Conjugate comprising protein and nucleic acid moiety, and immunodetection method using said conjugate
A novel nucleic acid-protein conjugate with photocrosslinking by cnvK addresses reproducibility issues in immuno-PCR, providing high sensitivity and specificity through isothermal amplification, enabling rapid and device-free detection of target molecules.
Patent Information
- Application Number
- PCT/JP2025/028867
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-08-19
- Filing Date
- 2025-08-18
- Publication Date
- 2026-02-26
AI Technical Summary
Existing immuno-PCR methods face challenges in reproducibility and specificity due to conventional DNA-antibody conjugate formation methods, such as biotin-streptavidin binding and chemical crosslinking, which result in reduced efficiency and selectivity.
A novel conjugate is developed comprising a nucleic acid moiety with photocrosslinking by cnvK and a protein moiety, allowing for a 1:1 binding ratio and high specificity and sensitivity through isothermal amplification methods like LAMP, eliminating the need for thermal cycling devices.
The novel conjugate achieves high specificity and sensitivity in detecting target molecules with improved reproducibility and efficiency, enabling rapid and device-free detection within 15 minutes to 1 hour, with visual confirmation options.
Smart Images

Figure JP2025028867_26022026_PF_FP_ABST
Abstract
Description
Conjugate containing a protein and a nucleic acid moiety and immunodetection method using said conjugate
[0001] The present invention relates to a conjugate comprising a protein and a nucleic acid moiety, and an immunodetection method using the conjugate. More specifically, the present invention relates to a conjugate comprising a protein and a nucleic acid moiety, and an immunodetection method using the conjugate by an isothermal amplification method. The present invention also relates to a nucleic acid drug and a gene therapy drug containing the conjugate.
[0002] Highly sensitive detection methods for substances contained in samples are extremely important in various fields. For example, highly specific and sensitive detection methods are required for in vitro diagnosis by detecting biomarkers or pathogens contained in biological samples, detection of trace amounts of pathogens contaminating food, environmental hygiene inspections of harmful pathogens in hot springs and hot water supply facilities, and basic research.
[0003] For example, immuno-PCR, an immune detection method that combines the specificity of antigen-antibody reactions with the excellent sensitivity of PCR, is a method that can detect antigens with high sensitivity for substances that exist in low amounts by utilizing the principles of PCR (Non-Patent Document 1). In general immuno-PCR, when a target substance binds to a capture antibody immobilized on a plate, a secondary antibody (DNA-antibody conjugate) to which detection DNA is bound further binds to the captured target substance. By amplifying the detection DNA by PCR, the target substance can be detected with high specificity and high sensitivity.
[0004] Various methods have been developed for creating DNA-antibody conjugates (conjugates) used in immuno-PCR. For example, methods utilizing biotin-streptavidin (or avidin) binding, chemical crosslinking via covalent bonds, and phage display are known for linking DNA and antibodies. In methods utilizing biotin-streptavidin (or avidin) binding, a DNA-antibody conjugate can be created by reacting a streptavidin (or avidin)-conjugated antibody with biotin-conjugated DNA. In this case, streptavidin (or avidin) binds to a maximum of four biotin molecules, resulting in one antibody molecule binding one to four DNA molecules, resulting in somewhat reduced reproducibility. Furthermore, linking DNA using cysteine or lysine residues in the antibody lacks selectivity for the crosslinking site, resulting in a lack of reproducibility and specificity.
[0005] A new method of immuno-PCR is known that applies the cDNA display method, also known as cD-IPCR (cDNA display-mediated immuno-PCR). The cDNA display molecule contains nucleic acid consisting of a main chain containing cDNA and mRNA complementary to the cDNA, and a DNA side chain having a polypeptide binding site, as well as a polypeptide encoded by the cDNA. The cDNA display method allows for correlation between genotype and phenotype, and allows for the acquisition of target proteins in vitro, and is widely used in 10 13 ~10 14 It is possible to screen 10 types of molecules at once (Non-Patent Document 2). In immuno-PCR using the cDNA display method, for example, when a target substance binds to a capture antibody immobilized on a plate, the cDNA display molecule further binds to the captured target substance via a polypeptide (e.g., a VHH antibody). The nucleic acid in the cDNA display molecule is amplified by PCR, allowing the target substance to be detected with higher specificity and sensitivity (Patent Document 1 and Non-Patent Document 3).
[0006] It has also been confirmed that a conjugate of VHH and double-stranded DNA can be prepared by performing PCR using a VHH linked to a forward primer via maleimide instead of a conventional PCR forward primer (Non-Patent Document 4).
[0007] Gene amplification is a method for selectively amplifying and detecting specific genes from a complex, trace amount of genes with high sensitivity and specificity. Polymerase Chain Reaction (PCR) is a representative gene amplification method that is widely used, but it requires a device (thermal cycler) to achieve specific temperature cycles for repeated thermal denaturation, annealing, and extension reactions. Meanwhile, Loop-Mediated Isothermal Amplification (LAMP) allows simple isothermal amplification using a strand-displacing polymerase and four types of primers containing six regions (Patent Document 2 and Non-Patent Document 5).
[0008] JP 2022-522337 A International Publication No. 2000 / 28082
[0009] T. Sano, et al., Science, 258 (1992) 120-122Nucleic Acid Research, 2000, Vol. 28, No. 12, Page e63
[0010] The present inventors have completed the present invention by creating a novel conjugate comprising a nucleic acid moiety containing photocrosslinking by cnvK in two nucleic acids having complementary sequences, and a protein moiety that binds to the nucleic acid moiety. Because this conjugate can contain any protein and any nucleic acid, it can be applied in a wide range of fields, including medicines, diagnostic agents, and detection reagents.
[0011] The present invention relates to the following items [1] to
[15] : [1] A conjugate for detecting a target molecule, comprising a protein and a nucleic acid portion, wherein the nucleic acid portion comprises: a first nucleic acid bound to the protein; and a second nucleic acid comprising a sequence complementary to the first nucleic acid, wherein the first nucleic acid and the second nucleic acid form a complementarily bound double-stranded portion, the second nucleic acid comprises an overhanging single-stranded portion, and the double-stranded portion comprises photocrosslinking by cnvK, which crosslinks the first nucleic acid and the second nucleic acid.
[0012] [2] The conjugate according to item [1], wherein the protein is bound to the first nucleic acid via a maleimide.
[0013] [3] The conjugate according to item [1], wherein the protein is bound to the first nucleic acid via puromycin and a third nucleic acid, and the third nucleic acid is crosslinked to the first nucleic acid.
[0014] [4] The conjugate according to any one of items [1] to [3], wherein the protein is a VHH.
[0015] [5] The conjugate according to any one of items [1] to [4], wherein the overhanging single-stranded portion in the second nucleic acid is contained on the 5' side of the second nucleic acid.
[0016] [6] A nucleic acid drug comprising the conjugate according to any one of items [1] to [5].
[0017] [7] A gene therapy drug comprising the conjugate according to any one of items [1] to [5].
[0018] [8] A method for detecting a target molecule, comprising: a step of contacting a target molecule contained in a sample solution with a detection compound to bind the target molecule to the detection compound; and a step of isothermally amplifying the second nucleic acid, wherein the detection compound is a conjugate comprising a protein that binds to the target molecule and a nucleic acid portion, the nucleic acid portion comprising a first nucleic acid bound to the protein and a second nucleic acid comprising a sequence complementary to the first nucleic acid, the first nucleic acid and the second nucleic acid forming a complementarily bound double-stranded portion, the second nucleic acid comprising an overhanging single-stranded portion, and the double-stranded portion comprising photocrosslinking by cnvK that crosslinks the first nucleic acid and the second nucleic acid.
