Prevention of AG-induced hair cell death

Abstract

Disclosed herein are methods for treating and / or preventing AG-induced hearing loss. The methods involve downmodulating GABARAP disclosed herein to thereby treat and / or prevent AG-induced hearing loss. Also disclosed herein are methods for treating and / or preventing AG-induced hearing loss in a patient in need thereof comprising downmodulating GABARAP, disclosed herein, to thereby treat and / or prevent AG-induced hearing loss in a patient in need thereof.

Description

[0001] 29920-427209

[0002] PREVENTION OF AG-INDUCED HAIR CELL DEATH

[0003] RELATED APPLICATIONS

[0004] This application claims the benefit of U.S. Provisional Application No. 63 / 688,456, filed August 29, 2024, the entire disclosure of which is incorporated herein by reference.

[0005] STATEMENT OF GOVERNMENT SUPPORT

[0006] This invention was made with government support under DC018785 awarded by National Institutes of Health. The Government has certain rights in the invention.

[0007] SEQUENCE LISTING

[0008] The Sequence Listing associated with this application is provided in .xml format in lieu of a paper copy, and is hereby incorporated by reference into the specification. The name of the .xml file containing the Sequence Listing is “29920-427209 PREVENTION OF AG- INDUCED HAIR CELL DEATH.xml”. The .xml file is 26,154 bytes, was created on August 22, 2025. and is being submitted electronically, concurrent with the filing of this specification.

[0009] BACKGROUND

[0010] Aminoglycosides (AGs) are potent antibiotics that are capable of treating a wide variety of life-threatening infections. AGs include kanamycin (KAN), gentamicin (GEN), amikacin and tobramycin. These antibiotics are highly potent, broad-spectrum, and frequently used as first-line treatment for multiple life-threatening infections. More than 100 million people worldwide are estimated to be treated with AGs each year. However, systemically administered AGs exhibit ototoxicity and can lead to irreversible cochlear damage, in both humans and experimental animals. It is thought that AGs kill inner ear hair cells, the mechanosensory cells that detect sound, which causes permanent hearing loss manifesting in about 20%-47% of patients who received AG therapy. Despite the decades of use and widespread availability' as a first-line treatment, the ototoxic effects of AGs have no treatment.

[0011] Recent studies have suggested a mechanism of action of AG-induced ototoxicity, and the route through which AGs enter hair cells. Systemically administered AGs are trafficked across the blood-endolymph barrier and preferentially enter hair cells across their apical membranes. The mechanotransduction (MET) channels, which convert sound-induced vibrations into electrical signals and are localized near the tips of stereocilia that protrude from 29920-427209 the apical surface of hair cells, are the major entry routes into hair cells for AGs. In addition to the MET channels, studies have also found that increased expression of transient receptor potential vanilloid-1 (TRPV1) during inflammation facilitates the uptake of AGs by hair cells. Upon entering hair cells, AGs bind to and trigger rapid translocation of RIPOR2, a protein that is abundantly expressed in cochlear hair cells and essential for normal hearing. Translocated RIPOR2 aberrantly activates the autophagy pathway, by interacting with GABARAP, a member of the autophagy-related protein 8 (Atg8) family. Atg8 proteins, which are ubiquitin- like proteins essential for autophagy, comprise three subfamilies based on their sequence similarities, the LC3, GABARAP and GATE- 16 subfamilies. The LC3 subfamily includes LC3A, LC3B, and LC3C; the GABARAP subfamily includes GABARAP and GABARAPL1; and the GATE- 16 subfamily includes GATE- 16 (also known as GABARAPL2). LC3 proteins are involved in the initial steps of autophagosome formation and membrane expansion, while GABARAP / GATE-16 proteins function during the later stages of autophagy and are crucial for autophagosome-lysosome fusion during the PINK1 / PRKN pathway of mitophagy. Genetic elimination or reduction in GABARAP expression completely prevents AG-induced hair cell death and subsequent hearing loss, without affecting hair cell development or normal hearing, suggesting that GABARAP is a promising therapeutic target for mitigating the ototoxic side effects of AGs. GABARAPL1, the close homolog of GABARAP, shares 87% amino acid identity with GABARAP. Like GABARAP, GABARAPL1 is abundantly expressed in cochlear hair cells and interacts with RIPOR2.

[0012] AG-induced hearing loss is currently treated through hearing aids and other hearing assistive technologies; however, these interventions merely amplify sound, and are effective only for sounds below 4000 Hz, which may not address high-frequency hearing loss associated with the early stages of AG-induced ototoxicity. Additionally, neither hearing aids, nor hearing assistive technologies can restore normal hearing. Moreover, these treatment options can be expensive and would not provide a long-term solution required of the irreversible hearing loss following AG treatment. An alternative current treatment option is a cochlear implant. While cochlear implants have been shown to successfully restore hearing in patients with drug- associated ototoxicity, cochlear implants also require surgery, the associated risks of surgery, and may not be feasible for many patients. Accordingly, therapeutic intervention to prevent AG-induced hearing loss is desired. 29920-427209

[0013] SUMMARY OF THE DISCLOSURE

[0014] In one aspect, the disclosure relates to a method of preventing aminoglycoside (AG) induced hearing loss in a patient in need thereof, the method comprising: administering to the patient an effective amount of a short hairpin RNA (shRNA) composition comprising an shRNA that decreases GAB ARAP expression; and administering to the patient an aminoglycoside.

[0015] In further aspects, the disclosure relates to pharmaceutical composition for preventing aminoglycoside (AG) induced hearing loss, the composition comprising: an shRNA that decreases GABARAP expression; and a delivery vehicle.

[0016] In further aspects, the disclosure relates to a method for preventing hearing loss by administering a short hairpin RNA (shRNA) to a patient in need thereof, wherein the shRNA is of the formula X-L-Y. wherein:

[0017] X is portion of an shRNA,

[0018] L is a nucleic acid linker that connects X to Y, and

[0019] Y is a complementary strand of RNA to X.

[0020] Other objects, features and advantages of the present disclosure will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating specific embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.

[0021] BRIEF DESCRIPTION OF THE FIGURES

[0022] FIGS. 1A-1D illustrate that Gabarapll and Gabarap are abundantly expressed in cochlear hair cells. FIG. 1A is a schematic illustrating the structure of the inner ear, including a cross-sectional view of the cochlea and the cellular organization within the organ of Corti. Inner hair cell (IHC) and outer hair cells (OHCs) are highlighted, while Deiters' cells, which support the base of OHCs. are shown below the OHC. FIGS. 1B-1D show RNAscope in situ hybridization analyses performed to characterize the expression of Gabarapll as shown in FIG. IB, Gabarap as shown in FIG. 1C, m< Myo7a as depicted in FIG. ID in P5 wild-type cochlea. Tissue sections were counterstained with MY07A antibodies to visualize the IHCs (arrows) and OHCs (arrowheads). Note, robust expression of Gabarapll and Gabarap in hair cells and some supporting cells, such as Deiters' cells. (Scale bars, 20 pm.) 29920-427209

[0023] FIGS. 2A-2F show the generation of Gabarapll null mutant mouse. FIG. 2A depicts the alignment of the protein sequences of mouse GAB ARAP, GABARAPL1. and GATE- 16 / GABARAPL2. Identical amino acids are colored light grey, while different amino acids are colored black. Note, GABARAP shares 87% amino acid identity with GABARAPL1, whereas it shares only 58% amino acid identity with GATE-16 / GABARAPL2. FIG. 2B illustrates RNAscope in situ hybridization analyses performed using a negative control probe- / A / / ? / i (Advanced Cell Diagnostics, 310043) in P5 wild-type cochlea. Tissue sections were counterstained with MY07A antibodies to visualize hair cells. Note, no RNAscope signal was detected. Scale bars: 20 pm. FIG. 2C depicts relative expression level of Gabarap and Gabarapll in P7 cochlear epithelial cells. cDNA samples obtained from P7 wild-type cochleae were used as the template. Data are represented as the mean ± SEM. ***p < 0.001 by Student's t test. FIG. 2D diagrams the strategy to generate Gabarapl / -deficient mice. Two sgRNAs targeting exon 2 of Gabarapll induced a 37-bp nucleotide deletion. Two primers, labelled as PCR-F and PCR-R, were designed for genotyping. FIG. 2E shows genomic nucleotide sequences of the wild-type and Gabarapll ''' mice. Note, the 37 bp deletion is highlighted in light grey. FIG. 2F depicts Sanger sequence pattern of a PCR amplicon of the same region derived from wild-type and Gabarapll^' mice. The arrow points to the site of the 37 bp deletion. FIG. 2G show s agarose gel electrophoresis of the PCR products amplified from the genomic DNA of wild-type and Gabarapll''' mice using primers shown in FIG. 2D. FIG. 2H shows plasmid expressing HA-tagged GABARAP, GABARAPL 1, or GABARAPL2 was transfected into HEK293 cells. Western blotting was carried out to evaluate the specificity of the GABARAPL 1 antibodies. Note, anti-GABARAPLl antibodies specifically detected HA- GABARAPL1.

[0024] FIGS. 3A-3F depicts GABARAP and GABARAPL 1 are not required for stereocilia morphogenesis or for normal hearing. FIG. 3A Diagrams the strategy to generate Gabarapll- deficient mice. Two sgRNAs targeting the exon 2 of Gabarapll induced a 37-bp nucleotide deletion. FIG. 3B Western blotting was used to analyze P7 wild-ty pe and GabarapH~'~ cochlear samples. Note, the ~15 kDa specific band was detected in wild-type but not in the Gabarapll~'~ inner ear samples, a-tubulin was used as the loading control. FIG. 3C shows scanning electron microscopy images showing P7 wild-type, Gabarapll~ / ~ , Gabarapl" , and Gabarap Gabarapl 7- / " (dKO) cochlear epithelia. In each group, more than three mice were used. FIG. 3D depicts P7 wild-type, GabaraplT^ , Gabarapl , and Gabarap~'~ Gabarapl 1~'~ (dKO) cochlear whole mounts were stained for RIPOR2 (top) and phalloidin (bottom) to reveal stereocilia. In each group, more than three mice were used. (FIG. 3E and FIG. 3F) ABR 29920-427209 thresholds for click stimuli FIG. 3E and pure tones FIG. 3F in wild-type. GabaraplT^ , and Gabarap~'~ Gabarapl 1~'~ (dKO) mice at 5 wk and 3 mo of age. Mouse numbers are indicated in the figure. Data are represented as the mean ± SEM. n.s., not significant by Student’s t test FIG. 3E. No significant difference by two-way ANOVA was detected between wild-type and Gabarapi ^ mice, or between wild-ty pe and Gabarap~ / ~Gabarapll~ / ~ (dKO) mice FIG. 3F. [Scale bars, FIG. 3C Left panel, 5 pm; Right panel, 1 pm; FIG. 3D 5 pm.]

