Modified plant

Abstract

The present invention addresses the problem of providing a technique capable of haploid induction by enhancing the expression and / or function of a regulatory gene. The problem is solved by the use of a modified plant comprising an introduced or modified H2A.W gene, wherein said introduction or modification enhances the expression and / or function of the H2A.W gene in a germ cell.

Description

Modified plants

[0001] The present invention relates to modified plants and the like.

[0002] It is known that haploid individuals are generated in plants by the loss of one parental chromosome set at fertilization. Non-Patent Document 1 reports that haploid individuals can be induced by crossing a plant with reduced function of CENH3, a centromere-specific histone H3 variant, with a normal plant.

[0003] In conventional techniques, haploid induction requires the creation of strains in which the expression and / or function of regulatory genes (e.g., CENH3) is suppressed. However, the creation of such suppressed strains requires the use of techniques such as introducing mutations into endogenous regulatory genes, which are not established for all plants or require complicated steps.

[0004] Nature 464, 615-618 (2010). https: / / doi.org / 10.1038 / nature08842Cell. 2014 July 3; 158(1): 98-109. doi:10.1016 / j.cell.2014.06.006

[0005] An objective of the present invention is to provide a technique capable of inducing haploidy by improving the expression and / or function of regulatory genes.

[0006] In view of the above-mentioned problems, the present inventors have conducted extensive research and have found that the above-mentioned problems can be solved by utilizing a modified plant into which an H2A.W gene has been introduced or modified, and the expression and / or function of the H2A.W gene in germ cells has been improved by said introduction or modification. Based on this finding, the present inventors have conducted further research and have completed the present invention. Specifically, the present invention encompasses the following aspects.

[0007] Item 1. A modified plant into which an H2A.W gene has been introduced or modified, and the expression and / or function of the H2A.W gene in germ cells has been improved as a result of the introduction or modification.

[0008] Item 2. The modified plant according to Item 1, wherein the protein encoded by the H2A.W gene is at least one selected from the group consisting of protein (a) and protein (b): (a) a protein consisting of an amino acid sequence set forth in any one of SEQ ID NOs: 1 to 39, and (b) a protein consisting of an amino acid sequence that has 90% or more identity to a protein consisting of an amino acid sequence set forth in any one of SEQ ID NOs: 1 to 39 and that has chromatin aggregation activity.

[0009] Item 3. The modified plant according to Item 1 or 2, wherein the protein encoded by the H2A.W gene is at least one selected from the group consisting of protein (a1) and protein (b1): (a1) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 1, and (b1) a protein consisting of an amino acid sequence having 90% or more identity to the protein consisting of the amino acid sequence set forth in SEQ ID NO: 1 and having chromatin aggregation activity.

[0010] Item 4. The modified plant according to any one of Items 1 to 3, into which the H2A.W gene has been introduced, and the introduction has resulted in improved expression of the gene in germ cells.

[0011] Item 5. The modified plant according to any one of Items 1 to 4, wherein the germ cell is an egg cell.

[0012] Item 6. The modified plant according to any one of Items 1 to 5, wherein the improvement in expression and / or function of the H2A.W gene is germ cell-specific.

[0013] Item 7. A seed that grows into the modified plant body according to any one of Items 1 to 6.

[0014] Item 8. A germline cell into which an H2A.W gene has been introduced or modified, and the expression and / or function of the H2A.W gene has been improved by the introduction or modification.

[0015] Item 9. A method for producing a plant, comprising fertilizing the germ cells of the modified plant according to any one of Items 1 to 6 with germ cells of another plant.

[0016] Item 10. A method for inducing haploidy, comprising fertilizing the germ cells of the modified plant according to any one of Items 1 to 6 with germ cells of another plant.

[0017] Item 11. A haploid or a doubled haploid derived from said haploid, or seeds of said doubled haploid, obtained by the method for inducing a haploid according to Item 10.

[0018] Item 12. A seed obtained by fertilizing the germ cells of the modified plant according to any one of Items 1 to 6 with germ cells of another plant.

[0019] Item 13. A reagent for producing a modified plant according to any one of Items 1 to 6, comprising a polynucleotide containing an expression cassette for the H2A.W gene.