[0019] [9] The detection method according to item [8], wherein the protein is bound to the first nucleic acid via a maleimide.
[0020]
[10] The detection method according to item [8], wherein the protein is bound to the first nucleic acid via puromycin and a third nucleic acid, and the third nucleic acid is crosslinked to the first nucleic acid.
[0021]
[11] The detection method according to any one of items [8] to
[10] , wherein the protein is a VHH.
[0022]
[12] The detection method according to any one of items [8] to
[11] , wherein the step of binding the target molecule to the detection compound is carried out by contacting the sample solution with a binding molecule that binds to the target molecule and is immobilized on a solid phase, thereby binding the target molecule in the sample solution to the binding molecule, and then contacting the target molecule bound to the binding molecule with the detection compound.
[0023]
[13] The detection method according to item
[12] , wherein the binding molecule is an antibody.
[0024]
[14] The detection method according to any one of items [8] to
[13] , wherein the isothermal amplification is a LAMP method.
[0025]
[15] The detection method according to any one of items [8] to
[14] , wherein the overhanging single-stranded portion in the second nucleic acid is contained on the 5' side of the second nucleic acid.
[0026] FIG. 1 is a schematic diagram showing one embodiment of the conjugate of the present invention. FIG. 1 is a schematic diagram showing one embodiment of the conjugate of the present invention. FIG. 2 is a schematic diagram showing an embodiment in which VHH is used as the protein contained in the conjugate. FIG. 3 is a schematic diagram showing an example of the synthesis of the conjugate of the present invention. FIG. 4 is a photograph showing the results of electrophoresis in Example 1. FIG. 5 is a schematic diagram showing the process of synthesizing ssDNA for linking in Example 2. FIG. 6 is a photograph showing the results of electrophoresis of intermediate products and ssDNA in Example 2. FIG. 7 is a photograph showing the results of LAMP using dsDNA and ssDNA as templates in Example 2. FIG. 8 is a schematic diagram showing the special nucleic acid for linking synthesized in Example 3. FIG. 9 is a photograph showing the results of electrophoresis in Example 10. FIG. 11 is a photograph showing the results of electrophoresis of 279-base ssDNA and the product of linking the special nucleic acid and ssDNA, performed in Example 10. 1 is a schematic diagram showing the case where a special nucleic acid is bound to the 5' end of ssDNA (top) and the case where a special nucleic acid is bound to the 5' end of ssDNA (bottom). A photograph showing the results of electrophoresis of the amplification product of a conjugate of a special nucleic acid and the 5' end or 3' end of ssDNA. A schematic diagram showing amplification by the LAMP method when a conjugate of a special nucleic acid and the 5' end or 3' end of ssDNA is used. A photograph showing the results of electrophoresis of the conjugate of a special nucleic acid and mRNA, and mRNA, performed in Example 11. A photograph showing the results of electrophoresis of the conjugate of a special nucleic acid and mRNA, a BDA-mRNA complex synthesized by a cell-free translation system, and a BDA-ssDNA conjugate, performed in Example 11. A photograph showing the results of electrophoresis of a BDA-ssDNA conjugate and ssDNA, performed in Example 12.
[0027] The conjugate of the present invention is a conjugate comprising a protein and a nucleic acid portion. The protein and nucleic acid portion are bound in a 1:1 ratio. The nucleic acid portion comprises a first nucleic acid bound to the protein and a second nucleic acid comprising a sequence complementary to the first nucleic acid. The first nucleic acid and the second nucleic acid comprise sequences complementary to each other and form a double-stranded portion complementarily bound thereto. The second nucleic acid comprises an overhanging single-stranded portion that is not complementary to the first nucleic acid. The double-stranded portion comprises photocrosslinking by cnvK, which crosslinks the first nucleic acid and the second nucleic acid.
[0028] The protein contained in the conjugate can be appropriately selected by those skilled in the art depending on the intended use. Examples of proteins include, but are not limited to, antigens, toxins, receptors, ligands, antibodies, VHHs, antibody mimetics, affibodies, glycoproteins, growth factors, transmembrane proteins, therapeutic drugs, etc. As an example, by incorporating a protein that can be used as a pharmaceutical into the conjugate, a pharmaceutical containing the conjugate can be produced. In this case, the conjugate can also be used as a nucleic acid drug or gene therapy drug containing the conjugate together with a pharmacologically acceptable excipient.
[0029] The protein may be produced by a cell-free translation system and then bound to the first nucleic acid. Alternatively, the cDNA display molecule described below may be modified to use a protein produced during the synthesis of the cDNA display molecule.
[0030] The nucleic acid portion includes a first nucleic acid bound to a protein and a second nucleic acid having a sequence complementary to the first nucleic acid. The first nucleic acid and the second nucleic acid complementarily bind to form a double-stranded portion, and the second nucleic acid includes an overhanging single-stranded portion. The overhanging single-stranded portion may be located on the 3' side of the second nucleic acid (FIGS. 1A and 2B) or on the 5' side of the second nucleic acid (FIGS. 1B and 2A). Furthermore, the overhanging single-stranded portion may be located on both the 3' side and the 5' side of the second nucleic acid (FIGS. 1C and 2C). However, it is preferable that the overhanging single-stranded portion be located on the 5' side of the second nucleic acid in terms of amplification efficiency.
[0031] The double-stranded portion where the first nucleic acid and the second nucleic acid are complementarily bound is crosslinked by photocrosslinking with cnvK (3-cyanovinylcarbazole). cnvK crosslinks 100% of pyrimidine bases upon UV irradiation at 366 nm, and the crosslinks are reversibly released upon UV irradiation at 312 nm. At least one cnvK crosslink may be present in the double-stranded portion.
[0032] The nucleic acid portion may be composed of DNA, RNA, or both DNA and RNA. For example, the first and second nucleic acids may be composed of DNA, the first and second nucleic acids may be composed of RNA, the first nucleic acid may be composed of DNA and the second nucleic acid may be composed of RNA, or the first nucleic acid may be composed of RNA and the second nucleic acid may be composed of DNA. Furthermore, a DNA / RNA hybrid may be contained in either the first or second nucleic acid, or in both the first and second nucleic acids. Furthermore, the first and second nucleic acids may contain artificial nucleic acids such as TNA (threose nucleic acid) or PNA (peptide nucleic acid), or modified bases.
[0033] The protein contained in the conjugate is bound to a first nucleic acid and can bind to the first nucleic acid via a maleimide. See Figure 1. For details on binding between a protein and a nucleic acid via a maleimide, see, for example, J. Biochem. 2020;168(1):63-72.
[0034] Alternatively, a cDNA display molecule can be modified to form a conjugate. In this case, the first nucleic acid and the second nucleic acid correspond to the backbone of the cDNA display molecule, and the first nucleic acid is bound to the protein contained in the conjugate via a third nucleic acid corresponding to the side chain and puromycin. See Figure 2. An example of a method for preparing this conjugate is as follows. For example, in the cDNA display molecule described in Journal of Biotechnology 212 (2015) 174-180, the cnvK crosslink is released by irradiating with UV at 312 nm, and the mRNA is degraded by RNase H (Figure 4A). As a result, a first nucleic acid is obtained in which the protein is bound via puromycin and the third nucleic acid (Figure 4B). Subsequently, a single-stranded nucleic acid corresponding to the second nucleic acid, which contains a sequence complementary to the first nucleic acid, is hybridized, and the cnvK is crosslinked by irradiating with UV at 366 nm (Figure 4C).
