-purging the source chemical (such as lymecycline) at room temperature or on ice; pure oxygen can be employed instead of air, if desired. Of course, in embodiments in which the APT is sensitive to other agents, such agents can be employed as the drug in accordance with the inventive method.

[0061] The inventive method can be used to impede or prevent the development of cancer, particularly in an individual at higher risk to develop such cancer than other individuals, or to treat a patient afflicted with cancer. The inventive RNA device, nucleic acid, vector, cell, population, and composition thereof is useful for preventing emergence of cancer, arresting progression of cancer or eliminating cancer. More particularly, the inventive RNA device, nucleic acid, vector, cell, population, and composition thereof can be used to prevent, inhibit or delay the development of tumors, and / or to prevent, inhibit or delay tumor migration and / or tumor invasion of other tissues (metastases) and / or to generally prevent or inhibit progression of cancer in an individual. The inventive RNA device, nucleic acid, vector, cell, and composition thereof can also be used to ameliorate at least one symptom of the cancer, such as by reducing tumor burden in the individual; inhibiting tumor growth in the individual; increasing survival of the individual; and / or preventing, inhibiting, reversing or delaying progression of the cancer inLeydig 774292 NIH E-234-2023-0-PC-01 18 the individual. The inventive RNA device, nucleic acid, vector, cell, and composition thereof can be used to treat a subject with any stage of cancer.

[0062] Administration of the inventive RNA device, nucleic acid, vector, cell, population, or composition can be “prophylactic” or “therapeutic.” When provided prophylactically, the inventive RNA device, nucleic acid, vector, cell, population, or composition is provided in advance of tumor formation, or the detection of the development of cancer or tumors, with the goal of preventing, inhibiting or delaying the development of cancer or tumors; and / or preventing, inhibiting or delaying metastases of cancer or tumors and / or generally preventing or inhibiting progression of cancer in an individual, and generally to allow or improve the ability of the host’s immune system to fight against a tumor that the host is susceptible of developing. The prophylactic administration of the inventive RNA device, nucleic acid, vector, cell, population, and / or composition thereof prevents, ameliorates, or delays the cancer.

[0063] When provided therapeutically, the inventive RNA device, nucleic acid, vector, cell, population, or composition thereof is provided at or after the diagnosis of the cancer, with the goal of ameliorating the cancer, such as by reducing tumor burden in the individual; inhibiting tumor growth in the individual; increasing survival of the individual; and / or preventing, inhibiting, reversing or delaying progression of the cancer in the individual.

[0064] Treatment (e.g., inhibiting cancer and / or enhancing an immune response against cancer) comprises, but is not limited to, destroying tumor cells, reducing tumor burden, inhibiting tumor growth, reducing the size of the primary tumor, reducing the number of metastatic legions, increasing survival of the individual, delaying, inhibiting, arresting or preventing the onset or development of metastatic cancer (such as by delaying, inhibiting, arresting or preventing the onset of development of tumor migration and / or tumor invasion of tissues outside of primary cancer and / or other processes associated with metastatic progression of cancer), delaying or arresting primary cancer progression, improving immune responses against the tumor, improving long term memory immune responses against the tumor antigens, and / or improving the general health of the individual. It will be appreciated that tumor cell death can occur without a substantial decrease in tumor size due to, for instance, the presence of supporting cells, vascularization, fibrous matrices, etc. Accordingly, while reduction in tumor size is preferred, it is not required in the treatment of cancer.Leydig 774292 NIH E-234-2023-0-PC-01 19

[0065] The cancer to be treated in accordance with the inventive methods can be any cancer, including, but not limited to, cancer of the head and neck, eye, skin, mouth, throat, esophagus, chest, bone, lung, urethra, uterine, bladder, colon, sigmoid, rectum, stomach, prostate, breast, ovaries, kidney, liver, pancreas, brain, intestine, fallopian tube, heart or adrenals. More particularly, cancers include solid tumor, sarcoma, carcinomas (including but not limited to cystic carcinomas), fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendothelio sarcoma, synovioma, mesothelioma, Ewing’s tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilms’ tumor, cervical cancer, testicular tumor, lung carcinoma, small cell lung carcinoma, bladder carcinoma, epithelial carcinoma, medulloblastoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, Kaposi’s sarcoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, menangioma, melanoma (including but not limited to uveal melanoma), neuroblastoma, retinoblastoma, a blood-born tumor, acute lymphoblastic leukemia, acute lymphoblastic B-cell leukemia, acute lymphoblastic T-cell leukemia, acute myeloblastic leukemia, acute promyelocytic leukemia, acute monoblastic leukemia, acute erythroleukemic leukemia, acute megakaryoblastic leukemia, acute myelomonocytic leukemia, acutenonlymphocyctic leukemia, acute undifferentiated leukemia, chronic myelocytic leukemia, chronic lymphocytic leukemia, hairy cell leukemia, or multiple myeloma.

[0066] In one aspect, the inventive method is performed in conjunction with the use or administration of, optionally, one or more immunostimulatory / regulatory molecules and / or other tumor-associated antigens (such as, but not limited to, AIM-2 (Interferon-inducible protein absent in melanoma 2), ALL (Acute lymphoblastic leukemia), AML (Acute myeloid leukemia), 707-AP (707 alanine proline), APL (Acute promyelocytic leukemia), ART-4 (Adenocarcinoma antigen recognized by T cells 4), BAGE (B antigen), bcr-abl (Breakpoint cluster region- Abelson), Brachyury, CAMEL (CTL-recognized antigen on melanoma), CAP-1Leydig 774292 NIH E-234-2023-0-PC-01 20 (Carcinoembryonic antigen peptide-1), CASP-8 (Caspase 8), CDC27 (Cell division cycle 27), CDK4 (Cyclin-dependent kinase 4), CEA (Carcinoembryonic antigen), CLCA2 (Calcium- activated chloride channel 2), CML (Chronic myelogenous leukemia), CT (Cancer-testis (antigen)), CTL (Cytotoxic T lymphocytes), Cyp-B (Cyclophilin B), DAM (Differentiation antigen melanoma (the epitopes of DAM-6 and DAM-10 are equivalent, but the gene sequences are different. DAM-6 is also called MAGE-B2 and DAM-10 is also called MAGE-B1), ELF2 (Elongation factor 2), Ep-CAM (Epithelial cell adhesion molecule), EphA2, 3 (Ephrin type-A receptor 2, 3), Ets (E-26 transforming specific (family of transcription factors)), ETV6-AML1 (Ets variant gene 6 / acute myeloid leukemia 1 gene ETS), FGF-5 (Fibroblast growth factor 5), FN (Fibronectin), G250 (Glycoprotein 250), GAGE (G antigen), GnT-V (N- Acetylglucosaminyltransferase V), Gp100 (Glycoprotein 100 kDa), HAGE (Helicase antigen), HER-2 / neu (Human epidermal receptor 2 / neurological), HLA-A*0201-R170I (Arginine (R) to isoleucine (I) exchange at residue 170 of the α-helix of the α2-domain in the HLA-A2 gene), H / N (Head and neck), HSP70-2 M (Heat shock protein 70-2 mutated), HST-2 (Human signet- ring tumor 2), hTERT (Human telomerase reverse transcriptase), iCE (Intestinal carboxyl esterase), IL-13Rα2 (Interleukin 13 receptor α2 chain), KIAA0205 (Name of the gene as it appears in databases), LAGE (L antigen), LDLR / FUT (Low density lipid receptor / GDP-L- fucose:β-D-galactosidase 2-α-L-fucosyltransferase), MAGE (Melanoma antigen), MART- 1 / Melan-A (Melanoma antigen recognized by T cells-1 / melanoma antigen A), MART-2 (Melanoma Ag recognized by T cells-2), MC1R (Melanocortin 1 receptor), M-CSF (Macrophage colony-stimulating factor gene), MHC (Major histocompatibility complex), MSI (Microsatellite instability), MUC1, 2 (Mucin 1, 2), MUM-1, -2, -3 (Melanoma ubiquitous mutated 1, 2, 3), NA88-A (NA cDNA clone of patient M88), Neo-PAP (Neo-poly(A) polymerase, NPM / ALK (Nucleophosmin / anaplastic lymphoma kinase fusion protein), NSCLC (Non–small cell lung carcinoma), NY-ESO-1 (New York esophageous 1), OA1 (Ocular albinism type 1 protein), OGT (O-Linked N-acetylglucosamine transferase gene), ORF (Open reading frame), OS-9, Name of the gene as it appears in databases, P15 (Protein 15), p190 minor bcr-abl (Protein of 190-kDa bcr-abl), Pml / RARα (Promyelocytic leukemia / retinoic acid receptor α), PRAME (Preferentially expressed antigen of melanoma), PSA (Prostate-specific antigen), PSMA (Prostate-specific membrane antigen), PTPRK (Receptor-type protein-tyrosine phosphatase kappa), RAGE (RenalLeydig 774292 NIH E-234-2023-0-PC-01 21 antigen), RCC (Renal cell carcinoma), RU1, 2 (Renal ubiquitous 1, 2), SAGE (Sarcoma antigen), SART-1, -2, -3 (Squamous antigen rejecting tumor 1, 2, 3), SCC (Squamous cell carcinoma), SSX-2 (Synovial sarcoma), X breakpoint 2, Survivin-2B (Intron 2-retaining surviving), SYT / SSX (Synaptotagmin I / synovial sarcoma, X fusion protein), TAA (Tumor-associated antigen), TEL / AML1 (Translocation Ets-family leukemia / acute myeloid leukemia 1), TGFβRII (Transforming growth factor β receptor 2), TPI (Triosephosphate isomerase), TRAG-3 (Taxol resistant associated protein 3), TRG (Testin-related gene), TRP-1 (Tyrosinase-related protein 1, or gp75), TRP-2 (Tyrosinase-related protein 2), TRP-2 / INT2 (TRP-2 / intron 2), TRP-2 / 6b (TRP- 2 / novel exon 6b), TSTA (Tumor-specific transplantation antigens), WT1 (Wilms’ tumor gene)), and the like, and including modified versions thereof, and immunogenic epitopes thereof that are co-administered. A subject to be treated in accordance with the inventive method also can be treated with other therapies or prophylactic regimens, such as one or more of treated with immunotherapy, radiation, chemotherapy, and the like.