[0020] According to the present invention, it is possible to provide a technology that enables haploid induction by improving the expression and / or function of a regulatory gene. Specifically, it is possible to provide modified plants used for haploid induction, seeds grown into the modified plants, methods for producing plants using the modified plants, methods for inducing haploids, reagents for producing the modified plants, etc.

[0021] This figure shows a schematic diagram of the structure of a plasmid (HTv1339) containing an expression cassette in which the genomic sequence of the H2A.W gene (H2A.W.6 (HTA6, At5g59870)) is placed under the control of an egg cell-specific promoter, and a plasmid (HTv1336) with the same structure but without the expression cassette. The figures show the results of ploidy analysis in Test Example 4. From top to bottom, the parent strain of egg cells (HTv1339 transgenic plant), the parent strain of pollen (trichomeless gl1 mutant strain), and the results of F1 plants obtained from these parent strains. The vertical axis indicates the number of nuclei (count), and the horizontal axis indicates DNA content. The box marked 1C indicates the DNA content of haploids. The figures show the results of fluorescence observation of fertilized eggs 24 hours after pollination in Test Example 4. The parent strain is shown at the top of the photograph. "Control" indicates an HTv1336 transgenic plant, and "+H2A.W" indicates an HTv1339 transgenic plant. In the area indicated by the arrowhead on the right side of the photograph, the CENH3 signal is weakened or absent, and instead the H2A.W signal is clearly observed.

[0022] In this specification, the expressions "contain" and "comprise" include the concepts of "contain", "include", "consist essentially of" and "consist only of".

[0023] "Identity" of amino acid sequences refers to the degree of correspondence between the amino acid sequences of two or more comparable amino acid sequences. Therefore, the greater the correspondence between two amino acid sequences, the greater the identity or similarity between those sequences. The level of identity of amino acid sequences can be determined, for example, using the sequence analysis tool FASTA with default parameters. Alternatively, it can be determined using the BLAST algorithm by Karlin and Altschul (Karlin S, Altschul SF. "Methods for assessing the statistical significance of molecular sequence features by using general scoring schemes," Proc Natl Acad Sci USA. 87:2264-2268 (1990); Karlin S, Altschul SF. "Applications and statistics for multiple high-scoring segments in molecular sequences," Proc Natl Acad Sci USA. 90:5873-7 (1993)). A program called BLASTP, based on the BLAST algorithm, has been developed. Specific techniques for these analysis methods are known and can be found on the National Center of Biotechnology Information (NCBI) website (http: / / www.ncbi.nlm.nih.gov / ). The "identity" of nucleotide sequences is also defined in the same manner as above.

[0024] As used herein, the term "conservative substitution" refers to the substitution of an amino acid residue with an amino acid residue having a similar side chain. For example, substitution between amino acid residues having basic side chains such as lysine, arginine, and histidine constitutes a conservative substitution. Other examples of conservative substitutions include substitution between amino acid residues having acidic side chains such as aspartic acid and glutamic acid; amino acid residues having uncharged polar side chains such as glycine, asparagine, glutamine, serine, threonine, tyrosine, and cysteine; amino acid residues having nonpolar side chains such as alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, and tryptophan; amino acid residues having β-branched side chains such as threonine, valine, and isoleucine; and amino acid residues having aromatic side chains such as tyrosine, phenylalanine, tryptophan, and histidine.

[0025] As used herein, the terms "nucleic acid" and "polynucleotide" are not particularly limited and encompass both natural and artificial nucleic acids. Specifically, in addition to DNA, RNA, and the like, known chemical modifications may be used, as exemplified below. To prevent degradation by hydrolases such as nucleases, the phosphate residue of each nucleotide may be substituted with a chemically modified phosphate residue, such as phosphorothioate (PS), methylphosphonate, or phosphorodithioate. Furthermore, the hydroxyl group at the 2-position of the sugar (ribose) of each ribonucleotide may be substituted with -OR (where R represents, for example, CH3(2'-O-Me), CH2CHOCH3(2'-O-MOE), CH2CH2NHC(NH)NH2, CH2CONHCH3, or CH2CH2CN). Furthermore, the base moiety (pyrimidine or purine) may be chemically modified, for example, by introducing a methyl group or a cationic functional group into the 5-position of the pyrimidine base, or by substituting a thiocarbonyl group for the carbonyl group at the 2-position. Further examples include, but are not limited to, those in which the phosphate moiety or hydroxyl moiety is modified with, for example, biotin, an amino group, a lower alkylamine group, an acetyl group, etc. Also usable are BNA (LNA), in which the conformation of the sugar moiety of the nucleotide is fixed to N-type by bridging the 2' oxygen and 4' carbon of the sugar moiety.