[0035] A cDNA display molecule is a molecule containing a protein and a cDNA encoding the protein, but the conjugate of the present invention is prepared by dissociating the crosslinked cnvK from the cDNA display molecule, then complementarily binding any single-stranded nucleic acid (corresponding to the second nucleic acid) to the first nucleic acid, and then crosslinking cnvK. Therefore, the conjugate of the present invention can contain a nucleic acid sequence containing any sequence.
[0036] As described above, in the conjugate of the present invention, the second nucleic acid may contain any sequence as long as it has a sequence complementary to the first nucleic acid. Therefore, a desired sequence can be contained in the conjugate of the present invention. For example, a conjugate useful for treatment, diagnosis, detection, or the like can be produced by using a second nucleic acid having a desired sequence. Examples of pharmaceuticals containing the conjugate of the present invention include nucleic acid pharmaceuticals and gene therapeutic drugs.
[0037] A nucleic acid drug is a pharmaceutical comprising a nucleotide, nucleoside, oligonucleotide, or polynucleotide, which acts directly on the body to achieve a desired therapeutic effect without being translated into a protein. The nucleic acid drug of the present invention is a nucleic acid drug comprising the conjugate described above.
[0038] Typical examples of nucleic acid drugs include DNA, nDNA, mtDNA, gDNA, antisense DNA, RNA, siRNA, shRNA, miRNA, mRNA, piRNA, antisense RNA, snRNA, snoRNA, vRNA, dsRNA, ribozymes, aptamers, and decoy nucleic acids. The nucleic acid drug of the present invention may contain not only natural bases, but also artificial bases and modified bases. The nucleic acid drug of the present invention may be on the surface of a liposome or encapsulated in a liposome.
[0039] Gene therapy refers to the administration of a gene or cells into which a gene has been introduced into the human body for the purpose of treating a disease, and refers to gene labeling. Gene labeling refers to the administration of a marker gene or cells into which a marker gene has been introduced into the human body for the purpose of developing a treatment for a disease. A gene therapy drug refers to a pharmaceutical used for gene therapy. The gene therapy drug of the present invention is a gene therapy drug containing the conjugate described above.
[0040] In the present invention, gene therapy may be in vivo gene therapy, in which a therapeutic gene is directly administered to a living body, or ex vivo gene therapy, in which specific cells are removed from a patient's body, gene-transduced therapeutic cells are prepared, and the cells are then returned to the body. The gene therapy drug of the present invention may be on the surface of a liposome or encapsulated in a liposome.
[0041] The method for detecting a target molecule of the present invention includes the steps of contacting the target molecule with a detection compound to bind the target molecule to the detection compound, and isothermal amplifying the nucleic acid contained in the target molecule.
[0042] The detection compound is a conjugate comprising a protein that binds to a target molecule and a nucleic acid portion. The nucleic acid portion comprises a first nucleic acid that binds to the protein and a second nucleic acid that comprises a sequence complementary to the first nucleic acid. The first nucleic acid and the second nucleic acid form a complementary double-stranded portion, and the second nucleic acid comprises an overhanging single-stranded portion that does not form a double strand. The double-stranded portion comprises a photocrosslink by cnvK that crosslinks the first nucleic acid and the second nucleic acid.
[0043] The step of binding the target molecule to the detection compound is not particularly limited, and can be carried out by contacting the target molecule contained in a sample solution with the detection compound. In one embodiment, the sample solution can be contacted with a binding molecule that binds to the target molecule and is immobilized on a solid phase, allowing the target molecule in the sample solution to bind to the binding molecule, and then the target molecule bound to the binding molecule can be contacted with the detection compound. Here, examples of the binding molecule that binds to the target molecule include polypeptides, proteins, such as aptamers, and antibodies, particularly VHH antibodies.
[0044] The target molecule is not particularly limited, and may be a protein, polypeptide, or peptide, such as an antigen, toxin, receptor, ligand, antibody, antibody mimetic, affibody, glycoprotein, or growth factor, or may be a nucleic acid, carbohydrate, lipid, polysaccharide, hormone, virus, pathogen, drug, pigment, cell, or tissue, or any fragment of the above.
[0045] The detection compound is a conjugate comprising a protein that binds to a target molecule and a nucleic acid portion. The protein that binds to the target molecule can be any protein that binds to the target molecule of interest, including, for example, a peptide aptamer, an affibody, an antibody, particularly a VHH antibody. The protein that binds to the target molecule can be produced by a cell-free translation system and then bound to the first nucleic acid. Alternatively, as described above, a cDNA display molecule can be modified to use a protein produced during the synthesis of the cDNA display molecule.
[0046] The nucleic acid portion includes a first nucleic acid bound to a protein capable of binding to a target molecule and a second nucleic acid having a sequence complementary to the first nucleic acid. The first and second nucleic acids complementarily to form a double-stranded portion, and the second nucleic acid includes an overhanging single-stranded portion. The overhanging single-stranded portion may be located on the 3' side of the second nucleic acid (FIGS. 1A and 2B) or on the 5' side of the second nucleic acid (FIGS. 1B and 2A). Furthermore, the overhanging single-stranded portion may be located on both the 3' and 5' sides of the second nucleic acid (FIGS. 1C and 2C). However, from the viewpoint of amplification efficiency, it is preferable that the overhanging single-stranded portion be located on the 5' side of the second nucleic acid.
[0047] The double-stranded portion where the first nucleic acid and the second nucleic acid are complementarily bound is crosslinked by photocrosslinking using cnvK. CnvK crosslinks 100% of pyrimidine bases upon UV irradiation at 366 nm, and the crosslinks are reversibly released upon UV irradiation at 312 nm. At least one cnvK crosslink may be present in the double-stranded portion.
[0048] The nucleic acid portion may be composed of DNA, RNA, or both DNA and RNA. For example, the first and second nucleic acids may be composed of DNA, the first and second nucleic acids may be composed of RNA, the first nucleic acid may be composed of DNA and the second nucleic acid may be composed of RNA, or the first nucleic acid may be composed of RNA and the second nucleic acid may be composed of DNA. Furthermore, a DNA / RNA hybrid may be contained in either the first or second nucleic acid, or in both the first and second nucleic acids. Furthermore, the first and second nucleic acids may include artificial nucleic acids such as TNAs and PNAs.
[0049] The protein contained in the detection compound is bound to a first nucleic acid and can bind to the first nucleic acid via a maleimide. See Figure 1. For details on binding of a protein to a nucleic acid via a maleimide, see, for example, J. Biochem. 2020;168(1):63-72.
[0050] Alternatively, a cDNA display molecule can be modified to form a detection compound. In this case, the first nucleic acid and the second nucleic acid correspond to the backbone of the cDNA display molecule, and the first nucleic acid is bound to a protein contained in the detection compound via a third nucleic acid corresponding to a side chain and puromycin. See Figure 2. An example of a method for producing this detection compound is described above.
