Inducible expression system and cells comprising same

Abstract

Provided herein is a recombinant plant cell including an inducible expression system including a plurality of artificial DNA molecules, and methods of using same, such as for the production of a polypeptide of interest.

Description

INDUCIBLE EXPRESSION SYSTEM AND CELLS COMPRISING SAMEREFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0001] The contents of the electronic sequence listing (PGMT-P-004-PCT.xml; size: 26,351 bytes; and date of creation: September 1, 2025) is herein incorporated by reference in its entirety.CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of priority of U.S. Provisional Patent Application No. 63 / 689,794, entitled “INDUCIBLE EXPRESSION SYSTEM AND CELLS COMPRISING SAME”, filed September 2, 2024, the contents which are incorporated by reference in its entirety.FIELD OF INVENTION

[0003] The present invention relates to an inducible expression system, a cell comprising same, and a method of using same, such as for production of a recombinant polypeptide of interest.BACKGROUND

[0004] Inductive expression systems are a crucial tool both in research and in the industry. With the help of inductive expression system tools in plants, a variety of new characteristics and modifications could potentially be provided. Expression of genes by implementing the induction at a specific developmental stage also has a variety of implementations in agriculture since it may allow the plant to develop essentially as a wild-type plant up until the inducer is added to the plant. By utilizing inductive expression system, high expression levels of a protein of interest and repression of gene expression can be possibly achieved concomitantly with expression of modifications usually causing lethality.

[0005] Thus, there is still a great need for a plant cell comprising an inducible expression system, and use thereof, such as for safe production of a heterologous protein of interest.SUMMARY

[0006] According to the first aspect, there is provided a recombinant plant cell comprising an inducible expression system comprising: (i) a first artificial DNA molecule encoding a recombinant fusion protein comprising: (a) at least one first chemically responsive element (CRE); (b) a nuclear localization signal (NLS); (c) a DNA binding domain (BD); and (d) atranscription activation domain (AD); wherein the at least one CRE is specifically activated in response to an exogenous ligand; and (ii) a second artificial DNA molecule comprising at least one first promoter and a nucleic acid sequence encoding a protein of interest, wherein the nucleic acid sequence encoding the protein of interest is operably linked to the at least one first protomer, and wherein the protein of interest is expressed upon binding of the fusion protein to the at least one first promoter.

[0007] According to another aspect, there is provided a plant, a part thereof, or a tissue derived therefrom, comprising the recombinant plant cell of the invention.

[0008] According to another aspect, there is provided an extract of any one of: (a) the recombinant plant cell of the invention; and the plant, part thereof, or tissue derived therefrom of the invention.

[0009] According to another aspect, there is provided a composition comprising any one of: (a) the recombinant plant cell of the invention; (b) the plant, part thereof, or tissue derived therefrom of the invention; and the extract of the invention; and an acceptable carrier.

[0010] According to another aspect, there is provided a method for producing a protein, the method comprising: (a) providing the recombinant plant cell of the invention or the plant, part thereof, or tissue derived therefrom of the invention; and (b) contacting the recombinant plant cell of the invention or the plant, part thereof, or tissue derived therefrom of the invention of step (a) with an effective amount of the exogenous ligand, thereby producing the protein of interest.[Oi l] In some embodiments, the exogenous ligand is an animal ligand or a functional analog thereof.

[0012] In some embodiments, the artificial DNA molecule comprises a first nucleic acid sequence encoding the at least one first CRE; a second nucleic acid sequence encoding the NLS; a third nucleic acid sequence encoding the BD; and a fourth nucleic acid sequence encoding the AD.

[0013] In some embodiments, the artificial DNA molecule further comprises at least one second promoter, and wherein the first, second, third, and fourth nucleic acid sequences are operably linked to the at least one second promoter.

[0014] In some embodiments, the at least one second promoter is a constitutive promoter.

[0015] In some embodiments, the animal ligand or a functional analog thereof is a steroid, a terpene, or a combination thereof.

[0016] In some embodiments, the steroid comprises a glucocorticosteroid.

[0017] In some embodiments, the glucocorticosteroid is dexamethasone, and the at least one first CRE is glucocorticosteroid receptor (GR).

[0018] In some embodiments, the at least one first CRE binds directly to the exogenous ligand.

[0019] In some embodiments, the at least one first CRE binds indirectly to the exogenous ligand.

[0020] In some embodiments, the at least one first CRE binding indirectly to the exogenous ligand binds to at least one second CRE, and wherein the at least one second CRE binds directly to the exogenous ligand.

[0021] In some embodiments, the second artificial DNA molecule further comprises a fifth nucleic acid sequence encoding the at least one second CRE.

[0022] In some embodiments, the fifth DNA molecule is operably linked to the first promoter.

[0023] In some embodiments, the terpene is a sesquiterpene.

[0024] In some embodiments, the sesquiterpene is methyl famesoate (MF).

[0025] In some embodiments, the BD is lac repressor (LacI).

[0026] In some embodiments, the AD is Gal4.

[0027] In some embodiments, the extract comprises the protein of interest.

[0028] In some embodiments, the method further comprises a step before the step (a) comprising introducing or transfecting a plant cell with the first and second artificial DNA molecules.

[0029] Unless otherwise defined, all technical and / or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the invention, exemplary methods and / or materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting.

[0030] Further embodiments and the full scope of applicability of the present invention will become apparent from the detailed description given hereinafter. However, it should be understood that the detailed description and specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only, since various changes andmodifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.BRIEF DESCRIPTION OF THE FIGURES

[0031] Figs. 1A-1B include photographs of a membrane assayed by western blot (1A) and general Ponceau staining (IB) comparing the inductive and overexpression of casein protein. (1) Molecular weight marker; (2) empty vector (E.V.); (3)-(5)casein - induced expression; (6)-(8) casein - overexpression; (9)-(ll) casein - induced expression; (12)-(14) casein - overexpression; and (15) E.V. + casein standard.

[0032] Figs. 2A-2F include fluorescent micrographs showing promoter efficiency based on dsRed fluorescent. (2A-2B) 35S promoter drives expression of dsRed in mature (2A) and young (2B) leaves. (2C-2D) 2 x35S I promoter drives expression of dsRed in mature (2C) and young (2D) leaves. (2E-2F) Dexamethasone (DEX)-induced promoter drives expression of dsRed in mature (2E) and young (2F) leaves.DETAILED DESCRIPTIONCells, plants, and extracts

[0033] According to the first aspect, there is provided a cell comprising an expression system. In some embodiments, the cell is a plant cell. In some embodiments, the cell is a recombinant cell. In some embodiments, the expression system is an inducible expression system. In some embodiments, the expression is expression of a recombinant or heterologous polypeptide or protein of interest.

[0034] In some embodiments, the expression system comprises a first artificial DNA molecule encoding a recombinant fusion protein, and a second artificial DNA molecule comprising at least one first promoter and a nucleic acid sequence encoding a protein of interest.

[0035] In some embodiments, the at least one first promoter comprises a plurality of the at least one promoter. In some embodiments, the plurality of at least one promoter comprises identical repeats of the at least one promoter. In some embodiments, the plurality of at least one promoter comprises identical repeats of the nucleic acid sequence of the at least one promoter.

[0036] In some embodiments, repeats comprises 2 to 12, 4 to 12, 6 to 12, 8 to 12, 10 to 12, 2 to 12, 3 to 10, 5 to 10, 7 to 10, 9 to 10, or 6 to 9. Each possibility represents a separate embodiment of the invention.

[0037] In some embodiments, the at least one first promoter comprises the nucleic acid sequence : TAGTCTTTCAATTGTGAGCGCTC ACAATTCTTTCTCTTCCCTTTCTTCTTTC (SEQ ID NO: 1).

[0038] In some embodiments, the at least one first promoter comprises 4 to 8 repeats of SEQ ID NO: 1. In some embodiments, the at least one first promoter comprises 6 repeats of SEQ ID NO: 1. In some embodiments, the at least one first promoter comprises the nucleic acid sequence: TAGTCTTTCAATTGTGAGCGCTCACAATTCTTTCTCTTCCCTTTCTTCTTTCTAGTCTT TCAATTGTGAGCGCTCACAATTCTTTCTCTTCCCTTTCTTCTTTCTAGTCTTTCAATTG TGAGCGCTCACAATTCTTTCTCTTCCCTTTCTTCTTTCTAGTCTTTCAATTGTGAGCGC TCACAATTCTTTCTCTTCCCTTTCTTCTTTCTAGTCTTTCAATTGTGAGCGCTCACAAT TCTTTCTCTTCCCTTTCTTCTTTCTAGTCTTTCAATTGTGAGCGCTCACAATTCTTTCT CTTCCCTTTCTTCTTTC (SEQ ID NO: 2).

[0039] In some embodiments, the at least one first promoter comprises the nucleic acid sequence:GGAGTTGCGAAGATCGATCCACTAGTCTTTCAATTGTGAGCGCTCACAATTCTTTCT CTTCCCTTTCTTCTTTCTAGTCTTTCAATTGTGAGCGCTCACAATTCTTTCTCTTCCCT TTCTTCTTTCTAGTCTTTCAATTGTGAGCGCTCACAATTCTTTCTCTTCCCTTTCTTCTT TCTAGTCTTTCAATTGTGAGCGCTCACAATTCTTTCTCTTCCCTTTCTTCTTTCTAGTC TTTCAATTGTGAGCGCTCACAATTCTTTCTCTTCCCTTTCTTCTTTCTAGTCTTTCAAT TGTGAGCGCTCACAATTCTTTCTCTTCCCTTTCTTCTTTCTAGCTCCACCGCGGTGGC GGCCGGCCGTCTAGTGGATCGATTCCCCTTCGCAAGACCCTTCCTCTATATAAGGAA GTTCATTTCATTTGGAGAGGACTCCGGTATTTTTACAACAATTACCACAACAAAACA AACAACAAACAACATTACAATTTACTATTCTAGTCGA (SEQ ID NO: 3).

