A microneedle device for delivering a bioactive substance through skin

The microneedle device with a three-dimensional shape and concave-convex design addresses inefficiencies in existing methods by facilitating low-pressure, high-efficiency bioactive substance transfer through the skin with enhanced surface area coverage and tolerability.

WO2026047625A1PCT designated stage Publication Date: 2026-03-05ALDENA THERAPEUTICS INC +1
View PDF 10 Cites 0 Cited by

Patent Information

Application Number
PCT/IB2025/058749
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-08-30
Filing Date
2025-08-29
Publication Date
2026-03-05

AI Technical Summary

Technical Problem

Existing methods and devices for delivering bioactive substances through the skin, such as microneedle particles, are limited in efficiency, depth of transfer, surface area coverage, convenience, and cost, and require high pressure or trained operators.

Method used

A microneedle device with a three-dimensional shape, featuring concave and convex surfaces and outwardly pointing microneedles, allows for efficient creation of micro-punctures in the skin with lower application pressure, enhancing bioactive substance transfer and distribution.

Benefits of technology

The device achieves improved bioactive substance transfer with reduced pressure, increased surface area coverage, and enhanced tolerability, while maintaining efficiency and convenience, compared to conventional methods.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IB2025058749_05032026_PF_FP_ABST
    Figure IB2025058749_05032026_PF_FP_ABST
Patent Text Reader

Abstract

A microneedle device with the ability to puncture micro-holes into a biological tissue such as skin is presented. The device has a concave surface and is optimally configured to have a plurality of arms and microneedles extending outward its body. The device can be used as a plurality of devices in a formulation applied onto the skin. The microneedles are optimally designed to puncture micro-holes into the biological tissue.
Need to check novelty before this filing date? Find Prior Art

Description

A MICRONEEDLE DEVICE FOR DELIVERING A BIOACTIVE SUBSTANCE THROUGH SKIN CROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of priority of U.S. Provisional Application No.63 / 689,131, filed August 30, 2024, the entirety of which is incorporated herein by reference. TECHNICAL FIELD

[0002] This disclosure relates to the field of micro-devices facilitating the delivery of anactive substance through biological tissue. BACKGROUND

[0003] Animals, especially mammals, are usually protected by a thick external layer, suchan epidermis or a skin. Such layer provides a protection against external elements. Such aggressive elements are of many types, for example, abrasion, pressure or cuts. That protection is also effective against the penetration of liquids, gaseous or solid substances into the body of the animal. The absorption of external substances is therefore heavily impacted by the protective layer. If this is a positive protection for the animal, such a protective layer also impairs the absorption of desirable compounds or actives through the skin.

[0004] Many methods and devices have been designed to help the absorption or thepassing of compounds, especially active compounds through the protective layers and through the skin of the mammals for example.

[0005] One of the most common methods and devices may be the injection devices usingsharp hollow needles able to penetrate the skin and transfer a liquid containing an active component into the body.

[0006] Other more sophisticated methods and devices use, for example, patches or soliddevices which surface are covered with microneedles able to penetrate slightly the upper layers of the skin and in which the patches are impregnated with the bioactive component which would then pass more easily through the skin. Alternatively, rigid macrostructures have been described to induce a transdermal drug delivery for example as described in US20130144261.

[0007] Other methods and devices use the abrasion of the skin and the contact with abioactive component. DB1 / 161793602.4

[0008] More recent methods have used microneedle particles of very small size which canbe incorporated into a matrix containing the bioactive. Such microneedles create small punctures or micropores in the skin upon rubbing and somewhat facilitate the transfer of the bioactive. Such microneedle particles, substantially flat, have been described in WO2017151745 (herewith referred as prior-art or conventional STAR particles or flat STAR). Other microneedle devices, substantially spherical, have been described in US20200121900A1. Such devices and methods are, however, of limited efficiency and improvements are needed.

[0009] All these methods and devices have disadvantages: low efficiency of transfer,superficial depth of transfer of the bioactive, inconvenience or pain, complexity, low surface area of transfer, low absorption into the body, high cost, need of a trained operator, etc.

[0010] The transfer of bioactives into the body of an animal, a mammal or human istherefore still a field of development; especially when the enteral / digestive path cannot be used and / or a trans-dermal path is desirable.

[0011] There is a need to have better methods and devices with an improved design totransfer a compound or bioactive components into the body of an animal, preferably a human – especially through the external protective layers of the body.

[0012] There is a need to transfer a compound or a bioactive substance locally onto or intothe skin, epidermis or external layer of a mammal, especially over a large surface area.

[0013] There is a need for having an efficient creation of micropores in the skin tofacilitate the transfer of the bioactive substance. There is a need to improve the design of the devices used for creating such micropores. When microneedles are used there is a need to improve the density of the micropores and / or their depth in the skin. There is a need in particular to enable the optimum creation of punctures / micropores in the skin with relatively low pressure or low time of application (for example by rubbing the devices onto the skin).

[0014] There is a need to have an efficient method and device to transfer such bioactivesubstances onto / into areas of the body which would be difficult to access by other methods.

[0015] There is a need to have such transfer performed in an efficient way, both in termsof amount of bioactive substance transferred, convenience of use, easiness and economics. DB1 / 161793602.4SUMMARY OF INVENTION

[0016] The present invention proposes a device and a related method that can facilitate thetransfer of a compound or a bioactive substance through the external protective layer of an animal, such as human skin.

[0017] The device comprises a plurality of microneedles configured to promote thecreation of micro-punctures / micropores when applied to a biological tissue. A plurality of devices can be used together, for example in a formulation applied to the skin of a mammal.