[0051] The conjugate contained in the detection compound can optionally be fluorescently labeled, preferably with absorption and emission wavelengths different from the 366 nm and 312 nm wavelengths used for cross-linking and cleavage of cnvK.
[0052] Examples of isothermal amplification that can be used include, but are not limited to, LAMP (Loop-Mediated Amplification), RPA (Recombinase Polymerase Amplification), HDA (Helicase-Dependent Amplification), NASBA (Nucleic Acid Sequence Based Amplification), WGA (Whole Genome Amplification), SDA (Strand Displacement Amplification), RCA (Rolling Circle Amplification), and ICAN (Isothermal and Chimeric Primer-Initiated Amplification of Nucleic Acids). PCR can also be used instead of isothermal amplification.
[0053] According to the method of the present invention, detection can be performed by an isothermal amplification reaction, eliminating the need for a device such as a cycler. Furthermore, for example, when the LAMP method is used, a greater variety of primers are used compared to the PCR method, resulting in high specificity and high amplification efficiency, and detection in a short period of time (approximately 15 minutes to 1 hour). Furthermore, when the LAMP method is used, simple detection is possible, such as visual detection of fluorescence or visual detection of turbidity due to magnesium pyrophosphate, which is produced as a by-product in proportion to the amplification product. Furthermore, quantification of turbidity in real time and quantification by electrophoresis on an agarose gel, etc., are also possible. Another advantage is that it is less susceptible to inhibitory substances than PCR.
[0054] The present invention will be described below based on examples. However, the following examples are for the purpose of illustrating the present invention and are not intended to limit the present invention.
[0055] [Examples 1 to 7] <Materials and Methods> The reagents used in Examples 1 to 7 are as follows.
[0056]
[0057] The methods and sequences used in Examples 1 to 7 are as follows. <DNA sequence (LAMP method)> For the LAMP method, sequences and primers were selected that had been proven to amplify in a previous paper (I. Gunimaladevi, et al., J. Fish. Dis., 2004, 10, 583-589). LAMP template DNA and LAMP primers were purchased from Eurofins Genomics.・LAMP method template DNA (236 bp): SEQ ID NO: 1 5'- TTATGCAGCAGCCCTTCAAGCAGGTGACGGCGTTGGTGCCCATGGCGGACAAGCTGGAC AAGCTGACGGCGGTGTGCATGAAGTGCAAGATGCGCGACGCACCCTTCACCGTCAGAAT CTCTCAGGGCACGGACCTGGTCCAGGTTGGAGGCGCCGAGTCTTACCAGGCGGTGTGTC GTCCCTGTCTCACGGGGTTCAGGATGGCCCAGTACGAGCTGTACGGTCCGCCGCCTCCT -3'
[0058] LAMP primer (FIP: Forward Inner Primer) (41 bases): SEQ ID NO: 2 5'-CTGACGGTGAAGGGTGCGTTTTTGCGGACAAGCTGGACAAG-3'
[0059] LAMP primer (BIP: Backward Inner Primer) (42 bases): SEQ ID NO: 3 5'- CACGGACCTGGTCCAGGTTGTTTTCCTGAACCCCGTGAGACA -3'
[0060] LAMP primer (F3 Primer) (18 bases): SEQ ID NO: 4 5'-GCCCTTCAAGCAGGTGAC-3'
[0061] LAMP primer (B3 Primer) (19 bases): SEQ ID NO: 5 5'-GGACCGTACAGCTCGTACT-3'
[0062] <DNA Sequence (ssDNA Synthesis)> The following primers were purchased from Eurofins Genomics.
[0063] Linker + template DNA (35 bases): SEQ ID NO: 6 5'-AATTTCCACGCCGCCCCCCG-AGGAGGCGGCGGACC -3' T7 Promoter + Linker (35 bases): SEQ ID NO: 7 5'-TAATACCGACTCACTATAGGG-AATTTCCACGCCGCC -3'
[0064] <DNA sequence (special nucleic acid for linking)>
[0065] Example 1: Amplification of template DNA by LAMP. LAMP was performed in a 25.0 μL reaction volume containing 1.6 μM FIP (SEQ ID NO: 1) and BIP (SEQ ID NO: 2), 0.4 μM F3 Primer (SEQ ID NO: 3) and B3 Primer (SEQ ID NO: 4), 400 μM dNTPs, 1.6 M betaine, 6% DMSO, 10x Bst Reaction Buffer, and 1 nM template DNA (SEQ ID NO: 1). The reaction solution was incubated at 95°C for 5 minutes and then cooled on ice. 8 U of Bst DNA polymerase (8 U / μL) was then added. The mixture was then incubated at 65°C for 45 minutes, followed by a 2-minute incubation at 95°C to terminate the LAMP reaction. The amplification results were analyzed by 2% agarose gel electrophoresis (0.5x TBE) at 100 V for 30 minutes, followed by staining of the nucleic acids with Gel Green. The electrophoresis results are shown in Figure 5. Ladder-like bands were visible in the sample (+) containing the LAMP template DNA, confirming that the LAMP method was progressing specifically for the template.
[0066] Example 2: Synthesis and Evaluation of ssDNA for Ligation <1st PCR> 1st PCR was performed using LAMP template DNA (SEQ ID NO: 1) as a template to add a region that hybridizes with the linker. See Figures 6A and 6B. 1st PCR was performed in a 25.0 μL reaction volume containing 1.0 μM Linker+ template DNA (SEQ ID NO: 6) and F3 Primer (SEQ ID NO: 3) as primers, 200 μM dNTP, 5x PrimeSTAR Buffer, 0.625 U of PrimeSTAR HS DNA Polymerase (2.5 U / μL), and 100 pM template DNA (SEQ ID NO: 1). The PCR temperature cycle was as shown in Table 2, and 25 cycles were performed for the second and third steps. The 1st PCR product was purified using a QIA quick PCR purification kit, and the concentration was determined by measuring the absorbance at 260 nm using a nanodrop 1000 spectrophotometer.
[0067]
[0068] <Second PCR> For the second PCR, a T7 promoter sequence was added using the first PCR product as a template. See Figures 6B and 6C. Second PCR was performed in a 25.0 μL reaction volume containing 1.0 μM T7 Promoter + Linker (SEQ ID NO: 7) and F3 Primer (SEQ ID NO: 3) as primers, 200 μM dNTPs, 5x PrimeSTAR Buffer, 0.625 U of PrimeSTAR HS DNA Polymerase (2.5 U / μL), and 10 pM of the first PCR product. The PCR temperature cycle was as shown in Table 3, and 25 cycles were performed for the second and fourth steps. The 1st PCR product was purified using a QIA quick PCR purification kit, and the concentration was determined by measuring the absorbance at 260 nm using a nanodrop 1000 spectrophotometer.
[0069]
[0070] <Transcription> Transcription products were obtained using the second PCR product as a template. See Figures 6C and 6D. Transcription reactions were performed in a 10.0 μL reaction volume containing 150 ng of the second PCR product, RiboMax Express T7 2x Buffer, and 1.0 μL of Enzyme Mix T7 Express. The reaction solution was incubated at 37°C for 15 minutes, after which 1.0 μL of RQ1 RNase-free DNase was added and incubated at 37°C for 15 minutes. The transcription products were purified using RNA Clean XP, and the concentration was determined by measuring the absorbance at 260 nm using a nanodrop 1000 spectrophotometer.
