Gene-edited plant with reduced glycoalkaloid synthesis and manufacturing method therefor

Genetic modification of Solanaceae plants using CRISPR/Cas9 to weaken StGAME4 and StSGT3 genes effectively reduces solanine and chaconine production, addressing crop disposal issues and stabilizing food supply.

WO2026043247A1PCT designated stage Publication Date: 2026-02-26KOREA RES INST OF BIOSCIENCE & BIOTECHNOLOGY
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2025/012550
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-08-19
Filing Date
2025-08-19
Publication Date
2026-02-26

AI Technical Summary

Technical Problem

Existing methods to suppress solanine production in Solanaceae crops, such as potatoes, are ineffective, leading to disposal of crops due to excessive solanine accumulation, which disrupts supply and potentially causes global food imbalance.

Method used

Genetically modify Solanaceae plants by weakening the expression of StGAME4 and StSGT3 genes using CRISPR/Cas9 technology to inhibit glycoalkaloid synthesis, specifically targeting and editing the genes with guide RNAs to reduce solanine and chaconine production.

Benefits of technology

Achieves significant reduction or complete inhibition of solanine and chaconine synthesis in genetically modified plants, maintaining edible quality and preventing food waste, thus stabilizing crop supply.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2025012550_26022026_PF_FP_ABST
    Figure KR2025012550_26022026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to: a gene-edited plant in which expression of StGAME4 and StSGT3 genes is attenuated; a manufacturing method therefor; a guide RNA targeting Solanaceae plant genes or a gene encoding same; and a composition for editing Solanaceae plant genes.
Need to check novelty before this filing date? Find Prior Art

Description

Genetically modified plant with reduced glycoalkaloid synthesis and method for producing the same

[0001] The present invention relates to a genetically corrected plant in which the expression of StGAME4 and StSGT3 genes is weakened; a method for producing the same; a guide RNA targeting a Solanaceae plant gene or a gene encoding the same; and a composition for gene correction of Solanaceae plants.

[0002]

[0003] Solanaceae crops, including potatoes, peppers, tomatoes, and eggplants, are an important plant group. While there are exceptions, such as peppers, most contain glycoalkaloid toxic substances. Solanine occurs in all parts of the plant, including leaves, fruits, and tubers. While it serves as a plant defense against pests and diseases, it is known to be hazardous to humans if consumed in excessive amounts. Since solanine production increases when exposed to light, the cost of dark storage facilities to prevent solanine production significantly impacts potato prices. Accumulation of solanine during storage or distribution can lead to the disposal of entire crops, significantly disrupting supply. The increasing severity of climate change is likely to lead to a disruption in potato supply, potentially leading to a global food imbalance. To address this issue, researchers are increasingly developing new varieties using high-precision molecular farming techniques, including gene editing. While various studies are ongoing to suppress the accumulation of steroidal glycoalkaloids (SGAs) in Solanaceae crops, the effectiveness of solanine suppression remains minimal. Krits et al. (Planta 2007, 227, 143-150) identified a relationship between the Hmg1 and Pss1 genes and glycoalkaloid content, but there are no previous studies that simultaneously knocked out two genes in the glycoalkaloid biosynthetic pathway.

[0004]

[0005] The inventors of the present invention attempted to solve the problem of discarding potatoes due to solanine accumulation by lowering the solanine content of potatoes to the lowest level that does not cause problems in growth and thereby maintaining edible quality.

[0006]

[0007] One object of the present invention is to provide a genetically modified plant in which the expression of the StGAME4 and StSGT3 genes is weakened.

[0008] Another object of the present invention is to provide a method for producing a genetically modified plant with reduced glycoalkaloid synthesis, comprising a step of attenuating the expression of StGAME4 and StSGT3 genes.

[0009] Another object of the present invention is to provide a genetically modified Solanaceae plant with reduced glycoalkaloid synthesis produced by the above method.

[0010] Another object of the present invention is to provide a guide RNA targeting a Solanaceae plant gene or a gene encoding the same.

[0011] Another object of the present invention is to provide seeds of the Solanaceae plant having reduced glycoalkaloid synthesis by correcting the genes thereof.

[0012] Another object of the present invention is to provide a composition for gene correction of a Solanaceae plant, which comprises, as an active ingredient, a guide RNA targeting a Solanaceae plant gene or a gene encoding the guide RNA.