[0025] FIGS. 4A-4B indicate Gabarapl 1' ' and Gabarap 'Gabarapir'' (dKO) hair cells show normal uptake of FM1-43. FIG. 4A shows P4 wild-type. Tmie f Gabarapll'f and dKO cochlear explants w ere incubated with 5 pM FM1-43 dye for 30 seconds at room temperature. Note, robust uptake of FM1-43 in wild-type, Gabarapll'f and dKO hair cells. Wild-ty pe hair cells showed no rapid FM1-43 uptake after 30 min of pretreatment with 5 mM EGTA, nor did Tmie''~ hair cells. FIG. 4B depicts quantification results of the FM1-43 fluorescence intensity as shown in (A). In each group, three mice w ere used, and more than 30 hair cells per mouse were analyzed. The total number of cells analyzed per group is indicated in the figure. Data are represented as the mean ± SEM. n.s., not significant. ***p < 0.001 by Student’s t test. Scale bar: 5 pm.

[0026] FIGS. 5A-5F illustrate GABARAPL 1 colocalizes with RIPOR2 in hair cells following AG exposure. FIG. 5A show s P4 wild-type, Gabarapl 1 " . Gabarap ^Gabarapll'^ (dKO), and Tmie / cochlear explants were treated with gentamicin- conjugated Texas Red (GTTR) for 1 min. Note, robust uptake of GTTR in wild-type, Gabarapll'f and dKO hair cells. GTTR uptake was significantly reduced in wild-ty pe hair cells after 30 min of pretreatment with 5 mM EGTA, as well as in Tmie^ hair cells. FIG. 5B depicts quantification results of the GTTR fluorescence intensity as shown in FIG. 5A. In each group, three mice were used, and more than 30 hair cells per mouse were analyzed. The total number of cells analyzed per group is indicated in the figure. Data are represented as the mean ± SEM. n.s., not significant, ***p < 0.001 by Student’s t test. FIG. 5C shows P4 wild-type, Gabarapll'f and Gabarapl Gabarapl 1'^ (dKO) cochlear explants were treated w ith 1 mM GEN for 15 min, fixed, and then stained for RIPOR2 (left) and phalloidin (right). Note, robust translocation of RIPOR2 from base of stereocilia to the pericuticular area in the hair cells. FIG. 5D graphically represents the percentage of RIPOR2 around the stereocilia base as shown in FIG. 5C was measured and quantified. In each group, more than three mice were used, and more than 20 hair cells per mouse were analyzed. The total number of cells analyzed per group is indicated in the figure. Data are represented as the mean ± SEM. n.s., not significant, *** / ’ < 0.001 by Student’s t test. FIG. 5E illustrates the experimental paradigm of determining the localization of 29920-427209

[0027] GABARAPL1 in hair cells. AAVs expressing HA-tagged GABARAPL1, under the control of a CBh promoter, were injected into the wild-type inner ear via the posterior semicircular canal. Cochlear explants were then dissected and exposed to GEN. Then tissues were fixed for immunostaining. FIG. 5F shows Cochlear explants were stained for RIPOR2 (left) and HA (middle). Note, colocalization of RIPOR2 and HA-GABARAPL1 (arrowheads) at the pericuticular area after GEN treatment. A non-AAV-infected cell (arrow) in the middle of the top image served as the control for antibody specificity. (Scale bars, 5 pm.)

[0028] FIGS. 6A-6D indicate expression of AAV-HA-GAB ARAPL 1. FIG. 6A shows AAV- HA-GABARAPL1 vector used in this study contains a CBh promoter, HA-GABARAPL1 coding sequence, a WPRE element, a polyadenylation sequence (pA), and AAV inverted terminal repeats (ITRs). FIG. 6B shows AAVs, expressing HA-tagged GABARAPL1, were added to the culture medium of HEK293 cells. After three days of culture, HEK293 cells were collected and lysed using ice-cold RIP A buffer. Western blotting was carried out to evaluate the expression of HA-GABARAPL1. Both anti-HA and anti-GAB ARAPL 1 antibodies detected a ~14 kDa specific band in samples infected with AAV-HA-GABARAPL1. p-actin was used as the loading control.

[0029] FIGS. 7A-7C display translocation of GAB ARAP and GAB ARAPL 1 in hair cells following AG exposure. FIG. 7A shows cochlear explants dissected from P4 wild-type mice were treated with 1 mM GEN and then stained for GABARAP and RIPOR2. Note, colocalization of GABARAP and RIPOR2 (arrowheads) in the pericuticular area following AG treatment. FIG. 7B depicts P4 Ripor2+ / ' cochlear explants treated with 1 mM GEN exhibited minimal GABARAP accumulation in the pericuticular area. FIG. 7C illustrates AAVs expressing HA-GABARAPL1 were injected into the Pl Ripor2+ / ~ inner ear via the posterior semicircular canal. Cochlear explants were then dissected at P5 and exposed to GEN. Note, minimal HA-GAB ARAPL 1 accumulation in the pericuticular area in Ripor2+~ hair cells. More than three mice were used per group in each experiment. Scale bars: 5 pm.

[0030] FIGS. 8A-8D illustrate GAB ARAPL 1 and GABARAP are essential for AG-induced hair cell death and subsequent hearing loss. FIG. 8A shows 3-wk-old wild-type. Gabarapll~'~ . and Gabarap-^ mice were treated with 800 mg / kg kanamycin (KAN) for 14 consecutive days. Two to four days after the final KAN injection, cochleae were then dissected and fixed for scanning electron microscopy. Middle regions of the cochlea were shown. FIG. 8B depicts the percentages of hair cell death in wild-type, Gabarapll ' . and Gabarap ' mice were quantified. The numbers of analyzed mice are indicated in the figure. Data are represented as 29920-427209 the mean ± SEM. *** / * < 0.001 by Student's t test. FIG. 8C shows ABR thresholds for click stimuli in wild-type. Gabarapll~'~, and Gabarap~'~ mice, measured 2 to 4 d after the final KAN injection. The numbers of analyzed mice are indicated. Data are represented as the mean ± SEM. n.s., not significant, **P < 0.01, ***P < 0.001 by Student’s / test. FIG. 8D shows ABR thresholds for pure tones in wild- type, GabaraplT^ , and Gabarap-^ mice, measured 2 to 4 d after the final KAN injection. Data are represented as the mean ± SEM. P < 0.001 between nontreated and KAN-treated wild-type mice, P < 0.001 between nontreated and KAN-treated Gabarapll~ / ~ mice, no significant difference between nontreated and KAN-treated Gabarap - mice (two-way ANOVA). (Scale bars, 5 pm.)

[0031] FIGS. 9A-9B illustrate that there is no hearing threshold elevation in Gabarap ^ mice following AG treatment. 3-week-old Gabarap''' mice were treated with 800 mg / kg kanamycin (KAN) for 14 consecutive days. Two weeks after the final KAN injection, ABR thresholds were measured for click stimuli shown in FIG. 9A and pure tones as shown in FIG. 9B. The numbers of analyzed mice are indicated. Data are represented as the mean ± SEM. n.s., not significant (Student’s t test) in FIG. 9A. In FIG. 9B, two-way ANOVA test revealed no significant difference between non-treated and KAN-treated Gabarap''’ mice.

[0032] FIGS. 10A-10I show Validation of shRNAs that specifically target Gabarap. FIG. 10A shows the alignment of the coding sequences of the mouse and human GABARAP genes, represented as Gabarap (M) and GABARAP (H) in the figure respectively. Identical nucleotides are colored in light grey, whereas mismatched nucleotides are colored black. Five shRNAs (bars above) that target identical sequences were designed. FIG. 10B shows a plasmid expressing HA- tagged mouse GABARAP, along with a plasmid expressing shRNA, were transfected into HEK293 cells in an equimolar ratio. Western blotting was carried out to evaluate shRNA knockdown efficiency. Scrambled shRNA (shRNA-control) was used as the control, and -actin was used as the loading control. FIG. 10C depicts the relative expression level of HA-GABARAP as shown in FIG. 10B. All values were normalized to P-actin and are shown as relative to samples treated with shRNA-control. Data are represented as the mean ± SEM. **P < 0.01, ***p <0.001 by Student's t test. FIG. 10D depict shRNA-1 knocked down mouse GABARAP efficiently in a dose-dependent manner. Different ratios (2: 1; 1 : 1, and 1:2) of the plasmid expressing HA-GABARAP and plasmid expressing shRNA-1 were used. Scrambled shRNA was used as the shRNA control, and -actin w as used as the loading control. FIG. 10E illustrates quantification of the HA-GABARAP expression as shown in FIG. 10D. All values were normalized to P-actin and are shown as relative to samples treated with shRNA- control. Data are represented as the mean ± SEM. **P < 0.01, ***p < 0.001 by Student’s t test. 29920-427209

[0033] FIG. 1OF depict plasmid expressing mouse GABARAP, human GABARAP, mouse GABARAPL1, or human GABARAPL1. along with either the shRNA-1 or shRNA-control plasmid, were transfected into HEK293 cells in an equimolar ratio. shRNA-1 efficiently knocks down both mouse and human GABARAP. shRNA-1 did not affect the expression of mouse or human GABARAPL1. Scrambled shRNA was used as the shRNA control, and P-actin was used as the loading control. FIG. 10G illustrates quantification of the HA-GABARAP expression as shown in FIG. 10F. Data are represented as the mean ± SEM. ***p < 0.001 by Student’s t test. FIG. 10H shows plasmid expression mouse GABARAP, GABARAPL1, GATE-16 / GABARAPL2, or LC3P, along with the plasmid expressing shRNA-1, were transfected into HEK293 cells in an equimolar ratio. shRNA-1 has no effect on the expression of GABARAPL1, GATE- 16 / GABARAPL2. or LC3p. Scrambled shRNA was used as the shRNA control, and P-actin was used as the loading control. FIG. 101 illustrates quantification of the expression of GABARAP, GABARAPL1, GATE-16 / GABARAPL2, and LC3P as shown in FIG. 10H. Data are represented as the mean ± SEM. n.s., not significant, *** / > < 0.001 by Student’s t test.