[0071] <Reverse transcription> Reverse transcription was performed on the transcript to obtain a double-stranded construct consisting of the transcript and its complementary cDNA strand. See Figures 6D and 6E. Reverse transcription was performed in a 20.0 μL reaction volume containing 2.0 μg of transcript, 2.5 μM F3 Primer (SEQ ID NO: 3) as the reverse transcription primer, 1.0 mM dNTPs, and 5x ReverTra Buffer. To allow annealing of the transcript and primer, the reaction solution was incubated at 80°C for 60 seconds and then cooled to 42°C at a rate of 0.1°C / s. 100 U of ReverTra Ace (100 U / μL) was added to this solution, and the mixture was incubated at 42°C for 20 minutes. The reverse transcription reaction was then stopped by incubating at 99°C for 5 minutes.
[0072] RNase H Treatment: ssDNA was obtained from the double-stranded transcript and its complementary cDNA strand. See Figures 6E and 6F. RNase H treatment was performed in a 25.0 μL reaction volume containing the total reverse transcription product (20 μL), 10x NE Buffer 2.1, and 1 U of RNase H (5 U / μL). The reaction solution was incubated at 37°C for 20 minutes and then purified using a QIA Quick PCR purification kit. The concentration of the purified ssDNA solution was determined by measuring the absorbance at 260 nm using a nanodrop 1000 spectrophotometer.
[0073] The results of the ssDNA synthesis described above are shown in Figure 7. 4% polyacrylamide gel electrophoresis was performed at 200 V for 30 minutes, and the nucleic acids were stained with SYBR Gold to confirm the synthesis results. See Figure 7. As a result of the electrophoresis, a band was visible around 250 bp in each sample, confirming that the target ssDNA had been synthesized.
[0074] The LAMP method was performed under the same conditions as in Example 1. The LAMP method was performed in a 25.0 μL reaction volume containing 1.6 μM FIP (SEQ ID NO: 1) and BIP (SEQ ID NO: 2), 0.4 μM F3 Primer (SEQ ID NO: 3) and B3 Primer (SEQ ID NO: 4), 400 μM dNTP, 1.6 M betaine, 6% DMSO, 10× Bst Reaction Buffer, and 1 nM ssDNA. The reaction solution was incubated at 95°C for 5 minutes, cooled on ice, and then 8 U of Bst DNA polymerase (8 U / μL) was added. The mixture was then incubated at 65°C for 45 minutes, followed by incubation at 95°C for 2 minutes to terminate the LAMP reaction. After electrophoresis on a 2% agarose gel (0.5× TBE), the nucleic acids were stained with Gel Green to confirm the amplification results. The electrophoresis results are shown in Figure 8. It was shown that the amplification efficiency was higher when ssDNA was used as a template than when LAMP template DNA was used.
[0075] [Example 3] Synthesis of special linking nucleic acids Modified oligonucleotides (special linking nucleic acids) shown in SEQ ID NOs: 8 and 9, modified at the 5'-end with cyanine 5 for fluorescent imaging and at the 3'-end with puromycin for binding to peptides, were chemically synthesized by Hokkaido System Science Co., Ltd. The structure of the chemically synthesized special nucleic acids is shown in Figure 9.
[0076] Example 4: Synthesis of VHH by cell-free translation system. DNA encoding the amino acid sequence of a VHH that binds to human IgG was transcribed using a T7 RiboMAX Express Large Scale RNA Production System. The transcript was purified using RNA Clean XP. The purified RNA and specific linking nucleic acids (SEQ ID NOs: 8 and 9) were annealed in a solution containing 20 pmol each of 200 mM NaCl and 50 mM Tris-HCl (pH 7.4) by gradually lowering the temperature from 90°C to 25°C. Subsequently, photocrosslinking was performed by irradiating with 366 nm UV light for 2 minutes. The results were electrophoresed on a 4% polyacrylamide gel, confirming a crosslinking efficiency of over 90%. The RNA-specific nucleic acid complex was translated to synthesize protein using PUREfrex (enzymatic cell-free protein synthesis kit) by incubating at 37°C for 15 minutes, followed by the addition of 18.0 μL of 0.5 M EDTA and incubation at 37°C for 10 minutes.
[0077] [Example 5] Linkage of VHH and ssDNA First, the VHH synthesized in Example 4 was cleaved from mRNA. The mRNA hybridized with the linker was degraded by RNase H treatment. RNase H treatment was performed using a reaction solution containing the total amount of translation product, 10xNE Buffer 2.1, and 1 U of RNase H (5 U / μL). Next, crosslink cleavage was performed by irradiation with 312 nm UV light for 3 minutes. Annealing was performed by gradually lowering the temperature from 90°C to 25°C in a solution containing the translation product, an equal amount of ssDNA to the translation product, 200 mM NaCl, and 50 mM Tris-HCl (pH 7.4). Thereafter, photocrosslinking was again performed by irradiation with 366 nm UV light for 2 minutes. The results were electrophoresed by SDS-PAGE to confirm the synthesis of a VHH-ssDNA complex. The concentration of the complex was roughly calculated from the band intensity ratio of the VHH synthesized in Example 4 and the VHH-ssDNA complex.
[0078] Example 6: Isothermal Amplification of VHH-ssDNA Conjugates by LAMP The LAMP method was performed under the same conditions as in Example 1. The LAMP reaction was carried out in a 25.0 μL reaction volume containing 1.6 μM FIP (SEQ ID NO: 1) and BIP (SEQ ID NO: 2), 0.4 μM F3 Primer (SEQ ID NO: 3) and B3 Primer (SEQ ID NO: 4), 400 μM dNTP, 1.6 M betaine, 6% DMSO, 10× Bst Reaction Buffer, and 1 nM VHH-ssDNA. The reaction solution was incubated at 95°C for 5 minutes and then cooled on ice. Then, 8 U of Bst DNA Polymerase (8 U / μL) was added. The mixture was then incubated at 65°C for 45 minutes, followed by a 2-minute incubation at 95°C to terminate the LAMP reaction. After electrophoresis on a 2% agarose gel (0.5x TBE), the nucleic acid was stained with Gel Green to confirm the amplification results. Amplification of the VHH-ssDNA complex was confirmed in the same way as for unmodified ssDNA.
[0079] Example 7: Isothermal Amplification of VHH-ssDNA Conjugates and Application to Immuno-PCR. This method utilized conjugates containing VHHs against normal human IgG. IgG was dissolved in 1x PBS to prepare a 10 μM IgG solution. The IgG solution was incubated overnight at 4°C and immobilized on a Maxisorp 96-well plate (Thermo Fisher Scientific). Each well was washed four times with 150 ml of PBS containing 0.02% Tween 20 (PBS-T) and blocked with 1% BSA PBS-T for 1 hour at room temperature. Each well was washed four times with PBS-T, and 100 ml of a test sample containing VHH-ssDNA conjugates diluted in PBS-T containing 0.1% BSA was added. Anti-IgG VHHs were used as VHHs. The wells were incubated for 2 hours at room temperature and then washed four times with 150 ml of PBS-T. Next, 50 ml of a LAMP mix solution containing a primer-containing isothermal amplification polymerase and a primer-free nucleic acid amplification polymerase was dispensed into each well. The plate was sealed, and amplification was performed by the LAMP method by incubating at 65°C for 45 minutes. The samples were subjected to acrylamide gel electrophoresis and stained with SYBR Gold, confirming the amplification of ssDNA in the primer-containing isothermal amplification polymerase mix solution.