[0013] Another object of the present invention is to provide a method for producing seeds with reduced glycoalkaloid synthesis using genetically modified plants in which the expression of the StGAME4 and / or StSGT3 genes is weakened.

[0014] Another object of the present invention is to provide a use for producing a genetically modified Solanaceae plant with reduced glycoalkaloid synthesis.

[0015]

[0016] The genetically modified plants with weakened expression of the StGAME4 and StSGT3 genes presented in the present invention can be usefully used to develop Solanaceae plants that do not synthesize the glycoalkaloids solanine and chaconine compared to the wild type.

[0017]

[0018] Figure 1 shows the selection of guide RNA for each target gene.

[0019] Figure 2 shows the efficiency of protoplast correction for each gene by guide RNA concentration.

[0020] Figure 3 shows plant regeneration derived from RNP-applied protoplasts.

[0021] Figure 4 shows the results of analyzing the gene editing type and confirming the NGS-based knock-out plant sequence.

[0022] Figure 5 shows the analysis of solanine and chaconine contents in the leaves of the genetically modified organism.

[0023] Figure 6 shows the analysis of solanine and chaconine contents in sprouted tubers of the genetically modified organism.

[0024]

[0025] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in the present invention can also be applied to each other description and embodiment. In other words, all combinations of the various elements disclosed in the present invention fall within the scope of the present invention. Furthermore, the scope of the present invention should not be considered limited by the specific descriptions described below.

[0026] Furthermore, those skilled in the art will recognize or be able to ascertain, using no more than routine experimentation, numerous equivalents to the specific embodiments of the invention described herein. Furthermore, such equivalents are intended to be encompassed by the present invention.

[0027]

[0028] One aspect for achieving the above object provides a genetically modified plant in which the expression of the StGAME4 and StSGT3 genes is weakened.

[0029] In the present invention, the term "StGAME4" refers to a gene for one of the key enzymes of the steroidal glycoalkaloids (SGA) pathway, and is known to be involved in the synthesis of solanidine from cholesterol. In the present invention, the StGAME4 gene may be composed of the base sequence of SEQ ID NO: 1, but is not limited thereto.

[0030] In the present invention, the term "StSGT3" also refers to a gene for one of the key enzymes of the steroidal glycoalkaloids (SGA) pathway, and is known to be involved in the synthesis of solanine and chaconine. In the present invention, the StSGT3 gene may be composed of the base sequence of SEQ ID NO: 3, but is not limited thereto.

[0031] The genetically modified plant of the present invention is characterized in that the genes StGAME4 and / or StSGT3 encoding StGAME4 and / or StSGT3 involved in the biosynthetic pathway of solanine and chaconine are weakened or deleted.

[0032] In the present invention, the term "attenuation" is a concept encompassing reducing the activity of an enzyme expressed by a corresponding gene by mutating, substituting, or deleting some bases of the corresponding gene, or introducing some bases, and includes all things that block part or a significant part of the biosynthetic pathway involved in the enzyme of the corresponding gene. The term "deletion" in the present invention is a concept encompassing preventing the gene from being expressed, or preventing the gene from exhibiting enzymatic activity even if expressed, by mutating, substituting, or deleting some or all bases of the corresponding gene, or introducing some bases, and includes all things that block the biosynthetic pathway involved in the enzyme of the corresponding gene. For the purposes of the present invention, the weakening of gene expression may be due to gene knock-out.

[0033] In the present invention, the term "genome / gene editing" refers to a technology capable of introducing a targeted mutation into the genetic base sequence of plant and animal cells, including human cells, by knocking out or knocking in a specific gene through deletion, insertion, substitution, etc. of one or more nucleic acid molecules by DNA cleavage, or a technology capable of introducing a mutation into a non-coding DNA sequence that does not produce a protein. For the purpose of the present invention, the gene editing may be, in particular, introducing a mutation into a plant using an endonuclease, such as Cas9 (CRISPR associated protein 9) protein and a guide RNA. In addition, 'gene editing' may be used interchangeably with 'gene editing'.

[0034]

[0035] Another aspect for achieving the above object provides a composition for correcting a Solanaceae plant gene, comprising i) a guide RNA for correcting a base sequence of a StGAME4 gene having sequence number 1; and ii) a guide RNA for correcting a base sequence of a StSGT3 gene having sequence number 3.

[0036] In one embodiment, the guide RNA for correcting the base sequence of the StGAME4 gene may be characterized by being composed of the base sequence of SEQ ID NO: 2, and the guide RNA for correcting the base sequence of the StSGT3 gene may be characterized by being composed of the base sequence of SEQ ID NO: 4.