[0034] FIGS.11A-11C show validation of shRNAs that specifically target GABARAP. FIG. 11A depict knockdown efficiencies of five shRNAs were tested. A plasmid expressing shRNA, along w ith a plasmid expressing HA-tagged mouse GABARAP, w ere transfected into HEK293 cells in an equimolar ratio. Western blotting was carried out to evaluate shRNA knockdown efficiency. Scrambled shRNA (shRNA-control) was used as the control, and P-actin was used as the loading control. FIG. 11B depicts relative expression level of HA-GABARAP as shown in (A). All values w ere normalized to P-actin and are show n as relative to samples treated with shRNA-control. Data are represented as the mean ± SEM. **p < 0.01, ***p < 0.001 by Student’s t test. FIG. 11C illustrates representative high-magnification images of the cochlea, with and without AAV transduction. GFP (left) was used to identify the transduced cells, while Parvalbumin (right) was used to reveal the hair cells. Note, there is no GFP signal in the cochlea in the absence of AAV transduction. Scale bar: 25 pm.

[0035] FIGS. 12A-12H AAVs expressing shRNA-1 reduce the expression of GABARAP in hair cells. FIG. 12A depicts AAV-shRNA vector used in this study. The expression of shRNA is driven by a U6 promoter and the expression of GFP is driven by a CMV promoter. FIG. 12B shows a representative low-magnification image of an injected cochlea showing the transduction level of AAV-shRNA- 1. 2 pL of AAVs, expressing shRNA-1 and GFP, were injected into Pl mouse inner ear through the posterior semicircular canal. Cochleae were dissected at P7 and fixed for immunostaining. GFP (grey) was used to identify’ the 29920-427209 transduced cells. FIG. 12C illustrates representative high- magnification images of the apical, middle, and basal regions of an injected cochlea. GFP (left) was used to identify the transduced cells, while Parvalbumin (right) was used to reveal the hair cells. Note, hair cells in the apical region showed a higher level of GFP expression. FIG. 12D depicts the percentage of IHCs and OHCs in the apical, middle, and basal regions of cochlea transduced with AAV- shRNA-1. Note, more hair cells were transduced in the apical region of the cochlea compared with the basal region. Four mice were used for analysis. Data are represented as the mean ± SEM. FIG. 12E shows 2 pL of AAVs expressing either shRNA-1 or control shRNA were injected into the inner ears of Pl mice. Cochleae were dissected at P7, and mRNA was extracted. qRT-PCR w as performed to evaluate the expression of Gabarap, Gabarapll, and Gabarapl2. Actb, which encodes fyactin, was used as the endogenous control. Note, significantly reduced Gabarap expression in cochleae that were infected with AAV-shRNA-1. Three mice per group were used, and the experiment was repeated three times. Data are represented as the mean ± SEM. n.s., not significant, **P <0.01 by Student’s t test. FIG. 12F depicts 2 pL of AAVs expressing either shRNA-1 or control shRNA were injected into Pl mouse inner ear. Cochleae were dissected at P7 and lysed for Western blot analysis. Note, reduced GABARAP expression in cochleae that were infected with AAV-shRNA-1. a-tubulin was used as the loading control. The experiment w as repeated more than four times. FIG. 12G shows quantification of the GABARAP and GABARAPL1 expression as shown in FIG. 12F. Data are represented as the mean ± SEM. n.s., not significant, **R< 0.01 by Student’s t test. FIG. 12H shows 2 pL of AAVs expressing either shRNA-1 or control shRNA were injected into Pl mouse inner ear. Cochleae were dissected at P7 and fixed for immunostaining. GFP was used to identify the transduced cells. Note, reduced GABARAP expression in hair cells that were transduced with AAV-shRNA-1. [Scale bars, (FIG. 12B and FIG. 12C) 25 pm; FIG. 12H 5 pm.]

[0036] FIGS. 13A-13F exhibit AAVs expressing shRNA-1 do not affect normal hearing. FIG. 13A show 2 pL of AAVs, expressing shRNA-1 or control shRNA, were injected into Pl wildtype mouse inner ear through the posterior semicircular canal. Auditory functions were characterized at the age of 5 weeks. Representative click ABR traces from 5-week-old uninjected control mice and AAV-shRNA-1 injected mice. FIG. 13B depict ABR thresholds for click stimuli in 5-week-old uninjected wild-type control mice, and mice injected with AAV- shRNA-1 or AAV-shRNA-control. The numbers of analyzed mice are indicated. Data are represented as the mean ± SEM. n.s., not significant by Student’s t test. FIG. 13C depict ABR thresholds for pure tones in 5-week-old uninjected control mice, and mice injected with AAV- 29920-427209 shRNA-1 or AAV-shRNA-control. The numbers of analyzed mice are indicated. Data are represented as the mean ± SEM. No significant difference by two-way ANOVA was detected between uninjected group and AAV-shRNA-1 injected group, or between AAV-shRNA- control injected group and AAV-shRNA-1 injected group. FIG. 13D illustrate representative click ABR traces from 3-month-old uninjected control mice and AAV-shRNA-1 injected mice. FIG. 13E depict ABR thresholds for click stimuli in 3-month-old uninjected control mice and AAV-shRNA-1 injected mice. The numbers of analyzed mice are indicated. Data are represented as the mean ± SEM. n.s., not significant by Student’s t test. FIG. 13F depict ABR thresholds for pure tones in 3-month-old uninjected control mice and AAV-shRNA-1 injected mice. The numbers of analyzed mice are indicated. Data are represented as the mean ± SEM. No significant difference by two-way ANOVA was detected between uninjected group and AAV-shRNA-1 injected group.

[0037] FIGS. 14A-14E depict AAVs expressing shRNA-1 prevent AG-induced hair cell death and subsequent hearing loss. FIG. 14A show 2 pL of AAVs, expressing shRNA-1, were injected into Pl wild-type mouse inner ear through the posterior semicircular canal. Mice at the age of 6 wk were treated with 800 mg / kg KAN twice daily for 14 consecutive days. Whole mounts from the middle part of the cochlea were analyzed by scanning electron microscopy. After KAN treatment, almost all the OHCs were lost in the mice that were not injected with AAV-shRNA-1. Limited hair cell death was observed in the mice that were injected with AAV- shRNA-1 after KAN treatment. FIG. 14B show the percentage of hair cell death in AAV- shRNA-1 or AAV-shRNA-control injected mice after KAN treatment. The numbers of analyzed mice are indicated. Data are represented as the mean ± SEM. ***p < 0.001 by Student’s t test. FIG. 14C illustrate representative click ABR traces from uninjected control mice and AAV-shRNA-1 injected mice, before and after 800 mg / kg KAN treatment. FIG. 14D depict ABR thresholds for click stimuli in uninjected control mice, and mice injected with AAV-shRNA-1 or AAV-shRNA-control, before and after 800 mg / kg KAN treatment. The numbers of analyzed mice are indicated. Data are represented as the mean ± SEM. n.s., not significant. ***P < 0.001 by Student's t test. FIG. 14E depict ABR thresholds for pure tones in uninjected control mice, and mice injected with AAV-shRNA-1 or AAV-shRNA-control. before and after 800 mg / kg KAN treatment. The numbers of analyzed mice are indicated. Data are represented as the mean ± SEM. Significantly elevated hearing thresholds in uninjected control mice and AAV-shRNA-control injected mice after KAN treatment in all tested frequencies (P < 0.001 by Student’s t test). A mild but significant hearing threshold elevation 29920-427209 in AAV-shRNA-1 injected mice after KAN treatment, at frequencies of 20, 24, 28, or 32 kHz (P < 0.001 by Student’s t test).

[0038] DETAILED DESCRIPTION OF THE DISCLOSURE

[0039] The present disclosure provides compositions and methods of treating AG-induced ototoxicity. Gabarapll is a gene that may be involved in AG ototoxicity. Accordingly, hearing loss induced by systemically administered AG may be prevented by inhibiting Gabarap expression, specifically in the inner ear. In certain embodiments of the present disclosure, a recombinant adeno-associated virus (AAV) based RNA interference (RNAi) is described, which can be used to reduce the expression Gabarap in the inner ear and prevent AG-induced ototoxicity7. Administration of the AAV-based RNAi genetic therapy with AG treatment effectively prevents hair cell death and subsequent hearing loss caused by systemic AG administration.

[0040] Definitions

[0041] Before the present disclosure is further described, it is to be understood that this disclosure is not limited to particular embodiments described, as such may. of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present disclosure will be limited only by the appended clauses.

[0042] For the sake of brevity, the disclosures of the publications cited in this specification, including patents, are herein incorporated by reference. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of ordinary skill in the art to which this disclosure belongs. All patents, applications, published applications and other publications referred to herein are incorporated by reference in their entireties. If a definition set forth in this section is contrary to or otherwise inconsistent with a definition set forth in a patent, application, or other publication that is herein incorporated by reference, the definition set forth in this section prevails over the definition incorporated herein by reference.

[0043] The term ''about” as used herein means greater or lesser than the value or range of values stated by 10 percent but is not intended to limit any value or range of values to only this broader definition. Each value or range of values preceded by the term "about" is also intended to encompass the embodiment of the stated absolute value or range of values. 29920-427209

[0044] As used herein, the term “pharmaceutically acceptable carrier’" includes any of the standard pharmaceutical carriers, such as a phosphate buffered saline solution, water, emulsions such as an oil / water or water / oil emulsion, and various types of wetting agents. The term also encompasses any of the agents approved by a regulator}7agency of the US Federal government or listed in the US Pharmacopeia for use in animals, including humans.

[0045] The term “inhibit’" refers to a decrease in an activity, response, condition, disease, or other biological parameter. This can include but is not limited to the complete ablation of the activity, response, condition, or disease. This may also include, for example, a 10% reduction in the activity, response, condition, or disease as compared to the native or control level. Thus, the reduction can be a 10, 20, 30, 40, 50, 60, 70, 80, 90, 100%, or any amount of reduction in between as compared to native or control levels.

[0046] As used herein and in the appended clauses, the singular forms "‘a,” “an,” and "‘the” include plural referents unless the context clearly dictates otherwise. It is further noted that the clauses may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as “solely,” “only” and the like in connection with the recitation of clause elements, or use of a “negative” limitation.

[0047] As used herein, the terms “including,” “containing,” and “comprising” are used in their open, non-limiting sense.

[0048] To provide a more concise description, some of the quantitative expressions given herein are not qualified with the term “about.” It is understood that, whether the term “about” is used explicitly or not, every quantity given herein is meant to refer to the actual given value, and it is also meant to refer to the approximation to such given value that would reasonably be inferred based on the ordinary skill in the art, including equivalents and approximations due to the experimental and / or measurement conditions for such given value. Whenever a yield is given as a percentage, such yield refers to a mass of the entity for which the yield is given with respect to the maximum amount of the same entity that could be obtained under the particular stoichiometric conditions. Concentrations that are given as percentages refer to mass ratios, unless indicated differently.