[0018] The shapes, dimensions and / or spatial configuration of the device's microneedlesallow micropores to have a sufficient density and depth to facilitate the passing / absorption of a bioactive substance through or into the biological tissue, such as skin. The depth of punctures through the protective layer may be adapted to change the perception of the punctuation process by the animal.

[0019] In one aspect the invention relates to a microneedle device that has a particularthree-dimensional shape and has a concave and, optionally, a convex surface.

[0020] In one aspect the microneedles pointing outwardly from the body (or core) of thedevice are sufficiently sharp and / or thin and are positioned in a way to facilitate the puncture of the biological tissue and the creation of micro-holes.

[0021] In one embodiment, a plurality of microneedles devices is associated with abioactive substance (such as a cosmetic active or a medicament), possibly in a matrix such as a gel, a cream and / or an ointment. The association enables an optimum / improved transfer of the bioactive substance to the animal or mammal through its external protective barrier or skin.

[0022] In one embodiment, the invention relates to a method of transferring a bioactivesubstance to an animal or a mammal or a human.

[0023] In one embodiment, the invention relates to a method of treating a physiologicalcondition or addressing a non-medical, but undesired condition, in particular an aesthetic, cosmetic or dermatological condition. In one embodiment, the invention relates to enhancing the prevention against a medical pathology or a non-medical undesired condition. BRIEF DESCRIPTION OF DRAWINGS

[0024] Figures 1A-1B represents a microneedle device of the invention having threemicroneedles. DB1 / 161793602.4

[0025] Figures 2A-2B represents a microneedle device of the invention having threearms / microneedles and one additional arm.

[0026] Figure 3 shows a typical performance test of the microneedle device of theinvention in comparison to a conventional alternative (by TransEpidermal Water Loss tests).

[0027] Figures 4A- 4D are photographs of the devices tested in Figure 3. Fig. 4A shows aflat device (flat STAR). Fig.4B shows Shape 1. Fig.4C shows Shape 2. Fig.4D shows Shape 3.

[0028] Figure 5 is a graph of the quantity of skin ALD-10514 days after a loadingregimen of ALD-105 applied in a formulation with the microneedles devices of the invention (Shape 1, 2, 3 ) or with the prior art STAR flat particles and also compared to an intradermal injection 28 days after injection

[0029] Figure 6A and B are graphs showing that the microneedle devices according tothe invention (Shape 1, 2, 3) do not require as much pressure as the flat STAR (prior art) and showing their performance at perforing the skin at 20 and 10 kPa

[0030] Figure 7 shows the flat STAR (prior art) and shape 2 microneedle device(according to the invention) tolerance during rubbing at 20 kPa on the healthy skin of healthy individuals are well tolerated. DETAILED DESCRIPTION

[0031] In one embodiment, the invention comprises micro-needles devices. The micro-needle device comprises a body having two opposing surfaces and a geometrical center, at least three arms and at least 3 microneedles. One of the opposite surfaces is concave. The second opposite surface may be flat or convex or also concave. The opposite surfaces may present some flat areas, even as part of their general concavity or convexity. In other words, the concave surface area may represent less than 100% of the total surface area of the concave surface (preferably it represents more than 50%, or more than 80% of the total surface area of said concave surface). Similarly, the convex surface area, when present, may represent less than 100% of the total surface area of the convex surface (preferably it represents more than 50%, or more than 80% of the total surface area of said concave surface). This applies to any concave or convex surface present. Similarly, a flat surface may comprise unflat areas (preferably the flat surface area represents more than 50%, or more than 80% of the total surface area of said flat surface).

[0032] In one embodiment, the microneedle device comprises one concave surface andone convex opposite surface. In one embodiment, the microneedle device comprises one DB1 / 161793602.4concave surface and one flat surface. In one embodiment the microneedle device comprises two concave surfaces.

[0033] In some embodiments, each arm has a distal end and proximal end. In someembodiments, the proximal end is attached or part of the body. In some embodiments, each arm extends from, or protrudes from, the body. In some embodiments, the arms point to different directions separated by an angle of more than 20 degrees, 30 degrees, 40 degrees, 50 degrees, 60 degrees, 70 degrees, 80 degrees, 90 degrees, 100 degrees, or 110 degrees. Without limitation, the preferred number of arms and microneedles is three of each. However, in some embodiments, the number of arms can be four, five, six, or seven and the corresponding number of microneedles can be four, five, six, or seven. In one embodiment the number of arms and / or the number of microneedles per device is less than 10 or less than 5. Having at least three arms on the device improves the benefit of not integrating into the skin and a limited number of arms improves the creation of microholes with the desirable depth. Indirectly it may also improve the transfer of the bioactive substance into the tissue, for example by limiting the excessive roll or glide of the device on the surface of the tissue.

[0034] At a distal end of each arm, a microneedle is arranged. Each microneedle has ageneral direction, most often similar to the direction of the arm, pointing outward and away from the center of the body of the microneedle device. In some embodiments, the angle between two of the general directions of the microneedles is at least 20 degrees, at least 30 degrees, at least 40 degrees, at least 50 degrees, at least 60 degrees, at least 70 degrees, at least 80 degrees, at least 90 degrees, or at least 110 degrees (measured as projected in the plane formed by three microneedles). In some embodiments, the microneedles are an integral part of the arms and / or represent the end or tip of the arm.

[0035] By pointing out of the microneedle device, the microneedles have a better abilityto puncture, and / or create microholes or micropores in the biological tissue. A spatial separation between the directions of the microneedles also promotes a better ability to create microholes and punctures.

[0036] In some embodiments, the number of microneedles on the device is three or four.In some embodiments, the device has a tetrahedral shape. This has been found to be a good compromise between the resistance of the device (prevention of breaking) and the ability to create microholes in the biological tissue.