[0040] In some embodiments, the at least one first promoter comprising the nucleic acid sequence as set forth in SEQ ID Nos: 1-3, is operable, inducible, activated with, or any combination thereof, with a transcription activation domain (AD) encoded by a nucleic acid sequence as set forth in SEQ ID NO: 12.

[0041] In some embodiments, the at least one second promoter comprises the nucleic acid sequence: TGAGACTTTTCAACAAAGGGTAATATCGGGAAACCTCCTCGGATTCCATTGCCCAGC TATCTGTCACTTCATCAAAAGGACAGTAGAAAAGGAAGGTGGCACCTACAAATGCC ATCATTGCGATAAAGGAAAGGCTATCGTTCAAGATGCCCCTGCCGACAGTGGTCCC AAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGCAC AATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGA GAGGAC (SEQ ID NO: 4).

[0042] In some embodiments, the at least one second promoter comprises the nucleic acid sequence:GGAGACTAGAGCCAAGCTGATCTCCTTTGCCCCGGAGATCACCATGGACGACTTTCTCTATCTCTACGATCTAGGAAGAAAGTTCGACGGAGAAGGTGACGATACCATGTTCACCACCGATAATGAGAAGATTAGCCTCTTCAATTTCAGAAAGAATGCTGACCCACAGATGGTTAGAGAGGCCTACGCGGCAGGTCTGATCAAGACGATCTACCCGAGTAATAA TCTCCAGGAGATCAAATACCTTCCCAAGAAGGTTAAAGATGCAGTCAAAAGATTCA GGACTAACTGCATCAAGAACACAGAGAAAGATATATTTCTCAAGATCAGAAGTACTATTCCAGTATGGACGATTCAAGGCTTGCTTCATAAACCAAGGCAAGTAATAGAGATTGGAGTCTCTAAGAAAGTAGTTCCTACTGAATCAAAGGCCATGGAGTCAAAAATTCAGATCGAGGATCTAACAGAACTCGCCGTGAAGACTGGCGAACAGTTCATACAGAGTCTTTTACGACTCAATGACAAGAAGAAAATCTTCGTCAACATGGTGGAGCACGACACTCTCGTCTACTCCAAGAATATCAAAGATACAGTCTCAGAAGACCAAAGGGCTATTGA GACTTTTCAACAAAGGGTAATATCGGGAAACCTCCTCGGATTCCATTGCCCAGCTAT CTGTCACTTCATCAAAAGGACAGTAGAAAAGGAAGGTGGCACCTACAAATGCCATCATTGCGATAAAGGAAAGGCTATCGTTCAAGATGCCCCTGCCGACAGTGGTCCCAAA GATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTC TTCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGA GGACTCCGGTATTTTTACAACAATTACCACAACAAAACAAACAACAAACAACATTA CAATTTACTATTCTAGTCGA (SEQ ID NO: 5).

[0043] In some embodiments, the at least one CRE is encoded by the nucleic acid sequence: GATCCTGAAGCTCGAAAAACAAAGAAAAAAATCAAAGGGATTCAGCAAGCCACTGCAGGAGTCTCACAAGACACTTCGGAAAATCCTAACAAAACAATAGTTCCTGCAGCA TTACCACAGCTCACCCCTACCTTGGTGTCACTGCTGGAGGTGATTGAACCCGAGGTG TTGTATGCAGGATATGATAGCTCTGTTCCAGATTCAGCATGGAGAATTATGACCACACTCAACATGTTAGGTGGGCGTCAAGTGATTGCAGCAGTGAAATGGGCAAAGGCGAT ACCAGGCTTCAGAAACTTACACCTGGATGACCAAATGACCCTGCTACAGTACTCATG GATGTTTCTCATGGCATTTGCCCTGGGTTGGAGATCATACAGACAATCAAGTGGAAACCTGCTCTGCTTTGCTCCTGATCTGATTATTAATGAGCAGAGAATGTCTCTACCCTGCATGTATGACCAATGTAAACACATGCTGTTTGTCTCCTCTGAATTACAAAGATTGCAGGTATCCTATGAAGAGTATCTCTGTATGAAAACCTTACTGCTTCTCTCCTCAGTTCCTA AGGAAGGTCTGAAGAGCCAAGAGTTATTTGATGAGATTCGAATGACTTATATCAAA GAGCTAGGAAAAGCCATCGTCAAAAGGGAAGGGAACTCCAGTCAGAACTGGCAAC GGTTTTACCAACTGACAAAGCTTCTGGACTCCATGCATGAGGTGGTTGAGAATCTCC TTACCTACTGCTTCCAGACATTTTTGGATAAGACCATGAGTATTGAATTCCCAGAGA TGTTAGCTGAAATCATCACTAATCAGATACCAAAATATTCAAATGGAAATATCAAA AAGCTTCTGTTTCATCAAAAAT (SEQ ID NO: 6).

[0044] In some embodiments, the at least one CRE being responsive to, capable of binding, complexing with, operable with, or any combination thereof, dexamethasone or a functional analog thereof, is encoded by the nucleic acid sequence set forth in SEQ ID NO: 6.

[0045] In some embodiments, the at least one first CRE is encoded by the nucleic acid sequence: AATGTTAACAGATACCGCCTTTCTGGATGATGCTCAGAGTTTAGGCGCAATCCCTTG CGAATCTCTGTCAAGTGAGCCTTGTTGGGCCAATATGAACACTCTCTCTTCAGGCGG AGGAGGAGGTGGCGGCGGGTCCAGCAGTAACTCTAACTCTCCTGGACTCGGGAACA ATAATAATACAGCCAGCAGCTCTCCAACAACAACCAATAATAACAATAATAGTACC AGTTCAGGTGGCGGAGGAGGAGGAGCTGGAGGAAGCAACGGGTTACTGCATGGAC CTTCAGCATCCGCAGGTGCTATTAAAAAACGTCGTAAATCTGACACCAAGCCTCTCA GTCAGATTAACAAATGCCTTAATGAGAAACGACGAAGGGAGCAGGAGAATGTGTAC ATCGAAGAACTGGCTGAGTTAATCTCTGTTTCAATCGCCGATGTTAACTCTTTGAGT GTCAAACCTGATAAATGTGCTATACTTCAAGAAACAGTTAACCAAATACGTAAGATT AGAGAACAAGAAGAAGATGGAAGGTCTTCCTCATCCAGCAGTTCCAGTAGCAGCAG TTCCAGTTCATCCAGTTCATCTTCCGGAACCTCATCAGGCCACAATAATAATAACAA TACAACAAGTCCCAGCGCTGACGGCGGAGTAGGTGGAGGTCCCCTTTTGCAGCAGG GCGACGTTAGCTCATCTAAACCCGCTCTCCTCGACACTCAACTGTTAGGTACTTTTTT ATTGGAGGCACTCGACGGCTTCCTCTTCGTCGTGAACACTGAAGGGAAAACAGAGT ATGTGAGTGAAAACGTTGCCCATTTCCTGCATTACCAACCCCAAGATTTAGTTGGAA AGTCTATCTACAACTTCATACATCATGGTGACCACGCTAGATTCTCTAGCTCTTTGCT CCCTACCGCAATAGCATGGCCCTCTGAAATGGCTCCCGCCTCCCAAAATAGGCTCGG CAGATGTTTCAACTGCCGATTGCTTATACAGCCCTTAGGAGAACAAGACGAAACCAT GGAGGAAAAGCAGCAGCGAGTGGAACACTATGAAAATATGCAAATCTCTGCAGTCT TGCAACCATATCCTGGAGATCCTGGGGGGGGTGGTGGGCATCAGCCCAAAAGGAAT AGTGGCGCCGCAGCCGCAGCCGCCGCAGTTGGTCTGGAAGCCTCTGATTTGGAGAT GGCCCTGACTAGTGTTGCATCCGGCAGTTCCGGCGCCGATCCCCAACACTGCCTCGT ATGTGTAGCAAGGAGAATCCCTTCTACTGAAAAAATGGCTTCATCTGCAATTGTGACAACAGGAGGACCCGTGGTTGAGCAATTTACCACTAAGTTGGACAGTACAGGCAAGA TCGTTGCCGTCGATGTGACTGGGGTGAGTCCTCCATATAGCAGTTACTTTAGCAAAG AATCTTTGTTATCATGTACTATACAAGAACTCTGCCACCCTGATGACTTGTCAATATT CCAGGCCCACTTCCAAGAGACTATCCAATCCGGGTGCGGCTTATCCTCAAGATACCG ATTGAGGTTAGCCGGTGTCGCCTCCTTCCTTGTTGTTCAAACTAAGTCTAAGCGTTTC GTTAACAGTGACACACACGACACTGATTTTGTCATGGCAACCCACTCCATTATTGTA GATGATGAAGACGGACAAGCTGACGGCGGCGGTGGAAGGCTCATGTTATCAAAATC CGACACACTCAAAGACGTTCATCAACAGATCACAGATGCCGCCAATCAAATGTCCC AGCAACAACAACAGACTACAGTCAATCCAGTGCTGACTAGTGTAGTCAGGCACGAC GTGATATCCGCTACTAGTTATGGAAATGGTAGGTCTGGTGCTACCACAACAACAACA AGTTCCTATTCTAGCACCTTCGCCGGACTTAGTTTGGGCACCTCCGGTGACCTGCTTA ATGACTTCGTAGTGCCAGACCTTTTCATGGCATCCCCACCATGGTC (SEQ ID NO: 7).