[0049] The term “polynucleotide.” as used herein, means a molecule including one or more nucleic acid subunits, or nucleotides, and can be used interchangeably with “nucleic acid” or “oligonucleotide”. A polynucleotide can include one or more nucleotides selected from adenosine (A), cytosine (C), guanine (G), thymine (T) and uracil (U), or variants thereof. A nucleotide can include a nucleoside and at least 1, 2, 3. 4, 5, 6, 7, 8, 9, 10, or more phosphate (PO?) groups. A nucleotide can include a nucleobase, a five-carbon sugar (either ribose or 29920-427209 deoxyribose), and one or more phosphate groups. Ribonucleotides are nucleotides in which the sugar is ribose. Polyribonucleotides or ribonucleic acids, or RNA, can refer to macromolecules that include multiple ribonucleotides that are polymerized via phosphodiester bonds. Deoxyribonucleotides are nucleotides in which the sugar is deoxyribose. As used herein, a polyribonucleotide sequence that recites thymine (T) is understood to represent uracil (U).

[0050] ■■Polydeoxyribonucleotides.” ‘"deoxyribonucleic acids.” and “DNA” mean macromolecules that include multiple deoxyribonucleotides that are polymerized via phosphodiester bonds. “Polyribonucleotides,” “ribonucleic acids,” and “RNA” mean macromolecules that include multiple ribonucleotides that are polymerized via phosphodiester bonds. A nucleotide can be a nucleoside monophosphate or a nucleoside polyphosphate. A nucleotide means a deoxyribonucleoside polyphosphate, such as, e.g., a deoxyribonucleoside triphosphate (dNTP), which can be selected from deoxyadenosine triphosphate (dATP), deoxycytidine triphosphate (dCTP), deoxyguanosine triphosphate (dGTP), deoxyuridine triphosphate (dUTP) and deoxythymidine triphosphate (dTTP) dNTPs, and may include detectable tags, such as protein tags, luminescent tags or markers (e.g., fluorophores). A nucleotide can include any subunit that can be incorporated into a growing nucleic acid strand. Such subunit can be an A, C, G, T, or U, or any other subunit that is specific to one or more complementary A, C, G, T or U, or complementary to a purine (i.e., A or G, or variant thereof) or a pyrimidine (i.e., C, T or U. or variant thereof).

[0051] DNA and RNA can be synthesized naturally (e.g. by DNA replication or transcription of DNA or RNA, respectively). DNA and RNA can also be chemically synthesized. RNA can be post- transcriptionally modified. The terms “target mRNA” and “target transcript,” “target sequence” are synonymous as used herein.

[0052] As used herein, “target sequence” refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during the transcription of a GABARAP gene, including mRNA that is a product of RNA processing of a primary transcription product.

[0053] “Targeting” an oligomeric compound to a particular nucleic acid molecule, in the context of this invention, can be a multistep process. The process usually begins with the identification of a target nucleic acid whose function is to be modulated. This target nucleic acid may be, for example, a cellular gene (or mRNA transcribed from the gene) whose expression is associated with a particular disorder or disease state, or a nucleic acid molecule from an infectious agent. In the present invention, the target nucleic acid encodes GABARAP. 29920-427209

[0054] The targeting process usually also includes determination of at least one target region, segment, or site within the target nucleic acid for the antisense interaction to occur such that the desired effect, e.g., modulation of expression, will result. Within the context of the present invention, the term "region" is defined as a portion of the target nucleic acid having at least one identifiable structure, function, or characteristic. Within regions of target nucleic acids are segments. “‘Segments” are defined as smaller or sub-portions of regions within a target nucleic acid. “Sites,” as used in the present invention, are defined as positions within a target nucleic acid.

[0055] The term “RNAi” as used herein refers to interfering RNA or RNA interference. RNAi refers to a means of selective post-transcriptional gene silencing by destruction of specific mRNA by molecules that bind and inhibit the processing of mRNA, for example inhibit mRNA translation or result in mRNA degradation. As used herein, the term “RNAi” refers to any type of interfering RNA, including but are not limited to, siRNAi, shRNAi, endogenous microRNA and artificial microRNA. For instance, it includes sequences previously identified as siRNA, regardless of the mechanism of down-stream processing of the RNA (i.e. although siRNAs are believed to have a specific method of in vivo processing resulting in the cleavage of mRNA. such sequences can be incorporated into the vectors in the context of the flanking sequences described herein).

[0056] The term “RNAi” and “RNA interfering” with respect to an agent of the invention, are used interchangeably herein. RNAi molecules are typically comprised of a sequence of nucleic acids or nucleic acid analogs, specific for a target gene. A nucleic acid sequence can be RNA or DNA, and can be single or double stranded, and can be selected from a group comprising; nucleic acid encoding a protein of interest, oligonucleotides, nucleic acid analogues, for example peptide-nucleic acid (PNA), pseudo-complementary PNA (pc-PNA), locked nucleic acid (LNA).

[0057] As used herein, “shRNA” or “small hairpin RNA” (also called stem loop) is a type of RNAi. shRNAs may be composed of a short, e.g. about 19 to about 25 nucleotide, antisense strand, followed by a nucleotide loop of about 5 to about 9 nucleotides, and the analogous sense strand. Alternatively, the sense strand can precede the nucleotide loop structure and the antisense strand can follow. shRNAs functions as RNAi but are further defined in that shRNA species are double stranded hairpin-like structure for increased stability. These shRNAs, as well as other such agents described herein, can be contained in plasmids, retroviruses, and lentiviruses and expressed from, for example, the pol III U6 promoter, or another promoter. 29920-427209

[0058] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present disclosure, the preferred methods and materials are now described. All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and / or materials in connection with which the publications are cited.

[0059] Except as otherwise noted, the methods and techniques of the present embodiments are generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification.

[0060] A “patient,’’ “subject,” or “individual” are used interchangeably and refer to either a human or a non-human animal. These terms include mammals, such as humans, primates, livestock animals (including bovines, porcines, etc.), companion animals (e.g., canines, felines, etc.) and rodents (e.g., mice and rats). In some embodiments, the term “subject” refers to a mammalian patient in need of such treatment, such as a human.

[0061] As used herein, unless otherwise indicated, the term “treating” means reversing, alleviating, inhibiting the progress of (i.e., curative treatment), or preventing the disorder or condition to which such term applies, or one or more symptoms of such disorder or condition. The term “treatment”, as used herein, unless otherwise indicated, refers to the act of treating as “treating” as defined immediately above. “Preventative” treatment is meant to indicate a postponement of development of a disease, a symptom of a disease, or medical condition, suppressing symptoms that may appear, or reducing the risk of developing or recurrence of a disease or symptom. Thus, prevention of cancer includes, for example, reducing the number of detectable cancerous growths in a population of patients receiving a prophylactic treatment relative to an untreated control population, and / or delaying the appearance of detectable cancerous growths in a treated population versus an untreated control population, e.g., by a statistically and / or clinically significant amount. “Curative” treatment includes reducing the severity of or suppressing the worsening of an existing disease, symptom, or condition. Thus, treatment includes ameliorating or preventing the worsening of existing disease symptoms, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable, preventing additional symptoms from occurring, ameliorating or preventing the underlying systemic causes of symptoms, inhibiting the disorder or disease, e.g., arresting the development of the disorder or 29920-427209 disease, relieving the disorder or disease, causing regression of the disorder or disease, relieving a condition caused by the disease or disorder, or stopping the symptoms of the disease or disorder. “Treatment” can also mean prolonging survival as compared to expected survival if not receiving treatment.

[0062] Administering” or “administration of’ a substance, a compound or an agent to a subject can be carried out using one of a variety of methods known to those skilled in the art. For example, a compound or an agent can be administered, intravenously, arterially, intradermally, intramuscularly, intraperitoneally, subcutaneously, ocularly, sublingually, orally (by ingestion), intranasally (by inhalation), intraspinally, intracerebrally, and transdermally (by absorption, e.g., through a skin duct). A compound or agent can also appropriately be introduced by rechargeable or biodegradable polymeric devices or other devices, e.g., patches and pumps, or formulations, which provide for the extended, slow or controlled release of the compound or agent. Administering can also be performed, for example, once, a plurality of times, and / or over one or more extended periods.

[0063] Appropriate methods of administering a substance, a compound or an agent to a subject will also depend, for example, on the age and / or the physical condition of the subject and the chemical and biological properties of the compound or agent (e g., solubility, digestibility, bioavailability, stability7and toxicity). In some embodiments, a compound or an agent is administered orally, e.g., to a subject by ingestion. In some embodiments, the orally administered compound or agent is in an extended release or slow release formulation, or administered using a device for such slow or extended release.

[0064] As used herein, the phrase “conjoint administration” refers to any form of administration of two or more different therapeutic agents such that the second agent is administered while the previously administered therapeutic agent is still effective in the body (e.g., the two agents are simultaneously effective in the patient, which may include synergistic effects of the two agents). For example, the different therapeutic compounds can be administered either in the same formulation or in separate formulations, either concomitantly or sequentially. Thus, an individual who receives such treatment can benefit from a combined effect of different therapeutic agents.

[0065] A “therapeutically effective amount” or a “therapeutically effective dose” of a drug or agent is an amount of a drug or an agent that, when administered to a subject will have the intended therapeutic effect. The full therapeutic effect does not necessarily occur by administration of one dose, and may occur only after administration of a series of doses. Thus, a therapeutically effective amount may be administered in one or more administrations. The 29920-427209 precise effective amount needed for a subj ect will depend upon, for example, the subject’s size, health and age, and the nature and extent of the condition being treated, such as cancer or MDS. The skilled worker can readily determine the effective amount for a given situation by routine experimentation.

[0066] It is appreciated that certain features of the disclosure, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the disclosure, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination. All combinations of the embodiments pertaining to the sequences described herein are specifically embraced by the present disclosure and are disclosed herein just as if each and every combination was individually and explicitly disclosed, to the extent that such combinations embrace compounds that are stable compounds (i.e., compounds that can be isolated, characterized, and tested for biological activity ). In addition, all subcombinations of the sequences listed in the embodiments describing such variables are also specifically embraced by the present disclosure and are disclosed herein just as if each and every such subcombination of sequences was individually and explicitly disclosed herein.

[0067] EMBODIMENTS

[0068] In certain aspects, a method for preventing aminoglycoside (AG) induced hearing loss in a patient in need thereof comprises: administering to the patient an effective amount of a short hairpin RNA (shRNA) composition comprising an shRNA that decreases GAB ARAP expression; and administering to the patient an aminoglycoside.

[0069] In some embodiments, the GAB ARAP expression is decreased in the ear (e.g., in inner ear hair cells).