[0037] Having a concave surface or a convex surface, the microneedle device is notgenerally flat but has a remarkable three-dimensional shape. The convex surface for example induces a better sliding of the microdevice when rubbed against the biological tissue, and thus DB1 / 161793602.4a better dispersion of the microneedles, leading to a higher and more homogeneous density of microholes created, and therefore a better efficiency to diffuse the bioactive substance.

[0038] The concave surface helps the pointing of the microneedles outwardly and thusenhances the ability to puncture a tissue. The concave and / or convex surfaces can result either from the original design of the manufacturing mold (having themself convex and / or concave surfaces) used to produce the device or can result from the controlled shrinkage or deformation of the device during some steps of the manufacture of the device (for example during the drying and / or the heat treatment). Also, concerning the slurry injected in the mold and used to create the device, the selection of the components and additives of the slurry improve the wetting behavior between the mold and the slurry, leading to a better filling of the mold and / or helps to control the shrinkage and / or deformation of the device during its manufacture. Similarly, the spatial orientation of the arms and microneedles can be dictated either by the shape of the mold or by the controlled shrinkage of the material during or after manufacture, or by the composition of the slurry. It is hypothesized, without being bound to the theory, that all these factors (including shape of mold, composition of the slurry, process parameters (e.g., duration of heating or cooling temperature), must be carefully selected and all play together synergistically to deliver the desired shape and quality of the end device.

[0039] In some embodiments, the microneedle devices of the invention have an improvedability to move on or roll on the tissue and to be dispersed, especially when associated with a gel and ointment or a cream.

[0040] It has been observed by the inventors that the application of the STAR particles ofthe 3D shape of the invention does not require any extra pressure than a regular gel application pressure (10kPa) to puncture the skin.

[0041] In some embodiments, the pressure required to deliver the compound through theskin is lower than the pressure to be used with the flat prior art STAR particles in order to obtain the same performance. This advantageous effect of the invention provides for a better convenience (e.g. less rubbing) and usability and safeguards the skin of the user. This is in particular illustrated in Figures 6A and 6B.

[0042] Similarly the STAR particles of the invention, in some embodiments, deliver asimilar tolerability to the one of the prior art STAR particles. This has been shown especially at the usual pressure application of 20kPa. Indeed one could have expected that the 3D structure of the particles according to the invention would have created more pain for the user. The inventors have observed that this is not the case, as for example illustrated in Figure 7. DB1 / 161793602.4

[0043] In one embodiment the microneedle device will not become embedded into thebiological tissue it is applied onto. In one embodiment, the microneedle device will not break during the application and will not leave parts of it embedded into the biological tissue. The application can be done by any suitable means, in particular by rubbing, with the hand or with a specific application apparatus, a composition comprising a plurality of microneedle devices onto the skin.

[0044] In one embodiment, the microneedle device of the invention is substantiallyelongated and has a concave surface and optionally a convex surface. In one embodiment of the invention, the microneedle device is not substantially spherical or not totally spherical. Without being bound to the theory, it is believed that a spherical or substantially spherical device has a high tendency to roll over the biological tissue too easily. The performance as for the creation of microholes is therefore somewhat impaired. Additionally, the manufacture of spherical devices requires complex and specific methods and may present a cost disadvantage.

[0045] In one embodiment of the invention, at least one arm, or at least a portion of thearm, is beveled. The distal end of the arm may be beveled. The overall shape of the arm may be beveled. The beveled portion or portions may provide additional sharpness and ability to puncture a tissue. In one embodiment, all the arms of the device are beveled or have beveled portions. In one embodiment, at least one of the beveled portion or portions, optionally all the beveled portions, are beveled in a portion opposite to the concave surface.

[0046] In one embodiment, the micro-needled device is made of, comprises or consists of,a substantially cured moldable plastic material, a metal, or a ceramic material.

[0047] In some embodiments, the microneedle devices are made of, or comprise, one ormore of aluminum oxide (Al2O3), of zirconium dioxide (ZrO2), of hydroxyapatite (Ca10(PO4)6(OH)2), of calcium phosphate (Ca3(PO4)2), of silicon carbide (SiC), of calcium sodium phosphosilicate, or any other element formed from a mixture of these elements (including stable and metastable phases that can occur).

[0048] The material of the microneedle devices is sufficiently resistant to preserve itsintegrity without breakage during its manufacturing and / or during its use. It is also sufficiently hard to have microneedles of enough sharpness and that can penetrate the biological tissue.

[0049] In one embodiment, the microneedle device has regions between the microneedlesthat do not present any (or only very few) angular edge or angular angles (especially when observed from a plane formed by three of the microneedles). In other words, the regions between the microneedles have rounded or smooth boundaries. This geometrical characteristic DB1 / 161793602.4has been shown to induce less breakage, during manufacturing and / or use, due to the absence of any angular point or line.

[0050] In one embodiment, the microneedle device has one, two, or three additional armsprotruding from the convex or from the concave surface (or from both) of the body. In one embodiment, the microneedle device has at least one additional arm protruding from the convex or from the concave surface (or from both) of the body. The additional arm can be a convex protuberance out of the concave or convex surface. In some embodiments, the additional arm(s) points into a direction that is perpendicular to the surface, and / or a direction that is perpendicular to the plane formed by three microneedles. Such additional arm(s) has a primary advantageous effect on the ability of the device to roll or slide on the surface of the biological tissue (enhancing dispersion upon use and increasing the surface area of the micro- holes). The additional arm(s) can be associated with additional microneedle(s) at their distal end. Such microneedles are, as described, thin and sharp. In this case, the additional arms and additional microneedles also have the ability to puncture the biological tissue and create additional micro-holes. In some embodiments, an additional arm lacks a microneedle.