[0046] In some embodiments, the at least one first CRE is encoded by the nucleic acid sequence: ATGAATGTGTACATCGAAGAACTGGCTGAGTTAATCTCTGTTTCAATCGCCGATGTT AACTCTTTGAGTGTCAAACCTGATAAATGTGCTATACTTCAAGAAACAGTTAACCAA ATACGTAAGATTAGAGAACAAGAAGAAGATGGAAGGTCTTCCTCATCCAGCAGTTC CAGTAGCAGCAGTTCCAGTTCATCCAGTTCATCTTCCGGAACCTCATCAGGCCACAA TAATAATAACAATACAACAAGTCCCAGCGCTGACGGCGGAGTAGGTGGAGGTCCCC TTTTGCAGCAGGGCGACGTTAGCTCATCTAAACCCGCTCTCCTCGACACTCAACTGT TAGGTACTTTTTTATTGGAGGCACTCGACGGCTTCCTCTTCGTCGTGAACACTGAAG GGAAAACAGAGTATGTGAGTGAAAACGTTGCCCATTTCCTGCATTACCAACCCCAA GATTTAGTTGGAAAGTCTATCTACAACTTCATACATCATGGTGACCACGCTAGATTC TCTAGCTCTTTGCTCCCTACCGCAATAGCATGGCCCTCTGAAATGGCTCCCGCCTCCC AAAATAGGCTCGGCAGATGTTTCAACTGCCGATTGCTTATACAGCCCTTAGGAGAAC AAGACGAAACCATGGAGGAAAAGCAGCAGCGAGTGGAACACTATGAAAATATGCA AATCTCTGCAGTCTTGCAACCATATCCTGGAGATCCTGGGGGGGGTGGTGGGCATCA GCCCAAAAGGAATAGTGGCGCCGCAGCCGCAGCCGCCGCAGTTGGTCTGGAAGCCT CTGATTTGGAGATGGCCCTGACTAGTGTTGCATCCGGCAGTTCCGGCGCCGATCCCC AACACTGCCTCGTATGTGTAGCAAGGAGAATCCCTTCTACTGAAAAAATGGCTTCAT CTGCAATTGTGACAACAGGAGGACCCGTGGTTGAGCAATTTACCACTAAGTTGGAC AGTACAGGCAAGATCGTTGCCGTCGATGTGACTGGGGTGAGTCCTCCATATAGCAGT TACTTTAGCAAAGAATCTTTGTTATCATGTACTATACAAGAACTCTGCCACCCTGAT GACTTGTCAATATTCCAGGCCCACTTCCAAGAGACTATCCAATCCGGGTGCGGCTTA TCCTCAAGATACCGATTGAGGTTAGCCGGTGTCGCCTCCTTCCTTGTTGTTCAAACTAAGTCTAAGCGTTTCGTTAACAGTGACACACACGACACTGATTTTGTCATGGCAACCCACTCCATTATTGTAGATGATGAAGACGGACAAGCTGACGGCGGCGGTGGAAGGCTCATGTTATCAAAATCCGACACACTCAAAGACGTTCATCAACAGATCACAGATGCCGCCAATCAAATGTCCCAGCAACAACAACAGACTACAGTCAATCCAGTGCTGACTAGTGTAGTCAGGCACGACGTGATATCCGCTACTAGTTATGGAAATGGTAGGTCTGGTGCTACCACAACAACAACAAGTTCCTATTCTAGCACCTTCGCCGGACTTAGTTTGGGCACCTCCGGTGACCTGCTTAATGACTTCGTAGTGCCAGACCTTTTCATGGCATCCCCACCAT GGTCAGCCGC (SEQ ID NO: 8).

[0047] In some embodiments, the at least one second CRE is encoded by the nucleic acid sequence:AATGTCTGAAACCCTTCCTAGTTCATCAAGGGAAATGCGAAATAGAGCCGAAAAACAAAGGCGAGACAAATTGAACGCATACATTTCCGAACTTTATTCCCTCGTTCCTAGCGCTGCCGCCGCACCACGTAAATTAGATAAGACCAGTACATTAAGGCTCTCTGCAAACTTTTTAAGAATACACCAAAACGTAGATCTTAGGGTTAAGCCCTATAATCGATGGAACGCATTGGCTGGCCATACTATCCTCGAAAAATTAGATAGTTTTTTACTTGTGGTATCTTGCTGTTCCGGCAAGATCATTTATGTCACCGATAGAGTCGAAAAGCTGTTGGGGCACGCCCAAGTGGACATGATGGGCTACCAGCTTAGCTGCTTCGTGCACCAGGCCGACCAGGAAGCTATTGAAAAACGACTCTCCGACTTTGCTAAGCAAGTTGCAGCCAACCCTGACGCTTCCGACTCCCTTGACGGGCAAGTCTACAGCTTTGAGTGTCACCTGGCAGGCAGGCAACTCAGCAGGGGGGAGCCTACCGTCTATGAACGTGTTTCAGTTTCCGGGACATTTAGAGGACCACGAAGACGAAGAGAGTGGGCTGATAAGTCCTCTGATAGAAGCGTTGCTACCATTCAGCAACATAACGATTATAGTGAACCTTTGTTCATTGGACTCGTTAGAATACTGCAGACACCCAACACCTTACCACCCTTAACTATTATGCAGGCCGTACAAGATGAGTATGCTACCCAGCACACAACTACCGGTACTATCATCCAAACTGATCATCGTATTGCAGTAATCGCAGGCTATCTCAGTGGTGAAGTAACTGGTATGTCAGCTTACGACTACGTATTTAAGGAGGACCTGGAGTATACTCTTAAAGCCCAAAAGCTCATGTTAGACCGTTCAGAAGGAATGGTTACCTATAGGCTCAAGACTAGCACTGGCAGGCTGATTTTTTTGCGTTCCCGAGGTTTCATCCAATACGACGAGAACACAAAAGAGATTATTAGTTTCTTTTGTATAAACAGTTTGATAGACGAAGAGCAAGGCATGAAAGAGATGCAAGAGATGAGAGCAATGCTGGATAAGTTAAACATTGGAAATGTAACTCCCGCTATAACCAGTTCCCCAACAAACGCCATCGAGCCAGTAGCAGCTGCCTCCACACAAGAGCCACTTTCCAGGTGTGTGAGAGCTTCCCTCGGAAAAGCCCCCTCTGCCCCCTCCAATGGGTGCCTCGCCAATGGAGCCCGTGTAAGCGGACTCAGTCGTAGTGGCCTTATGCCAAATGGACAGTCAAGCCTGTGTATATCACCAGCATCAGAGCTGCAATATTCCCCCTCAGGCTCAAGTACCGCTAGTTCAACTTTTGAAGAAAGATGTCAATCCGTCACTCCACACTCCATAGTCTCATC CCATACAGAGATCCCCAATTTGGTAGCCGTACCCTATCCTTTTGCACCCATCCCCTTC CCCTGGCGACCTACCGAAGTGTCTTCAATTACCACAACCAGCAACGGCGTAGTCAAC ATCCAAGAGGTTTCAAAGTCCCCCGAGGTAAATCCCGTGGATTGCATCGGGGCACC CGGGAGTTTGGTTGTTTCCATAGATCACCAATGGGAGTCCGCTCCTAATTCCCAATC AGTCGTTATTCAACATAATGAGTCTCTCTCACATCAACAACCACTTACCCCAGTTAA TAACGTACAAGCCCACAGTCTTCAATCCTCCCCTTCCGATAATGTCGACTCCATAAG AAGCACCCTTAACCCACCAAGCTCCTGCAGTGTCGTGCAAGTTCCTTACCAACAACATCCAGAGGATGTACTTAAGATATCCATACCAGAAAGATCATCTCCAAATGAATCAAATCGAAACAACTACTTAAACGGATACATTATCTGGCCTCAAAAGATGAGTCCTAAA AATAGAAAGGAAAATCTGATCTTGTCATATTTGGATTCTGATAAGCATTTATACAAG CAGTCCGAAATTGCCGGCACTGATCAACATTACTTTCCTGGCGAGCTTAAGGTTAACACAGGGACATCTAGTCCCTGA (SEQ ID NO: 9).