[0080] [Examples 8 to 13] <Materials and Methods> The reagents used in Examples 8 to 13 are as follows.
[0081]
[0082]
[0083] The methods and sequences used in Examples 8 to 13 are as follows. <DNA sequence (LAMP method)> For the LAMP method, template sequences and primers were selected whose amplification had been confirmed in a previous paper (Y. Manabu, et al., Fish Pathology, 2006, 41(1), 19-27). A complementary sequence of a special nucleic acid for linkage and a T7 promoter sequence were designed 3' downstream of the sequence to be amplified by the LAMP method. The designed LAMP template DNA and LAMP primers were purchased from Eurofins Genomics.
[0084] LAMP method template (321 b.p.): SEQ ID NO: 10 5'-AGCCGTAGC CCTGTATGCC CGAGAGTGCC TGTGAGGGCG ACGCAGACGC CGTTGCCTGT AGCATAGAAG ATCCGTGCGG CGGCGGGCCG GTGGGTTTCT GCTTCTTGGG TTTGGGAGGC CCGCCGCCCT CGCCGTCTTC TCCGGGCACG GACTGCACTC CTCCGATGGA GTGAAACTGG AACTGTCTGA TGAGCGTGGG GTCAAAGTTG CACATGGGCA GTCCGCTGGC CTCGGAGAGC ATGACGGCGA TGGAGTTGGG GTTGATCCTC GGGGGGCGGC GTGGAAATTC CCTATAGTGA GTCGTATTAA TTTCGCGGGA TC -3'
[0085] LAMP primer (FIP: Forward Inner Primer) (44 bases): SEQ ID NO: 11 5'- CCCAAACCCAAGAAGCAGAAACCCGTTGCCTGTAGCATAGAAGA -3'
[0086] LAMP primer (BIP: Backward Inner Primer) (40 bases): SEQ ID NO: 12 5'-CACTCCTCCGATGGAGTGAAACTGCCCATGTGCAACTTTG-3'
[0087] LAMP primer (F3 Primer) (18 bases): SEQ ID NO: 13 5'-CTGTATGCCCGAGAGTGC-3'
[0088] LAMP primer (B3 Primer) (18 bases): SEQ ID NO: 14 5'-AACTCCATCGCCGTCATG-3'
[0089] LAMP primer (LF: Loop Forward primer) (12 bases): SEQ ID NO: 15 5'-CCCGCCGCCGCA-3'
[0090] LAMP primer (LB: Loop Backward primer) (20 bases): SEQ ID NO: 16 5'-TGGAACTGTCTGATGAGCGT -3'
[0091] <DNA sequence (ssDNA synthesis)> The following primers were purchased from Eurofins Genomics.
[0092] Reverse ssDNA synthesis template (21 bases): SEQ ID NO: 17 5'-ATCCCGCGAAATTAATACGAC-3'
[0093] <DNA Sequence (Special Nucleic Acid for Ligation)> The special nucleic acids shown below were purchased from Hokkaido System Science Co., Ltd.
[0094] DNA encoding the amino acid sequence of BDA (B domain of protein A): SEQ ID NO: 20 5'- GATCCCGCGA AATTAATACG ACTCACTATA GGGAGACCAC AACGGTTTCC CTCTAGAAAT AATTTTGTTT AACTTTAAGA AGGAGATATA CCAATGGATA ATAAATTTAA TAAAGAACAA CAAAACGCTT TCTACGAAAT TCTGCATCTT CCGAATCTGA ACGAGGAACA GCGTAACGGC TTTATCCAAA GCCTGAAAGA TGACCCGTCT CAGTCCGCAA ACCTGCTGGC CGAAGCTAAA AAGCTGAATG ATGCGCAGGC ACCGAAAGCT GACAACAAAT TCAACGGTGG CGGTAGCCAC CATCACCACC ATCACGGCGG TTCTAGGACG GGGGGCGGCG TGGAAA -3'
[0095] Example 8: Amplification of template DNA by LAMP The LAMP method was performed in a 25.0 μL reaction volume containing 1.6 μM FIP (SEQ ID NO: 11) and BIP (SEQ ID NO: 12), 0.4 μM F3 Primer (SEQ ID NO: 13) and B3 Primer (SEQ ID NO: 14), 0.8 μM LF (SEQ ID NO: 15) and LB (SEQ ID NO: 16), 400 μM dNTP, 1.6 M betaine, 6% DMSO, 10× Bst Reaction Buffer, and 1 nM template DNA (SEQ ID NO: 10). The template DNA was incubated at 95°C for 5 minutes, cooled on ice, and then mixed with the reaction solution. 8 U of Bst DNA polymerase (8 U / μL) was added. The mixture was then incubated at 65°C for 45 minutes, followed by a 2-minute incubation at 95°C to terminate the LAMP reaction. The amplification results were obtained by 2% agarose gel electrophoresis (0.5x TBE) at 100 V for 30 minutes, followed by staining of the nucleic acids with Gel Green. The electrophoresis results are shown in Figure 10. Ladder-like bands were visible in the sample (+) containing the template DNA for the LAMP method, confirming that the LAMP method was progressing specifically for the template.
[0096] [Example 9] Synthesis of ssDNA for ligation <PCR> Using the designed LAMP template DNA (SEQ ID NO: 10) as a template, dsDNA for ssDNA synthesis was obtained by PCR. PCR was performed in a 25.0 μL reaction volume containing 0.5 μM F3 Primer (SEQ ID NO: 13) and Reverse ssDNA synthesis temp. (SEQ ID NO: 17) as primers, 200 μM dNTP, 5x OneTaq Buffer, 0.625 U of OneTaq DNA Polymerase (5 U / μL), and 100 pM template DNA (SEQ ID NO: 10). The PCR temperature cycle was as shown in Table 6, and 30 cycles were performed from the second step to the fourth step. PCR products were purified using a QIA quick PCR purification kit, and concentrations were determined by measuring absorbance at 260 nm in a nanodrop 1000 spectrophotometer.
[0097]
[0098] Transcription: Transcription products were obtained using PCR products as templates. Transcription reactions were performed in a 10.0 μL reaction volume containing 50 ng of PCR product, 1.0 μL of RNase Inhibitor, RiboMax Express T7 2x Buffer, and 1.0 μL of Enzyme Mix T7 Express. The reaction solution was incubated at 37°C for 30 minutes, after which 1.0 μL of RQ1 RNase-free DNase was added and incubated at 37°C for 15 minutes. The transcription products were purified using RNA Clean XP, and the concentration was determined by measuring the absorbance at 260 nm using a nanodrop 1000 spectrophotometer.
[0099] <Reverse transcription> Reverse transcription was performed from the transcript to obtain a double-stranded construct consisting of RNA and its complementary cDNA. Reverse transcription was performed in a 20.0 μL reaction volume containing 3.0 μg of transcript, 2.0 μM F3 Primer (SEQ ID NO: 13) as the reverse transcription primer, 1.0 mM dNTP, 1.0 μL RNase inhibitor, and 5× ReverTra Buffer. First, to allow annealing of the transcript and primer, the reaction solution was incubated at 65°C for 5 minutes and then cooled to room temperature at a rate of 0.1°C / s. Then, 100 U of ReverTra Ace (100 U / μL) was added to the solution, and the mixture was incubated at 42°C for 30 minutes.