[0051] In one embodiment, the microneedle device comprises microneedles that aresufficiently thin and sharp, while keeping a good resistance to breakage, to easily puncture the biological tissue or skin. A thin microneedle is preferred. A sharp microneedle is also preferred. The extremity of a microneedle can be encompassed by a circle of less than 60 micrometers, less than 50 micrometers, less than 40 micrometers, less than 30 micrometers, less than 25 micrometers, less than 15 micrometers, less than 10 micrometers, or less than 6 micrometers in tip diameter (or in cross sectional maximum dimension). Alternatively, or additionally, the extremity or distal end of the microneedles can be encompassed by a cone having an angle of less than 45 degrees, or less than 30 degrees, less than 20 degrees, less than 10 degrees, less than 5 degrees, or less than 2.5 degrees. A smaller angle means that the microneedles are sharp and thin at their extremity, promoting a good penetration in the tissue or skin.

[0052] In one embodiment, the microneedle device has a small overall dimension. Themicroneedle device can be encompassed by a circle of less than 3000 micrometers, less than 2000 micrometers, less than 1500 micrometers, less than 1000 micrometers, less than 900 micrometers, less than 600 micrometers, or less than 500 micrometers in diameter. In some embodiments, the encompassing circle is between 500 micrometers and 1500 micrometers or between 100 micrometers and 600 micrometers diameter. DB1 / 161793602.4

[0053] In one embodiment, the distance between the center of the body of the device andany microneedle (or distal extremity thereof) is less than 800 micrometers, less than 700 micrometers, less than 600 micrometers, or less than 500 micrometers, less than 400 micrometers, less than 300 micrometers, or less than 200 micrometers. In some embodiments, such distance is between 300 micrometers and 600 micrometers.

[0054] In some embodiments, the overall size of the microneedle device is a balancebetween its ability to rub / roll / slide on the tissue (a small size is better) and its inability to completely pass through the tissue (a larger size and / or pyramidal or conic shape preventing this). It is thought that the device of the invention, or its arms or microneedles, should be shaped and dimensionalized such as to avoid fully entering, or becoming embedded or passing into the tissue. Without being bound to the theory, it is thought that such passing through or full embedding or full entering is undesirable as it introduces a foreign body into the tissue and that its removal may be complex or uncertain. However, without being bound to the theory, in some embodiments, a device of smaller size allows an improved density of devices and therefore an improved creation of microholes over a larger surface area as well as a better tolerability during its application.

[0055] The microneedle device has a defined thickness of material. That thickness isdefined by the distance between the first opposite surface and the second opposite surface, especially at its body center (measured perpendicularly to the surfaces). In one embodiment, the material thickness is between 20 micrometers and 120 micrometers, between 550 micrometers and 600 micrometers, between 100 micrometers and 450 micrometers, or between 150 and 250 micrometers. In one embodiment said thickness is 30 micrometers, 50 micrometers, 70 micrometers, 100 micrometers, 150 micrometers, 200 micrometers, 250 micrometers or 300 micrometers. In one embodiment, the thickness of material is at least 100 micrometers, at least 200 micrometers, or at least 300 micrometers. The thickness of material must be sufficient to enhance the resistance of the device (during its manufacturing and / or during its use), while being thin enough to allow for a good sharpness (and ability to puncture the tissue) of the microneedles. Additionally, the thickness influences the elasticity of the three-dimensional device on the tissue.

[0056] The microneedle device in the invention has a particular three-dimensional shape:The presence of a concave surface and arms / microneedles extending outward induces a curved body (contrary to a generally flat body). The distance between the plane defined by the distal ends of three of the microneedles and the center of the second surface represents the 3D thickness of the device. In one embodiment, the 3D thickness of the device is at least 20 DB1 / 161793602.4micrometers, at least 50 micrometers, at least 100 micrometers, at least 150 micrometers, at least 250 micrometers, at least 350 micrometers, or at least 500 micrometers. In one embodiment, the 3D thickness of the device is between 50 micrometers and 1200 micrometers, between 100 micrometers and 800 micrometers, between 200 and 600 micrometers. In one embodiment, the 3D thickness of the device is less than 1200 micrometers, less than 800 micrometers, less than 500 micrometers, less than 300 micrometers, or less than 100 micrometers.

[0057] A larger 3D thickness of the device may impact positively the device ability topuncture the tissue and / or the ability to roll / slide on the biological tissue. However too large 3D thickness of the device may negatively impact its tolerability on the skin and / or its resistance during manufacturing and / or during use.

[0058] In one embodiment of the invention, the microneedles are both sufficiently sharpand thin and have sufficient resistance to efficiently puncture the tissue and create microholes / micropores on the biological tissue. Such microholes can be of 5 micrometers in diameter, 6 micrometers in diameter, 10 micrometers in diameter, 15 micrometers in diameter, 20 micrometers in diameter, 30 micrometers in diameter, 40 micrometers in diameter, 50 micrometers in diameter, 100 micrometers in diameter, 200 micrometers in diameter, 500 micrometers in diameter, 800 micrometers in diameter, or 1000 micrometers in diameter. In some embodiments, the microholes can be between 5 micrometers in diameter and 100 micrometers in diameter, between 20 micrometers in diameter and 50 micrometers in diameter, or between 10 micrometers in diameter and 500 micrometers in diameter.

[0059] In one embodiment, the biological tissue is an animal, a mammal or a human skinor epidermis.