[0048] In some embodiments, the at least one second CRE is encoded by the nucleic acid sequence:ATGACATTAAGGCTCTCTGCAAACTTTTTAAGAATACACCAAAACGTAGATCTTAGGGTTAAGCCCTATAATCGATGGAACGCATTGGCTGGCCATACTATCCTCGAAAAATTAGATAGTTTTTTACTTGTGGTATCTTGCTGTTCCGGCAAGATCATTTATGTCACCGATAGAGTCGAAAAGCTGTTGGGGCACGCCCAAGTGGACATGATGGGCTACCAGCTTAGCTGCTTCGTGCACCAGGCCGACCAGGAAGCTATTGAAAAACGACTCTCCGACTTTGCT AAGCAAGTTGCAGCCAACCCTGACGCTTCCGACTCCCTTGACGGGCAAGTCTACAGC TTTGAGTGTCACCTGGCAGGCAGGCAACTCAGCAGGGGGGAGCCTACCGTCTATGA ACGTGTTTCAGTTTCCGGGACATTTAGAGGACCACGAAGACGAAGAGAGTGGGCTG ATAAGTCCTCTGATAGAAGCGTTGCTACCATTCAGCAACATAACGATTATAGTGAAC CTTTGTTCATTGGACTCGTTAGAATACTGCAGACACCCAACACCTTACCACCCTTAA CTATTATGCAGGCCGTACAAGATGAGTATGCTACCCAGCACACAACTACCGGTACTA TCATCCAAACTGATCATCGTATTGCAGTAATCGCAGGCTATCTCAGTGGTGAAGTAA CTGGTATGTCAGCTTACGACTACGTATTTAAGGAGGACCTGGAGTATACTCTTAAAG CCCAAAAGCTCATGTTAGACCGTTCAGAAGGAATGGTTACCTATAGGCTCAAGACT AGCACTGGCAGGCTGATTTTTTTGCGTTCCCGAGGTTTCATCCAATACGACGAGAACACAAAAGAGATTATTAGTTTCTTTTGTATAAACAGTTTGATAGACGAAGAGCAAGGCATGAAAGAGATGCAAGAGATGAGAGCAATGCTGGATAAGTTAAACATTGGAAATGT AACTCCCGCTATAACCAGTTCCCCAACAAACGCCATCGAGCCAGTAGCAGCTGCCTC CACACAAGAGCCACTTTCCAGGTGTGTGAGAGCTTCCCTCGGAAAAGCCCCCTCTGCCCCCTCCAATGGGTGCCTCGCCAATGGAGCCCGTGTAAGCGGACTCAGTCGTAGTGG CCTTATGCCAAATGGACAGTCAAGCCTGTGTATATCACCAGCATCAGAGCTGCAATA TTCCCCCTCAGGCTCAAGTACCGCTAGTTCAACTTTTGAAGAAAGATGTCAATCCGT CACTCCACACTCCATAGTCTCATCCCATACAGAGATCCCCAATTTGGTAGCCGTACC CTATCCTTTTGCACCCATCCCCTTCCCCTGGCGACCTACCGAAGTGTCTTCAATTACC ACAACCAGCAACGGCGTAGTCAACATCCAAGAGGTTTCAAAGTCCCCCGAGGTAAA TCCCGTGGATTGCATCGGGGCACCCGGGAGTTTGGTTGTTTCCATAGATCACCAATG GGAGTCCGCTCCTAATTCCCAATCAGTCGTTATTCAACATAATGAGTCTCTCTCACAT CAACAACCACTTACCCCAGTTAATAACGTACAAGCCCACAGTCTTCAATCCTCCCCT TCCGATAATGTCGACTCCATAAGAAGCACCCTTAACCCACCAAGCTCCTGCAGTGTC GTGCAAGTTCCTTACCAACAACATCCAGAGGATGTACTTAAGATATCCATACCAGAA AGATCATCTCCAAATGAATCAAATCGAAACAACTACTTAAACGGATACATTATCTGG CCTCAAAAGATGAGTCCTAAAAATAGAAAGGAAAATCTGATCTTGTCATATTTGGAT TCTGATAAGCATTTATACAAGCAGTCCGAAATTGCCGGCACTGATCAACATTACTTT CCTGGCGAGCTTAAGGTTAACACAGGGACATCTAGTCCCTGA (SEQ ID NO: 10).

[0049] In some embodiments, the at least one second CRE being responsive to, capable of binding, complexing with, operable with, or any combination thereof, methyl famesoate (MF) or a functional analog thereof, is encoded by the nucleic acid sequence set forth in SEQ ID NOS: 9- 10.

[0050] In some embodiments, the BD is encoded by the nucleic acid sequence: GTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACC GTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGT GGAAGCGGCAATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGG CGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGC CGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGG TGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAAT CTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGAT GCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTG ACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCG TGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAA GTTCTGTCTCGGCGCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATC AAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAA CAAACCATGCAAATGCTGAATGAGGGCATCGTTCCCACTGCTATGCTGGTTGCCAAC GATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAGTGGGATACGACGATACCGAAGACAGCTCATGTTATATCCC GCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACC GCTTGCTGCAACTCTCTCAGGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTAT CACTGGTGAAAAGAAAAACCACCCTG (SEQ ID NO: 11).

[0051] In some embodiments, the AD is encoded by the nucleic acid sequence: GAGCCAACAAATTCTCAAGCGCTTTCACAACCAATTGCCTCCTCTAACGTTCATGAT AACTTCATGAATAATGAAATCACGGCTAGTAAAATTGATGATGGTAATAATTCAAA ACCACTGTCACCTGGTTGGACGGACCAAACTGCGTATAACGCGTTTGGAATCACTAC AGGGATGTTTAATACCACTACAATGGATGATGTATATAACTATCTATTCGATGATGA AGATACCCCACCAAACCCAAAAAAAGAG (SEQ ID NO: 12).

[0052] In some embodiments, the NLS is encoded by the nucleic acid sequence: ATGAGGAAGCGTAAAGAGTCAAATCGAGAATCTGCTAGAAGAAGTAGGTATCGGA A (SEQ ID NO: 13).

[0053] In some embodiments, the first artificial DNA molecule comprises the nucleic acid sequences in the following order: SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 11, SEQ ID NO: 12, and SEQ ID NO: 14.

[0054] In some embodiments, the first artificial DNA molecule comprises the nucleic acid sequences in the following order: SEQ ID NO: 5; SEQ ID NO: 13; SEQ ID NO: 8; SEQ ID NO: 11; SEQ ID NO: 12; SEQ ID NO: 15; SEQ ID NO: 5; SEQ ID NO: 13; SEQ ID NO: 10; and SEQ ID NO: 15.

[0055] In some embodiments, the first artificial DNA molecule comprises the nucleic acid sequences in the following order: SEQ ID NO: 5; SEQ ID NO: 13; SEQ ID NO: 8; SEQ ID NO: 11; SEQ ID NO: 12; SEQ ID NO: 15; SEQ ID NO: 5; SEQ ID NO: 10; and SEQ ID NO: 15.

[0056] In some embodiments, the first artificial DNA molecule comprises the nucleic acid sequences in the following order: SEQ ID NO: 5, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 5; SEQ ID NO: 13, SEQ ID NO: 10; and SEQ ID NO: 15.

[0057] In some embodiments, the first artificial DNA molecule comprises the nucleic acid sequences in the following order: SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 5; SEQ ID NO: 10, and SEQ ID NO: 15.

[0058] In some embodiments, the first artificial DNA molecule comprises the nucleic acid sequences in the following order: SEQ ID NO: 5, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 5; SEQ ID NO: 10, and SEQ ID NO: 15.

[0059] In some embodiments, the first artificial DNA molecule comprises the nucleic acid sequences in the following order: SEQ ID NO: 5, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 5; SEQ ID NO: 9, and SEQ ID NO: 15.

[0060] In some embodiments, the recombinant fusion protein encoded by the first artificial DNA molecule comprises: (a) at least one first chemically responsive element (CRE); (b) a nuclear localization signal (NLS); (c) a DNA binding domain (BD); and (d) a transcription activation domain (AD). In some embodiments, the BD is lac repressor (LacI). In some embodiments, the AD is Gal4.

[0061] As used herein, the terms “nucleus localization sequence” or “NLS” refers to any amino acid sequence that labels a polypeptide or a protein, such that it is transported or imported into the nucleus of a cell. Such transport or import is via a nuclear transporter or transport machinery.

[0062] In some embodiments, the at least one CRE is specifically activated in response to an exogenous ligand.

[0063] In some embodiments, the nucleic acid sequence encoding the protein of interest is operably linked to the first protomer. In some embodiments, protein of interest is expressed upon binding of the fusion protein to the at least one first promoter.

[0064] In some embodiments, the exogenous ligand is an animal ligand or a functional analog thereof. In some embodiments, exogenous is exogenous to plants. In some embodiments, exogenous to plants is to means as not naturally occurring or present in plants. In some embodiments, the exogenous ligand is an artificial or a synthetic ligand. In some embodiments, a ligand, such as an exogenous ligand, is exogenously applied (to a plant, or any part thereof) by a subject or user.

[0065] As used herein, the terms “artificial” and “synthetic” are to be meant as man-made, such as, but not limited to, produced or synthesized in a laboratory, factory, or an equivalent thereof.

[0066] In some embodiments, the artificial DNA molecule comprises at least a first nucleic acid. In some embodiments, the artificial DNA molecule comprises a first nucleic acid, a second nucleic acid sequence, a third nucleic acid sequence, a fourth nucleic acid sequence, or any combination thereof. In some embodiments, the first nucleic acid sequence encodes at least one first chemical or chemically responsive element (CRE). In some embodiments, the second nucleic acid sequence encodes a nucleus localization sequence (NLS). In some embodiments, the third nucleic acid sequence encodes a DNA binding domain (BD). In some embodiments, the fourth nucleic acid sequence encodes a transcription activation domain (AD).

[0067] In some embodiments, the first artificial DNA molecule further comprises at least one second promoter. In some embodiments, the first, second, third, and fourth nucleic acid sequences are operably linked to the at least one second promoter.

[0068] In some embodiments, the at least one second promoter is a constitutive promoter.

[0069] In some embodiments, the at least one second promoter comprises two second promoters. In some embodiments, the at least one second promoter comprises two copies or sequences of the second promoter. In some embodiments, the at least one second promoter comprises two identical copies of the second promoter. In some embodiments, the first, second, third, and fourth nucleic acid sequences of the first artificial DNA molecule are operably linked to a first copy of the second promoter and the fifth nucleic acid sequence of the first artificial DNA molecule is operably linked to a second copy of the second promoter.

[0070] In some embodiments the first artificial DNA molecule comprises nucleic acid sequence as follows: a nucleic acid sequence of a first copy of a second promoter; a second nucleic acid sequence encoding a first NLS; a first nucleic acid sequence encoding at least one first CRE; a third nucleic acid sequence encoding BD; a fourth nucleic acid sequence encoding AD; a nucleic acid sequence of a first terminator; a nucleic acid sequence of a second copy of a second promoter; a nucleic acid sequence encoding a second NLS; a fifth nucleic acid sequence encoding at least one second CRE; and a nucleic acid sequence of a second terminator.