[0070] In some embodiments, a pharmaceutical composition for preventing AG induced hearing loss comprises an shRNA that decreases GABARAP expression; and a delivery vehicle.

[0071] In some embodiments, the shRNA comprises a sequence having at least 90% (e g., at least 95%) sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5. In certain preferred embodiments, shRNA comprises a sequence having at least 90% (e.g., at least 95%) sequence identity to SEQ ID NO: 1. 29920-427209

[0072] In some embodiments, the shRNA consists of a sequence having at least 90% (e.g., at least 95%) sequence identity to a sequence selected from the group consisting of SEQ ID NO:

[0073] 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, and SEQ ID NO: 15.

[0074] In some embodiments, the shRNA consists essentially of a sequence having at least 90% (e.g., at least 95%) sequence identity to a sequence selected from the group consisting of SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9. SEQ ID NO: 10. SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, and SEQ ID NO: 15. In some embodiments, the shRNA consists a sequence having at least 90% (e.g., at least 95%) sequence identity to SEQ ID NO: 6 or SEQ ID NO: 7.

[0075] In some embodiments, the shRNA consists of a sequence having at least 90% (e.g., at least 95%) sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5.

[0076] In some embodiments, the shRNA consists essentially of a sequence having at least 90% (e.g., at least 95%) sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2. SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5. In some embodiments, the shRNA consists of a sequence having at least 90% (e g., at least 95%) sequence identity to SEQ ID NO: 1 or SEQ ID NO: 2.

[0077] In some embodiments, the shRNA comprises a sequence selected from the group consisting of SEQ ID NO: 1. SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5. In certain preferred embodiments, the shRNA comprises SEQ ID NO: 1

[0078] In some embodiments, the shRNA consists a sequence having at least 90% (e.g., at least 95%) sequence identity' to SEQ ID NO: 6 or SEQ ID NO: 7.

[0079] In some embodiments, shRNA consists essentially of SEQ ID NO: 6 and SEQ ID NO:

[0080] 7. In some embodiments, the shRNA consists of SEQ ID NO: 6 or SEQ ID NO: 7.

[0081] In some embodiments, the shRNA consists essentially of SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, or SEQ ID NO: 15.

[0082] In some embodiments, the shRNA consists of a sequence having at least 90% (e.g., at least 95%) sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5. In some embodiments, the shRNA consists of a sequence having at least 90% (e.g., at least 95%) sequence identity to SEQ ID NO: 1 or SEQ ID NO: 2. 29920-427209

[0083] In some embodiments, the shRNA consists essentially of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3. SEQ ID NO: 4, and SEQ ID NO: 5.

[0084] In some embodiments, shRNA consists essentially of SEQ ID NO: 1 and SEQ ID NO: 2. In some embodiments, shRNA consists essentially of SEQ ID NO: 1 or SEQ ID NO: 2. In some embodiments, the shRNA consists of SEQ ID NO: 1 or SEQ ID NO: 2.

[0085] In some embodiments, a method for preventing hearing loss comprises administering a short hairpin RNA (shRNA) to a patient in need thereof, wherein the shRNA comprises a sequence of the formula X-L-Y, wherein:

[0086] X is a portion of an shRNA,

[0087] L is a nucleic acid linker that connects X to Y, and

[0088] Y is a complementary strand of RNA to X.

[0089] X may contain a sequence that reduces the expression of GABARAP, for example in the ear. In some embodiments, X comprises a sequence that has at least 90% or at least 95% sequence identity to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5. In some embodiments, X is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO:3, SEQ ID NO:4. SEQ ID NO: 5.

[0090] In some embodiments, Y is a complementary strand of RNA to X. In some embodiments, Y is an antisense strand of RNA to X.

[0091] L is a nucleic acid linker that connects X to Y. In some embodiments, L joins the 3’ terminus of first portion of the shRNA nucleic acid (e.g.. X) to the 5’ terminus of the 2ndnucleic acid (e.g., Y). In some embodiments, L is TTCAAGAGA or TCTCTTGAA.

[0092] In some embodiments, the shRNA composition comprises a viral vector for delivering the shRNA. In a preferred embodiment, the viral vector is an Adeno-Associated Virus (AAV).

[0093] In some embodiments, the shRNA that includes the formula X-L-Y is SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 1 1, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, or SEQ ID NO: 15.

[0094] In some embodiments, the shRNA that includes the formula X-L-Y is SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO:3, SEQ ID NO:4. SEQ ID NO: 5.

[0095] In some embodiments, the shRNA and the aminoglycoside are administered at the same time. In some embodiments, the shRNA composition is administered concurrently with the aminoglycoside. Alternatively, the shRNA and the aminoglycoside are administered at different times. For example, the shRNA can be administered prior to aminoglycoside administration. In some embodiments, the shRNA composition is administered about 1 day to 29920-427209 about 4 weeks prior to aminoglycoside treatment. In some embodiments, the shRNA composition is administered about 3 weeks prior to aminoglycoside treatment.

[0096] In some embodiments, the shRNA composition is administered to the subject by injection.

[0097] In some embodiments, the patient is a mammal. For example, the patient may be a human.

[0098] In some embodiments, the aminoglycoside is selected from the group consisting of gentamycin, tobramycin, amikacin, kanamycin, streptomycin, and combinations thereof. In some embodiments, the aminoglycoside is kanamycin (KAN).

[0099] In some embodiments, the shRNA and delivery vehicle are present in a solution. For example, the shRNA and the delivery vehicle can be present in an unbuffered solution. The unbuffered solution may include or be saline or water. In some embodiments, the composition is administered with a buffer solution, for example a phosphate buffered saline (PBS).

[0100] In an embodiment, the shRNA comprises SEQ ID NO: 1 and the amino glycoside is kanamycin.

[0101] Additional Embodiments

[0102] 1. A method of preventing aminoglycoside (AG) induced hearing loss in a patient in need thereof, the method comprising administering to the patient an effective amount of a short hairpin RNA (shRNA) composition comprising an shRNA that decreases GAB ARAP expression; and administering to the patient an aminoglycoside.

[0103] 2. The method of embodiment 1 , wherein GAB ARAP expression is decreased in the ear (e.g., in inner ear hair cells).

[0104] 3. The method of embodiment 1 or 2, wherein the shRNA comprises a sequence having at least 90% (e.g., at least 95%) sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1. SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5.

[0105] 4. The method of embodiment 1 or 2, wherein the shRNA consists of a sequence having at least 90% (e.g., at least 95%) sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5. 29920-427209

[0106] 5. The method of embodiment 1 or 2. wherein the shRNA consists essentially of a sequence having at least 90% (e.g., at least 95%) sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5.

[0107] 6. The method of embodiment 1 or 2, wherein the shRNA consists of a sequence having at least 90% (e.g., at least 95%) sequence identity to SEQ ID NO: 1 or SEQ ID NO: 2.

[0108] 7. The method of embodiment 1 or 2, wherein the shRNA comprises a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5.

[0109] 8. The method of embodiment 1 or 2, wherein the shRNA consists essentially of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3. SEQ ID NO: 4, and SEQ ID NO: 5.

[0110] 9. The method of embodiment 1 or 2, wherein the shRNA consists essentially of SEQ ID NO: 1 or SEQ ID NO: 2.

[0111] 10. The method of embodiment 1 or 2, wherein the shRNA consists of SEQ ID NO: 1 or SEQ ID NO: 2.

[0112] 11. The method of any one of the preceding embodiments, wherein the shRNA composition comprises a viral vector for delivering the shRNA.

[0113] 12. The method of embodiment 14, wherein the viral vector is an Adeno-Associated Virus (AAV).

[0114] 13. The method of any one of the preceding embodiments, wherein the step of administering the shRNA composition is performed about 3 weeks before the step of administering the aminoglycoside.

[0115] 14. The method of any one of embodiments 1 to 12, wherein the step of administering the shRNA composition occurs concurrently with the step of administering the aminoglycoside.

[0116] 15. The method of any one of the preceding embodiments, wherein the shRNA composition is administered to the subject by injection.

[0117] 16. The method of any one of the preceding embodiments, wherein the patient is a human. 29920-427209

[0118] 17. The method of any one of the preceding embodiments, wherein the aminoglycoside is selected from the group consisting of gentamycin. tobramycin, amikacin, kanamycin, streptomycin, and any combination thereof.

[0119] 18. A pharmaceutical composition for preventing aminoglycoside (AG) induced hearing loss, the composition comprising: an shRNA that decreases GABARAP expression; and a delivery vehicle.

[0120] 19. The pharmaceutical composition of embodiment 18, wherein the delivery vehicle is an Adeno- Associated Virus (AAV).

[0121] 20. The pharmaceutical composition of embodiment 18 or 19, wherein the shRNA and delivery vehicle are present in an unbuffered solution.

[0122] 21. The pharmaceutical composition of any one of embodiments 18-20 wherein the shRNA comprises a sequence having at least 90% (e g., at least 95%) sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5.

[0123] 22. The pharmaceutical composition of any one of embodiments 18-20, wherein the shRNA comprises a sequence having at least 90% (e.g.. at least 95%) sequence identity’ to SEQ ID NO: 1.

[0124] 23. The pharmaceutical composition of any one of embodiments 18-20, wherein the shRNA consists of a sequence having at least 90% (e.g., at least 95%) sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5.

[0125] 24. The pharmaceutical composition of any one of embodiments 18-20, wherein the shRNA consists of a sequence having at least 90% (e.g., at least 95%) sequence identity to SEQ ID NO: 1 or SEQ ID NO: 2.

[0126] 25. The pharmaceutical composition of any one of embodiments 18-20, wherein the shRNA comprises a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5. 29920-427209

[0127] 26. The pharmaceutical composition of any one of embodiments 18-20, wherein the shRNA consists essentially of SEQ ID NO: 1. SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5.

[0128] 27. The pharmaceutical composition of any one of embodiments 18-20, wherein the shRNA consists essentially of SEQ ID NO: 1 or SEQ ID NO: 2.

[0129] 28. The pharmaceutical composition of any one of embodiments 18-20, wherein the shRNA consists of SEQ ID NO: 1 or SEQ ID NO: 2.

[0130] 29. The pharmaceutical composition of any one of embodiments 20-28, wherein the unbuffered solution is saline or water.

[0131] 30. The pharmaceutical composition of any one of embodiments 18, 19, and 21-28 wherein the composition is administered with a buffer solution.

[0132] 31. The pharmaceutical composition of any one of embodiments 18, 19, and 21-30, wherein the buffer solution is phosphate buffered saline (PBS).

[0133] 32. A method for preventing hearing loss by administering a short hairpin RNA (shRNA) to a patient in need thereof, wherein the shRNA comprises a sequence of the formula X-L-Y, wherein:

[0134] X is portion of an shRNA,

[0135] L is a nucleic acid linker that connects X to Y, and

[0136] Y is a complementary strand of RNA to X.