[0037] The term "guide RNA" of the present invention refers to a short single-stranded RNA, which is specific to a target DNA among the base sequences encoding a target gene, and refers to a ribonucleic acid that complementarily binds to all or part of the target DNA base sequence and guides an endonuclease protein to the target DNA base sequence. The guide RNA is a dual RNA comprising two RNAs, namely crRNA (CRISPR RNA) and tracrRNA (trans-activating crRNA), as components; Or, it refers to a single-stranded guide RNA (sgRNA) form that includes a first portion that includes a sequence that is completely or partially complementary to a base sequence in a target gene and a second portion that includes a sequence that interacts with an endonuclease (particularly, an RNA-guided nuclease). However, if the endonuclease is in a form that can be active in the target base sequence, it can be included in the scope of the present invention without limitation, and can be manufactured and used according to a technique known in the art, taking into account the type of endonuclease used together or the microorganism from which the endonuclease is derived.

[0038] Additionally, the guide RNA may be, but is not limited to, a guide RNA transcribed from a plasmid template, transcribed in vitro (e.g., an oligonucleotide double strand), or synthesized.

[0039] In the present invention, the guide RNA is specifically designed for the target base sequence of the StGAME4 and StSGT3 genes, and the guide RNA specific for the target base sequence may specifically be composed of the base sequence of SEQ ID NO: 2 or SEQ ID NO: 4, but is not limited thereto. The base sequence of SEQ ID NO: 2 or SEQ ID NO: 4 is a guide RNA sequence targeting the genomic sequence of StGAME4 composed of the base sequence of SEQ ID NO: 1, or a guide RNA sequence targeting the genomic sequence of StSGT3 composed of the base sequence of SEQ ID NO: 3.

[0040] In the present invention, the base sequences of SEQ ID NO: 1 to SEQ ID NO: 4 may include base sequences having a homology of 80% or more, specifically 90% or more, and more specifically 95% or more, but are not limited thereto.

[0041] As used herein, the terms "homology" or "identity" refer to the degree of relationship between two given amino acid sequences or base sequences, and may be expressed as a percentage. The terms "homology" and "identity" are often used interchangeably.

[0042] Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard alignment algorithms, and may be combined with default gap penalties established by the program being used. In practice, homologous or identical sequences are generally capable of hybridizing under moderate or high stringency conditions along at least about 50%, 60%, 70%, 80%, or 90% of the entire sequence or its full length. Hybridization is also contemplated for polynucleotides that contain degenerate codons in place of codons in the polynucleotide.

[0043] Whether any two polynucleotide or polypeptide sequences are homologous, similar or identical can be determined using known computer algorithms such as the "FASTA" program using default parameters, for example as in Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) can be determined using the GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO ET AL / .](1988) SIAM J Applied Math 48: 1073). For example, homology, similarity, or identity can be determined using BLAST or ClustalW of the National Center for Biotechnology Information Database.

[0044] Homology, similarity, or identity of polynucleotides or polypeptides can be determined by comparing sequence information, for example, as disclosed in Smith and Waterman, Adv. Appl. Math (1981) 2:482, or using a GAP computer program such as, for example, Needleman et al. (1970), J Mol Biol. 48:443. In brief, the GAP program defines the total number of symbols in the shorter of the two sequences as the total number of similarly arranged symbols (i.e., nucleotides or amino acids). Default parameters for the GAP program include (1) a binary comparison matrix (containing values ​​of 1 for identity and 0 for non-identity) and (2) a quantile matrix as disclosed in Gribskov et al. (1986) Nucl. Acids Res. 48:443, as disclosed in Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979). 14: 6745 weighted comparison matrix (or EDNAFULL (EMBOSS version of NCBI NUC4.4) permutation matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for terminal gaps.

[0045] Additionally, whether any two polynucleotide or polypeptide sequences have homology, similarity or identity can be determined by comparing the sequences by Southern hybridization experiments under defined stringent conditions, and appropriate hybridization conditions are within the skill of the art and can be determined by methods well known to those skilled in the art (e.g., J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F. M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York).

[0046]

[0047] The term "target gene" in the present invention refers to a portion of DNA within the genome of a plant to be corrected through the present invention. The type of gene is not limited, and may include both coding and non-coding regions. Those skilled in the art can select the target gene according to the desired mutation for the genetically corrected plant to be produced, depending on the purpose.