[0071] In some embodiments the first artificial DNA molecule comprises nucleic acid sequence as follows: a nucleic acid sequence of a first copy of a second promoter; a second nucleic acid sequence encoding a first NLS; a first nucleic acid sequence encoding at least one first CRE; a third nucleic acid sequence encoding BD; a fourth nucleic acid sequence encoding AD; a nucleic acid sequence of a first terminator; a nucleic acid sequence of a second copy of a second promoter; a fifth nucleic acid sequence encoding at least one second CRE; and a nucleic acid sequence of a second terminator.

[0072] In some embodiments the first artificial DNA molecule comprises nucleic acid sequence as follows: a nucleic acid sequence of a first copy of a second promoter; a first nucleic acid sequence encoding at least one first CRE; a third nucleic acid sequence encoding BD; a fourth nucleic acid sequence encoding AD; a nucleic acid sequence of a first terminator; a nucleic acid sequence of a second copy of a second promoter; a nucleic acid sequence encoding a second NLS; a fifth nucleic acid sequence encoding at least one second CRE; and a nucleic acid sequence of a second terminator.

[0073] In some embodiments the first artificial DNA molecule comprises nucleic acid sequence as follows: a nucleic acid sequence of a first copy of a second promoter; a first nucleic acid sequence encoding at least one first CRE; a third nucleic acid sequence encoding BD; a fourth nucleic acid sequence encoding AD; a nucleic acid sequence of a first terminator; a nucleic acid sequence of a second copy of a second promoter; a fifth nucleic acid sequence encoding at least one second CRE; and a nucleic acid sequence of a second terminator.

[0074] In some embodiments, the NLS is an endogenous NLS of the at least one CRE. In some embodiments, the endogenous NLS and CRE originate from the same gene, protein product thereof, or both.

[0075] In some embodiments, the NLS is an exogenous NLS of the at least one CRE. In some embodiments, the exogenous NLS and CRE are of different or distinct genes, protein products thereof, or both. In some embodiments, the exogenous NLS and CRE are derived from different or distinct genes, protein products thereof, or both.

[0076] In some embodiments, the BD and AD are of different or distinct genes, protein products thereof, or both. In some embodiments, the BD and AD are derived from different or distinct genes, protein products thereof, or both.

[0077] In some embodiments, the BD and CRE are of different or distinct genes, protein products thereof, or both. In some embodiments, the BD and CRE are derived from different or distinct genes, protein products thereof, or both.

[0078] In some embodiments, the AD and CRE are of different or distinct genes, protein products thereof, or both. In some embodiments, the AD and CRE are derived from different or distinct genes, protein products thereof, or both.

[0079] In some embodiments, the BD and NLS are of different or distinct genes, protein products thereof, or both. In some embodiments, the BD and NLS are derived from different or distinct genes, protein products thereof, or both.

[0080] In some embodiments, the AD and NLS are of different or distinct genes, protein products thereof, or both. In some embodiments, the AD and NLS are derived from different or distinct genes, protein products thereof, or both.

[0081] In some embodiments, the first and second terminators are identical. In some embodiments, the first and second NLS are identical.

[0082] The term "promoter" as used herein refers to a group of transcriptional control modules that are clustered around the initiation site for an RNA polymerase e.g., RNA polymerase II.Promoters are composed of discrete functional modules, each comprising or consisting of approximately 7-20 bp of DNA, and containing one or more recognition sites for transcriptional activator or repressor proteins.

[0083] In some embodiments, a promoter is considered “responsive” to an input signal if the input signal modulates the function of the promoter, indirectly or directly. In some embodiments, an input signal may positively modulate a promoter such that the promoter activates or increases, transcription of a nucleic acid to which it is operably linked. In some embodiments, an input signal may negatively modulate a promoter such that the promoter is prevented from activating or inhibits, or decreases, transcription of a nucleic acid to which it is operably linked. In some embodiments, an input signal modulates the function of the promoter directly by binding to the promoter or by acting on the promoter without an intermediate signal.

[0084] In some embodiments, a promoter responsive to an input signal and / or regulatory protein is considered an “inducible” promoter. Inducible promoters for use according to the present invention include any inducible promoter described herein or known to one of ordinary skill in the art. Non-limiting examples of inducible promoters include, but are not limited to, chemically- regulated, biochemically-regulated, and / or physically-regulated promoters, such as alcohol- regulated promoters, tetracycline-regulated promoters (e.g., anhydrotetracycline (aTc)-responsive promoters and / or other tetracycline-responsive promoter systems, which include a tetracycline repressor protein (tetR), a tetracycline operator sequence (tetO), and / or a tetracycline transactivator fusion protein (tTA)), steroid-regulated promoters (e.g., promoters based on the rat glucocorticoid receptor, human estrogen receptor, moth ecdysone receptors, and promoters from the steroid / retinoid / thyroid receptor superfamily), metal -regulated promoters (e.g., promoters derived from metallothionein (proteins that bind and sequester metal ions) genes from yeast, mouse and human), pathogenesis-regulated promoters (e.g., induced by salicylic acid, ethylene or benzothiadiazole (BTH)), temperature / heat-inducible promoters (e.g., heat shock promoters), and / or light-regulated promoters (e.g., light responsive promoters from plant cells), or any combination thereof.

[0085] In some embodiments, an animal ligand comprises an animal hormone or a functional analog thereof. In some embodiments, a hormone comprises a steroid, a terpene, or a combination thereof. In some embodiments, a hormone functional analog comprises an agonist of a cognate receptor of the hormone.

[0086] In some embodiments, a steroid comprises a glucocorticosteroid. In some embodiments, a glucocorticosteroid comprises dexamethasone. In some embodiments, the at least one first CRE comprises glucocorticosteroid receptor (GR) or a binding protein thereof.

[0087] In some embodiments, the at least one first CRE binds directly to the exogenous ligand.

[0088] In some embodiments, the at least one first CRE binds indirectly to the exogenous ligand. In some embodiments, the at least one first CRE does not bind or binds indirectly to the exogenous ligand. In some embodiments, the at least one first CRE multimerizes or tends to multimerization in the absence of the exogenous ligand. In some embodiments, multimerization is or comprises homo-multimerization. In some embodiments, multimerization comprises or is dimerization.

[0089] As used herein, the term multimerization refers to any process wherein molecules join together to form a larger molecule. In this regard, these molecule can be identical, e.g., homo- multimerization, or different.

[0090] In some embodiments, the first artificial DNA molecule further comprises a fifth nucleic acid sequence. In some embodiments, the fifth nucleic acid sequence encodes at least one second CRE. In some embodiments, the at least one second CRE binds directly to the exogenous ligand. In some embodiments, the fifth DNA molecule is operably linked to the second promoter.

[0091] In some embodiments, a terpene comprises a sesquiterpene. In some embodiments, a sesquiterpene comprises methyl famesoate (MF).

[0092] The term “terpene” as used herein also covers terpenoids. Terpenes are lipophilic compounds, volatile and liquid at room temperature. Terpenes are formed by the union of hydrocarbon of 5 carbon atoms, known as isoprene. The smallest and most volatile compounds are monoterpenes, which are biosynthesized by the union of two isoprene molecules. The biggest and least volatile are biosynthesized by the union of three or more isoprene molecules. The sesquiterpenes are next in the chain, which are formed by the union of three isoprene molecules. Terpenes are secondary metabolites, which provide the plant with its organoleptic characteristics (aroma and flavor) and that constitutes most of the essential oil produced by aromatic plants.

[0093] In some embodiments, a cell is or comprises a transgenic cell, a transformed cell, a transfected cell, a transduced cell, or any combination thereof.

[0094] In some embodiments, a cell is or comprises: a cell of a plant, or a plant cell in a culture (such as of a cell line, a stable line, a primary cell line).

[0095] As used herein, the term "transgenic cell" refers to any cell that has undergone human manipulation on the genomic or gene level. In some embodiments, the transgenic cell has had exogenous polynucleotide, such as an “isolated” or “artificial” (used herein interchangeably) DNA molecule of the invention, introduced into it. In some embodiments, a transgenic cell comprises a cell that has an artificial vector introduced into it. In some embodiments, a transgenic cell is a cell which has undergone genome mutation or modification. In some embodiments, the exogenous polynucleotide (e.g., the artificial DNA molecule of the invention) or vector is stably integrated into the cell or particularly the genome of the cell. In some embodiments, the transgenic cell expresses an artificial DNA molecule of the invention. In some embodiments, the transgenic cell expresses a plasmid or an expression vector of the invention. In some embodiments, the transgenic cell expresses a recombinant protein of the invention. In some embodiments, the transgenic cell, prepared using a cell that is initially devoid of an artificial DNA molecule of the invention that has been transformed or genetically modified so as to include the artificial DNA molecule of the invention.

[0096] In some embodiments, the cell comprises a plurality of artificial DNA molecules as disclosed herein. In some embodiments, the plurality of artificial DNA molecules comprise a plurality of different nucleic acid sequences. In some embodiments, each different nucleic acid sequence encodes one or more recombinant proteins as disclosed herein.

[0097] In some embodiments, the artificial DNA molecules comprise a terminator. In some embodiments, the terminator corresponds to the promoter. In some embodiments, the terminator is a terminator of the first promoter, the at least one second promoter, or both. In some embodiments, the terminator is a terminator of the at least one second promoter.