[0137] 33. The method of embodiment 32, wherein X comprises a portion (e.g., the first 5-10 nucleotides)of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO: 5.

[0138] 34. The method of embodiment 32 or 33, wherein L is TTCAAGAGA or TCTCTTGAA.

[0139] 35. The method of any one of embodiments 32-34, wherein the shRNA consists of a sequence having at least 90% (e.g., at least 95%) sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4. and SEQ ID NO: 5.

[0140] 36. The method of any one of embodiments 32-34, wherein the shRNA consists of a sequence having at least 90% (e.g., at least 95%) sequence identity to SEQ ID NO: 1 or SEQ ID NO: 2. 29920-427209

[0141] EXAMPLES

[0142] Example 1: Exemplary Materials and Methods

[0143] The following examples provide exemplary materials and methods utilized in examples as described herein.

[0144] Animal models

[0145] Gabarapi '~ mice were made using CRISPR / Cas9 technology on a C57BL / 6J background. A CRISPR design tool was used to analyze the exon 2 sequence of Gabarapll. Two sgRNAs, targeting genomic DNA sequence 5'-GGGTCCCTGATCTGGATAAGAGG-3' (SEQ ID NO: 27) and 5'-ATGGTTACCAGTGAGGTCGGAGG-3' (SEQ ID NO: 28), were synthesized by in vitro transcription following the published protocol and microinjected into one-cell embryos. Genomic DNA from the offspring obtained by the embryo injections was then collected and screened by PCR using the following primers: 5'-GGAGTATTGGAAATGGGGACT-3' (SEQ ID NO: 24) and 5'-GCCAGCTCACTGAAGGAAAC-3' (SEQ ID NO: 25). The founder mice were then backcrossed with C57BL / 6J mice for two generations. Gabarap ' mice have been described previously. Both male and female mice were used in the experiments. No sex-based differences were found. More than three mice per group were used in each experiment.

[0146] All animal experiments were carried out in accordance with the NIH Guide and were approved by the Institutional Animal Care and Use Committee of Indiana University School of Medicine (1ACUC Protocol 22069).

[0147] Cell culture, transfection and Western blotting

[0148] HEK293 (RRID:CVCL_0045) and HEK293T (RRID:CVCL_0063) cells were obtained from the American Type Culture Collection (ATCC) and maintained in DMEM (cat# 11965118, Life Technologies) supplemented with 10% heat-inactivated fetal bovine serum (cat# MT35011CV, Fisher Scientific) and 1% penicillin / streptomycin (cat# 15140122, Life Technologies). Cells were grown at 37 °C in a 5% CO2 humidified atmosphere. HEK293 cells were transfected with plasmids expressing ATG8 proteins or shRNAs using lipofectamine 2000 (cat# 11668019, Life Technologies) following the manufacturer’s instruction. Three days after transfection, cells were collected and lysed using ice-cold RIPA buffer containing 50 mM HEPES pH 7.4, 150 mM NaCl, 1% Triton X-100, and protease inhibitors. Supernatants were collected after configuration at 16,000 x g at 4 °C for 15 minutes, loaded into SDS-PAGE gels and immunoblotted with suitable antibodies. The intensity of the band was analyzed using ImageJ (NIH). The following antibodies were used for the experiments: anti-HA (cat# 3724, 29920-427209

[0149] RRID:AB_1549585, Cell Signaling Technology), anti-HA (Cat# 11867423001, RRID:AB_390918, MilliporeSigma), anti-GABARAPLl (cat# 11010-1-AP, RRID:AB_2294415, Proteintech), anti-GABARAP (cat# AP1821a, RRID:AB_2278762, abcepta), anti-actin (cat# NB600-501, RRID:AB_10077656, Novus), anti-a-tubulin (cat# T6199, RRID:AB_477583, MilliporeSigma).

[0150] Plasmids

[0151] The coding sequence of Gabarap (NM_019749.4), Gabarapll (NM_020590.4), Gabarapl2 (NM_026693.5), Lc3 (NM_026160.4), GABARAP (NM_007278.1) or GABARAPL1 (NM_031412.2) was inserted into the pEGFP-N3 vector (Clontech) between Xhol and Notl endonuclease restriction sites, replacing the EGFP coding sequence with that of the respective gene. The coding sequence of Gabarapll (NM_020590.4) was cloned into the pAAV-Cbh vector (SignaGen). A translation start codon and an HA epitope tag (YPYDVPDYA; ATGTACCCATACGATGTTCCAGATTACGCT, SEQ ID NO: 26) were added at the N-terminus of the above Atg8 genes. shRNA targeting Gabarap (see Table 1) was inserted into AAV-shRNA plasmid (cat# 75438, addgene) between BamHI and EcoRl restriction enzyme site. Primers used to generate the respective shRNA are indicated in Table 2.

[0152] Table 1. shRNA targeting Gabarap

[0153] Table 2. Primers used to generate shRNAs 29920-427209

[0154] AA V production and injection

[0155] AAVs were produced according to the protocols known in the art. In brief. HEK293T cells, cultured in DMEM supplemented with 10% heat-inactivated fetal bovine serum, were transfected with pHelper, pAnc80L65AAP (Cat# 92307, Addgene) and AAV expression plasmids in an equimolar ratio using polyethylenimine. One day after transfection, culture medium was changed to DMEM supplemented with 2% heat-inactivated fetal bovine serum. After four days of culture, cells were harvested and lysed. Supernatants were collected after configuration at 16,000 x g at 4 °C for 15 minutes. Then, density gradient ultracentrifugation was performed by loading supernatant onto 60%, 40%, 25% and 15% iodixanol layers and centrifuge at 350,000 x g for 1.5 hours at 4 °C. To remove iodixanol in the AAV containing fractions, buffer exchange was performed using 100 kD Amicon ultra- 15 centrifugal filter unit (MilliporeSigma). AAV titer was determined by qRT-PCR using PowerUp™ SYBR™ Green Master Mix kit (Cat# A25741, Life Technologies) and QuantStudio™ 3 Real-Time PCR system (Life Technologies). AAVs (~ 1 X 1010 GC) were injected into P1-P2 pups via posterior semicircular canal according to the known methods. 29920-427209

[0156] Cochlear explant culture and immunostaining

[0157] Cochlear explants were dissected and cultured according to established protocols. In brief, cochleae from P3-P4 mice were dissected and cultured in DMEM / F12 medium (cat# 21041025, Life Technologies) at 37 °C in a 5% CO2 humidified atmosphere. Then cochlear explants were treated with 1 mM GEN for 15 minutes at 37 °C, and fixed with 4% formaldehyde in Hank’s Balanced Salt Solution (HBSS) for 20 minutes. Samples were washed with HBSS three times and the tectorial membrane was then removed. Next, samples were blocked with 5% bovine serum albumin for 20 minutes at room temperature and incubated with primary antibodies overnight at 4 °C. After incubating with secondary antibodies for 2 hours at room temperature, tissues were mounted in ProLong® Antifade Reagents (Life technologies). Stacked images were then captured by using a fluorescence deconvolution microscope (Leica) or a confocal (Leica). The fluorescence intensity of RIPOR2 at the base of stereocilia was measured using ImageJ (NIH).

[0158] The primary antibodies employed in this study were as follows: anti-RIPOR2, anti-HA (Cat# 11867423001, RRID:AB_390918, MilliporeSigma), anti-GABARAP (Cat# GABA 8H5; RRID: AB 2904599, Provided by Drs. Regina Feederle and Andrew Flatley at Helmholtz Zentrum Munich, and Dr. Silke Hoffmann at Forschungszentrum Jiilich), anti-GFP (Cat# 600- 901-215, RRID:AB_1537402, Rockland) and anti-parvalbumin (Cat# SAB4200545, RRID:AB_2857970, MilliporeSigma). Additional reagents included: Alexa Fluor 568- phalloidin (Life technologies), Alexa Fluor 488 goat anti-rabbit (Life technologies), Alexa Fluor 488 goat anti-chicken (Life technologies), Alexa Fluor 546 goat anti-rat (Life technologies), Alexa Fluor 546 goat anti-mouse (Life technologies) and Alexa Fluor 647 goat anti-mouse (Life technologies).

[0159] Kanamycin treatment

[0160] Kanamycin (KAN) treatment was performed as is known. In brief, after dissolving KAN (Fisher Scientific) in USP grade saline (Fisher Scientific), the concentration was adjusted to 160 mg / mL. Subcutaneous injections were administered twice daily for 14 consecutive days. There was a minimum of 8 h interval between the two injections within a day. The dosage of KAN was determined daily according to the body w eight of the mice. Tw o to four days (FIG. 8 and FIG. 14) or 2 wk (FIG. 9) after the final KAN injection, mice were subjected to morphological analysis and auditory function tests. qRT-PCR 29920-427209

[0161] Cochleae were dissected from P7 pups. RNA was extracted using RNeasy mini kit (Qiagen), and cDNA was reverse transcribed using Superscript III Reverse Transcriptase (Life Technologies). Then, qRT-PCR was performed using the QuantStudio™ 3 Real-Time PCR system (ThermoFisher) and the PowerUp™ SYBR™ Green Master Mix kit (A25741, ThermoFisher).

[0162] Primers used to detect Gabarap were: 5'- GCTCTGAGGGCGAGAAAATC -3’ (SEQ ID NO: 16) and 5’- ACTGGTGGGTGGAATGACAT -3?(SEQ ID NO: 17); Primers used to detect Gabarapll were: 5'- GGACCACCCCTTCGAGTATC -3’ (SEQ ID NO: 18) and 5’- GTTGTCCTCATACAGCTGGC -3’ (SEQ ID NO: 19); Primers used to detect Gabarapl2 were: 5’- AGTCTCGGGCTCTCAGATTG -3’ (SEQ ID NO: 20) and 5’- AGAGACACAAGCAGGAAGGG -3’ (SEQ ID NO: 21). Actb. which encodes -actin, was used as the endogenous control. Primers used to detect Actb were: 5’-

[0163] CATTGCTGACAGGATGCAGAAGG -3’ (SEQ ID NO: 22) and 5’-

[0164] TGCTGGAAGGTGGACAGTGAGG -3’ (SEQ ID NO: 23).