[0067] In one embodiment, lymphocytes are removed from the subject and modified ex vivo to comprise the RNA device or genetic vector, and then reintroduced into the subject. The lymphocytes can be expanded prior to reintroduction into the subject. The cytotoxic T lymphocytes can be administered to the subject in order to enhance an immune response to cancer, thereby inhibiting the cancer. Accordingly, the invention provides a method of inhibiting cancer in a subject comprising (a) obtaining lymphocytes (e.g., from the subject), (b) modifying the lymphocytes ex vivo to comprise the RNA device, and (c) administering the modifying T lymphocytes to the host, wherein the cancer is inhibited. Of course, the inventive method can be employed where heterologous lymphocytes likewise are obtained, modified to comprise the RNA device, and the introduced into the patient.

[0068] When the agent to be administered comprises an inventive cell or population thereof (e.g., cytotoxic T cells), such can be administered, by way of non-limiting example, to a host in a dose of between about 1 x 105and 2 x 1011(e.g., 1 x 106, 1 x 107, 1 x 108, 1 x 109, 1 x 1010, and ranges therebetween) cells per infusion. The cells can be administered in multiple, for example one to three (e.g., one, two, or three), infusions. In addition to the administration of the cells, the host can be administered a biological response modifier, such as interleukin 2 (IL-2).Leydig 774292 NIH E-234-2023-0-PC-01 22 EXAMPLES

[0069] The following working experimental Example further illustrates the invention but, of course, should not be construed as in any way limiting its scope. In brief, the experiments discussed in the Example demonstrate the construction of a fully functional RNA device according to the invention, which was knocked-in using CRISPR / Cas9 to regulate PD-1 expression in mammalian cells. The data demonstrate that PD-1 expression can be regulated by tetracycline (Tc) in HEK cells that are transiently transfected to express the device; PD-1 expression can be regulated in a Tc dose-dependent manner in knock-in HEK cells; and PD-1 expression can be regulated in a Tc dose-dependent manner in CRISPR knock-in EL4 mouse T cells. EXAMPLE 1

[0070] This Example demonstrates stable CRISPR-mediated integration of D43 into the 3′- UTR of PD-1 in EL4 cells and efficient Tc-dose-dependent regulation of PD1 expression at the mRNA level. Importantly, the regulation of PD-1 expression by D43 is both reversible and tunable depending on Tc concentrations. Methods ^ RNA sample preparation for structure determination

[0071] Synthesized linear DNA templates (Integrated DNA Technologies) for D43 and D43m3, which contained the T7 RNA polymerase promoter, were amplified by PCR. The PCR products where then used directly for in vitro transcription overnight at 37 ℃. For holo samples, the transcription buffer was supplemented with 0.5 mM tetracycline hydrochloride. Transcription products were clarified by centrifugation and purified by gel-filtration chromatography (HiLoad 16 / 600 SuperdexTM200 pg, Cytiva) in a buffer containing 10 mM BisTris pH 6.8, 100 mM KCl, and 1 mM MgCl2 (cryo-EM samples: holo-D43, apo-D43m3) or 20 mM MgCl2 (crystallization sample: holo-D43m3). Pure RNA fractions were pooled and then concentrated to > 10 g / L using an AmiconTMUltra-4 centrifugal Filter Unit (10 kDa MWCO, MilliporeSigmaTM). ConcentratedLeydig 774292 NIH E-234-2023-0-PC-01 23 samples were treated with SUPERase•InTMRNase Inhibitor (Thermo Fisher Scientific) and used immediately (cryo-EM samples) or stored at -80 ℃ until use (crystallization sample). ^ Cryo-EM sample preparation and data acquisition

[0072] Two and a half microliters of apo-D43m3 sample at 1.2 mg / ml was applied onto each side of a glow-discharged (30 s, 30 mA on both sides) 300-mesh R1.2 / 1.3 Quantifoil Au grid. Four microliters of holo-D43 or apo-D43, diluted to 1.5 – 3.0 mg / ml in RNA buffer containing 0.1% w / v CHAPSO, were applied to the carbon side of a glow-discharged (30 s, 30 mA) 300- mesh R1.2 / 1.3 Quantifoil Au grid. Grids were blotted for 2 to 3 s in 100% humidity at 11 ℃ and plunge frozen in liquid ethane using a Vitrobot Mark IV (Thermo Fisher Scientific).

[0073] Data were collected in counted mode in EER format on a CFEG-equipped Titan Krios G4 (Thermo Fisher Scientific) operating at 300 kV with a Selectris imaging filter (Thermo Fisher Scientific) with slit width of 10 e-V and Falcon 4 direct detection camera (Thermo Fisher Scientific) at 165,000x magnification, with a physical pixel size of 0.693 Å. Movies were collected at a dose rate of 13.7 e- / Å2 / s (apo-D43m3), 12.8 e- / Å2 / s (holo-D43), or 13.1 e- / Å2 / s (apo-D43) with a constant exposure time of 3.98 s, resulting in a total dose of 54.5 e- / Å2 (apo- D43m3), 50.9 e- / Å2 (holo-D43), or 52.2 e- / Å2 (apo-D43). ^ Cryo-EM data processing

[0074] Patched (20 x 20) motion correction, CTF parameter estimation, particle picking, extraction, and initial 2D classification were performed in SIMPLE 3.0.55 All downstream processing was conducted in Relion 3.156 or cryoSPARC 3.3.1.57 Gold-standard Fourier shell correlations (FSCs) using the 0.143 criterion were calculated within cryoSPARC and local resolution estimations were calculated within Relion.