[0100] <RNase H Treatment> ssDNA was obtained using a double strand consisting of RNA and its complementary cDNA strand. RNase H treatment was performed in a 25.0 μL reaction volume containing the total amount of reverse transcription product (20 μL), 5x ReverTra Buffer, and 2.5 U of RNase H (5 U / μL). The reaction solution was incubated at 30°C for 20 minutes, then purified using RNA Clean XP. The concentration of the purified ssDNA solution was determined by measuring the absorbance at 260 nm using a nanodrop 1000 spectrophotometer. The results of ssDNA synthesis shown in Example 9 are shown in Figure 11. 4% polyacrylamide gel electrophoresis was performed at 200 V for 30 minutes, and the nucleic acids in the gel after electrophoresis were stained with SYBR Gold to confirm the synthesis results.
[0101] [Example 10] Synthesis of special linking nucleic acid and evaluation of binding to ssDNA Modified oligonucleotides (special linking nucleic acids: SEQ ID NOS: 18 and 19) modified at the 5' end with Cyanine 5 for fluorescent imaging and at the 3' end with puromycin for binding to peptides were chemically synthesized by Hokkaido System Science Co., Ltd. The structure of the chemically synthesized special nucleic acid is shown in Figure 12.
[0102] Next, we confirmed whether the synthesized special nucleic acid could bind to ssDNA. Photocrosslinking of cnvK with thymine in ssDNA was carried out in a 10.0 μL reaction volume containing 2 pmol each of the special nucleic acid for linkage and ssDNA, and 10x Annealing Buffer (100 mM Tris-HCl (pH 7.8), 500 mM NaCl, 10 mM EDTA). First, annealing of the special nucleic acid and ssDNA was carried out according to the program shown in Table 7. After annealing, the solution was immediately irradiated with 366 nm UV for 2 minutes using a UV-1000 Ultraviolet Crosslinker to photocrosslink cnvK with thymine.
[0103]
[0104] 4% polyacrylamide gel electrophoresis was performed at 200 V for 30 minutes, and the nucleic acids in the gel after electrophoresis were stained with SYBR Gold to confirm the synthesis results. Furthermore, binding of the special linking nucleic acid to the ssDNA was confirmed by observing the fluorescence of Cy5 modified on the special linking nucleic acid.
[0105] The experimental results of Example 10 are shown in Figure 13. Lane 1 is ssDNA (279 bases), and lane 2 is the binding product of the special nucleic acid and ssDNA. The band in lane 2, which represents the binding product of the special nucleic acid and ssDNA, was shifted above the band of ssDNA (lane 1). Furthermore, the band due to Cy5 fluorescence, which was not visible in lane 1, was visible in lane 2, confirming that the special nucleic acid and ssDNA had bound. Based on the band intensity in lane 2 stained with SYBR Gold, the binding efficiency was calculated to be approximately 85%.
[0106] Next, the binding position of the special nucleic acid and ssDNA was evaluated. The special nucleic acid was bound to the 5' or 3' end of the ssDNA, and a comparison was made to see if there was any difference in the amplification ability of the LAMP method. See Figure 14. Amplification by the LAMP method and confirmation of the results were the same as in Example 8. The amplification results for the conjugate in which the special nucleic acid was bound to the 5' or 3' end of the ssDNA are shown in Figure 15.
[0107] The conjugate of the 5' end of ssDNA and the special nucleic acid (lane 1) showed a slightly lower amplification efficiency in the LAMP method compared to ssDNA (lane 2), whereas the conjugate of the 3' end of ssDNA and the special nucleic acid (lane 3) showed an amplification efficiency comparable to that of ssDNA (lane 4). This is thought to be because, as shown in Figure 16, when the special nucleic acid is configured to bind to the 3' end of ssDNA, the polymerase activity proceeds without interference from cnvK. In other words, a polymerase with strand displacement activity synthesizes a DNA strand while peeling off the hydrogen bonds in the annealing region between the special nucleic acid and ssDNA. When cnvK is present near the 5' end of ssDNA due to binding of the special nucleic acid to the 5' end of ssDNA, the polymerase stops on the spot when it reaches cnvK or undergoes a structural change, reducing the amplification efficiency. However, when cnvK is present at the 3' end of ssDNA, cnvK does not come into contact with LAMP amplification, so amplification inhibition does not occur. Therefore, it was suggested that it is desirable to design the nucleic acid so that it overhangs on the 5' side of the nucleic acid that serves as the template for amplification.
[0108] Example 11 Synthesis of VHH Using a Cell-Free Translation System <Transcription> mRNA was synthesized from DNA (SEQ ID NO: 20) encoding the amino acid sequence of the B domain (BDA) of protein A that binds to human IgG, and BDA was further synthesized using a cell-free translation system. A transcription reaction was carried out in a 10.0 μL reaction volume containing 100 ng of DNA encoding the amino acid sequence of BDA, 1.0 μL of RNase Inhibitor, RiboMax Express T7 2x Buffer, and 1.0 μL of Enzyme Mix T7 Express. The reaction solution was incubated at 37°C for 30 minutes, after which 1.0 μL of RQ1 RNase-free DNase was added, and the mixture was incubated at 37°C for 15 minutes. Transcripts were purified by RNA Clean XP and concentrations were determined by measuring absorbance at 260 nm in a nanodrop 1000 spectrophotometer.
[0109] <Binding of special nucleic acids to mRNA> Photocrosslinking of cnvK was carried out in a 10.0 μL reaction volume containing 15 pmol each of the special nucleic acid for ligation and mRNA, and 10x Annealing Buffer (100 mM Tris-HCl (pH 7.8), 500 mM NaCl, 10 mM EDTA). First, annealing of the special nucleic acid and ssDNA was carried out according to the program shown in Table 7. After annealing, the solution was immediately irradiated with 366 nm UV using a UV-1000 Ultraviolet Crosslinker to photocrosslink cnvK and uracil. The results of binding of the special nucleic acid and mRNA are shown in Figure 17. Lane 1 is mRNA alone, and lane 2 is the binding product of the special nucleic acid and mRNA.
[0110] The band of the binding product of the special nucleic acid and mRNA in lane 2 was shifted higher than the band in lane 1, where only mRNA was electrophoresed. Furthermore, the band due to Cy5 fluorescence, which was not visible in lane 1, was visible in lane 2, confirming that the special nucleic acid and mRNA had bound. From the band intensity in lane 2 stained with SYBR Gold, the binding efficiency was calculated to be approximately 95%.
[0111] <Synthesis of BDA in a cell-free translation system using a special nucleic acid-mRNA conjugate> BDA was synthesized in a cell-free translation system using a conjugate of special nucleic acid and mRNA. BDA was synthesized in a cell-free translation system in a 25.0 μL reaction volume containing 10 pmol of the special nucleic acid-mRNA conjugate, 12.5 μL of PUREfrex 2.0 Solution I, 1.25 μL of PUREfrex 2.0 Solution II, and 2.5 μL of PUREfrex 2.0 Solution III. After incubation at 37°C for 15 minutes, 12.0 μL of 3 M KCl and 1 M MgCl were added to the reaction solution. 2 3.0 μL of was added, and the mixture was further incubated for 40 minutes at 37° C. Finally, 9.0 μL of 0.5 M EDTA was added, and the mixture was incubated for 10 minutes at 37° C. Subsequently, buffer exchange was carried out using a Micro Bio-Spin P-6 Gel Column.