[0026] As used herein, the term "gene" includes not only the regions (exons, introns) on genomic DNA that code for a protein, but also the regions that control the expression of the protein (expression control regions).

[0027] In one aspect, the present invention relates to a modified plant (sometimes referred to in this specification as a "modified plant of the present invention") into which the H2A.W gene has been introduced or modified, and which has improved expression and / or function of the H2A.W gene in reproductive cells as a result of said introduction or modification.

[0028] The plants from which the modified plants of the present invention are derived (unmodified plants) are not particularly limited. Examples of plants include a wide range of plants, including the angiosperms Magnolia, monocotyledons, and eudicotyledons (Rosaceae I, Rosaceae II, Chrysanthemum I, Chrysanthemum II, and their outgroups). Cultivars are particularly preferred. Specific examples of plants include eggplants such as tomatoes, bell peppers, chili peppers, and eggplants; gourds such as cucumbers, pumpkins, melons, and watermelons; vegetables such as cabbage, broccoli, and Chinese cabbage; fresh or spicy vegetables such as celery, parsley, and lettuce; onions such as leeks, onions, and garlic; beans such as soybeans, peanuts, green beans, peas, and adzuki beans; other fruit vegetables such as strawberries; taproots such as radishes, turnips, carrots, and burdock; potatoes such as taro, cassava, potato, sweet potato, and Chinese yam; soft vegetables such as asparagus, spinach, and mitsuba; flowers such as lisianthus, stock, carnations, and chrysanthemums; and grains such as rice, wheat, barley, oats, and corn. Examples of suitable plants include grasses such as bentgrass and Zoysiagrass, oil crops such as rapeseed and peanut, sugar crops such as sugarcane and sugar beet, fiber crops such as cotton and rush, forage crops such as clover, sorghum and dent corn, deciduous fruit trees such as apples, pears, grapes and peaches, citrus fruits such as Satsuma mandarins, lemons and grapefruit, woody plants such as Satsuki azalea, azalea and cedar, and nuts and seeds such as almonds, hemp, flax, perilla, cashew, pumpkin, Japanese kaya, ginkgo, chestnut, walnut, poppy, coconut, sesame, Japanese castanea, watermelon, chia, horse chestnut, lotus, water chestnut, pistachio, sunflower, Brazil nut, hazel, pecan, macadamia, pine and peanut.

[0029] The plant body means the entire plant including all of the plant tissues (roots, stems, leaves, etc.).

[0030] The H2A.W gene is a variant of the histone H2A and is known to have chromatin condensation activity (Non-Patent Document 2). Chromatin condensation activity is mediated by a unique motif (SPKK motif) present in the C-terminal region of H2A.W. Furthermore, this motif is highly conserved among plant species.