[0075] For apo-D43m3, 2,639,686 particles were selected after initial 2D classification (k = 300) and further subjected to one round of reference-free 2D classification in cryoSPARC (k = 200).2Dcleaned particles (1,646,984) were then subjected to multi-class ab initio, generating five volumes of which two corresponded to monomeric species, two corresponded to artefactual dimer species, and one junk class. Particles belonging to each volume, apart from the junk class, were independently nonuniform refined against their corresponding volumes lowpass-filtered to 30 Å. Particles belonging to the monomeric classes were combined (43.2% of the total particles)Leydig 774292 NIH E-234-2023-0-PC-01 24 and non-uniform refined against a 30 Å lowpass-filtered monomeric map, yielding a 3.9 Å reconstruction. Low-quality particles and artefactual dimers were further removed from this subset by heterogeneous refinement against 20 Å lowpass filtered references derived from the two dimer and one monomer volumes generated from the ab initio job, yielding a high-resolution class that contained 464,524 particles. These particles were further refined using non-uniform refinement and a 30 Å lowpass-filtered reference, improving the resolution of the volume to 3.7 Å. Bayesian polishing followed by an additional round of heterogeneous refinement, using the same references as previous, generated a volume reconstructed from 404,781 particles that could be further non-uniform refined to 3.4 Å.

[0076] For holo-D43, 5,314,940 particles were selected after initial 2D classification (k = 300) and subjected to one round of reference-free 2D classification in cryoSPARC (k = 200) yielding 1,624,195 good particles. This particle set was then subjected to heterogeneous refinement against the two dimer and one monomer reference volumes (lowpass-filtered to 20 Å) used for apo-D43m3 heterogeneous refinements. Whilst 2D averages showed no evidence for artefactual dimer formation in the holo-D43 specimen, the inclusion of dimer references in heterogeneous refinements helped improve monomer refinement outcomes by acting as a “junk” sink, effectively removing poor or low-signal particles from downstream processing. Particles within the most populated and highest resolution class were subjected to non-uniform refinement against their corresponding volume, lowpass-filtered to 30 Å, yielding a 3.3 Å volume. Bayesian polishing followed by an additional round of 2D-classification, to further clean the dataset, generated 571,000 particles which were used as input for heterogeneous refinement against the volumes generated from the heterogeneous refinement described above, lowpass-filtered to 20 Å. Nonuniform refinement of particles belonging to the most populated class (64.7%; 369,486 particles) generated a 3.0 Å volume which could be further improved by fitting beamtilt and trefoil followed by another round of non-uniform refinement.

[0077] For apo-D43, 12,033,045 particles were selected after initial 2D classification (k = 300) and subjected to two rounds of reference-free 2D classification in cryoSPARC (k = 200) yielding 3,741,616 good particles. These particles were then subjected to two consecutive rounds of heterogeneous refinement against dimer and monomer reference volumes described previously (lowpass-filtered to 20 Å), with selection of particles classifying to the highestLeydig 774292 NIH E-234-2023-0-PC-01 25 resolution monomer volume between each round. Non-uniform refinement was then performed with particles belonging to the highest resolution class against their corresponding volume, lowpass-filtered to 30 Å, yielding a 3.8 Å volume. These particles were Bayesian polished and heterogeneously refined against the output volumes of the previous heterogeneous refinement classification, lowpass-filtered to 20Å. Particles (731,795) belonging to the strongest class were then non-uniform refined to yield a 3.2 Å volume. Further extensive CTF refinement and 3D classification schemes using multi-class ab initio, heterogeneous refinements in cryoSPARC or alignment-free classification schemes in Relion were performed but did not appreciably increase map quality. ^ Cryo-EM structure determination and model refinement

[0078] An initial model was manually constructed for D43m3 in PyMOL58 starting from the crystal structures of the Tc-bound aptamer (PDB: 3EGZ) and the full-length hammerhead ribozyme (PDB: 3ZP8). The individual domains were modified according to the sequence of 43m3 and then linked together through the CM helix. This model was rigid-body fit to the EM volume of apo-43m3 using Chimera, and then subjected to dynamic fitting using cryo_fit260 in Phenix.61 Model-building was performed in Coot62 using the unsharpened map, and then real- space-refined against this map using Phenix, including refinement of individual B-factors. The refined structure of apo-D43m3 was then used as the starting model for structure determination of holo-D43 using the same procedure. Cryo-EM data and refinement statistics are summarized in Table 1. ^ Crystal structure determination of holo-D43m3

[0079] Crystals of holo-D43m3 were grown by sitting-drop vapor diffusion. A drop containing 2 µL of RNA (1 g / L) and 1 µL of crystallization buffer (0.05 M HEPES pH 7.5, 0.01 M MgCl2, 2.5 mM Spermine, and 14% MPD) was mixed and set on a 24-well plate and incubated at 22 ℃. Trapezoidal crystals grew to > 50 µm in 1–3 days. Crystals were dehydrated and cryo-protected by exchanging the well-buffer with the same buffer supplemented with 40% MPD and incubating overnight at 22 ℃. The crystals were then harvested from the drop and flash-frozen in liquid nitrogen.Leydig 774292 NIH E-234-2023-0-PC-01 26

[0080] Crystal data for holo-43m3 were collected at beamline 19-ID of the Advanced Photon Source, Argonne National Laboratory, and processed with XDS. The data were merged and scaled using AIMLESS to a maximum resolution of 3.06 Å. POINTLESS strongly indicated P 4 22 point-group symmetry but with abnormal intensity distribution and Wilson ratios. Data were also collected for dozens of other crystals of holo-43m3 obtained under very different crystallization conditions, but all exhibited the same pathology. The crystal structure of holo- 43m3 was solved by iterative molecular replacement (MR) using PHASER in the Phenix software suite. The cryo-EM structure of apo-D43m3 and the HHRZ domain alone were used as search models. The crystals belong to space-group P 43212 with four molecules per AU. The abnormal intensity distribution created difficulty in structure determination by MR and very high starting R-factors (>40%). However, after model corrections, the structure could be successfully refined (Rfree = 25.9%) in P 43212 without applying any twin operators, thus ruling out the possibility of twinning. Phenix was used for structure refinement, with a strategy consisting of energy minimization, individual atomic displacement parameters (ADP), translation / libration / screw (TLS) parameters with six TLS groups per chain, and automatic optimization of X-ray / stereochemistry and X-ray / ADP weighting factors.) The structure of holo- D43m3 was deposited in the PDB under accession code 8SYK. Crystal data and refinement statistics are summarized in Table 2. ^ NMR samples, data acquisition and analysis

[0081] NMR samples of apo and holo D43m3 were prepared as described above except that uniformly15N-labeled ribonucleotide triphosphates (Cambridge Isotope Laboratories, Inc.) were used during in vitro transcription, and the RNA was purified in buffer consisting of 10 mM KPO4 pH 6.5, 50 mM KCl, 1 mM MgCl2. Purified RNA samples were concentrated to a final concentration of 11 mg / mL and transferred into 5 mm NMR Shigemi tubes with 10% D2O (v / v) added before conducting NMR experiments. For this study, we used a trimmed version of the device (D43m3) in which the lower part of the ribozyme’s Stem I has been removed, as it is mostly disordered in the full-length holo structure. The cryo-EM structure of apo-D43m3 verifies that the truncation does not result in any significant structural changes relative to apo-D43 beyond the lower half of Stem I (all-atom RMSD=1.1 Å; residues 12—111). All NMR spectra were recorded at 30 ºC (303 K) and performed on Bruker Avance III 600, 700, 800 and 850 MHzLeydig 774292 NIH E-234-2023-0-PC-01 27 spectrometers equipped with four channel inverse detection H / C / N / D helium cooled cryoprobe. Data were processed using NMRpipe70 and further displayed and assigned using Sparky. Two- dimensional (2D) imino 1H, 15N-correlation TROSY and sensitivity-enhanced gradient HSQC spectra were recorded on 800 and 850 spectrometers, respectively. 2D 1H,1H-NOESY spectra with different mixing times of 50, 200 and 300 milliseconds were recorded on 700 and 850 MHz spectrometers to ensure all NOE cross peaks signal can be appeared during spin relaxation delay. 2D HNN-COSY spectra were acquired on 600 and 850 spectrometers to prevent the signal lost due to spin-spin relaxation effect at varied strength of magnetic fields.