[0165] Scanning electron microscopy

[0166] The experiment was performed according to established methods. In brief, inner ears were dissected in fixative (0.05 mM HEPES Buffer pH 7.2; 2.5% glutaraldehyde; 4% formaldehyde; 10 mM CaCk; 5 mM MgCh; 0.9% NaCl) and fixed for 1 hour at room temperature. After dissecting the samples, the stria vascularis, Reissner's membrane, and tectorial membrane were removed. Following post-fixation for one day at 4 °C in the same fixative, samples were washed with a washing buffer containing 0.05 mM HEPES Buffer (pH of 7.2) and 0.9% NaCl. Then, samples were fixed in 1% OsCh for 1 hour, serially dehydrated in ethanol, dried in a critical point drier (Autosamdri-815A, Tousimis), fine dissected, mounted on aluminum stubs, coated by gold, and imaged on a JEOL 7800F scanning electron microscope. To evaluate the survival of hair cells after KAN treatment, the percentage of hair cells that were lost in the middle turn of cochleae was quantified.

[0167] ABR measurement

[0168] ABR experiments were performed as previously described, using TDT Bioacoustic system 3 and software (BioSig). In brief, mice were anesthetized using a cocktail of xylazine and ketamine. Three subdermal needle electrodes were placed at the vertex (active electrode), ipsilateral ear (reference electrode) and near the tail (ground electrode). The speaker was positioned 5 cm away from the mouse's ear. The sound stimulus started at an intensity of 90 29920-427209 dB and decreased stepwise to a sub-threshold level. ABR thresholds were analyzed for the left ear and for a range of frequencies (for Pure Tone, 4-32 kHz). If no ABR wave was detected at maximum intensity stimulation, a nominal threshold of 90 dB was assigned.

[0169] Statistics

[0170] Each experimental group had a minimum of three animals of both genders from different litters. Precise numbers, sample size, repetitions and statistic tests are indicated in the figures and figure legends. Data are represented as the mean ± standard error of the mean (SE). Student's two-tailed unpaired t test and two-way ANOVA were used to determine statistical significance (n.s., not significant, *, p<0.05, **, p<0.01, ***, p<0.001).

[0171] Example 2: Generation of Gabarapll-null mouse

[0172] GABARAP and GABARAPL1 share 87% amino acid identity (FIG. 2A) GABARAP and GABARAPL1 share 87% amino acid identity (FIG. 2A) and function redundantly in the autophagy pathway. According to published RNA-Seq studies, Gabarap and Gabarapll are highly expressed in hair cells. To extensively study the expression profiles of Gabarap and Gabarapll in the inner ear, specific RNAscope in situ hybridization probes targeting each gene were designed. Indeed, RNAscope revealed a robust expression of both Gabarap and Gabarapll in cochlear OHCs and IHCs. which are characterized by abundant Myosin 7A (MY07A) expression (FIGS. 1A-1D and FIG. 2B). Both genes were also expressed in some surrounding cells, such as Deiters' cells (FIGS. 1A-1C), which is consistent with previous single-cell RNA-seq studies. As a control, the RNAscope probe targeting Myo 7a produced a strong signal in both OHCs and IHCs, overlapping with the immunostaining signal from the MY07A antibody (FIG. ID). In line with RNASeq results, which indicate higher expression levels of Gabarap compared with Gabarapll in hair cells, qRT-PCR analysis also suggested that Gabarap is expressed at higher levels than Gabarapll in the inner ear (FIG. 2C).

[0173] To gain insight into the functions of GABARAPL1 in hair cells, a 37-bp nucleotide deletion was introduced in the exon 2 of Gabarapll using the CRISPR / Cas9 system. The frameshift caused by the deletion in the Gabarapll genomic locus resulted in a change of amino acid after residue 40, followed by an early stop codon (FIGS. 2D-2G and FIG. 3A). To confirm whether this mouse is a Gabarapll -mW mutant, cochlear tissue was dissected from pups at postnatal day 7 (P7). and Western blotting was performed. Antibodies specific to GABARAPL1, which do not recognize GABARAP or GATE-16 / GABARAPL2 — another 29920-427209 homolog sharing 71% amino acid identity with GABARAPL1 and 58% amino acid identity with GABARAP (FIG. 2A and FIG. 2H), detected a ~15 kDa protein in wild-type mice but not in the Gabarapll -mutant mice (FIG. 3B). This result suggests that this mouse is a. Gabarapll-mA\ mutant. Hereafter, this mouse will be referred to as the mouse.

[0174] Example 3: Neither GABARAP nor GABARAPL1 is required for stereocilia morphogenesis or for normal hearing.

[0175] As determined by coimmunoprecipitation assays, both GABARAP and GABARAPL1 bind strongly with RIPOR2, a protein that is required for stereocilia morphogenesis and AG- induced hearing loss. Mice lacking RIPOR2 have disorganized stereocilia and profound early- onset hearing loss. To investigate the extent to which GABARAPL1 is required for the morphogenesis of stereocilia, scanning electron microscopy and whole mount immunostaining were performed. Hair bundle development and RIPOR2 localization in hair cells were minimally affected at P7 in mice lacking GABARAP or GABARAPL1 (FIG. 3C and FIG. 3D). Given the redundant functions of GABARAP and GABARAPL1 in the autophagy7pathway, it was asked whether GABARAP and GABARAPL1 could compensate for one another’s function in the single null mutant mouse. Thus, Gabarap and Gabarapll doubleknockout mice were generated (referred to as Gabarap~ / ~Gabarapll~ / ~) by crossing Gabarap~ / _mice with Gabarapll~ / ~ mice. The hair bundle morphology7of Gabarap~ ~ Gabarapl 1~'~ mice was then characterized. Scanning electron microscopy and whole mount immunostaining revealed that stereocilia morphology7and RIPOR2 localization were unaffected in the double-knockout mice (FIG. 3C and FIG. 3D). Next, the styryl dye FM1-43 was used to assess MET activity in hair cells. Rapid FM1-43 uptake w as abolished in hair cells lacking MET, either through genetic knockout of TMIE, an essential subunit of MET channel, or via pharmacological treatment with 5 mM EGTA. Remarkably, robust intracellular fluorescence following a brief 30-s exposure to 5 pM FM1-43 was observed in Gabarapla and Gabarap-^ GabaraplG^ hair cells (FIG. 4A and FIG. 4B), indicating the presence of functional MET in these mutant mice. Next, to characterize the auditory7function of these mice, the auditory brainstem response (ABR) to broadband click stimuli was measured. Both Gabarapll ' single-knockout mice and Gabarap Gabarapll doubleknockout mice had normal hearing at 6 weeks and 3 months of age (FIG. 3E). Furthermore, pure tone audiometry revealed that hearing thresholds were unaffected across the entire tested 29920-427209 frequency spectrum (4 to 32 kHz) (FIG. 3F). These results suggest that GABARAP and GABARAPL1 are dispensable for normal hearing.

[0176] Example 4: GABARAPL1 colocalizes with RIPOR2 in hair cells following AG exposure.

[0177] AGs enter hair cells mainly through the MET channel, which is formed by TMC 1 / TMC2. TMIE. and other components. Genetic deletion of TMC1 / TMC2 or TMIE results in the loss of robust AG uptake in hair cells (FIG. 5A). To investigate whether GABARAP and GABARAPL1 are required for AG uptake by hair cells, cochlear explants were dissected from P4 Gabarapll- / ~ and Gabarap (iabarapll mice, and subsequently incubated with GEN-conjugated Texas Red (GTTR) for 1 min. The robust uptake of GTTR in Gabarapll~'~ and Gabarap~ / ~Gabarapll~'~ hair cells was not significantly different from that in wild-type hair cells (FIG. 5A and FIG. 5B), suggesting that depletion of GABARAP and GABARAPL1 expression has no effect on AG uptake by hair cells. In line with previous studies, robust GTTR uptake was abolished in hair cells lacking MET subunit TMIE, as well as in wild-type hair cells with impaired MET following EGTA treatment (FIG. 5A and FIG. 5B)

[0178] AGs trigger a rapid translocation of RIPOR2 from the base of stereocilia to the pericuticular area within minutes. GABARAP and GABARAPL1, in addition to their roles as essential components in the autophagy pathway, are known for their involvement in regulating the transport and cell surface expression of various receptors and ion channels in different types of cells. Thus, the GEN-triggered translocation of RIPOR2 was characterized in Gabarapi " single-knockout mice. Cochlear explants were dissected from P4 mice, treated with 1 rnM GEN for 15 min, and then fixed for immunostaining to characterize RIPOR2 localization. A rapid translocation of RIPOR2 from the stereocilia base to the pericuticular region was induced by GEN in Gabarapll-'- hair cells, without any significant difference when compared with wild-type hair cells (FIG. 5C and FIG. 5D). It is possible that GABARAP may compensate for the function of GABARAPL1 in Gabarapl 1 mice. Thus, RIPOR2 translocation was characterized double-knockout hair cells. Similar to that in wild-type hair cells, GEN triggered a robust translocation of RIPOR2 in Gabarap (iabarapll - double-knockout hair cells (FIG. 5C and FIG. 5D).

[0179] To investigate whether GABARAPL1 is involved in AG ototoxicity', its localization in wild-type hair cells treated with or without AG was studied. Due to a lack of specific antibodies for immunostaining, an AAV vector was packaged containing the CBh promoter to drive HA- 29920-427209 tagged GABARAPL1 expression (FIG. 6). AAV was injected into the inner ear of Pl wildtype mice through the posterior semicircular canal. Cochlear explants were then dissected at P5 and treated with GEN (FIG. 5E). Similar to GAB ARAP (FIG. 7 A), without GEN treatment, HA-GABARAPL1 diffused in hair cells. Notably, after 5- or 15-min of GEN treatment, HA- GABARAPL1 was concentrated in the pericuticular area and colocalized with RIPOR2 (FIG. 5F), indicating that GABARAPL1 is involved in the RIPOR2-mediated AG-ototoxicity pathway. Similar to GAB ARAP (FIG. 7B), HA-GABARAPL1 did not significantly accumulate in the pericuticular area of Ripor2+ / heterozygous hair cells with reduced RIPOR2 expression following GEN treatment (FIG. 7C). This suggests that RIPOR2 regulates GABARAPL1 translocation and functions upstream of GABARAPL1.

[0180] Example 5: GABARAPL1 and GABARAP are essential for AG-induced hair cell death and subsequent hearing loss.

[0181] Next, the extent to which GABARAPL1 is required for AG ototoxicity was determined using a well-established method for studying AG ototoxicity: subcutaneous injection of 800 mg / kg KAN twice daily for 14 consecutive days, which induces robust hair cell death and profound hearing loss across all frequencies in wild-type C57BL / 6J mice. After 14 d of KAN treatment, cochleae from Gabarapll~'~ mice, Gabarap~'~ mice, and wild-type C57BL / 6J control mice were dissected, and scanning electron microscopy was performed. In wild-type mice, only -18% of hair cells survived after 800 mg / kg KAN treatment. In GabaraplT^ mice treated with KAN, more than 80% of the hair cells survived (FIG. 8A and FIG. 8B). Remarkably, minimal hair cell loss was detected in Gabarap mice after KAN treatment (FIG. 8A and FIG. 8B). These results suggest that ablating GABARAPL1 provides partial protection against AG-induced hair cell death, whereas ablating GABARAP offers complete protection against hair cell death induced by AG.