[0112] <Binding of special nucleic acid-BDA conjugate to ssDNA> The BDA synthesized in the previous section is bound to mRNA via a special nucleic acid. First, the mRNA was degraded and the bond between cnvK and uracil in the special nucleic acid was dissociated. Next, the special nucleic acid-BDA conjugate was bound to ssDNA. The total amount of BDA-mRNA conjugate was incubated at 30°C for 30 minutes in a 52.0 μL reaction volume containing 10x Ne Buffer 2, 2.5 U of RNase H (5 U / μL), and 1250 U of RNase T1 (1000 U / μL) to degrade the mRNA. The sample was then irradiated with 312 nm UV light using a CI-210B UV transilluminator for 4 minutes to dissociate the bond between cnvK and uracil, yielding a special nucleic acid-BDA conjugate.
[0113] The entire amount of special nucleic acid-BDA conjugate was used in a 65.0 μL reaction volume containing 15 pmol of ssDNA, which had been previously incubated at 95°C for 3 minutes, and 10x Annealing Buffer, to photocrosslink cnvK with thymine in the ssDNA. First, annealing of the special nucleic acid-BDA conjugate and ssDNA was performed according to the program shown in Table 8. After annealing, the solution was immediately irradiated with 366 nm UV light for 2 minutes using a UV-1000 Ultraviolet Crosslinker to photocrosslink cnvK with thymine, yielding a BDA-ssDNA conjugate. Purification was performed using HisMag Sepharose, and the results were observed by SDS-polyacrylamide gel electrophoresis at 20 mA for 90 minutes, followed by monitoring the fluorescence of Cy5 in the special nucleic acid.
[0114]
[0115] The synthesis results of the BDA-ssDNA conjugate are shown in Figure 18. Lane 1 is the special nucleic acid-mRNA conjugate, lane 2 is the cell-free translation product, lane 3 is after buffer exchange using a column, lane 4 is after mRNA degradation, lane 5 is the BDA-ssDNA conjugate, and lane 6 is the BDA-ssDNA conjugate after HisTag purification. The dark band in lane 1 (special nucleic acid-mRNA conjugate) shifted upward in lane 2, confirming the synthesis of a protein-mRNA complex by cell-free translation. Furthermore, the band disappeared upon RNase treatment (lane 4), and a band appeared upon binding to ssDNA (lane 5). Finally, the upper band in lane 6, after HisTag purification, is the desired BDA-ssDNA conjugate. Based on the band intensity ratio between the dark band in lane 1 and the upper band in lane 6, the formation efficiency of the BDA-ssDNA conjugate was calculated to be approximately 0.6%.
[0116] Example 12 Amplification of BDA-ssDNA Conjugate by LAMP The BDA-ssDNA conjugate synthesized in Example 11 was subjected to LAMP under the same conditions as in Example 8. The amplification results of the LAMP method are shown in Figure 19. Lane 1 is a sample containing no template DNA, lane 2 is a sample using ssDNA as a template, and lane 3 is a sample using BDA-ssDNA as a template. As shown in Figure 19, the BDA-ssDNA conjugate was amplified in the same way as ssDNA, confirming that even special nucleic acids in a protein-bound state can be sufficiently amplified by the LAMP method.
[0117] Example 13: Application of VHH-ssDNA conjugates to isothermal amplification immuno-PCR. In Example 12, it was confirmed that there were no problems with LAMP amplification even when a protein was bound to a specific nucleic acid. Therefore, for example, a VHH-ssDNA conjugate containing a VHH capable of binding to a target molecule is prepared, and the VHH-ssDNA conjugate is contacted with a sample solution in which the presence or absence of the target molecule is to be confirmed, resulting in a complex of the target molecule and the VHH-ssDNA conjugate (a target molecule / VHH-ssDNA conjugate complex). After removing any VHH-ssDNA conjugates that have not bound to the target molecule by washing or other methods, isothermal amplification is performed. As a result, an amplification product is generated in a concentration-dependent manner of the target molecule only when the target molecule and the VHH-ssDNA conjugate are bound, allowing detection and quantification of the target molecule. For example, a sample solution is contacted with an antibody that binds to the target molecule, which is immobilized on a solid phase such as beads or a well, and then the sample solution is contacted with the VHH-ssDNA conjugate. Furthermore, after removing VHH-ssDNA conjugates that are not bound to the target molecule, isothermal amplification such as LAMP is carried out. If the sample solution contains the target molecule, an amplification product is generated according to the amount of the target molecule, allowing detection and quantitative analysis of the target molecule.
Claims
1. A conjugate for detecting a target molecule, comprising a protein and a nucleic acid portion, wherein the nucleic acid portion comprises a first nucleic acid bound to the protein and a second nucleic acid comprising a sequence complementary to the first nucleic acid, wherein the first nucleic acid and the second nucleic acid form a complementary double-stranded portion, the second nucleic acid comprises an overhanging single-stranded portion, and the double-stranded portion comprises a photocrosslink by cnvK that bridges the first nucleic acid and the second nucleic acid.
2. The conjugate of claim 1, wherein the protein is attached to the first nucleic acid via a maleimide.
3. The conjugate of claim 1, wherein the protein is bound to the first nucleic acid via puromycin and a third nucleic acid, and the third nucleic acid is cross-linked to the first nucleic acid.
4. The conjugate of claim 1, wherein the protein is a VHH.
5. The conjugate of claim 1, wherein the overhanging single-stranded portion of the second nucleic acid is contained on the 5' side of the second nucleic acid.
6. A nucleic acid drug comprising the conjugate described in claim 1.
7. A gene therapy drug comprising the conjugate of claim 1.
8. A method for detecting a target molecule, comprising: a step of contacting a target molecule contained in a sample solution with a detection compound to bind the target molecule to the detection compound; wherein the detection compound is a conjugate comprising a protein that binds to the target molecule and a nucleic acid portion, the nucleic acid portion comprising a first nucleic acid bound to the protein and a second nucleic acid comprising a sequence complementary to the first nucleic acid, the first nucleic acid and the second nucleic acid forming a complementarily bound double-stranded portion, the second nucleic acid comprising an overhanging single-stranded portion, and the double-stranded portion comprising photocrosslinking by cnvK that bridges the first nucleic acid and the second nucleic acid; and a step of isothermally amplifying the second nucleic acid.
9. The detection method according to claim 8, wherein the protein is bound to the first nucleic acid via a maleimide.
10. The detection method of claim 8, wherein the protein is bound to the first nucleic acid via puromycin and a third nucleic acid, and the third nucleic acid is crosslinked to the first nucleic acid.
11. The detection method according to claim 8, wherein the protein is a VHH.
12. The detection method according to claim 8, wherein the step of binding the target molecule to the detection compound is carried out by contacting the sample solution with a binding molecule that is immobilized on a solid phase and binds to the target molecule, thereby binding the target molecule in the sample solution to the binding molecule, and then contacting the target molecule bound to the binding molecule with the detection compound.
13. The method of claim 12, wherein the binding molecule is an antibody.
14. The detection method according to claim 8, wherein the isothermal amplification is the LAMP method.
15. The detection method according to claim 8, wherein the overhanging single-stranded portion in the second nucleic acid is contained on the 5' side of the second nucleic acid.
Citation Information
Patent Citations
A novel immuno-PCR method using cDNA display
JP2022522337A
Novel linker for antigen detection and antigen detection method using same
WO2022102791A1