[0082] Imino protons in each base pair can be observed in the 2D 1H, 15N-correlation spectra. Most of imino proton signals are well-dispersed, except a few of signals in overcrowded regions on the spectra. 2D 1H, 1H-NOESY, 2D sensitivity-enhanced gradient 1H, 15N-HSQC, 1H, 15N-TROSY, and three-dimensional (3D) NOESY-HSQC experiments were employed to assign these imino proton resonances and improve the resolution to resolve the signals in the crowded regions. All imino proton 1H and 15N chemical shifts from the hydrogen bond were fully assigned based on NOE connectivity from 2D 1H,1HNOESY and 3D NOESY-HSQC spectra. For Watson-Crick base pairs in ribonucleic acids, the HNN-COSY experiment utilizes the 2h J NN scalar coupling for obtaining direct correlations between the hydrogen bond donor imino groups of uridine (U) or guanine (G) and the hydrogen bond acceptor N1 or N3 nitrogen atoms of adenine (A) or cytosine (C), respectively. The imino proton resonance assignments were deposited in the Biological Magnetic Resonance Bank (BMRB) under accession numbers 51998 and 52000 for holo- and apo-devices, respectively.

[0083] Chemical shift perturbation (CSP: Δ^^) for each residue was calculated based on following equation (Equation 1): (Equation 1)CSP for each imino proton was divided by the standard deviation (SD) derived from numerical statistics and mapped on the crystal structure of the truncated D43m3 per the number of SD using PyMol. Signal intensity and ratio of each imino proton was calculated using Sparky71 and mapped on the same crystal structure using PyMol.Leydig 774292 NIH E-234-2023-0-PC-01 28 ^ Cell culture

[0084] EL4 cells (ATCC TIB-39) were cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum (GIBCO, Thermo Fisher Scientific), 1% Penicillin-Streptomycin- Glutamine (GIBCO, Thermo Fisher Scientific), and 50 µM 2-mercaptoethanol (GIBCO, Thermo Fisher Scientific). Cell lines were maintained in a humidified incubator at 37 ºC with 5% CO2 supplementation. Cell lines were tested for mycoplasma at regular intervals and cultured according to the ATCC guidelines.

[0085] CRISPR mediated knock-in of RNA devices into PDCD1 in EL4 cells gRNA for device integration was designed using sgRNA Scorer 2.0 (https : / / sgrnascorer. cancer. gov / ). For electroporation, 10 ^^g of Cas9 protein (obtained from Genome Modification Core, NCI, Frederick, MD) and 2 ^^g of sgRNA (IVT 400: AGGGGGTCCAGGTATACTAT (SEQ ID NO:24)) were mixed and incubated for 10 min at room temperature. Electroporation of 0.2 million cells was performed following Lonza 4D nucleofection kit instructions by adding 2 ^^g of donor plasmid to the Cas9 / sgRNA mix. Cells were grown in 24 well plates and single-cell sorting was performed three days post transfection. Sorted cells were further grown for two weeks and then subjected to PCR-mediated screening for the desired genotype using the Platinum direct PCR universal master mix (Invitrogen-A44647500) with forward (CTGTGCCTGGAAATGGAGAGATC SEQ ID NO:25)) and reverse (GATTGGTTCAGTCCCCCAGTCTACG (SEQ ID NO:26)) primers, whose PCR products spanned the RNA device and part of the mouse PD13′-UTR. Positive knock-in cell-lines were sequence verified and subsequently used in the present study. ^ Immunostaining

[0086] EL4 cells were treated with varying concentration of cell-culture-grade tetracycline (Tc) hydrochloride (Millipore Sigma-T7660) for 72 hours, which was replenished with fresh Tc every 24 hr. Cells were centrifuged at 300 g for 5 min and the supernatant was discarded. Cells were washed with 1X PBS, and 106 cells / ml were left stationary for 30 min at RT to allow for sedimentation and adhesion to the coverslip in a 12-well plate. Cells were fixed with 4% formaldehyde (PierceTM 16% Formaldehyde (w / v), Methanol-free, Thermo Fisher Scientific - 28906) for 10 min at room temperature. Fixed cells were washed once with 1X PBS for 5 min. Then, 0.1% Tween-20 (Sigma Aldrich-P9416) in 1X PBS was added and cells were incubated atLeydig 774292 NIH E-234-2023-0-PC-01 29 room temperature for 10 min. Permeabilized cells were washed once with 1X PBS for 5 min followed by blocking in 1% Blocker BSA (Thermo Fisher Scientific - 37525) in 1X PBS for 30 min. Blocking solution was replaced with Recombinant Anti-PD1 antibody [EPR20665] (Abcamab214421) at 1:100 dilution, and cells were incubated at 4 ºC for 1 hr. Cells were washed three times with 1X PBS for 5 min each. Cells were incubated with alexa fluor 647 goat anti- rabbit secondary antibody (Abcam-ab150083) at 1:200 dilution for 1 hr and washed three times with 1X PBS for 5 min each. Coverslips were air-dried briefly followed by mounting in DAPI containing Vectashield (Vector Laboratories- H-1200). Confocal imaging was carried out with LSM880 Meta Zeiss laser scanning using a dichroic and barrier filter. Images were processed with Zen 2 software (Zeiss) and the Figure panels were generated in Adobe Photoshop. ^ Immunoblotting

[0087] EL4 cells were treated with Tc as mentioned above for immunostaining.106 cells / ml cells were washed with 1X PBS and then lysed in Mammalian Protein Extraction Reagent (Thermo Fisher Scientific - PI78501) supplemented with Pierce Protease and Phosphatase Inhibitor Mini Tablets (Thermo Fisher Scientific - A32959) for 1 hr at 4 ºC, followed by centrifugation at 15,000 g for 5 min. The supernatant was collected and subjected to protein quantification using the PierceTM BCA protein assay (Thermo Fisher Scientific-PI23225). Protein samples were prepared in NuPAGE LDS buffer (Invitrogen-NP0007) by heating them at 70 ºC for 10 min, followed snap-cooling on ice.20 ^^g protein from each sample was electrophoresed under denaturing conditions in a vertical SDS polyacrylamide NuPAGE 4-12% Bis Tris gel (Invitrogen-NP0322) in SDS running buffer (Invitrogen NP0002). Chameleon Duo Pre-stained protein ladder was loaded in each gel for reference (Li Cor- D11110-20). Following electrophoretic separation, the proteins were transferred onto a 0.45-^^m pore-size Nitrocellulose membrane paper sandwich (Invitrogen-2429017) in NuPAGE 1X transfer buffer (Invitrogen- P0006-1) for 4 hr at 4 ºC using an Invitrogen mini-gel X cell II blot module at constant current. Transfer membranes were briefly rinsed with 1X TBS (Thermo Fisher Scientific -28358) and then subjected to blocking in Starting Block TBS Blocking Buffer (Thermo Fisher Scientific - 37579) for 2 hr at room temperature. Membranes were probed with Recombinant Anti-PD1 antibody [EPR20665] (Abcam-ab214421) at 1:1000 dilution and Anti-alpha Tubulin antibodyLeydig 774292 NIH E-234-2023-0-PC-01 30 (Abcam- ab7291) at 1:15,000 dilution overnight at 4 ºC. The next day, the blots were washed three times for 10 min each in 1X TBS supplemented with 0.1% Tween-20.

[0088] Membranes were incubated in IRdye 800 (for PD1) and 680 (for alpha tubulin) at 1:10,000 dilution for 1 hr at room temperature, and washed five times with 1X TBS supplemented with 0.1% Tween-20 for 5 min each, followed by air-drying and detection using an Odyssey infrared imaging system (LI-COR Biosciences). Band intensity measurements and image processing were performed using ImageJ and assembled in Adobe Photoshop.