[0048] A genetically modified plant according to one embodiment of the present invention is a genetically modified plant with reduced glycoalkaloid synthesis.

[0049] The reduction in glycoalkaloid production according to the present invention is characterized by, but is not limited to, regulating the expression of glycoalkaloid biosynthetic genes.

[0050] Regulation of the expression of the above glycoalkaloid biosynthesis gene means reducing the expression of the glycoalkaloid biosynthesis gene.

[0051] In the present invention, the glycoalkaloid may be, but is not limited to, solanine or chaconine.

[0052] As used herein, the term "glycoalkaloid" refers to a secondary metabolite involved in pest and disease resistance in Solanaceae plants, such as potatoes and tomatoes. Specifically, glycoalkaloids are classified based on the sugar that binds to solanidine. In potatoes, solanine and chaconine account for 95% of all glycoalkaloids.

[0053] Solanine refers to a solanum alkaloid glycoside compound that is found in potatoes or tomatoes and has high water solubility, commonly known as α-solanine (C 45 H 73 NO 15 , MW = 868 Da), β-solanine (C 39 H 63 NO 11 , MW = 722) and γ-solanine (C 33 H 53 NO6, MW = 560). Chaconine is also a steroidal glycoalkaloid that occurs in plants of the Solanaceae family. The above solanine and chaconine are natural toxic compounds expressed in the green part of potatoes, and are known to cause food poisoning in humans.

[0054] The above plant is a Solanaceae plant, and the Solanaceae plant is characterized by being at least one species selected from the group consisting of potatoes, tomatoes, and eggplants.

[0055]

[0056] Another aspect for achieving the above object provides a method for producing a genetically modified plant with reduced solanine synthesis, comprising a step of weakening the expression of StGAME4 and StSGT3 genes.

[0057] In a manufacturing method according to one embodiment of the present invention, the weakening of gene expression may be due to gene knock-out, but is not limited thereto.

[0058] In a manufacturing method according to one embodiment of the present invention, the gene knock-out may be performed using a complex of guide RNA and endonuclease protein (RNP, ribonucleoprotein); or a recombinant vector including DNA encoding guide RNA and a nucleic acid sequence encoding endonuclease protein, but is not limited thereto.

[0059] The above terms, 'StGAME4 and StSGT3 genes', 'gene expression attenuation', 'guide RNA', and 'endonuclease protein', etc. are as described above.

[0060] In a manufacturing method according to one embodiment of the present invention, the endonuclease protein may be at least one selected from the group consisting of Cas9, Cpf1 (also known as Cas12a), TALEN (Transcription activator-like effector nuclease), ZFN (Zinc Finger Nuclease) or a functional analog thereof, specifically, it may be Cas9 or Cpf1, and more specifically, it may be a Cas9 protein, but is not limited thereto.

[0061] In addition, the Cas9 protein may be at least one selected from the group consisting of a Cas9 protein derived from Streptococcus pyogenes, a Cas9 protein derived from Campylobacter jejuni, a Cas9 protein derived from S. thermophilus or S. aureus, a Cas9 protein derived from Neisseria meningitidis, a Cas9 protein derived from Pasteurella multocida, a Cas9 protein derived from Francisella novicida, and the like, but is not limited thereto. The Cas9 protein or its genetic information can be obtained from a known database such as GenBank of the National Center for Biotechnology Information (NCBI). The above Cas9 gene information may use a known sequence as is, or may use a sequence optimized for the codon of the target (organism) to be transduced, but is not limited thereto.

[0062] The Cas9 protein is an RNA-guided DNA endonuclease enzyme that induces double-stranded DNA breaks. In order for the Cas9 protein to precisely bind to the target sequence and cleave the DNA strand, a short sequence of three bases known as a Protospacer Adjacent Motif (PAM) must be present next to the target sequence. The Cas9 protein cleaves between the third and fourth base pairs from the PAM sequence (NGG).

[0063] In the method for producing a genetically corrected plant according to the present invention, the guide RNA and endonuclease protein can form a ribonucleoprotein complex and function as RNA-Guided Engineered Nuclease (RGEN).

[0064]

[0065] In the manufacturing method according to the present invention, the introduction of the guide RNA and endonuclease protein into the Solanaceae plant cell may be performed using a complex (ribonucleoprotein) of the guide RNA and the endonuclease protein specific to the target base sequence of the StGAME4 and StSGT3 genes; or a recombinant vector including a DNA encoding the guide RNA specific to the target base sequence of the StGAME4 and StSGT3 genes derived from the Solanaceae plant, and a nucleic acid sequence encoding the endonuclease protein, but is not limited thereto.