[0031] Proteins encoded by the H2A.W gene include, for example, the Arabidopsis thaliana H2A.W gene (SEQ ID NOs: 1-3), the cabbage (Brassica oleracea var. capitata) H2A.W gene (SEQ ID NOs: 4-5), the oilseed rape (Brassica rapa) H2A.W gene (SEQ ID NOs: 6-9), the soybean (Glycine max) H2A.W gene (SEQ ID NOs: 10-14), the broad bean (Vicia faba) H2A.W gene (SEQ ID NOs: 15-16), the grape (Vitis vinifera) H2A.W gene (SEQ ID NOs: 17-18), the tomato (Solanum lycopersicum) H2A.W gene (SEQ ID NOs: 19-21), the potato (Solanum tuberosum) H2A.W gene (SEQ ID NOs: 22-24), the rice (Oryza sativa) H2A.W gene (SEQ ID NOs: 25-26), the maize (Zea mays) H2A.W gene (SEQ ID NOs: 27-28), the rice (Zea mays) H2A.W gene (SEQ ID NOs: 29-30), the rice (Zea mays) H2A.W gene (SEQ ID NOs: 31-32), the rice (Zea mays) H2A.W gene (SEQ ID NOs: 33-34), the rice (Zea mays) H2A.W gene (SEQ ID NOs: 35-36), the rice (Zea mays) H2A.W gene (SEQ ID NOs: 37-38), the rice (Zea mays) H2A.W gene (SEQ ID NOs: 39-40), the rice (Zea mays) H2A.W gene (SEQ ID Examples of plant H2A.W genes include the (maybe) H2A.W gene (SEQ ID NOS: 27-30), the (Sorghum) H2A.W gene (SEQ ID NOS: 31-34), the (Nymphaea) H2A.W gene ... H2A.W genes of plants other than those mentioned above are either already known or can be easily identified based on identity / homology analysis based on the sequence information of the above-mentioned H2A.W genes.

[0032] The H2A.W gene also includes functionally normal mutants that can occur naturally or artificially. The H2A.W gene may have base mutations such as substitutions, deletions, additions, and insertions, so long as the protein it encodes has chromatin condensation activity. Preferred mutations are those that do not result in amino acid substitutions in the encoded protein or those that result in conservative amino acid substitutions.

[0033] The protein encoded by the H2A.W gene is preferably at least one selected from the group consisting of protein (a) and protein (b): (a) a protein consisting of the amino acid sequence shown in any one of SEQ ID NOs: 1 to 39 (particularly preferably SEQ ID NO: 1), and (b) a protein consisting of an amino acid sequence that has 80% or more identity to a protein consisting of the amino acid sequence shown in any one of SEQ ID NOs: 1 to 39 (particularly preferably SEQ ID NO: 1), and that has chromatin aggregation activity.

[0034] In the above (b), the identity is more preferably 85% or more, even more preferably 90% or more, even more preferably 95% or more, and particularly preferably 98% or more.

[0035] An example of protein (b) is (b') a protein having an amino acid sequence in which one or more amino acids have been substituted, deleted, added, or inserted relative to the amino acid sequence shown in any of SEQ ID NOs: 1 to 39 (particularly preferably SEQ ID NO: 1), and which has chromatin aggregating activity.

[0036] In the above (b'), "plurality" means, for example, 2 to 10, preferably 2 to 5, more preferably 2 to 3, and even more preferably 2.

[0037] The presence or absence and degree of chromatin condensation activity can be determined according to the in vitro test shown in Figure 5 of Non-Patent Document 2.

[0038] The "function" of the H2A.W gene refers to chromatin condensation activity. Furthermore, the "expression" of the H2A.W gene includes both expression of H2A.W gene mRNA and expression of H2A.W gene protein, but preferably expression of H2A.W gene protein. "Improved" means that for a sample obtained from a modified plant of the present invention, the chromatin condensation activity and / or gene expression level (index value of gene function and / or expression) of the H2A.W gene protein is, for example, 110% or more, 120% or more, 130% or more, 140% or more, 150% or more, 200% or more, 300% or more, 400% or more, 500% or more, 1000% or more, or, for example, 10,000% or less, 5,000% or less, 3,000% or less, 2,000% or less, relative to 100% of the chromatin condensation activity and / or gene expression level (index value of gene function and / or expression) of the H2A.W gene protein for a sample from the plant before modification.

[0039] The germ cells are egg cells or sperm cells, and egg cells are particularly preferred. In a preferred embodiment of the present invention, the improvement in expression and / or function of the H2A.W gene is germ cell-specific. Germ cell-specific means that the improvement does not occur in cells other than germ cells (e.g., leaf cells, root cells).