[0098] In some embodiments, the terminator comprises the nucleic acid sequence: CTAGAGTCCGCAAAAATCACCAGTCTCTCTCTACAAATCTATCTCTCTCTATTTTTCT CCAGAATAATGTGTGAGTAGTTCCCAGATAAGGGAATTAGGGTTCTTATAGGGTTTC GCTCATGTGTTGAGCATATAAGAAACCCTTAGTATGTATTTGTATTTGTAAAATACTT CTATCAATAAAATTTCTAATTCCTAAAACCAAAATCCAGTGAC (SEQ ID NO: 14).

[0099] In some embodiments, the terminator comprises the nucleic acid sequence: GCTTCGGCCATGCTAGAGTCCGCAAAAATCACCAGTCTCTCTCTACAAATCTATCTC TCTCTATTTTTCTCCAGAATAATGTGTGAGTAGTTCCCAGATAAGGGAATTAGGGTT CTTATAGGGTTTCGCTCATGTGTTGAGCATATAAGAAACCCTTAGTATGTATTTGTAT TTGTAAAATACTTCTATCAATAAAATTTCTAATTCCTAAAACCAAAATCCAGTGACC T (SEQ ID NO: 15).

[0100] As used herein, the term “terminator” refers to any nucleic acid sequence that indicates, symbolizes, or marks the end of a gene, thus, controls, regulates, mediates, or any combination thereof, the termination of RNA transcription.

[0101] According to another aspect, there is provided a lysate, a homogenate, or an extract of the cell, including any combination thereof.

[0102] In some embodiments, a lysate, homogenate, or an extract, comprises any fraction thereof.

[0103] In some embodiments, the lysate, homogenate, or extract comprises the polypeptide or protein of interest.

[0104] In some embodiments, the polypeptide or protein of interest is a recombinant polypeptide or protein.

[0105] Methods and / or means for extracting, lysing, homogenizing, fractionating, or any combination thereof, a cell or a culture of same, are common and would be apparent to one of ordinary skill in the art of cell biology and biochemistry. Non-limiting examples include, but are not limited to, pressure lysis (e.g., such as using a French press), enzymatic lysis, soluble-insoluble phase separation (such for obtaining a supernatant and a pellet), detergent-based lysis, solvent (e.g., polar, or nonpolar solvent), liquid chromatography mass spectrometry, or others.

[0106] In some embodiments, a plant comprises a leafy green or a grain. In some embodiments, leafy green comprises lettuce. In some embodiments, a grain comprises oat.

[0107] In some embodiments, a plant comprises any plant material. In some embodiments, a plant or plant material comprises any one of: leaf, fruit, root, tuber, bulb, stem, seed, and any combination thereof.

[0108] The terms “derived from” and “obtained from” are used herein interchangeably.

[0109] The term “operably linked” is intended to mean that the nucleotide sequence of interest is linked to the regulatory element(s) in a manner that allows for expression of the nucleotide sequence (e.g. in an in vitro transcription / translation system or in a host cell when the vector is introduced into the host cell). In some embodiments, operably linked refers to the first nucleic acid sequence and the second nucleic sequence being linked to the regulatory element(s) in a manner that allows for expression of the first nucleic acid sequence and the second nucleic sequence. In some embodiments, the first nucleic acid sequence and the second nucleic sequence are coexpressed. In some embodiments, the first nucleic acid sequence and the second nucleic sequence are expressed at the same time or together. In some embodiments, when the first nucleic acidsequence is expressed the second nucleic sequence is expressed. In some embodiments, when the second nucleic acid sequence is expressed the first nucleic sequence is expressed.

[0110] The terms “homology” and / or “identity”, as used interchangeably herein, refer to sequence identity between two amino acid sequences or two nucleic acid sequences, with identity being a stricter comparison. The phrases “percent identity or homology” and “% identity or homology” refer to the percentage of sequence identity found in a comparison of two or more amino acid sequences or nucleic acid sequences. Two or more sequences can be anywhere from 0-100% identical, or any value there between. Identity can be determined by comparing a position in each sequence that can be aligned for purposes of comparison to a reference sequence. When a position in the compared sequence is occupied by the same nucleotide base or amino acid, then the molecules are identical at that position. A degree of identity of amino acid sequences is a function of the number of identical amino acids at positions shared by the amino acid sequences. A degree of identity between nucleic acid sequences is a function of the number of identical or matching nucleotides at positions shared by the nucleic acid sequences. A degree of homology of amino acid sequences is a function of the number of amino acids at positions shared by the polypeptide sequences.

[0111] The following is a non-limiting example for calculating homology or sequence identity between two sequences (the terms are used interchangeably herein). The sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes). The optimal alignment is determined as the best score using the GAP program in the GCG software package with a Blossum 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frame shift gap penalty of 5. The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percentage identity between the two sequences is a function of the number of identical positions shared by the sequences.

[0112] In some embodiments, % homology or identity as described herein are calculated or determined using the basic local alignment search tool (BLAST). In some embodiments, % homology or identity as described herein are calculated or determined using Blossum 62 scoring matrix. In some embodiments, % homology or identity as described herein are calculated or determined using any tool known and accessible to a person of skill in the art. Non-limitingexamples of such methods and / or tools include, but are not limited to, PAM30, PAM70, BLOSUM 30, BLOSUM 45, BLOSUM 80, to name a few.

[0113] According to another aspect, there is provided a plasmid or an expression vector comprising the artificial DNA molecules of the invention.

[0114] The terms “nucleic acid” and “nucleic acid molecule”, which are used herein interchangeably, are well known in the art. A "nucleic acid molecule" as used herein will generally refer to a molecule (i.e., a strand) of DNA, RNA or a derivative or analog thereof, comprising a nucleobase. A nucleobase includes, for example, a naturally occurring purine or pyrimidine base found in DNA (e.g., an adenine "A," a guanine "G," a thymine "T" or a cytosine "C") or RNA (e.g., an A, a G, an uracil "U" or a C). In some embodiments, a nucleobase includes non-naturally occurring purine or pyrimidine base found in DNA, RNA, or a hybrid thereof.

[0115] The term “nucleic acid molecule” includes but not limited to singlestranded RNA (ssRNA), double-stranded RNA (dsRNA), single -stranded DNA (ssDNA), double-stranded DNA (dsDNA), small RNA such as miRNA, siRNA and other short interfering nucleic acids, snoRNAs, snRNAs, tRNA, piRNA, tnRNA, small rRNA, hnRNA, circulating nucleic acids, fragments of genomic DNA or RNA, degraded nucleic acids, ribozymes, viral RNA or DNA, nucleic acids of infectious origin, amplification products, modified nucleic acids, plasmidical or organellar nucleic acids and artificial nucleic acids such as oligonucleotides.

[0116] The terms “expression”, “expressing, or “encoding”, being used herein interchangeably, refer to the biosynthesis of a gene product, including the transcription and / or translation of a gene product. Thus, expression of a nucleic acid molecule may refer to transcription of the nucleic acid fragment (e.g., transcription resulting in mRNA or other functional RNA) and / or translation of RNA into a precursor or mature protein (e.g., polypeptide, a recombinant protein of the invention, etc.).

[0117] Expressing a gene within a cell is well known to one skilled in the art. It can be carried out by, among many methods, transfection, viral infection, or direct alteration of the cell’s genome. In some embodiments, the gene is in an expression vector such as plasmid or viral vector. One such example of an expression vector containing pl6-Ink4a is the mammalian expression vector pCMV pl6 INK4A available from Addgene.

[0118] A vector nucleic acid sequence generally contains at least an origin of replication for propagation in a cell and optionally additional elements, such as a heterologous polynucleotidesequence, expression control element (e.g., a promoter, enhancer), selectable marker (e.g., antibiotic resistance), poly-Adenine sequence.

[0119] The vector may be a DNA plasmid delivered via non-viral methods or via viral methods . The viral vector may be a retroviral vector, a herpesviral vector, an adenoviral vector, an adeno- associated viral vector or a poxviral vector. The promoters may be active in mammalian cells. The promoters may be a viral promoter.

[0120] In some embodiments, the vector is introduced into the cell by standard methods including electroporation (e.g., as described in From et al., Proc. Natl. Acad. Sci. USA 82, 5824 (1985)), heat shock, infection by viral vectors, high velocity ballistic penetration by small particles with the nucleic acid either within the matrix of small beads or particles, or on the surface (Klein et al., Nature 327. 70-73 (1987)), and / or the like.

[0121] In some embodiments, nucleic acid sequences are transcribed by RNA polymerase II (RNAP II and Pol II). RNAP II is an enzyme found in eukaryotic cells. It catalyzes the transcription of DNA to synthesize precursors of mRNA and most snRNA and microRNA.

[0122] Various methods can be used to introduce the expression vector of the present invention into cells. Such methods are generally described in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratory, New York (1989, 1992), in Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Md. (1989), Chang et al., Somatic Gene Therapy, CRC Press, Ann Arbor, Mich. (1995), Vega et al., Gene Targeting, CRC Press, Ann Arbor Mich. (1995), Vectors: A Survey of Molecular Cloning Vectors and Their Uses, Butterworths, Boston Mass. (1988) and Gilboa et at. [Biotechniques 4 (6): 504-512, 1986] and include, for example, stable or transient transfection, lipofection, electroporation and infection with recombinant viral vectors. In addition, see U.S. Pat. Nos. 5,464,764 and 5,487,992 for positive-negative selection methods.