[0066] In the manufacturing method according to the present invention, the method for introducing the complex of the guide RNA and endonuclease protein into plant cells can be appropriately selected from the calcium / polyethylene glycol method for protoplasts (Krens et al., 1982, Nature 296:72-74; Negrutiu et al., 1987, Plant Mol. Biol. 8:363-373), electroporation of protoplasts (Shillito et al., 1985, Bio / Technol. 3:1099-1102), microinjection into plant elements (Crossway et al., 1986, Mol. Gen. Genet. 202:179-185), particle bombardment of various plant elements (DNA or RNA-coated) (Klein et al., 1987, Nature 327:70), etc.

[0067] In addition, introducing a recombinant vector containing DNA encoding a guide RNA specific for the target base sequence and a nucleic acid sequence encoding an endonuclease protein into a plant cell refers to a transformation method. In a manufacturing method according to one embodiment of the present invention, when the recombinant vector is transformed into a plant cell, an endonuclease protein having DNA binding and cleavage activity and an sgRNA that binds to the endonuclease protein and guides the endonuclease protein to the target sequence are co-expressed, thereby performing correction of a desired target gene.

[0068] In the manufacturing method according to the present invention, the "plant cell" into which the guide RNA and endonuclease protein specific for the target base sequence are introduced may be any plant cell. The plant cell is a cultured cell, cultured tissue, cultured organ, or whole plant. The "plant tissue" includes differentiated or undifferentiated plant tissue, such as, but not limited to, roots, stems, leaves, pollen, microspores, egg cells, seeds, and various types of cells used for culture, such as single cells, protoplasts, shoots, and callus tissues. The plant tissue may be in planta or in an organ culture, tissue culture, or cell culture state. A preferred plant cell according to the present invention is a protoplast.

[0069] In the production method of the present invention, any method known in the art can be used to regenerate a gene-corrected plant from a gene-corrected plant cell. The gene-corrected plant cell must be regenerated into a whole plant. Techniques for regenerating mature plants from callus or protoplast cultures are well known in the art for numerous different species (Handbook of Plant Cell Culture, Vol. 1-5, 1983-1989 Momillan, NY).

[0070]

[0071] The present invention also provides a genetically corrected Solanaceae plant that does not synthesize solanine and chaconine compared to a wild type plant produced by the above method, and a seed having its gene corrected.

[0072] The genetically corrected Solanaceae plant according to the present invention, which does not synthesize solanine and chaconine, is a genetically corrected Solanaceae plant in which the StGAME4 and StSGT3 genes are corrected using the CRISPR / Cas9 system, and has the trait of not synthesizing the glycoalkaloids solanine and chaconine compared to a Solanaceae plant in which the StGAME4 and StSGT3 genes are knocked out and the genome is not corrected.

[0073] Another aspect of the present invention provides a use for producing seeds of a plant of the Solanaceae family having reduced glycoalkaloid synthesis by correcting the genes thereof.

[0074] Another aspect of the present invention provides a use for producing a genetically modified Solanaceae plant having reduced glycoalkaloid synthesis.

[0075] Another aspect of the present invention provides the use of a genetically modified plant in which the expression of the StGAME4 and / or StSGT3 genes is attenuated to provide a food having a reduced glycoalkaloid content.

[0076] Another aspect of the present invention provides a use of a composition comprising a guide RNA having a target sequence of SEQ ID NO: 2 and / or a guide RNA having a target sequence of SEQ ID NO: 4 for producing a genetically modified Solanaceae plant with reduced glycoalkaloid synthesis.

[0077]

[0078] Hereinafter, to aid understanding of the present invention, examples and other embodiments will be described in detail. However, the embodiments according to the present invention may be modified in various ways, and the scope of the present invention should not be construed as being limited to the following examples. The embodiments of the present invention are provided to more fully explain the present invention to those of average skill in the art.

[0079]

[0080] Example 1. Sequence and SNP analysis of target genes and guide RNA design

[0081] Among the genes encoding key enzymes of the steroidal glycoalkaloids (SGA) pathway, StGAME4 and StSGT3 were selected as target genes and sequence analysis was performed on the potato cultivar Solanum tuberosum L. cv. Desiree to be corrected. Guide RNAs with no SNPs, no off-targets, and the highest correction efficiency were selected (Fig. 1). The sequences of the selected guide RNAs are as follows.