[0040] Specifically, when introducing the H2A.W gene, a transfectant containing a polynucleotide containing an expression cassette for the H2A.W gene is introduced into plant cells. The expression cassette is not particularly limited, as long as the H2A.W gene is incorporated in an expressible state. Typically, the expression cassette contains a polynucleotide containing a promoter sequence and a gene coding sequence (and, if necessary, a transcription termination signal sequence). The expression cassette can also be in the form of a vector.

[0041] The promoter is not particularly limited, and examples thereof include the RPS5A promoter, the UBQ promoter, the CaMV35S promoter, the NOS promoter, etc. Furthermore, promoters of genes that are expressed in a tissue-specific (preferably germ cell-specific, such as oocyte) and / or stage-specific manner can also be used.

[0042] When modifying a gene, a specific example is a method of introducing an introducer containing at least one selected from the group consisting of a target-specific nuclease, an expression cassette for the nuclease, and mRNA for the nuclease into plant cells.

[0043] Examples of gene mutations resulting from such modifications include mutations in protein coding regions, mutations in splicing regulatory regions, and mutations in expression control regions (e.g., promoters, activators, enhancers, repressor binding elements, etc.). More specifically, H2A.W gene expression can be improved by, for example, incorporating into the promoter the nucleotide sequence of a region that improves the expression of an activator, enhancer, etc., or by modifying it to strengthen binding with a binding factor, or by modifying the nucleotide sequence of a region that suppresses the expression of a repressor, etc., to weaken binding with a binding factor. These regions can be easily identified based on known databases of transcription factor binding sequences.

[0044] The target-specific nuclease is not particularly limited as long as it is a nuclease that can specifically cleave a specific site on genomic DNA to induce a mutation. Examples of target-specific nucleases include Cas proteins, TALEN proteins, and ZFN proteins.

[0045] The target of introduction is not particularly limited, and may be undifferentiated plant tissue (e.g., callus), a part of a seed (e.g., hypocotyl, shoot apex, etc.), or a part of an adult plant (e.g., shoot apex, etc.).

[0046] The introduction method is not particularly limited as long as it allows the introduced substance to reach the plant cells, and can be appropriately selected depending on the type of substance to be introduced and the target of introduction. Examples of introduction methods include the floral dip method, floral spray method, Agrobacterium method, particle gun method, infiltration method, toothpick inoculation method, suction injection method, leaf disc method, inflorescence infiltration method, vacuum filtration method, virus-mediated nucleic acid delivery, etc. Among these, the Agrobacterium method is preferred from the viewpoints of simplicity, safety, etc.

[0047] A more specific example of how to implement it is shown below.

[0048] A first specific example of the introduction method (Introduction Example 1) includes the steps of: preparing a plasmid containing a promoter (e.g., T7 promoter, T3 promoter, 35S promoter, etc.) and a sequence containing an expression cassette downstream of the promoter (step a1); obtaining plant virus genomic RNA from the plasmid obtained in step a1 by in vitro transcription (step b1); and inoculating a plant with the genomic RNA (active ingredient) obtained in step b1 (e.g., friction inoculation, particle gun inoculation, etc.) (step c1). Alternatively, if the plasmid obtained in step a1 is a Ti plasmid containing a promoter capable of activating transcription in plant cells, such as the 35S promoter, instead of steps b1 and c1, the introduction can be carried out by a method including, for example, introducing the plasmid obtained in step a1 into Agrobacterium and culturing it (step b2), and inoculating a plant with the culture solution obtained in step b2 (containing the active ingredient) (e.g., infiltration, toothpick inoculation, suction injection, etc.) (step c2). Alternatively, instead of steps b1 and c1 above, a method including a step (step c3) of inoculating a plant with the plasmid (active ingredient) obtained in step a1 (for example, grinding inoculation, particle gun inoculation, etc.) can be used. Alternatively, instead of step c2 above, a method including a step (step c4) of performing, for example, the leaf disc method, inflorescence infiltration method, vacuum filtration, etc. can be used. The desired protein, peptide, or nucleic acid is produced from the genomic RNA, plasmid, T-DNA, etc. introduced into the plant by these methods.