[0060] In one embodiment, the invention relates to a composition comprising a bioactivesubstance (also abbreviated “bioactive”) or active substance. Such bioactive substance can be an inducer of immune response and / or a dermatologically active substance and / or a medicament and / or a cosmetic active and / or an aesthetically active and / or a medically active substance and / or a non-medically active substance. The composition comprises a plurality of microneedle devices. The concentration of the microneedle devices in the composition can be between 1 w / w % and 30 w / w %, between 2.5 w / w % and 25 w / w %, or between 5 w / w % to 15 w / w %. The concentration of the microneedle devices in the composition can be about 2 w / w %, about 5 w / w %, or about 10 w / w %. In one embodiment, such concentration is more than 1 w / w %, more than 2 w / w %, more than 5 w / w %, more than 10 w / w %, or more than 20 % w / w of the composition. DB1 / 161793602.4

[0061] In one embodiment, the composition also comprises a gel, a cream, an ointment oran excipient. One of its effects may be to modify or decrease the overall viscosity of the composition such as to obtain a better dispersibility of the composition on the biological tissue. With that, an enlarged area of the tissue can be reached or covered by the composition.

[0062] In one embodiment of the invention, the gel, cream, ointment, or excipient isselected such as to maintain the composition at a sufficient viscosity to keep the microneedle devices in suspension, thus insuring the homogeneity of the composition.

[0063] The bioactive substance can comprise, in one embodiment, a protein, a peptide, abioactive peptide, and / or a nucleotide and / or an oligonucleotide and / or a plurality of nucleotides and / or a siRNA. Other and additional bioactives have been described in WO2017151745, U.S.11,291,816, U.S.20220226626, each of which is incorporated by reference in its entirety.

[0064] siRNA is a small (approximately 21-23 nucleotides) double-stranded RNA,comprised of a passenger strand (sense strand) and an active, guide strand (antisense strand), which is complementary to the target mRNA (Alshaer et al,, siRNA: Mechanism of action, challenges, and therapeutic approaches (European Journal of Pharmacology, August, 15, 2121, 905(5):174178). Upon internalization in the cells, the antisense strand of the siRNA is loaded into an RNA-induced silencing complex (RISC) capable of recognizing and cleaving complementary targeted mRNA, thus silencing the mRNA and aborting target protein translation. As the target specificity / selectivity is determined simply by the sequence of the antisense strand, siRNA sequences are selected among the transcriptome (full range of mRNA), representing a highly programable and specific / selective silencing-method. Unmodified siRNAs have a half-life of less than 5 minutes in circulation, without permeating intact cellular membranes. Chemical modifications are introduced at the level of the phosphate backbone, the ribose moiety or the base. Typically, these modifications are simultaneously introduced in siRNA. Overall, the precise chemical modifications of siRNAs increase their efficacy, specificity, and stability and reduce their toxicity and immunogenicity. In addition, siRNA-based drugs require addition of a conjugate to enable tissue targeting and efficient delivery.

[0065] In some embodiments, the bioactive substance is an siRNA comprising or having apassenger strand (sense strand) and an active, guide strand (antisense strand), which is complementary to the respective target (as described in SEQ ID NO.1 to SEQ ID NO.3). DB1 / 161793602.4# SequenceUCCAGAAACAUUGAAUAAGU 20 mer targetSEQ ID NO.1 sequence 5’3' SEQ ID NO. 2 UCUUAUUCAAUGUUUCUGGA antisense 5'-3'SEQ ID NO. 3 AAACAUUGAAUAAGA sense 5'-3'

[0066] In one aspect, the invention relates to a method of transferring a bioactivesubstance into an animal, a mammal or a human through the skin or epidermis, by rubbing the composition of the invention onto the skin or epidermis. The microneedle of the devices of the composition creates microholes / punctures to the skin or epidermis. This enables the bioactive to pass into the body of the animal or human.

[0067] In one aspect, the invention relates to the treatment or prevention of suboptimal orpathological conditions, especially in mammals or in humans.

[0068] In one embodiment, the invention relates to the use of the described microneedledevices and / or of the described compositions for use in the treatment or prevention of suboptimal or pathological conditions.

[0069] In one embodiment, the intended use is for non-medical use, such as cosmeticaluse, or aesthetic use, of the described microneedle devices or of the described compositions. In one embodiment, the invention relates to a non-medical method for treating non-medical suboptimal conditions (such as aesthetic or dermatological conditions).

[0070] The undesired conditions, whether pathological, dermatological, aesthetical,medical or non-medical, or prevention thereof, addressed by the present invention include inflammations, inflammatory skin diseases, erythema, alopecia, atopic dermatitis, allergic conditions, vitiligo, skin cancer, superficial skin cancer, chronic autoimmune diseases as well as the need of vaccination and the need of induction of an immune response.

[0071] The invention is of particular use for administering a bioactive substance that isnot well tolerated or inefficient or not conveniently administered or not efficiently administered, by topical, enteral, oral or parenteral paths.

[0072] In some aspects the invention relates to a microneedle device as described, or thecomposition as described that are especially adapted for enabling the efficient delivery of a compound or a bioactive through a biological tissue by applying a pressure of less than 40 kPa or less than 20 kPa or less than 10 kPa, optionally combined with a rubbing action. The delivery is intended to be of high efficiency and to not induce discomfort or pain to the subject. DB1 / 161793602.4

[0073] In some aspects, the invention relates to methods as described that also comprisethe step of applying a composition and / or microneedle devices as described on a biological tissue, preferably a mammal or human skin, with a pressure of less than 40 kPa or less than 20 kPa or less than 10 kPa. Such methods of the inventions are well-tolerated by the subjects as they combine high transfer efficiency with low side effects (such as irritation, pain or discomfort), due to the low pressure of application.