[0089] Transcript analysis through qRT-PCR Following treatment with Tc as mentioned above, total RNA was extracted using RNeasy Plus Mini Kit (Qiagen-74134). Extracted RNA was first subjected to DNA removal using the DNA-free DNA removal kit (Invitrogen- AM1906). Samples were subjected to cleanup by RNeasy MinElute Cleanup Kit (Qiagen74204). cDNA was synthesized from 500 ng of RNA using High-Capacity cDNA Reverse Transcription Kit with RNase Inhibitor (Thermo Fisher Scientific - 4374966). PCR reactions were performed in 96 well plates using PowerTrack» SYBR Green Master Mix (Thermo Fisher Scientific - A46110) in a Quant Studio 3 Real Time PCR machine from Applied Biosystems. Gene-specific primers for PD1 (Forward: CGTCCCTCAGTCAAGAGGAG (SEQ ID NO:27); Reverse: GCTCCCAGCTTGTGGTAAAC (SEQ ID NO:28)) and housekeeping gene actin (Forward: CCCTACAGTGCTGTGGGTTT (SEQ ID NO:29); Reverse: GACATGCAAGGAGTGCAAGA (SEQ ID NO:30)) were used in knock-in and wild-type samples with the cycling condition of 95 ºC hold for 5 min, 20 to 30 cycles of annealing at 58 ºC for 30 sec and extension at 72 ºC for 20 sec per cycle. All the reactions were performed in triplicates and the 2^(-ΔΔCT) method was used to calculate the relative levels of expression of the target transcripts and normalized to wild- type RNA with no insertion. ^ Cloning strategy for Promoter swapping

[0090] The pAG0134-(promoter)-EGFP (Figure 12) lentiviral vectors were modified from the pAG0134 lentiviral vector made by the Genome Modification Core (NCI, Frederick, MD). To generate pAG0134-CMV-EGFP, pAG0134 was digested with MluI and BmgBI to remove the promoter and swap the parent vector gene. Then, a 1489-bp fragment of the pcDNA3-EGFP (Addgene) vector containing the CMV promoter and EGFP gene was PCR-amplified with primers 5′-GCGATGTACGGGCCAGATATACGCGTT-3′ (SEQ ID NO:31) and 5′-Leydig 774292 NIH E-234-2023-0-PC-01 31 ATGTAGTACACGTCTTACTTGTACAGCTCGTCCATGCCGAGA-3′ (SEQ ID NO:32) and digested with MluI and BmgBI. These sequences were then ligated to generate pAG0134-CMV- EGFP.

[0091] Different promoters were inserted into the pAG0134-CMV-EGFP vector to replace CMV promoter. The human EF1a core promoter (212 bp) was PCR-amplified from the pAG0134 vector using the primers 5′- ATGATCTTACGCGTCCGGTGCCCGTCAGTGGGCAGA -3′ (SEQ ID NO:33) and 5′- TAACACAGTTGCGGCCGCGGTGGCTCGAGGATCCTGTGTTCTGGCG -3′ (SEQ ID NO:34). The MSCV promoter (342 bp) was PCR-amplified from the pMSCV-GFP (Addgene) vector using the primers 5′-ATTACTAGACGCGTGGAGGTTCCACCGAGATTTGGAGAC - 3′ (SEQ ID NO:35) and 5′-TTATCGTCTGCGGCCGCTAATTTTCAGACAAATACAGAAAC -3′ (SEQ ID NO:36). The SFFV promoter (407 bp) was PCR-amplified from the pAG0134 vector using the primers 5′-TATCGATTACGCGTCACGTGCTAG -3′ (SEQ ID NO:37) and 5′- TATAATCGTTGCGGCCGCTCTTCCTCCTCCCCGCTGCTCACC-3′ (SEQ ID NO:38). All PCR products were digested with MluI and NotI and purified with the QIAquick PCR Purification Kit (Qiagen). Then, the pAG0134-CMV-EGFP vector was digested with MluI and NotI, and the 7663-bp fragment was gel-purified with the QIAquick Gel Extraction Kit (Qiagen) and ligated to the EF1a, MSCV, or SFFVpromoter PCR fragments, generating three unique vectors. EF-1α promoter: gggcagagcgcacatcgcccacagtccccgagaagttggggggaggggtcggcaattgaaccggtgcctagagaaggtggcgcggg gtaaactgggaaagtgatgtcgtgtactggctccgcctttttcccgagggtgggggagaaccgtatataagtgcagtagtcgccgtgaacgt tctttttcgcaacgggtttgccgccagaacacag (SEQ ID NO:39) MSCV promoter: aagctggccagcggtcgtttcgtgtctgtctctgtctttgtgcgtgtttgtgccggcatctaatgtttgcgcctgcgtctgtactagttagctaact agctctgtatctggcggacccgtggtggaactgacgagttctgaacacccggccgcaaccctgggagacgtcccagggactttgggggc cgtttttgtggcccgacctgaggaagggagtcgatgtggaatccgaccccgtcaggatatgtggttctggtaggagacgagaacctaaaac agttcccgcctccgtctgaatttttgctttcggtttggaaccgaagccgcgcgtcttgtctgctg (SEQ ID NO:40)Leydig 774292 NIH E-234-2023-0-PC-01 32 SFFV promoter: gtaacgccattttgcaaggcatggaaaaataccaaaccaagaatagagaagttcagatcaagggcgggtacatgaaaatagctaacgttgg gccaaacaggatatctgcggtgagcagtttcggccccggcccggggccaagaacagatggtcaccgcagtttcggccccggcccgagg ccaagaacagatggtccccagatatggcccaaccctcagcagtttcttaagacccatcagatgtttccaggctcccccaaggacctgaaatg accctgcgccttatttgaattaaccaatcagcctgcttctcgcttctgttcgcgcgcttctgcttcccgagctctataaaagagctcacaacccct cactcggcgcgccagtcctccgacagactgagtcgcccgg (SEQ ID NO:41) Results ^ Apo and holo cryo-EM structures of a complete synthetic RNA device

[0092] The cryo-EM structures of D43 reveal its designed three-module architecture, in which the CM (residues 47-50 and 98-101) is flanked directly by the ligand-binding pocket (residues 63, 66, 67, and 97) and the catalytic residues (27-29, 43, 103, 104) of the RZ (Figure 1). The Tc-binding pocket is defined primarily by the non-canonical pseudoknot (PK) formed between L3 (A58-C68) and the two junction regions, J1 / 2 (residues 91-97) and J2 / 3 (residues 51- 53) that connect the APT to the CM. Importantly, this irregular helical region in the APT is coaxially stacked with the CM and Stem II of the ribozyme, thus creating an elongated helix that spans all three aptazyme modules (Figure 1). ^ Mammalian cells harboring the RNA device show Tc-dependent reduction in PD-1 levels.

[0093] To demonstrate the capability of D43 to regulate mRNA levels through Tc-induced cis-cleavage, CRISPR-mediated integration of D43 into the 3′-UTR of PD-1 in EL4 mouse lymphoblasts was performed (Figure 2). Insertion using CRISPR / Cas9 gene editing was considered necessary because it is difficult to have a proper control condition in the case of transient transfection, as differences in plasmid copy number per cell may alter the Tc-dependent response and convolute data interpretation. Device insertion into the 3′UTR is expected to allow normal protein synthesis in the absence of Tc and tunable down-regulation of PD-1 expression in the presence of Tc by initiating RZ self-cleavage and subsequent degradation of the RNA transcript.Leydig 774292 NIH E-234-2023-0-PC-01 33

[0094] Importantly, the region of the 3′-UTR selected for device integration was found not to be associated with any microRNA binding activity and is dispensable. There are 50 predicted miRNAs targeting the 1177 nt long 3’UTR of HPD1 RNA Sequence (mirdb. org / . custom. html), none of these miRNAs target to the location which RNA device inserted in. There are a total of 47 predicted miRNAs targeting 1153 nt long 3’ UTR of CTLA4 (mirdb. org / . custom. html); none of these miRNAs target to the location which RNA device inserted in. Under normal conditions, a substantial level of PD1 protein is expressed in EL4 cells. Induction of device activity in the presence of Tc is expected to result in the activation of device and the transcript degradation results in overall reduction in the protein level.

[0095] The modified knock-in (KI) cells showed similar amounts of PD-1 protein as compared to WT cells in the absence of Tc. Both WT and KI cells were then treated for three days with varying doses of Tc (0, 12.5, 25, or 50 ^^M). These Tc concentrations were based on a MTT viability assay used to determine an appropriate tolerance level. Immunostaining of Tc- treated / untreated and WT cells showed a Tc-dose-dependent reduction in PD-1 expression in cells harboring D43 in comparison to their respective WT controls, demonstrating fully functional Tc-responsive device activity in mammalian cells (Figure 3). A higher concentration of Tc (>50 ^^M) also was observed to result in distorted cellular morphology and hence the image is not shown.