[0049] A second specific example of the introduction method (Introduction Example 2) includes a step (step d1) of collecting a plant virus from a plant containing the virus (e.g., obtained by the above-mentioned Introduction Example 1), and a step (step e1) of inoculating a plant with the virus (a virus containing an active ingredient) collected in step d1. The collection in step d1 can be carried out, for example, by grinding a part of the plant containing the plant virus (e.g., a leaf) and recovering the virus solution. The inoculation in step e1 can be carried out, for example, by using an abrasive such as silicon carbide to make a wound in the part of the plant to be inoculated (e.g., a leaf) and contacting the wound with the virus.

[0050] After the introduction, the modified plant of the present invention can be obtained by growing the resulting plant or plant cells, or by growing the resulting plant through callus. Furthermore, after the introduction, the introduced cells, tissues, etc. can be selected with a drug, if necessary.

[0051] The above-mentioned introduced products can be used as reagents for producing the modified plants of the present invention.

[0052] The production reagent of the present invention may consist solely of the above-described introduced substance (essential component), or may contain various other components in addition to the essential component, depending on the type of essential component contained, the dosage form described below, the mode of use, etc. The content of the essential components (dry weight) in the production reagent of the present invention can be determined appropriately depending on the dosage form described below, the mode of use, etc., and can range, for example, from 0.0001 to 100% by mass. Examples of other components include bases, carriers, solvents, dispersants, emulsifiers, buffers, stabilizers, excipients, binders, disintegrants, lubricants, thickeners, humectants, colorants, fragrances, chelating agents, etc. The form of the production reagent of the present invention is not particularly limited and can be, for example, a dry form, a solution form, etc., or even a kit form. The kit may optionally contain other materials, reagents, tools, etc. necessary for plant production, such as a nucleic acid introduction reagent and buffer solution.

[0053] In one aspect, the present invention relates to seeds grown in the modified plants of the present invention. The seeds of the present invention can be obtained by the above-described method for producing modified plants of the present invention or by harvesting seeds from modified plants of the present invention.

[0054] Haploid induction is possible by fertilizing the germ cells of the modified plant of the present invention (i.e., germ cells in which the expression and / or function of the H2A.W gene is improved) with germ cells of another plant. From this perspective, in one aspect, the present invention relates to germ cells into which the H2A.W gene has been introduced or modified, and in which the expression and / or function of the H2A.W gene has been improved by said introduction or modification. From a similar perspective, in one aspect, the present invention relates to a method for producing a plant / a method for inducing haploids, which includes said steps. From a similar perspective, in one aspect, the present invention relates to a haploid obtained by said method, or a doubled haploid derived from said haploid, or seeds thereof (the haploid, seeds that grow into doubled haploids, seeds obtained from doubled haploids).

[0055] Fertilization can be carried out according to or in accordance with known methods. After fertilization, some chromosomes are lost during the division of the egg cell, resulting in an egg with a reduced number of chromosomes (preferably a haploid egg) compared to normal. After fertilization, cultivation can be continued as needed, seeds can be collected, and the seeds can be sown, and germinated plants from the seeds can be cultivated.

[0056] Other plants include, but are not limited to, plants transformed by genome editing, high-energy radiation, or the like. Using the technology of the present invention, it is possible to shed chromosomes derived from the modified plant of the present invention during the division process of a fertilized egg. By using the plant as another plant, it is possible to obtain a haploid having only the chromosomes of the plant. By subjecting the haploid to a chromosome doubling treatment such as colchicine treatment, a doubled haploid can be obtained in which the traits obtained by the transformation are fixed. By utilizing the technology of the present invention, doubled haploid breeding can be performed more easily and in a wider range of plant species.

[0057] The present invention will be described in detail below based on examples, but the present invention is not limited to these examples.

[0058] Test Example 1. Plasmid Preparation A plasmid (HTv1339: Figure 1) containing an H2A.W gene expression cassette in which the genomic sequence of the H2A.W gene (H2A.W.6 (HTA6, At5g59870)) was placed under the control of an egg-specific promoter was prepared, as was a plasmid (HTv1336: Figure 1) with the same configuration but excluding the expression cassette. HTv1339 expresses the Arabidopsis thaliana H2A.W.6 protein (amino acid sequence: SEQ ID NO: 1).