[0074] Manufacturing process

[0075] The microneedle devices of the invention can be made by a combination ofconventional ceramic processes, including molding / demolding and / or other techniques including laser ablation, for example as those presented in references WO / 2017151745 and WO / 2021081260. The microneedle devices of the invention can also be made by a combination of conventional ceramics processes, including molding / demolding, these processes being cost-efficient compared to the laser ablation processes

[0076] Alternatively, the microneedle devices of the invention can optimally bemanufactured by an optimized and improved process such as the processes presented in the co-pending patent application titled “Process for manufacturing micro-devices having thin parts or extensions, especially for delivering a bioactive substance to a mammal” filed on the same date as the present patent application. EXAMPLES

[0077] Figures 1A- 1B and Figures 2A-2B represent examples of the invention.

[0078] Figures 1A- 1B show a microneedle device having three arms and threemicroneedles. The microneedles are pointing outward of the device in a configuration that is especially suitable for the intended use (e.g., for creating microholes / punctures on the surface of a biological tissue). The microneedles are elongated, thin and sharp. The picture corresponds to “Shape 1” of Figure 3.

[0079] Figures 2A-2B show a microneedle device having three arms and threemicroneedles as well as an additional arm. The three microneedles are pointing outward of the device in a configuration that is especially suitable for the intended use (e.g., for creating microholes / punctures on the surface of a biological tissue). The microneedles are elongated, thin and sharp. The additional arm points outward of the convex surface. It also helps the rolling, gliding, and / or sliding of the device on the biological tissue, together with potentially creating additional micropunctures on the tissue upon pressure. DB1 / 161793602.4

[0080] Figure 3 illustrates performance of the microneedle devices of the compositions ofthe inventions (“Shape 1, 2, 3”) in comparison to a conventional device (“Flat”) . The microneedle devices of Figures 1A-1B have been tested for their ability to create micro- punctures / microholes on a test biological tissue. For comparison, other devices have been tested together with variations of the devices of the invention. Photographs of the tested devices are shown in Figures 4A-4D and the test results are presented in Figure 3.

[0081] The experiment was performed as follows:

[0082] Frozen dermatomed human skin (thickness between 500 µm and 700 µm) fromthree donors has been selected (samples obtained in accordance with legal and ethical requirements). Square pieces of skin, 3 cm by 3 cm, were cut from each donor after thawing and laid out flat on a support, and then kept until experimental procedure.

[0083] The microneedle devices tested are (a) according to the present invention, i.e. witha concave and a convex surface (samples “Shape 1”, “Shape 2”, “Shape 3”) or (b) according to and as described in WO2017151745, i.e., substantially flat (“FLAT”).

[0084] The microneedle devices were incorporated in a standard Aloe Vera gel (Fruit ofthe Earth Advance Research 100% gel) at a concentration of 10.45 w / w% in the gel.

[0085] The pieces were rubbed with the test samples of the composition (10.45 w / w%microneedle devices in Aloe Vera gel at 10 mg / cm2) applying a pressure of approximately 40 kPa-80 kPa in a circular motion; 30 rubbing seconds. Just after, microneedle devices were removed with warm water pads.

[0086] TransEpidermal Water Loss test (TEWL): Before applying the microneedledevices on a dry skin, the initial TEWL level was measured on each zone of skin. TEWL measures were performed at 15-30 minutes after the application of the samples.

[0087] The data are mean ± SD and CV (%) values per donor and for the three donors wascalculated for TEWL.

[0088] Figure 3 shows the TEWL loss results for the conventional sample “FLAT” andfor the 3 microneedle devices of the invention (“Shape 1”, “Shape 2”, “Shape 3”).

[0089] Table 1. The tested devices.Microneedle device Thickness of materialLength of arm (measured from the (at the center of the distal extremity of the arm to the mid- body of the device) distance point between two arms along (micrometers) the boundary of material) (micrometers) DB1 / 161793602.4Flat 125 350Shape 1 200 435Shape 2 160 450Shape 3 210 310

[0090] The results clearly show the superiority of the microneedle devices of theinvention (samples “Shape 1”, “Shape 2”, “Shape 3”) over the conventional one (“FLAT”). This indicates a superior water permeability, i.e. a better creation of micro-holes in the skin.

[0091] Example: siRNA PK live minipig.To investigate the performance of the different shape of STARs at delivering siRNA in skin in vivo, a skin pharmacokinetic experiment was performed in minipig with the 4 types of particles (microneedles) (Shape 1, 2, 3 according to the invention and conventional ”flat STAR“ particle). A minipig was applied 3 times a week for a week the formulation containing 10 w / w% of one type of the particle with 5 mM of the siRNA (named ALD-105). Fourteen (14) days after the last application, skin biopsies were obtained, and upper dermis and epidermis tissues were analyzed for ALD-105 quantity per gram of tissue using a LCMS method. The flat STAR and Shape 3 delivered similar levels of siRNA. This level was comparable to an ID injection 28 days post-injection. Interestingly, Shape 1 and Shape 2 were able to deliver substantially more siRNA in the skin (Figure 5). Figure 5: PK of ALD-105 siRNA 14 days following the loading regimen consisting of 3 applications over a week. The data are mean ± SD. Levels obtained with transepidermal application of a formulation containing particles / microneedle devices are compared to the level observed 28 days after a single intradermal injection of 50 ^l at 400 ^M in the skin. The data show a clear performance superiority of the microneedle devices of the invention in comparison to conventional STAR particles for delivering an active into the skin of a mammal. The results also show a superiority of the delivery by the microneedle devices of the invention in comparison to an intradermal injection.