[0096] In addition to immunofluorescence, the protein levels were quantified by immunoblotting (Figure 4) by probing the total protein lysate from D43-KI cells and WT cells with PD1 antibody. Antibody for the housekeeping gene, alpha tubulin, was also co-incubated as an internal loading control in the same blot. Relative quantification of PD1 to tubulin in each case showed that the PD-1 levels were significantly reduced for D43-integrated cells (Figure 5) when normalized to their respective WT controls. It was noticeable that the higher concentration of Tc may slightly affect the WT cells as well; therefore, all the data were quantified relative to WT in order to assess the activity of D43 exclusively. To confirm that the reduction in PD-1 was occurring at the mRNA level, qRT-PCR was performed using the RNA extracts from cells treated or untreated with Tc. These data also showed a Tc-dose-dependent reduction in the amount of PD-1 transcripts relative to WT (Figure 6), indicating the reduction in the level of protein is indeed due to efficient RNA degradation.Leydig 774292 NIH E-234-2023-0-PC-01 34 ^ PD-1 expression is recoverable in mammalian cells

[0097] Whether the observed device activity in mammalian cells was reversible, and whether the PD-1 expression was recoverable after the removal of Tc, also were investigated. The Tc- treated cells were recovered in regular media for seven days and subjected to immunostaining, and RNA extracts were used for qPCR.

[0098] In both assays, the data showed that PD-1 levels were restored upon the removal of Tc (Figure 7). The same pool of cells was then reinduced with varying concentrations of Tc for three days. Once again, the device-containing cells exhibited a Tc-induced reduction in both PD- 1 immunofluorescence and transcript levels, comparable to that of the first induction (Figure 6). Therefore, the device-mediated control of PD-1 expression in mammalian cells is not only efficient, but also reversible and recoverable. In light of the available information on the deleterious effects of PD-1 deficiency by PD-1 knock-downs and knock-outs, these results may provide a less harmful yet highly efficient approach to develop therapies that avoid an underactive or overactive immune response. ^ High throughput device (HTP1) performed better than previous device (D43) in response to tetracycline treatment

[0099] In addition to regulating the PD1 gene, the inventive approach also is being employed with reporter genes like neon-green, mPlum and Luciferase, which indicates the global application of the RNA devices in controlling various genes of interest (Figures not shown).

[0100] As mentioned in figure 11 followed by cloning of top 20 devices selected from HTP library, the top 3 devices, HTP1, HTP2, HTP3, were also packed in lentivirus and transduced to HEK cells to generate the lenti-stable cell lines expressing PD1. Sequence verification is performed in all three cases to confirm the stable integration in the genome. These cell lines will be subjected to Tc treatment to check the respective device activity. Stable cell lines are expected to provide better quantification of the effect as they have equal copy number (probably one) in each case (treated or untreated) in comparison to transient transfection.

[0101] To further test the device activity in mouse models, luciferase reporter system was created by cloning luciferase gene from vector-pLX307 P2A-GFP-Luciferase, to the modified vector pAG0134_Ef1a-EGFP-3LTRdU3. Two different types of reporters were created in thisLeydig 774292 NIH E-234-2023-0-PC-01 35 context, one with GFP (to visualize the transduced cells before injecting to the mice) and the other one is non-GFP luciferase reporter (in case tetracycline fluorescence, which interferes with the detection of luciferase activity). In these two types of parent vectors, HTP1, 2 and 3 devices along with several control devices like ribozyme and HTP1-mutant (non-functional) devices are also integrated to test the luciferase activity in mouse models. Such testing will be employed by transducing the KOPN-8 cell line (ACC 552, B cell precursor leukemia) with the device- harboring vectors. These cells will be subsequently injected to the mice followed by Tc treatment to test the device activity by luciferase assay. BIOLOGICAL SEQUENCES