[0059] The H2A.W gene expression cassette is a cassette comprising the sequences (1) to (7) arranged in this order from upstream: (1) DD45 (EC1.2, At2g21740) promoter: (SEQ ID NO: 40);(2) Linker: actagt, (3) H2A.W.6 (HTA6, At5g59870) genomic sequence: (SEQ ID NO: 41, in which lowercase letters indicate introns), (4) Linker: ggatcctctggaggtggtggatctggaggtggtggagcc (SEQ ID NO: 42),(5) mScarlet-I coding sequence: (SEQ ID NO: 43), (6) linker: agcggccgcccggctgca (SEQ ID NO: 44),(7) Nos terminator: gatcgttcaaacatttggcaataaagtttcttaagattgaatcctgttgccggtcttgcgatgattatcatataatttctgttgaattacgttaagcatgtaataattaacatgtaatgcatgacgttatttatgagatgggtttttatgattagagtcccgcaattatacatttaatacgcgatagaaaacaaaatatagcgcgcaaactaggataaattatcgcgcgcggtgtcatctatgttactagatc (SEQ ID NO: 45).

[0060] The plasmids were constructed as follows: HTv1336 and HTv1339 plasmids were constructed by standard molecular cloning techniques, including restriction digestion of the backbone vector followed by Gibson assembly reaction using T4 DNA ligase (Nippon Gene, Japan) or Gibson Assembly Master Mix (New England Biolabs Japan, E2611). Both plasmids are pPZP211-based vectors (Hajdukiewicz, P., Svab, Z. & Maliga, P. The small, versatile pPZP family of Agrobacterium binary vectors for plant transformation. Plant Mol. Biol. 25, 989-994 (1994)). These vectors contain a red fluorescent seed selection cassette (At2S3p::mCherry, Kroj, T., Savino, G., Valon, C., Giraudat, J., and Parcy, F. (2003) Regulation of storage protein gene expression in Arabidopsis. Development, 130: 6065-6073). A green fluorescent marker for the centromere (pCENH3::mClover3-CENH3) and red fluorescent markers for the egg and zygote plasma membranes (pEC1::mRuby3-LTI6b and pWOX2::mRuby3-LTI6b) were sequentially inserted into a pPZP211-based vector to obtain the control vector (HTv1336). To ectopic express H2A.W.6 (HTA6, At5g59870) in egg cells, the genomic sequence of H2A.W.6 was ligated by PCR with the DD45 (At2g21740) promoter, mScarlet-I (a red fluorescent protein gene), and Nos terminator sequences, and then inserted into the HTv1336 vector to obtain HTv1339.

[0061] Test Example 2. Preparation of Transformants The plasmid obtained in Test Example 1 was introduced into A. thaliana Col-0 by the floral dip method using Agrobacterium tumefaciens GV3101. T1 transformants were selected for red seed fluorescence (derived from the At2S3p::mCherry cassette) and germinated on 1 / 2 MS medium containing 50 mg / L cefotaxime sodium under continuous light at 22°C. Seedlings were transplanted into soil and further grown under long-day conditions in a plant growth chamber at 22°C.

[0062] Test Example 3. Haploid Induction by Crossing. Pistils of HTv1339 or HTv1336 transgenic plants obtained in Test Example 2 were emasculated one day before pollination. Mature pistils were pollinated with pollen from the trichomeless gl1 mutant. Immediately after pollination, shoots containing pollinated pistils were grown with or without a film heater at 30°C for three days, after which they were grown normally at 22°C. After several weeks, seeds were harvested and sown on 1 / 2 MS agar medium. Germinated seedlings were observed under a stereomicroscope and screened for the gl1 (no trichomes on true leaves) phenotype (showing haploid) or the dwarf (small, irregularly shaped leaves) phenotype (showing aneuploid). The results are shown in Table 1. In Table 1, the "temp" column on the right indicates the temperature at which shoots containing pollinated pistils were kept for three days immediately after pollination.