[0092] Example: Performance on human skin ex vivo.To investigate the required pressure to puncture the skin sufficiently, the inventors investigated the ability of the 4 different shapes of particles / microneedle devices (Shape 1, 2, DB1 / 161793602.43 of the invention and convention flat STAR) at increasing TEWL at different application pressures. The experiment was performed as follows: Frozen dermatomed human skin (thickness between 500 µm and 700 µm) from three donors has been selected (samples obtained in accordance with legal and ethical requirements and tests performed accordingly). Square pieces of skin, 3 cm by 3 cm, were cut from each donor after thawing and laid out flat on a support, and then kept until experimental procedure. The microneedle devices tested are (a) according to the present invention, i.e. with a concave and a convex surface (samples “Shape 1”, “Shape 2”, “Shape 3”) or (b) according to and as described in WO2017151745, i.e., substantially flat (“FLAT”). The microneedle devices were incorporated in a standard Aloe Vera gel (Fruit of the Earth Advance Research 100% gel) at a concentration of 10.45 w / w% in the gel. The pieces were rubbed with the test samples of the composition (10.45 w / w% microneedle devices in Aloe Vera gel at 10 mg / cm2) applying a pressure of approximately 10, 20 or 40kPa in a circular motion; 30 rubbing seconds. Just after, microneedle devices were removed with warm water pads. TransEpidermal Water Loss test (TEWL): Before applying the microneedle devices on a dry skin, the initial TEWL level was measured on each zone of skin. TEWL measures were performed at 15-30 minutes after the application of the samples. The data are mean ± SD and CV (%) values per donor and for the three donors was calculated for TEWL.

[0093] Figures 6A and 6B illustrate the performance of the microneedle devices of thecompositions of the inventions. Photographs of the tested devices are shown in Figure 4. and the test results are presented in Figure 6. Figure 6A and 6B shows the TEWL (g / m2 / s) loss results for the conventional sample “FLAT” and for the 3 microneedle devices of the invention (“Shape 1”, “Shape 2”, “Shape 3”) at 40, 20 (Fig.6A) and 10 kPa (Fig.6B).

[0094] The test results clearly show that the Shape 1, 2, and 3 of the invention are largelymore potent at perforing the skin compared to the conventional Flat STAR, and especially at a relatively low pressure (10 and 20 kPa).

[0095] Example: Tolerability, Performance in human volunteers.Three human volunteers applied the conventional Flat STAR and Shape 2 (according to invention) on their skin to test the tolerability of the microneedle particles. The experiment was performed as follows: A gel composition was prepared according to co-pending patent application ”Topical Formulations”, first inventor Carine Blanchard, filed under US 63 / 57,253 on 06 / 07 / 2024. Either Shape 2 or Flat STAR were incorporated into the gel at a final concentration of 10 w / w%. The human volunteers (n=3) were blinded to the type of microneedles / particle applied. The application procedure was performed with 2 fingers. DB1 / 161793602.4Pressure was calibrated for 20 kPa before application using a scale and assuming a 1cm2 surface of application for one finger. Application was performed for 30 sec using circular motion. The pain during the application was assessed right after the 30 seconds application time. Both Flat STAR and Shape 2 generated minimum pain at 20 kPa on healthy volunteer skin. Figure 7 displays the pain felt during the application using a visual analogue pain (VAS) assuming 0 is no pain and 10 is the worst imaginable pain. This shows that, despite its 3D-structure and the presence of outwardly oriented microneedles, Shape 2 according to the invention induces a similar level of ”pain” (or discomfort) in comparison to the conventional flat STAR. Together with their better ability to deliver an active through the skin, it confirms the superiority of the devices according to the invention. DB1 / 161793602.4

Claims

CLAIMS 1. A microneedle device comprising:a body having a first and a second opposite surfaces; a geometrical center; at least three arms, each having a distal and a proximal end; the proximal end being part of the body; at least three microneedles, each arranged at the distal end of each arm, and each having a general direction pointing away from the geometrical center and wherein the angle between any two general directions is at least 30 degrees, at least 60 degrees, or at least 90 degrees measured by projection in the plane formed by three distal ends, wherein the first opposite surface is concave, and / or the second opposite surface is convex.

2. The microneedle device of claim 1, wherein the geometrical center lies outside the planeof the three distal ends.

3. The microneedle device of claim 1 or claim 2, comprising a moldable plastic material,a metal, and / or a ceramic material.

4. The microneedle device of any of the proceeding claims, comprising one or more ofAl2O3, ZrO2,hydroxyapatite, calcium sodium phosphosilicate, (Ca10(PO4)6(OH)2), calcium phosphate (Ca3(PO4)2), silicon carbide (SiC).

5. The microneedle device of any of the preceding claims, wherein the body region joiningany two arms has a rounded or smooth material boundary and / or lacks any angular edge when observed from a direction perpendicular to the plane formed by the three distal ends.

6. The microneedle device of any of the preceding claims, having at least one additionalarm, and optionally an additional microneedle, pointing out of the second opposite surface, and / or of the first opposite surface. DB1 / 161793602.

47. The microneedle device of any of the preceding claims, having at least one additionalarm pointing in a direction perpendicular to the opposite surfaces and / or in a direction perpendicular to the plane formed by said the three distal ends.

8. The microneedle device of any of the preceding claims, wherein the microneedles haveextremities encompassed in a cone of less than 45 degrees, less than 30 degrees, less than 20 degrees, less than 10 degrees, less than 5 degrees, or less than 2.5 degrees of opening, and / or are beveled.

9. The microneedle device of any of the preceding claims, wherein the microneedle deviceis encompassed by a circle of less than 2000 micrometers in diameter, less than 1500 micrometers in diameter, less than 1000 micrometers in diameter, or less than 900 micrometers in diameter.

10. The microneedle device of any of the preceding claims, wherein the microneedle deviceis encompassed by a circle of less than 600 micrometers in diameter, less than 500 micrometers in diameter, less than 400 micrometers in diameter, or less than 300 micrometers in diameter.