[0123] In one embodiment, plant expression vectors are used. In one embodiment, the expression of a polypeptide coding sequence is driven by a number of promoters. In some embodiments, viral promoters such as the 35S RNA and 19S RNA promoters of CaMV [Brisson et al., Nature 310:511-514 (1984)], or the coat protein promoter to TMV [Takamatsu et al., EMBO J. 6:307-311 (1987)] are used. In another embodiment, plant promoters are used such as, for example, the small subunit of RUBISCO [Coruzzi et al., EMBO J. 3: 1671-1680 (1984); and Brogli et al., Science 224:838-843 (1984)] or heat shock promoters, e.g., soybean hsp 17.5 -E or hspl7.3- B [Gurley et al., Mol. Cell. Biol. 6:559-565 (1986)]. In one embodiment, constructs are introduced into plant cells using Ti plasmid, Ri plasmid, plant viral vectors, direct DNA transformation,microinjection, electroporation and other techniques well known to the skilled artisan. See, for example, Weissbach & Weissbach [Methods for Plant Molecular Biology, Academic Press, NY, Section VIII, pp 421-463 (1988)]. Other expression systems such as insects and mammalian host cell systems, which are well known in the art, can also be used by the present invention.

[0124] It will be appreciated that other than containing the necessary elements for the transcription and translation of the inserted coding sequence (encoding the recombinant protein), the expression construct of the present invention can also include sequences engineered to optimize stability, transcription efficiency and / or rate (e.g., codon optimization), production, purification, yield or activity of the expressed recombinant protein.

[0125] In some embodiments, the artificial DNA molecules ofthe invention are codon optimized for expression in a target cell.

[0126] In some embodiments, a target cell comprises a cell suitable for or configured to expression, over-expression, production, secretion, or any combination thereof, of a recombinant protein. In some embodiments, a target cell is a plant cell. In some embodiments, a plant cell is the plant cell of the invention.

[0127] As used herein, the term "analog" includes any peptide having an amino acid sequence substantially identical to one of the sequences specifically shown herein in which one or more residues have been conservatively substituted with a functionally similar residue and which displays the abilities as described herein. Examples of conservative substitutions include the substitution of one non-polar (hydrophobic) residue such as isoleucine, valine, leucine or methionine for another, the substitution of one polar (hydrophilic) residue for another such as between arginine and lysine, between glutamine and asparagine, between glycine and serine, the substitution of one basic residue such as lysine, arginine or histidine for another, or the substitution of one acidic residue, such as aspartic acid or glutamic acid for another. Each possibility represents a separate embodiment of the present invention.Compositions

[0128] According to another aspect, there is provided a composition comprising: (a) the plant cell of the invention; (b) the polypeptide or protein of interest; or (c) both (a) and (b), and an acceptable carrier.

[0129] In some embodiments, the composition consists essentially of (a) the plant cell of the invention; (b) the polypeptide or protein of interest; or (c) both (a) and (b).

[0130] As used herein, the term “consists essentially of’ denotes that a given compound or substance constitutes the vast majority of a particular portion or fraction of the composition.

[0131] In some embodiments, consists essentially of means that: the recombinant protein of the invention, constitute at least 80%, 90%, 95%, at least 98%, at least 99%, or at least 99.9% by weight, of the proteins or the protein fraction of the composition, or any value and range therebetween. Each possibility represents a separate embodiment of the invention.

[0132] As used herein, the term “plurality” refers to any integer being equal to or greater than 2.

[0133] As used herein, the terms “peptide”, "polypeptide" and "protein" are used interchangeably to refer to a polymer of amino acid residues. In another embodiment, the terms "peptide", "polypeptide" and "protein" as used herein encompass native peptides, peptidomimetics (typically including non-peptide bonds or other synthetic modifications) and the peptide analogues peptoids and semipeptoids or any combination thereof. In another embodiment, the peptides polypeptides and proteins described have modifications rendering them more stable while in the body or more capable of penetrating into cells. In one embodiment, the terms “peptide”, "polypeptide" and "protein" apply to naturally occurring amino acid polymers. In another embodiment, the terms “peptide”, "polypeptide" and "protein" apply to amino acid polymers in which one or more amino acid residue is an artificial chemical analogue of a corresponding naturally occurring amino acid.

[0134] In some embodiments, the polypeptide or protein of interest encode or expressed by the system may include any polypeptide or protein which a skilled artisan wishes to produce (hereinafter “a polypeptide / protein of interest”). In some embodiments, the polypeptide of interest is a full protein. In some embodiments, the polypeptide of interests is a fragment of a protein. In some embodiments, the polypeptide of interests is an enzyme. In some embodiments, the polypeptide of interests is an antibody. In some embodiments, the polypeptide of interests is a therapeutic protein. In some embodiments, the polypeptide of interest is a structural protein. In some embodiments, the polypeptide of interest is a scaffold protein. In some embodiments, the polypeptide of interest is a reporter protein (e.g., a fluorescent and / or chemiluminescent and / or bioluminescent protein). In some embodiments, the polypeptide of interest is a heterologous protein. In some embodiments, the polypeptide of interest is industrially relevant protein. Examples of industrial and pharmaceutically relevant proteins include, but are not limited antibodies, antibody fragments, hormones, interleukins, enzymes, coagulants and vaccines to name but a few. Specific examples of proteins include, but are not limited to, insulin, thyroid hormone, human growth hormone, follicle-stimulating hormone, factor VIII, erythropoietin,granulocyte colony-stimulating factor, alpha-galactosidase A, alpha-L-iduronidase, N- acetylgalactosamine-4-sulfatase, interferon, insulin-like growth factor 1, and lactase.Methods of use

[0135] According to another aspect, there is provided a method for producing or synthesizing a polypeptide or a protein of interest.

[0136] In some embodiments, the method comprises: (a) providing a recombinant plant cell comprising an expression inducible system comprising: (1) a first artificial DNA molecule encoding a recombinant fusion protein comprising: i. at least one first chemically responsive element (CRE); ii. a nuclear localization signal (NLS); iii. a DNA binding domain (BD); and iv. a transcription activation domain (AD); and (2) a second artificial DNA molecule comprising at least one first promoter and a nucleic acid sequence encoding a protein of interest; and (b) contacting the recombinant plant cell of step (a) with an effective amount of an exogenous ligand.

[0137] In some embodiments, the method comprises contacting a recombinant plant cell comprising an expression inducible system comprising: (1) a first artificial DNA molecule encoding a recombinant fusion protein comprising: i. at least one first chemically responsive element (CRE); ii. a nuclear localization signal (NLS); iii. a DNA binding domain (BD); and iv. a transcription activation domain (AD); and (2) a second artificial DNA molecule comprising at least one first promoter and a nucleic acid sequence encoding a protein of interest with an effective amount of an exogenous ligand.

[0138] In some embodiments, the method comprises culturing a recombinant plant cell comprising an expression inducible system comprising: (1) a first artificial DNA molecule encoding a recombinant fusion protein comprising: i. at least one first chemically responsive element (CRE); ii. a nuclear localization signal (NLS); iii. a DNA binding domain (BD); and iv. a transcription activation domain (AD); and (2) a second artificial DNA molecule comprising at least one first promoter and a nucleic acid sequence encoding a protein of interest in the presence of an effective amount of an exogenous ligand.

[0139] In some embodiments, the at least one CRE is specifically activated in response to the exogenous ligand. In some embodiments, the nucleic acid sequence encoding the protein of interest is operably linked to the first protomer. In some embodiments, the protein of interest is expressed upon binding of the fusion protein to the at least one first promoter.

[0140] In some embodiments, the method further comprises a step before the step (a) comprising introducing or transfecting a plant cell with the first and second artificial DNA molecules. In someembodiments, the method further comprises a step before the step (a) comprising introducing or transfecting a plant cell with the inducible expression system as disclosed herein.

[0141] In some embodiments, the method further comprises a step before the contacting and / or culturing, comprising introducing or transfecting a plant cell with the first and second artificial DNA molecules. In some embodiments, the method further comprises a step before the contacting and / or culturing comprising introducing or transfecting a plant cell with the inducible expression system as disclosed herein.

[0142] In some embodiments, the method comprises contacting a plant or a plant part with an effective amount of an exogenous ligand (e.g., as disclosed herein).

[0143] In some embodiments, the method further comprises a step comprising extracting the cultured plant or plant part, thereby obtaining an extract comprising the polypeptide or the protein of interest, or plurality thereof. In some embodiments, the step (culturing) is after / proceeding step (b) and / or the contacting.

[0144] Methods for introducing exogenous or foreign DNA, such as comprising a plasmid or expression vector(s) of the inducible expression system, are common and would be apparent to one of ordinary skill in the art.

[0145] In some embodiments, introducing comprises contacting a plant or a plant part with an effective amount of Agrobacterium-based vector. In some embodiments, introducing comprises contacting a plant or a plant part with an effective amount of TRV-based vector. In some embodiments, introducing comprises contacting a plant or a plant part with an effective amount of gold particles. In some embodiments, introducing comprises contacting a plant or a part thereof with an effective amount of a CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)-Cas system.

[0146] In some embodiments, the introducing is Agrobacterium-based or -mediated transformation, TRV mediated transient expression, gold particles bombardment, and / or CRISPR- inserted DNA, or any equivalent thereof.General definitions

[0147] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the invention,subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.

[0148] As used herein, the term "about" when combined with a value refers to plus and minus 10% of the reference value. For example, a length of about 1,000 nanometers (nm) refers to a length of 1,000 nm ± 100 nm.

[0149] It is noted that as used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a polynucleotide" includes a plurality of such polynucleotides and reference to "the polypeptide" includes reference to one or more polypeptides and equivalents thereof known to those skilled in the art, and so forth. It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as "solely," "only" and the like in connection with the recitation of claim elements or use of a "negative" limitation.