[0063]

[0064] Test Example 4. Ploidy Analysis of Haploid-Induced Individuals by Crossing Crossing was performed as in Test Example 3. The HTv1339 transgenic plants (n = 2), which served as egg cell parents, the gl1 plant (n = 2), and the F1 plants (n = 13) derived from these parental lines were analyzed using a ploidy analyzer. Specifically, the samples were minced with a razor blade in nuclear extraction buffer (CyStain UV Precise P; Sysmex, Kobe, Japan), incubated at room temperature for 5 minutes, and then filtered through a 30 μm filter (ProFlow Cell Filter; Bio-Rad Laboratories Inc.). Nuclei were stained with a DAPI-containing buffer (CyStain UV Precise P; Sysmex). To determine ploidy, the fluorescence intensity of each nucleus was analyzed using a CyFlow Ploidy Analyser (Sysmex) according to the manufacturer's instructions. The number of nuclei in each window of fluorescence intensity was plotted as a histogram using Rstudio (http: / / www.rstudio.com / ). The results are shown in Figure 2.

[0065] Figure 3 shows the results of fluorescence observation of fertilized eggs 24 hours after pollination, when crossbreeding was performed as in Test Example 3, except that A. thaliana Col-0 pollen was used. The CENH3 signal was attenuated or absent in the area indicated by the arrowhead on the right side of the photograph, and instead, the H2A.W signal was clearly observed. H2A.W has been reported to promote chromatin condensation (Non-Patent Document 2). It has also been reported that CENH3 marks centromeres to maintain chromosomes, and that fertilization of germ cells with reduced CENH3 function results in the detachment of chromosomes from the germ cells, resulting in the induction of haploid cells (Non-Patent Document 1, etc.). Based on these prior findings and the results of Test Examples 3 and 4, it is believed that the promotion of chromatin condensation by H2A.W suppresses centromere marking by CENH3, thereby resulting in the induction of haploid cells after fertilization.

Claims

1. A modified plant body in which the H2A.W gene has been introduced or modified, and the expression and / or function of the H2A.W gene in germ cells has been improved as a result of the introduction or modification.

2. The modified plant body described in claim 1, wherein the protein encoded by the H2A.W gene is at least one selected from the group consisting of protein (a) and protein (b): (a) a protein consisting of an amino acid sequence set forth in any one of SEQ ID NOs: 1 to 39, and (b) a protein consisting of an amino acid sequence that is 90% or more identical to a protein consisting of an amino acid sequence set forth in any one of SEQ ID NOs: 1 to 39 and that has chromatin aggregation activity.

3. The modified plant body described in claim 1, wherein the protein encoded by the H2A.W gene is at least one selected from the group consisting of protein (a1) and protein (b1): (a1) a protein consisting of the amino acid sequence shown in SEQ ID NO: 1, and (b1) a protein consisting of an amino acid sequence having 90% or more identity to the protein consisting of the amino acid sequence shown in SEQ ID NO: 1 and having chromatin aggregation activity.

4. A modified plant body according to claim 1, in which the H2A.W gene has been introduced and the introduction has resulted in improved expression of the gene in reproductive cells.

5. The modified plant body according to claim 1, wherein the germ cell is an egg cell.

6. A modified plant body described in claim 1, wherein the improvement in expression and / or function of the H2A.W gene is germ cell-specific.

7. A seed that grows into a modified plant body according to any one of claims 1 to 6.

8. A germline cell into which the H2A.W gene has been introduced or modified, and in which the expression and / or function of the H2A.W gene has been improved by said introduction or modification.

9. A method for producing a plant, comprising fertilizing the germ cells of a modified plant according to any one of claims 1 to 6 with germ cells of another plant.

10. A method for inducing haploidy, comprising fertilizing the germ cells of a modified plant according to any one of claims 1 to 6 with germ cells of another plant.

11. A haploid or a doubled haploid derived from said haploid, or seeds of said doubled haploid, obtained by the method for inducing a haploid according to claim 10.

12. A seed obtained by fertilizing the germ cells of the modified plant according to any one of claims 1 to 6 with germ cells of another plant.

13. A reagent for producing a modified plant according to any one of claims 1 to 6, comprising a polynucleotide containing an expression cassette for the H2A.W gene.

Images