11. The microneedle device of any of the preceding claims, wherein the microneedle deviceis encompassed by a circle and any of the distance of any of said microneedle to the geometrical center is less than 800 micrometers, less than 700 micrometers, less than 600 micrometers, less than 500 micrometers, less than 400 micrometers, less than 300 micrometers, or less than 200 micrometers.

12. The microneedle device of any of the preceding claims, wherein said microneedlesdevice has a thickness of material which is a distance between the first and second opposite surfaces as measured in a perpendicular direction to the opposite surfaces.

13. The microneedle device of claim 12, wherein the thickness of material is between 50micrometers and 600 micrometers or between 100 micrometers and 450 micrometers. DB1 / 161793602.

414. The microneedle device of any of the preceding claims, wherein the distance betweenthe plane defined by the distal ends of three of the microneedles and the center of the second opposite surface is at least 50 micrometers, at least 100 micrometers, at least 150 micrometers, at least 350 micrometers, or at least 500 micrometers.

15. The microneedle device of any of the preceding claims, wherein the distance betweenthe plane of the three distal ends and the geometrical center is at least 50 micrometers, at least 100 micrometers, at least 150 micrometers, at least 350 micrometers, or at least 500 micrometers.

16. The microneedle device of any of the preceding claims, wherein said microneedles arestructured, and / or are sufficiently sharp and / or have sufficient resistance, to be able to penetrate and / or create micro-holes in a biological tissue.

17. The microneedle device of claim 16, wherein the biological tissue is an animal skin,wherein the animal skin is a mammal skin or epidermis or human skin or epidermis.

18. The microneedle device of any of the preceding claims, wherein extremities of eachmicroneedle can be encompassed by a circle of less than 60 micrometers in diameter, less than 50 micrometers in diameter, less than 40 micrometers in diameter, less than 30 micrometers in diameter, or less than 25 micrometers in diameter, or less than 15 micrometers in diameter, less than 10 micrometers in diameter, or less than 6 micrometers in diameter.

19. The microneedle device of any of the preceding claims, wherein extremities of eachmicroneedles are less than 60 micrometers in diameter, less than 50 micrometers in diameter, less than 40 micrometers in diameter, less than 30 micrometers in diameter, or less than 25 micrometers in diameter, or less than 15 micrometers in diameter, less than 10 micrometers in diameter, or less than 6 micrometers in diameter20. The microneedle device of claim 18, wherein the extremities of each microneedle arebeveled. DB1 / 161793602.

421. A composition comprising a bioactive substance and a plurality of microneedle devicesof any of the preceding claims, preferably the plurality of microneedle devices comprising 1 to 30 w / w %, 2.5 to 25 w / w %, or 5 to 15 w / w % of said composition.

22. The composition of claim 21, further comprising a gel and / or an ointment and / or anexcipient and / or a fatty or greasy substance.

23. The composition of claim 21 or claim 22, wherein the bioactive substance is an inducerof immune response, and / or a medicament and / or a dermatological active substance, and / or an aesthetically active substance and / or a cosmetically active substance and / or comprise a nucleotide, and / or an oligonucleotide and / or comprises siRNA, preferably said siRNA being bioactive and / or comprises a protein, a peptide, said peptide preferably being a bioactive peptide.

24. A method of transferring a bioactive and / or an active substance, and / or inducer ofimmune response, and / or a medicament and / or a dermatological active substance into a biological tissue, preferably an animal epidermis, preferably a human epidermis or skin, by applying and / or rubbing a composition of any of claims 21 onto said biological tissue preferably an animal skin, preferably a mammal or human skin or epidermis, wherein said microneedles create punctures or micro-holes in the surface of said biological material or epidermis or skin.

25. The method of claim 24 for use in the prevention, the reduction or the treatment of anundesired condition in a mammal, preferably a human, optionally said treatment not being a medical treatment, said undesired condition being medical or non-medical, and selected from the list: pathological, dermatological, aesthetical conditions, cosmetic applications or the prevention thereof, inflammations, inflammatory skin diseases, erythema, alopecia, atopic dermatitis, allergic conditions, vitiligo, chronic autoimmune diseases, need of vaccination, need of induction of an immune response.

26. The microneedle device of any of claims 1 to 20, or the composition of any of claim2121 to 2323 for use in the treatment of an undesired condition in a mammal, preferably DB1 / 161793602.4a human, said undesired condition being medical or non-medical, and selected from the list: pathological, dermatological, aesthetical or cosmetic conditions, or the prevention thereof, inflammations, inflammatory skin diseases, erythema, alopecia, atopic dermatitis, allergic conditions, vitiligo, chronic autoimmune diseases, superficial skin cancer, the need of vaccination, need of induction of an immune response.

27. The microneedle device of any of claims 1 to 20, or the composition of any of claims2121 to 2323 adapted for enabling the efficient delivery of a compound or a bioactive through a biological tissue by applying a pressure of less than 40 kPa or less than 20 kPa or less than 10 kPa, preferably combined with a rubbing action.

28. The method of claims 24 or 25 wherein said method comprises the step of applyingsaid composition and / or said microneedle device(s) on said biological tissue with a pressure of less than 40 kPa or less than 20 kPa or less than 10 kPa. DB1 / 161793602.4

Citation Information

Patent Citations

  • Microneedle particles, compositions, and methods of treatment and delivering a substance of interest

    US11291816B2

  • Structures for transdermal drug delivery

    US20130144261A1

  • Microneedle device

    US20200121900A1

  • Microneedle particles, compositions, and methods of treatment and delivering a substance of interest

    US20220226626A1

  • Wine bottle cooling device

    US6357253B1