[0102] The following sequences are provided to further elucidate the invention. In SEQ ID NOs:1-4, the underlined nucleotides indicate where the communication module sequences are. D43 (SEQ ID NO:1): CUGAGGUGCAGGUACAUCCAGCUGAUGAGUCCCAAAUAGGACGAAAAGGGAGAG GUGAAGAAUACGACCACCUAGGCUCGAAAGAGCCUAAAACAUACCUUUCCUGGAU UCCACUGCUAUCCAC HTP-1 (SEQ ID NO:2): GGGTCCAGGTATACTATGGGCTGAGGTGCAGGTACATCCAGCTGATGAGTCCCAAA TAGGACGAAACAATAGAGGTGAAGAATACGACCACCTAGGCTCGAAAGAGCCTAA AACATAACAGTCCTGGATTCCACTGCTATCCACCCAGCACCTAAAGCCACCC HTP-2 (SEQ ID NO:3): GGGTCCAGGTATACTATGGGCTGAGGTGCAGGTACATCCAGCTGATGAGTCCCAAA TAGGACGAAACGGAAGAGGTGAAGAATACGACCACCTAGGCTCGAAAGAGCCTAA AACATAGAGGTCCTGGATTCCACTGCTATCCACCCAGCACCTAAAGCCACCC HTP-3 (SEQ ID NO:4): GGGTCCAGGTATACTATGGGCTGAGGTGCAGGTACATCCAGCTGATGAGTCCCAAA TAGGACGAAAGCGCAGAGGTGAAGAATACGACCACCTAGGCTCGAAAGAGCCTAA AACATAATGGTCCTGGATTCCACTGCTATCCACCCAGCACCTAAAGCCACCCLeydig 774292 NIH E-234-2023-0-PC-01 36 HTP-4 (SEQ ID NO:5): GGGTCCAGGTATACTATGGGCTGAGGTGCAGGTACATCCAGCTGATGAGTCCCAAA TAGGACGAAATCGGAGAGGTGAAGAATACGACCACCTAGGCTCGAAAGAGCCTAA AACATAAGGCTCCTGGATTCCACTGCTATCCACCCAGCACCTAAAGCCACCC HTP-5 (SEQ ID NO:6): GGGTCCAGGTATACTATGGGCTGAGGTGCAGGTACATCCAGCTGATGAGTCCCAAA TAGGACGAAAAATCAGAGGTGAAGAATACGACCACCTAGGCTCGAAAGAGCCTAA AACATAGACATCCTGGATTCCACTGCTATCCACCCAGCACCTAAAGCCACCC HTP-6 (SEQ ID NO:7): GGGTCCAGGTATACTATGGGCTGAGGTGCAGGTACATCCAGCTGATGAGTCCCAAA TAGGACGAAACTGAAGAGGTGAAGAATACGACCACCTAGGCTCGAAAGAGCCTAA AACATACCTTTCCTGGATTCCACTGCTATCCACCCAGCACCTAAAGCCACCC HTP-7 (SEQ ID NO:8): GGGTCCAGGTATACTATGGGCTGAGGTGCAGGTACATCCAGCTGATGAGTCCCAAA TAGGACGAAACCGTAGAGGTGAAGAATACGACCACCTAGGCTCGAAAGAGCCTAAA ACATACCTATCCTGGATTCCACTGCTATCCACCCAGCACCTAAAGCCACCC HTP-8 (SEQ ID NO:9): GGGTCCAGGTATACTATGGGCTGAGGTGCAGGTACATCCAGCTGATGAGTCCCAAA TAGGACGAAACCTGAGAGGTGAAGAATACGACCACCTAGGCTCGAAAGAGCCTAAA ACATAGTGTTCCTGGATTCCACTGCTATCCACCCAGCACCTAAAGCCACCC HTP-9 (SEQ ID NO:10): GGGTCCAGGTATACTATGGGCTGAGGTGCAGGTACATCCAGCTGATGAGTCCCAAA TAGGACGAAACCCAAGAGGTGAAGAATACGACCACCTAGGCTCGAAAGAGCCTAA AACATAGCGTTCCTGGATTCCACTGCTATCCACCCAGCACCTAAAGCCACCCLeydig 774292 NIH E-234-2023-0-PC-01 37 HTP-10 (SEQ ID NO:11): GGGTCCAGGTATACTATGGGCTGAGGTGCAGGTACATCCAGCTGATGAGTCCCAAA TAGGACGAAAGTGGAGAGGTGAAGAATACGACCACCTAGGCTCGAAAGAGCCTAA AACATAATTCTCCTGGATTCCACTGCTATCCACCCAGCACCTAAAGCCACCC HTP-11 (SEQ ID NO:12): GGGTCCAGGTATACTATGGGCTGAGGTGCAGGTACATCCAGCTGATGAGTCCCAAA TAGGACGAAATTAGAGAGGTGAAGAATACGACCACCTAGGCTCGAAAGAGCCTAAA ACATAGAAATCCTGGATTCCACTGCTATCCACCCAGCACCTAAAGCCACCC HTP-12 (SEQ ID NO:13): GGGTCCAGGTATACTATGGGCTGAGGTGCAGGTACATCCAGCTGATGAGTCCCAAA TAGGACGAAACTTGAGAGGTGAAGAATACGACCACCTAGGCTCGAAAGAGCCTAAA ACATACTGTTCCTGGATTCCACTGCTATCCACCCAGCACCTAAAGCCACCC HTP-13 (SEQ ID NO:14): GGGTCCAGGTATACTATGGGCTGAGGTGCAGGTACATCCAGCTGATGAGTCCCAAA TAGGACGAAACGCTAGAGGTGAAGAATACGACCACCTAGGCTCGAAAGAGCCTAAA ACATAAGATTCCTGGATTCCACTGCTATCCACCCAGCACCTAAAGCCACCC HTP-14 (SEQ ID NO:15): GGGTCCAGGTATACTATGGGCTGAGGTGCAGGTACATCCAGCTGATGAGTCCCAAA TAGGACGAAAGTCCAGAGGTGAAGAATACGACCACCTAGGCTCGAAAGAGCCTAAA ACATAAGAGTCCTGGATTCCACTGCTATCCACCCAGCACCTAAAGCCACCC HTP-15 (SEQ ID NO:16): GGGTCCAGGTATACTATGGGCTGAGGTGCAGGTACATCCAGCTGATGAGTCCCAAA TAGGACGAAATGTCAGAGGTGAAGAATACGACCACCTAGGCTCGAAAGAGCCTAAA ACATATGATTCCTGGATTCCACTGCTATCCACCCAGCACCTAAAGCCACCCLeydig 774292 NIH E-234-2023-0-PC-01 38 HTP-16 (SEQ ID NO:17): GGGTCCAGGTATACTATGGGCTGAGGTGCAGGTACATCCAGCTGATGAGTCCCAAA TAGGACGAAATGTGAGAGGTGAAGAATACGACCACCTAGGCTCGAAAGAGCCTAAA ACATACCTCTCCTGGATTCCACTGCTATCCACCCAGCACCTAAAGCCACCC HTP-17 (SEQ ID NO:18): GGGTCCAGGTATACTATGGGCTGAGGTGCAGGTACATCCAGCTGATGAGTCCCAAA TAGGACGAAATCGTAGAGGTGAAGAATACGACCACCTAGGCTCGAAAGAGCCTAAA ACATATAAATCCTGGATTCCACTGCTATCCACCCAGCACCTAAAGCCACCC HTP-18 (SEQ ID NO:19): GGGTCCAGGTATACTATGGGCTGAGGTGCAGGTACATCCAGCTGATGAGTCCCAAA TAGGACGAAACGCTAGAGGTGAAGAATACGACCACCTAGGCTCGAAAGAGCCTAAA ACATAGGGTTCCTGGATTCCACTGCTATCCACCCAGCACCTAAAGCCACCC HTP-19 (SEQ ID NO:20): GGGTCCAGGTATACTATGGGCTGAGGTGCAGGTACATCCAGCTGATGAGTCCCAAA TAGGACGAAATCGTAGAGGTGAAGAATACGACCACCTAGGCTCGAAAGAGCCTAAA ACATACAGTTCCTGGATTCCACTGCTATCCACCCAGCACCTAAAGCCACCC HTP-20 (SEQ ID NO:21): GGGTCCAGGTATACTATGGGCTGAGGTGCAGGTACATCCAGCTGATGAGTCCCAAA TAGGACGAAATCGAAGAGGTGAAGAATACGACCACCTAGGCTCGAAAGAGCCTAA AACATAATGTTCCTGGATTCCACTGCTATCCACCCAGCACCTAAAGCCACCC HTP-21 (SEQ ID NO:22): GGGTCCAGGTATACTATGGGCTGAGGTGCAGGTACATCCAGCTGATGAGTCCCAAA TAGGACGAAACGTCAGAGGTGAAGAATACGACCACCTAGGCTCGAAAGAGCCTAAA ACATAGACGTCCTGGATTCCACTGCTATCCACCCAGCACCTAAAGCCACCCLeydig 774292 NIH E-234-2023-0-PC-01 39 HTP-22 (SEQ ID NO:23): GGGTCCAGGTATACTATGGGCTGAGGTGCAGGTACATCCAGCTGATGAGTCCCAAA TAGGACGAAAGGGGAGAGGTGAAGAATACGACCACCTAGGCTCGAAAGAGCCTAA AACATAAAACTCCTGGATTCCACTGCTATCCACCCAGCACCTAAAGCCACCC EXAMPLE 2

[0103] This Example demonstrates the activity of RNA devices D43 (SEQ ID NO:1), HTP-1 (SEQ ID NO:2), HTP-2 (SEQ ID NO:3), and HTP-3 (SEQ ID NO:4).

[0104] To sort out the better performers from high throughput screening, the top 20 devices were selected (those having higher reads in sequencing data) and subjected to tetracycline treatment (at 25 µM concentration for 24 hr) to check their efficacy in reducing the level of PD1. Simultaneously, several controls were also treated in a similar way for better comparison (No Plasmid- Cells not transfected with any construct to show the profile with no PD1 expression; No-Device-Cells transfected with the plasmid expressing PD1 without any device; D43- Cells expressing PD1 with the functional device 43 in gene’s 3’UTR; RBZ- Cells expressing PD1 with the ribozyme in 3’UTR of the gene).

[0105] Figure 8 presents NXN plots from the resulting flow cytometry data to visually assess the separation of populations for PD1 expression. It is notable that in comparison to all controls, the test devices (HTP-1, HTP-2 and HTP-3) showed reduced PD1 expression in the presence of Tc and relatively higher PD1 expression in the absence of Tc (showing wide dynamic range) with more pronounced effect with HTP-1. The data reveal that HTP-1, HTP-2, and HTP-3 display better activity than D43 and the other controls and that HTP-1 outperformed even at lower tetracycline concentrations. EXAMPLE 3

[0106] This Example demonstrates the effect of oxidized lymecycline on the inventive RNA device activity in reducing the level of PD1.

[0107] Oxidized lymecycline was prepared by air-purging lymecycline at room temperature or over ice. The product was assessed using HPLC, which revealed the presence of multiple oxidized derivatives of lymecycline, and this mixture was used in the following experiments.Leydig 774292 NIH E-234-2023-0-PC-01 40

[0108] To compare the device activity of HTP-1 at lower tetracycline dosages (lower than 25 mM), transiently transfected HEK cells were treated with 6.25 µM and 12.5 µM Tc (Lymecycline) for 24-hour post-transfection. Cells were also preincubated in the same Tc concentrations for 4 hours prior to transfection.

[0109] The results of this are presented in Figure 9, which depicts flow cytometry data showing the intensity of PD1 signal (Y-axis) and cell count (X-axis) scanned at PE-Cy7 channel with 10,000 cells (out of 1 X 106cells stained with anti-PD1 antibody). These results reveal that HTP-1 outperformed D-43 and other controls in reducing the level of PD1 at lower concentrations. A remarkable reduction of PD1 due to HTP-1 activity is seen to get down to the level of ribozyme at 12.5 µM concentration and hence, it appears to be the best device with a large dynamic range. EXAMPLE 4

[0110] This Example demonstrates the effect of oxidized lymecycline on the inventive RNA device activity in reducing the level of CTLA4.

[0111] To check the versatility of the inventive RNA device (HTP-1) in regulating the expression of genes other than PD1, one of the most potent checkpoint receptors, CTLA4, was tested and its effect compared with PD1 expression in the absence / presence of Tc (Lymecycline oxidized). This experiment was performed with a vast range of concentrations of the ligand ranging from 0.39 µM to 12.5 µM for both genes having HTP-1 in their 3’UTR.