[0082] StGAME4: GCUAUAUUAAUGAGAAUUAA (SEQ ID NO: 2)

[0083] StSGT3: GACGAGUCAUAUAACUCCAU (SEQ ID NO: 4)

[0084]

[0085] Example 2. Confirmation of the protoplast correction efficiency of the selected guide RNA.

[0086] The guide RNA of the corresponding gene of Example 1 was simultaneously applied to the protoplasts, and it was confirmed that the correction was performed at a very high level, with 32% and 51%, respectively.

[0087] Various concentrations of Cas9 protein and RNP were introduced into plants to perform correction and efficiency analyses. Guide RNA was used as a complex of crRNA and tracrRNA at a 1:1 molar ratio, and Cas9 protein was used at concentrations of 10 µg (RNP1) and 20 µg (RNP2) to create RNP complexes with the same concentration of two guide RNAs at a 1:10 molar ratio, and mutation efficiency and callus induction efficiency were analyzed.

[0088] As a result, mutation efficiencies of 18% and 51% were observed at the protoplast level in StGAME4 and StSGT3, respectively, at a concentration of 20 ug of RNP (RNP1, 10 ug Cas9 + 10 ug gRNA), but the mutation rates improved to 32% and 58%, respectively, at a concentration of 40 ug of RNP (RNP2, 20 ug Cas9 + 20 ug gRNA) (Fig. 2). The callus induction efficiency by the two RNP concentrations was higher under the RNP1 condition than under the RNP2 condition, but since excessive callus induction rate had a negative effect on the future plant differentiation rate, the result with a high mutation rate could be ultimately selected.

[0089]

[0090] Example 3. Multiple regenerated plants obtained from protoplasts to which RNPs were applied.

[0091] The series of processes from RNP application to protoplasts to secure plants were as follows. Specifically, to induce micro-callus from intact protoplasts, 5 Х 10 were placed on alginate lenses. 4Protoplasts were fixed at a concentration of 10 protoplasts / ml and cultured in a division medium for 3 weeks. After microcallus formation, minicallus formation was induced in a callus proliferation medium. Callus greening was induced in a regeneration medium using calli that had sufficiently proliferated for 4 weeks. After 6 weeks of culture in a medium inducing callus greening, approximately 100 regeneration plants were obtained (Fig. 3).

[0092]

[0093] Example 4. Results of sequence analysis of the corresponding genes in plants derived from protoplasts.

[0094] One hundred regenerated plants were obtained from protoplasts into which two RNPs were simultaneously introduced. To secure indel-inducible plants from the regenerated plants, plants were initially screened using PCR-Sanger sequencing chromatograms. As a result, mutations were observed in a total of 73 plants, resulting in a correction efficiency of 73%.

[0095] To suppress the function of the SGA biosynthetic enzyme gene, complete knockout must occur in all alleles (four alleles in potato) due to indels that induce frameshifts in the sequence. To confirm this, accurate base sequence confirmation is required. In the present invention, next-generation sequencing (NGS)-based targeted deep sequencing was applied.

[0096] NGS analysis was performed on 52 plants out of 73 plants, excluding those with poor growth.

[0097] As a result, 19 plants with both genes knocked out, 3 plants with only the StSGT3 gene knocked out, and 2 plants with only the StGAME4 gene knocked out were obtained.

[0098] In contrast to previous reports, the present invention demonstrated excellent results, with a multi-gene knock-out correction efficiency of approximately 20% when multi-RNPs were applied. This was particularly evident in the polyploid crop potato, demonstrating its exceptional excellence. This demonstrates that the gene correction efficiency confirmed at the protoplast level is almost identical to the efficiency observed in regenerated plants, demonstrating that the efficiency of the selected guide RNA and the smooth and well-established linkage between the protoplast and the entire process of obtaining plants were achieved.

[0099] Analysis of gene editing type Individual number Gene editing type 902 Simultaneous knock-out of genes (StSGT3 and StGAME4) 361 Gene (StGAME4) knock-out 231 Gene (StSGT3) knock-out 182 Gene knockdown (StSGT3 50% and StGAME4 25%) 22 Gene knockdown (StSGT3 25% and StGAME4 50%)

[0100] Example 5. Analysis of solanine and chaconine contents in StGAME4 and StSGT3 gene correctors

[0101] SGAs such as solanine and chaconine are known to be strongly expressed not only in potato tubers but also in flowers and leaves (Smith et al., Trends in Food Sci Tech. 7(4):126-131, 1996).