[0150] In those instances where a convention analogous to "at least one of A, B, and C, etc." is used, in general such a construction is intended in the sense one having skill in the art would understand the convention (e.g., "a system having at least one of A, B, and C" would include but not be limited to systems that have A alone, B alone, C alone, A and B together, A and C together, B and C together, and / or A, B, and C together, etc.). It will be further understood by those within the art that any disjunctive word and / or phrase presenting two or more alternative terms, whether in the description, claims, or drawings, should be understood to contemplate the possibilities of including one of the terms, either of the terms, or both terms. For example, the phrase "A or B" will be understood to include the possibilities of "A" or "B" or "A and B".

[0151] It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination. All combinations of the embodiments pertaining to the invention are specifically embraced by the present invention and are disclosed herein just as if each and every combination was individually and explicitly disclosed. In addition, all sub-combinations of the various embodiments and elements thereof are also specifically embraced by the present invention and are disclosed herein just as if each and every such sub-combination was individually and explicitly disclosed herein.

[0152] Additional objects, advantages, and novel features of the present invention will become apparent to one ordinarily skilled in the art upon examination of the following examples, which are not intended to be limiting. Additionally, each of the various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below finds experimental support in the following examples.

[0153] Various embodiments and aspects ofthe present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples.EXAMPLES

[0154] The nomenclature used herein, and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological, and recombinant DNA techniques. Such techniques are thoroughly explained in the literature. See, for example, "Molecular Cloning: A laboratory Manual" Sambrook et al., (1989); "Current Protocols in Molecular Biology" Volumes I-III Ausubel, R. M., ed. (1994); Ausubel et al., "Current Protocols in Molecular Biology", John Wiley and Sons, Baltimore, Maryland (1989); Perbal, "A Practical Guide to Molecular Cloning", John Wiley & Sons, New York (1988); Watson et al., "Recombinant DNA", Scientific American Books, New York; Birren et al. (eds) "Genome Analysis: A Laboratory Manual Series", Vols. 1-4, Cold Spring Harbor Laboratory Press, New York (1998); methodologies as set forth in U.S. Pat. Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; "Cell Biology: A Laboratory Handbook", Volumes I-III Cellis, J. E., ed. (1994); "Culture of Animal Cells - A Manual of Basic Technique" by Freshney, Wiley-Liss, N. Y. (1994), Third Edition; "Current Protocols in Immunology" Volumes I-III Coligan J. E., ed. (1994); Stites et al. (eds), "Basic and Clinical Immunology" (8thEdition), Appleton & Lange, Norwalk, CT (1994); Mishell and Shiigi (eds), "Strategies for Protein Purification and Characterization - A Laboratory Course Manual" CSHL Press (1996); all of which are incorporated by reference. Other general references are provided throughout this document.Materials and MethodsCreation of DNA sequence

[0155] To construct modified plant(s), the inventors utilized a transgenic construct cloning process. The process begins with amplifying or synthesizing the desired genes and DNA sequences. The desired genes and DNA sequences are then cloned into an initial backbone - pUPD2 to be verified by digestion and sequencing. After successful validation, these sequences are used for assembling full and functional transcriptional units (TUs) (few or all of the listed):promoter, UTR, sorting signal, CDS, and a terminator into the final GoldenBraid3.0 backbone plasmid (Alpha or Omega) (Sarrion-Perdigones, A. et al., 2011, Vazquez-Vilar, M. el al, 2017).Infiltration

[0156] To induce production of a recombinant polypeptide of interest, e.g., casein, in Romaine lettuce, the inventors applied the Agrobacterium tumefaciens -mediated transformation (AGRO) method (Gasser, C. S. & Fraley, R. T., 1989). The inventors utilizes AGLO, a modified and non- pathogenic strain of AGRO, to facilitate the transgene transformation (Weir B. et al., 2001, Aida R. et al., 1999). All reagents and chemicals used for transformation were of high purity and analytical grade, to meet the standards of plant cell tissue culture applications. In the first step of the plant transformation process, lettuce seeds are disinfected with bleach. The sterile seeds are sprouted in a petri dish on a meager bed until the cotyledons emerge. The cotyledons are then cut and embedded in media containing Agrobacterium with the desired construct. The cotyledons are further dried and returned to a petri dish for incubation in the dark. When incubation is over, the cotyledons are transferred to an antibiotic selection plate with hormones, where the cotyledons are grown to a callus stage. The inventors use antibiotics (carbenicillin) to exterminate any leftover Agrobacterium at this stage, as part ofthe selection process. Each callus grown from the treated cotyledons comes from a single successfully transformed plant cell. Further, after cellular differentiation and plant regeneration, plants are grown, and the transgene becomes a permanent part of the genome of the transgenic plant. The successful transformation events undergo hardening conditions in the ground, and the modified plants are self-pollinated to generate seeds for homozygous lines.Results

[0157] The inventors have generated numerous constructs comprising nucleic acid sequences encoding various casein proteins, for expression in lettuce, under the regulation of several promoters, as disclosed herein.

[0158] To this end, the inventors have showed that the disclosed inducible system provides higher expression of protein of interest, as exemplified for Casein and dsRed from the same amount of lysate / biomass.

[0159] Specifically, a western blot (WB) analysis was performed to compared between lysates of plants which were infiltrated with either an inducible or overexpression system, expressing the same protein of interest. The results show a representative immunostaining of the expression levels of a protein of interest using a specific antibody (Fig. 1A). Using Ponceau staining of the WB membranes of Fig. 1A, the inventors showed that the increased expression levels of theprotein of interest (Fig. 1A) was a result of specific overexpression of this protein, and not a nonspecific overall increased expression of all proteins, e.g., protein levels appear to be the same (Fig. IB). Further, the inventors showed the ability of the system to drive overexpression of a fluorescent protein (dsRed) in plant cells (Fig. 2).

[0160] While the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications, and variations will be apparent to those skilled in the art. accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims.

Claims

1. CLAIMSWhat is claimed is:

1. A recombinant plant cell comprising an inducible expression system comprising: i. a first artificial DNA molecule encoding a recombinant fusion protein comprising:(a) at least one first chemically responsive element (CRE)(b) a nuclear localization signal (NLS);(c) a DNA binding domain (BD); and(d) a transcription activation domain (AD); wherein said at least one CRE is specifically activated in response to an exogenous ligand; and ii. a second artificial DNA molecule comprising at least one first promoter and a nucleic acid sequence encoding a protein of interest, wherein said nucleic acid sequence encoding said protein of interest is operably linked to said at least one first protomer, and wherein said protein of interest is expressed upon binding of said fusion protein to said at least one first promoter.

2. The recombinant plant cell of claim 1, wherein said exogenous ligand is an animal ligand or a functional analog thereof.

3. The recombinant plant cell of claim 1 or 2, wherein said artificial DNA molecule comprises a first nucleic acid sequence encoding said at least one first CRE; a second nucleic acid sequence encoding said NLS; a third nucleic acid sequence encoding said BD; and a fourth nucleic acid sequence encoding said AD.

4. The recombinant plant cell of any one of claims 1 to 3, wherein said artificial DNA molecule further comprises at least one second promoter, and wherein said first, second, third, and fourth nucleic acid sequences are operably linked to said at least one second promoter.

5. The recombinant plant cell of claim 4, wherein said at least one second promoter is a constitutive promoter.

6. The recombinant plant cell of any one of claims 2 to 5, wherein said animal ligand or a functional analog thereof is a steroid, a terpene, or a combination thereof.

7. The recombinant plant cell of claim 6, wherein said steroid comprises a glucocorticosteroid.

8. The recombinant plant cell of claim 7, wherein said glucocorticosteroid is dexamethasone, and said at least one first CRE is glucocorticosteroid receptor (GR).

9. The recombinant plant cell of any one of claims 1 to 8, wherein said at least one first CRE binds directly to said exogenous ligand.

10. The recombinant plant cell of any one of claims 1 to 8, wherein said at least one first CRE binds indirectly to said exogenous ligand.

11. The recombinant plant cell of claim 10, wherein said at least one first CRE binding indirectly to said exogenous ligand binds to at least one second CRE, and wherein said at least one second CRE binds directly to said exogenous ligand.

12. The recombinant plant cell of claim 11, wherein said second artificial DNA molecule further comprises a fifth nucleic acid sequence encoding said at least one second CRE.

13. The recombinant plant cell of claim 12, wherein said fifth DNA molecule is operably linked to said first promoter.

14. The recombinant plant cell of any one of claims 6, and 10 to 13, wherein said terpene is a sesquiterpene.

15. The recombinant plant cell of claim 14, wherein said sesquiterpene is methyl famesoate (MF).

16. The recombinant plant cell of any one of claims 1 to 15, wherein said BD is lac repressor (LacI).

17. The recombinant plant cell of any one of claims 1 to 16, wherein said AD is Gal4.

18. A plant, a part thereof, or a tissue derived therefrom, comprising the recombinant plant cell of any one of claims 1 to 17.

19. An extract of any one of:(a) the recombinant plant cell of any one of claims 1 to 17; and(b) the plant, part thereof, or tissue derived therefrom of claim 18.

20. The extract of claim 19, comprising said protein of interest.

21. A composition comprising any one of:(a) the recombinant plant cell of any one of claims 1 to 17;(b) the plant, part thereof, or tissue derived therefrom of claim 18; and(c) the extract of claim 19 or 20; and an acceptable carrier.

22. A method for producing a protein, the method comprising:(a) providing the recombinant plant cell of any one of claims 1 to 17 or the plant, part thereof, or tissue derived therefrom of claim 18; and(b) contacting the recombinant plant cell of any one of claims 1 to 17 or the plant, part thereof, or tissue derived therefrom of claim 18 of step (a) with an effective amount of said exogenous ligand, thereby producing the protein of interest.

23. The method of claim 22, further comprising a step before said step (a) comprising introducing or transfecting a plant cell with said first and second artificial DNA molecules.

Images