[0112] The results of this experiment are presented in Figure 10, reflecting 10,000 cells (out of 1 X 106cells stained with anti-PD1 or anti-CTL-4 antibody) (data are not shown in Figure 10 for all concentrations). Interestingly, in addition to the reproducible result for PD1 (Figure 10, panel A, also as shown in Figure 1), HTP-1 displayed remarkable activity in reducing the level of CTLA4 in the presence of Tc at a concentration as low as 0.39 µM (Figure 10, panel B). It is notable that the minimum amount of Tc required for the execution of RNA device-mediated PD1 reduction is 6.25 µM (Figure 10, panel B), however, only 0.39 µM concentration is sufficient to carry out the process to reduce the level of CTLA4 (Figure 10, panel B), presumably due to the relatively shorter half-life of the CTLA4 (CTLA4, ~2 hours, vs.6-8 hours for PD1).Leydig 774292 NIH E-234-2023-0-PC-01 41 TABLES Table 1 Cryo-EM data collection, refinement, and validation statistics holo-D43 (EMD- apo-D43 apo-D43m3 41059) (EMDB-xxxx) (EMDB-xxxx) (PDB 8T5O) (PDB xxxx) (PDB xxxx) Data collection and processing Magnification 165,000 165,000 165,000 Voltage (kV) 300 300 300 Electron exposure (e– / Å2) 50.9 52.2 54.5 Defocus range (μm) -0.5 to -2.0 -0.5 to -2.0 -0.5 to -2.0 Pixel size (Å) 0.693 0.693 0.693 Symmetry imposed C1 C1 C1 Initial particle images (no.) 5,664,968 12,033,045 4,061,465 Final particle images (no.) 369,486 731,795 404,781 Map resolution (Å) 3.0 3.2 3.4 FSC threshold 0.143 0.143 0.143 Map resolution range (Å) 2.9 - 5.8 3.2 - 6.5 3.3 – 5.3 Refinement 3.0 3.2 3.4 Model resolution (Å) FSC threshold Model resolution range (Å) Map sharpening B factor (Å2) -88 -139 -142 Model composition Non-hydrogen atoms RNA residues Ligands B factors (Å2) Protein Ligand R.m.s. deviations Bond lengths (Å) Bond angles (°) Validation MolProbity score Clashscore Poor rotamers (%) Ramachandran plot Favored (%) Allowed (%) Disallowed (%)Leydig 774292 NIH E-234-2023-0-PC-01 42 Table 2 Crystal data and refinement statistics holo-D43m3 (PDB: 8SYK) Data collection Beamline 19-ID, APS Wavelength (Å) 0.97918 Space group P 43212 Unit-cell parameters (Å,o) 81.2, 81.2, 528.8, 90, 90, 90 Resolution range (Å) 44.32 – 3.06 (3.17-3.06) Completeness for range (%) 99.9 (99.1) Observed reflections 426,977 (43,647) Unique reflections 35,013 (3402) Multiplicity 12.2 (12.8) I / ^^(I) 11.8 (0.96) Wilson B-factor (Å2) 108.8 Solvent content (%) 66.7 Rmerge 0.08534 (2.509) Rmeas 0.09002 (2.613) Rp.i.m 0.02767 (0.726) 0.996 (0.356) 0.999 (0.725)range (Å) 44.32 – 3.06 (3.14-3.06) Completeness for range (%) 100 (100) Reflections used 35,012 (2616) Reflections in test set 1170 (125) Rwork 0.2226 (0.3602) Rfree 0.2571 (0.3967) CCwork 0.989 (0.635) CCfree 0.981 (0.545) Number of non-hydrogen atoms 9474 RNA 2965 Ir-hex ions 238 Other 33 RMSD bond lengths (Å) 0.005 RMSD bond angles (o) 0.47Leydig 774292 NIH E-234-2023-0-PC-01 43 Coordinate error (Å) 0.41 Phase error (o) 28.92 All-atom clash score 3.45 Average B-factor (Å2) 169.2 RNA 169.8 Ligand 154.3 Solvent 127.2 Number of TLS groups per monomer 6

[0113] All references, including publications, patent applications, and patents, cited herein are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein.

[0114] The use of the terms “a” and “an” and “the” and “at least one” and similar referents in the context of describing the invention (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The use of the term “at least one” followed by a list of one or more items (for example, “at least one of A and B”) is to be construed to mean one item selected from the listed items (A or B) or any combination of two or more of the listed items (A and B), unless otherwise indicated herein or clearly contradicted by context. The terms “comprising,” “having,” “including,” and “containing” are to be construed as open-ended terms (i.e., meaning “including, but not limited to,”) unless otherwise noted. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., “such as”) provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.Leydig 774292 NIH E-234-2023-0-PC-01 44

[0115] Preferred embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of those preferred embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.

Claims

Leydig 774292 NIH E-234-2023-0-PC-01 45 CLAIM(S):

1. An RNA device comprising a nucleic acid comprising a first domain comprising a drug- responsive aptamer (APT), a second domain comprising a communication module (CM), and a third domain comprising a ribozyme (RZ), wherein one or more of the following are present: (a) the first domain comprises a tetracycline (Tc)-binding APT, (b) the second domain comprises a CM comprising helical base pairs, (c) the third domain comprises an RZ derived from the HHRZ from Schistosoma mansoni (Sm), or (d) a combination of one or more of (a) through (c).

2. The RNA device of claim 1, wherein the first domain comprises a tetracycline (Tc)- responsive APT.

3. The RNA device of claim 1 or 2, wherein the second domain comprises a CM comprising four helical base pairs.

4. The RNA device of any one of claims 1-3, wherein the third domain comprises an RZ derived from the HHRZ from Sm.

5. The RNA device of claim 1, comprising a sequence of nucleotides at least 95% identical to SEQ ID NO:1-23.

6. The RNA device of claim 1, comprising a sequence of nucleotides at least 95% identical to D43 (SEQ ID NO:1), HTP-1 (SEQ ID NO:2), HTP-2 (SEQ ID NO:3), or HTP-3 (SEQ ID NO:4).

7. A DNA molecule encoding the RNA device of any one of claims 1-6.

8. A genetic vector comprising the DNA molecule of claim 7.

9. The genetic vector of claim 8, which is a plasmid or viral vector.

10. The genetic vector of claim 8, which is a lentiviral or an adenoassociated viral (AAV) vector.

11. A cell comprising the RNA device of claim any one of claims 1-6.Leydig 774292 NIH E-234-2023-0-PC-01 46 12. A cell comprising the DNA molecule of claim 7 or the genetic vector of claim 8 or 9.

13. The cell of claim 11 or 12, which comprises a genome comprising a PD-1 gene or a CTLA-4 gene and the RNA device or genetic construct encoding the RNA device, wherein the RNA device or genetic construct encoding the RNA device is inserted into the 3’ untranslated region (UTR) of the PD-1 gene or a CTLA-4 gene within the genome.

14. The cell of any one of claims 11-13, which is a lymphocyte.

15. The cell of any one of claims 11-14, which is a T-cell.

16. The cell of any one of claims 11-15, which is a human cell.

17. A population of cells comprising the cell of any one of claims 11-16.

18. A pharmaceutical preparation comprising the cell of any of claims 11-16 or the population of claim 17 and a pharmaceutically-acceptable carrier.

19. A method of treating cancer in mammalian subject, wherein the subject comprises cancerous cells, the method comprising introducing the cell of any of claims 11-16, the population of claim 17, or the pharmaceutical preparation of claim 18 into the subject and treating the subject with the drug to which the APT is sensitive.

20. The method of claim 19, wherein the drug is a tetracycline or oxidized derivative thereof.

21. The method of claim 20, wherein the tetracycline is lymecycline or oxidized derivative thereof.

22. The method of any one of claims 19-21, wherein the subject is treated with immunotherapy, radiation, chemotherapy, or a combination thereof.

23. The method of any one of claims 19-22, wherein the cell comprises a lymphocyte obtained from the subject, and wherein the cell is modified ex vivo to comprise the RNA device or genetic vector, and wherein the cell is reintroduced into the subject.Leydig 774292 NIH E-234-2023-0-PC-01 47 24. The method of any one of claims 19-23, wherein the subject is human.

Images