[0102] In the present invention, it was confirmed that the contents of solanine and chaconine in leaves were similar to the results of Smith et al. Specifically, the Solanum tuberosum L. cv. Desiree variety contained 583.74 mg / kg dry weight of solanine and 671.27 mg / kg dry weight of chaconine.

[0103] In the present invention, it was intended to simultaneously inhibit the functions of StGAME4, which is involved in the synthesis of solanidine from cholesterol, and StSGT3, which is involved in the synthesis of solanine and chaconine, which are downstream processes.

[0104]

[0105]

[0106] In the case of the SG2 gene-edited strain that knocked down the function of the StSGT3 gene, which inhibits the synthesis of solanine and chaconine, by half (StGAME4 had a 25% decrease in function), solanine was measured at 414.06 mg / kg dry weight, showing a reduction effect of approximately 29%, and chaconine was observed to accumulate at 574.69 mg / kg dry weight, showing a reduction effect of approximately 14%.

[0107] On the other hand, in the case of the SG18 gene-edited mutant that knocked down the function of the StGAME4 gene involved in solanidine synthesis from cholesterol, which is the upper process of solanine synthesis, by half (StSGT3 had a 25% decrease in function), solanine showed a reduction effect of approximately 72% to 164.54 mg / kg dry weight, and chaconine showed a reduction effect of approximately 59% to 274.23 mg / kg dry weight.

[0108] In the SG23 gene-edited strain with StSGT3 knocked out, solanine accumulated at 200 ug / kg dry weight, and chaconine accumulated at 420 ug / kg dry weight. In the SG36 gene-edited strain with StGAME4 knocked out, solanine accumulated at 180 ug / kg dry weight, and chaconine accumulated at 370 ug / kg dry weight, showing a rapid decrease in solanine and chaconine in individuals with one gene knocked out.

[0109] Finally, in the case of the SG90 gene-edited strain in which both genes, StGAME4 and StSGT3, were knocked out, the content of solanine and chaconine was 0.00 mg / kg dry weight, showing complete inhibition with no synthesis (Table 3).

[0110]

[0111] Solanine and chaconine standard standard substance concentration Ret. Time Area Concentration (ppm) Solanine 0.01 ppm 5.0647, 767 0.007 0.1 ppm 5.070 74, 922 0.103 1 ppm 5.073 703, 085 1.000 Chaconine 0.01 ppm 4.7196, 915 0.009 0.1 ppm 4.730 66, 471 0.101 1 ppm 4.716 653, 049 1.000

[0112]

[0113] Solanine Chaconine Mutants Ret. Time Area Concentration (mg / kg DW) Ret. Time Area Concentration (mg / kg DW)Desiree5.01940,897,640583.744.73043,786,929671.27SG25.0222 9,009,947474.064.72237,487,619574.69SG185.02111,529,650164.544 .71117,888,608274.23SG235.00216,4220.2004.69128,1130.420SG365. 01615,1250.1804.70924,7740.370SG904.9885770.0004.7031,0250.000

[0114]

[0115] Furthermore, the present invention analyzed the effects of functional inhibition of the two genes, StGAME4 and / or StSGT3, on the accumulation of solanine and chaconine not only in potato leaves but also in potato tubers. For this analysis, sprouted potatoes were used.

[0116] As a result, it was confirmed that the accumulation of solanine and chaconine was significantly reduced or suppressed depending on the level of gene expression suppression of the gene corrector in the tuber. In the case of the SG2 gene corrector that knocked down the function of the StSGT3 gene that suppresses solanine and chaconine synthesis by half (StGAME4 function was reduced by 25%), solanine was measured to be 639.3 mg / kg dry weight in potato tubers, showing an approximately 18% reduction effect, and chaconine was observed to accumulate to be 514.2 mg / kg dry weight, showing an approximately 20% reduction effect.

[0117] On the other hand, in the case of the SG18 gene-edited form that knocked down the function of the StGAME4 gene involved in solanidine synthesis from cholesterol, which is the upper process of solanine synthesis, by half (StSGT3 function was reduced by 25%), solanine in the tuber was reduced by approximately 55% to 351.2 mg / kg dry weight, and chaconine was reduced by approximately 49% to 324.3 mg / kg dry weight.

[0118] In the SG23 gene-edited strain with StSGT3 knocked out, solanine accumulated at 8.25 mg / kg dry weight, and chaconine accumulated at 17.1 mg / kg dry weight, showing inhibitory effects of approximately 98.9% and 97.3%, respectively. In the SG36 gene-edited strain with StGAME4 knocked out, solanine accumulated at 10.85 mg / kg dry weight, and chaconine accumulated at 20.5 mg / kg dry weight, showing a rapid decrease in solanine and chaconine in individuals with one gene knocked out.

[0119] Finally, in the case of the SG90 gene-edited strain in which both StGAME4 and StSGT3 genes were knocked out, the content of solanine and chaconine in the tuber was 0.00 mg / kg dry weight, indicating complete inhibition with no synthesis (Table 4).

[0120] Solanine Chaconine Mutants Concentration (mg / kg DW) Concentration (mg / kg DW) Desiree778.1639.0SG2639.3514.2SG18351.2324.3SG238.2517.1SG3610.8520.5SG900.0000.000

[0121]

[0122] In summary of the above results, it can be seen that in the case of a genetic corrector in which the expression of the two genes of the present invention, StGAME4 and / or StSGT3, is weakened, the accumulation of solanine and / or chaconine is reduced in leaves and tubers. In the case of a genetic corrector in which the expression of the genes is completely suppressed, the accumulation of solanine and chaconine is drastically inhibited, and in particular, it was confirmed that solanine and chaconine are not synthesized at all in a genetic corrector in which both genes are knocked out, compared to a genetic corrector in which one gene is knocked out. This suggests that the two genes are involved in the synthesis of solanine and chaconine, and that it is possible to produce a plant in which the glycoalkaloids, solanine and chaconine, are not synthesized.

[0123]

[0124] From the above description, those skilled in the art will understand that the present invention can be implemented in other specific forms without altering the technical concept or essential characteristics thereof. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present invention should be interpreted as encompassing all changes or modified forms derived from the meaning and scope of the following claims and their equivalent concepts, rather than the detailed description above.

Claims

1. Genetically modified plants with weakened expression of the StGAME4 and StSGT3 genes.

2. In the first paragraph, the plant is a genetically modified plant with reduced glycoalkaloid synthesis.

3. A genetically modified plant according to claim 1, wherein the weakening of gene expression is due to gene knock-out.

4. A genetically modified plant according to claim 2, characterized in that the glycoalkaloid is solanine or chaconine.

5. A genetically modified plant according to claim 1, wherein the plant is of the Solanaceae family.

6. A genetically modified plant, characterized in that in paragraph 5, the Solanaceae plant is at least one species selected from the group consisting of potatoes, tomatoes, and eggplants.

7. A method for producing a genetically modified plant with reduced glycoalkaloid synthesis, comprising a step of weakening the expression of StGAME4 and StSGT3 genes.

8. A method for producing a genetically modified plant according to claim 7, wherein the plant is of the Solanaceae family.

9. A method for producing a genetically modified plant, wherein the weakening of gene expression in paragraph 7 is due to gene knock-out.

10. In the 9th paragraph, the gene knock-out is a complex of guide RNA and endonuclease protein (RNP, ribonucleoprotein); or A method for producing a genetically modified plant, comprising using a recombinant vector comprising DNA encoding a guide RNA and a nucleic acid sequence encoding an endonuclease protein. 11.i) Guide RNA for correcting the base sequence of the StGAME4 gene consisting of sequence number 1; and ii) A composition for correcting a gene of a Solanaceae plant, comprising a guide RNA for correcting the base sequence of the StSGT3 gene consisting of sequence number 3.

12. A composition according to claim 11, characterized in that the guide RNA for correcting the base sequence of the StGAME4 gene consists of the base sequence of sequence number 2.

13. A composition according to claim 11, characterized in that the guide RNA for correcting the base sequence of the StSGT3 gene consists of the base sequence of SEQ ID NO:

4.

14. Use of genetically modified plants with weakened expression of the StGAME4 and / or StSGT3 genes to produce seeds with reduced glycoalkaloid synthesis.

15. Use in the production of genetically modified Solanaceae plants with reduced glycoalkaloid synthesis.

Citation Information

Patent Citations

  • A method for improving crop yield and quality.

    CN115029359B

  • Plant with altered content of steroidal alkaloids

    US20200390053A1

  • Organisms with altered steroidal saponin and steroidal alkaloid levels and methods for producing same

    WO2012095843A1