[0182] Consistent with the histological results, wild-type mice were profoundly deaf across the entire tested frequency spectrum (4 to 32 kHz) after 800 mg / kg KAN treatment, as determined by click ABR and pure-tone audiometry (FIG. 8C and FIG. 8D). In Gabarapll~'~ mice, the same KAN treatment resulted in a -16 dB hearing threshold elevation, as determined by click ABR; accompanied by mild hearing loss at lower frequencies and moderate-to-severe hearing loss at higher frequencies, as determined by pure-tone audiometry (FIG. 8C and FIG. 8D). Notably, no significant hearing threshold elevation across the entire tested frequency spectrum was detected in Gabarap mice following KAN treatment (FIG. 8C, FIG. 8D and FIGS. 29920-427209

[0183] 9A-9B). These results suggest that both GAB ARAP and GABARAPL1 are essential for AG- induced hearing loss and that GAB ARAP has a more prominent function than GAB ARAPL 1.

[0184] Example 6: Validation of shRNAs that specifically target GAB ARAP.

[0185] Given that GAB ARAP, compared to GABARAPL1, plays a dominant role in AG ototoxicity, and that genetic ablation of GABARAP does not affect normal hearing, one aim herein is to develop drug modalities to inhibit GABARAP expression, thereby mitigating AG- induced hearing loss. Additionally, to date, all genetic mouse models that have been reported to be entirely resistant to AG ototoxicity are null mutants. Thus, it was asked whether reducing the expression of Gabarap specifically in the inner ear could prevent hearing loss induced by AG that is administered systemically. Thus, one aim herein is to use AAV-based RNAi to reduce Gabarap expression, specifically in the inner ear.

[0186] Gabarap is highly conserved across species. The coding sequences of mouse and human Gabarap mRNAs exhibit -95% nucleotide identity (FIG. 10A). With future clinical and translational research in mind, one aim herein is to design shRNAs targeting Gabarap mRNA of both mouse and human origin. Given that the coding sequence (CDS) of Gabarap has only 354 nucleotides, it is noteworthy that there are only six regions where identical nucleotides span more than 19 base pairs, which is the minimal length required for shRNA design. A total of five shRNAs that target the conserved sequence spanning both mouse and human Gabarap mRNAs were designed following shRNA design rules (FIG. 10A). To evaluate the knockdown efficiencies of these shRNAs, HEK293 cells that overexpressed mouse or human GABARAP w ere used. The expression of mouse GABARAP was effectively knocked down by each of the five shRNAs (FIG. 10B. FIG. IOC, FIG. 11A, and FIG. 11B) One shRNA, hereafter referred to as shRNA-1, was chosen for further study because of its better knockdown efficiency (FIG. 10B, FIG. 10C, FIG. 11A, and FIG. 11B). Next, Western blot analysis revealed that the expression of both mouse and human GABARAP was knocked down in a dose-dependent manner by shRNA-1, but not by the control shRNA (FIGS. 10D-10G). Notably, shRNA-1 specifically reduced the expression of GABARAP without affecting the expression of other Atg8 family proteins including GABARAPL1 , GATE-16 / GABARAPL2, and LC30 (FIGS. 10F-10I). 29920-427209

[0187] Example 7: Reducing GABARAP expression does not affect normal hearing.

[0188] Next, an AAV expressing shRNA-1 under the control of a U6 promoter, hereafter referred to as AAV-shRNA-1, was produced and purified. AAV-shRNA-1 also expressed green fluorescence protein (GFP) under the control of a CMV promoter to identify the cells that were transduced (FIG. 12A). Wild-type mice were injected with AAV-shRNA-1 via the posterior semicircular canal at Pl. Then, the cochleae were dissected at P7 and fixed for immunostaining. As indicated by the GFP fluorescence signal, -92% of the IHCs and -89% of the OHCs in the apical region, -92% of the IHCs and -82% of the OHCs in the middle region, and -82% of the IHCs and -76% of the OHCs in the basal region were transduced with AAVs (FIGS. 12B-12D, and FIG. 11C). In addition to the higher AAV transduction rate at the apical region, most apical hair cells exhibited a stronger GFP fluorescence signal compared with basal hair cells (FIG. 12C and FIG. 12D), which is in line with the previously reported tonotopic gradient of AAV transduction from the apex to the base in the inner ear.

[0189] Next, qRT-PCR, Western blotting, and immunostaining revealed that the expression of GABARAP was significantly lower in hair cells after AAV-shRNA-1 administration than in those after control AAV-shRNA administration (FIG. 12E-12H). Treatment with AAV- shRNA-1 did not affect the expression of Gabarapll or Gabarapl2 in the inner ear (FIG. 12E- 12G)

[0190] To determine whether reducing GABARAP expression through AAV -mediated RNAi affects normal hearing, the auditory functions of mice injected with AAV-shRNA-1 were characterized. The auditory brainstem responses to broadband click stimuli were not affected at 5 wk or 3 mo of age (FIG. 13A, FIG. 13B, FIG. 13D, and FIG. 13E). Furthermore, pure tone audiometry revealed that there was no significant change in hearing thresholds across the entire frequency spectrum, in the AAV-shRNA-1 treated mice compared with the untreated mice or control AAV-shRNA injected mice (FIG. 13C, and FIG. 13F). These results indicate that AAV-shRNA-1. which reduces GABARAP expression, does not affect normal hearing.

[0191] Example 8: Reducing GABARAP expression prevents AG-induced hair cell death and subsequent hearing loss

[0192] Next, to determine whether AG ototoxicity can be prevented by specifically inhibiting GABARAP expression in the inner ear, 6-wk-old wild-type mice, which were injected with AAV-shRNA-1 via the posterior semicircular canal at Pl, were given subcutaneous KAN injections at a dose of 800 mg / kg for 14 consecutive days. The cochleae were dissected for 29920-427209 scanning electron microscopy analysis. Mice without AAV injection or injected with control AAV-shRNA lost more than 75% of their hair cells after KAN treatment, whereas mice injected with AAV-shRNA-1 lost only -17.8% of their hair cells (FIG. 14A and FIG. 14B). These results suggest that reducing GABARAP expression in the inner ear prevents AG- induced hair cell death.

[0193] The auditory brainstem responses to broadband click stimuli were then measured. Treatment with 800 mg / kg KAN resulted in profound hearing loss in control mice that did not receive AAV injection or were injected with control AAV-shRNA. Remarkably, the same KAN treatment did not significantly affect the hearing thresholds of mice injected with AAV- shRNA-1 (FIG. 14C and FIG. 14D). Furthermore, pure-tone audiometry revealed that KAN treatment induced profound hearing loss across the entire frequency spectrum tested (4 to 32 kHz) in control mice that did not receive AAV injection or were injected with control AAV- shRNA. In contrast, the same KAN treatment did not induce any significant hearing threshold elevation at lower frequencies (4, 8, 12, or 16 kHz) and only induced a -15 dB hearing threshold elevation at higher frequencies (20. 24. 28. or 32 kHz) (FIG. 14E). The tonotopic gradient of AAV transduction, in which the infection rate is greater in apical hair cells responsible for detecting low -frequency sounds than in basal hair cells tuned to high-frequency sounds (FIGS. 11B-11D), may provide a plausible explanation for the slightly different protective effects observed across different hearing frequencies. These findings suggest that reducing GABARAP in the inner ear prevents AG-induced hearing loss.

[0194] Example 9: Discussion

[0195] Annually, hundreds of millions of doses of AGs are consumed for the treatment of life- threatening Gram-negative bacterial infections; this causes an estimated 20 million cases of hearing loss every year. Therefore, it is imperative to investigate the mechanism by which AGs affect hair cell function in order to identify potential pharmacological targets, and subsequently to develop novel strategies to mitigate AG ototoxicity while preserving antimicrobial activity. It has been demonstrated that the RIPOR2-mediated autophagy pathway is essential for AG- induced hearing loss. Genetic ablation in all tissues the expression of Ripor2, Gabarap. c3[b inkL or Prkn completely prevents AG-induced hair cell death and subsequent hearing loss, paving the way for the rational design and subsequent testing of inhibitors that selectively target the proteins in this pathway. Here, it has been shown that Gabarapll is another gene essential for AG ototoxicity. Furthermore, it has been demonstrated that hearing loss, induced by AG administered systemically, can be prevented by 29920-427209 inhibiting Gabarap expression specifically in the inner ear. Additionally, by using an AAV- mediated gene knockdown approach, hearing loss induced by a high dose of AG in wild-type mice was successfully prevented.

[0196] Since AGs’ severe ototoxicity was first reported in the 1940s, significant efforts have been devoted to the development of pharmacological antidotes to mitigate this adverse effect. However, clinical trials have been discouraging. One aim herein was to mitigate AG ototoxicity by targeting the RIPOR2 / GABARAP pathway. RIPOR2, an AG-binding protein previously identified in hair cells, is essential for AG-induced hearing loss, as is the RIPOR2 / GAB ARAP - mediated autophagy pathway. AG-induced hearing loss can be completely or partially prevented by reducing the expression of Ripor2. Gabarap, c31i. Pinkl . Prkn , or Gabarapll, as identified in this disclosure. However, the autophagy pathway, as well as many of these central autophagy proteins, are not ideal pharmacological targets. Broadly targeting the autophagy pathway can lead to undesirable consequences because the survival of hair cells and auditory7perception depend on several key autophagy proteins, such as Atg5 and Atg7. Genetic deletion otRipor2 ox Prkn expression in mice results in profound or progressive hearing loss, respectively. Additionally, some familial forms of Parkinson's disease have been linked to loss- of-function mutations in PINK1 or PRKN in humans, and genetic knockout cP Pink 1 ox Prkn expression in mice results in central nervous system defects. In this study, Gabarapll was identified as another gene essential for AG-induced hearing loss. However, Gabarapll is not an optimal pharmacological target either, as abolishing its expression can only partially prevent AG ototoxicity. Currently, Gabarap stands as one of the most promising targets for preventing AG ototoxicity7. Gabarap-^xciexP. mice are viable and exhibit no discernible morphological or behavioral abnormalities. Moreover, if RNAi entirely abolishes the expression of GABARAP, GABARAPL1 is most likely able to function redundantly and partially compensate for the absence of GABARAP, ensuring safety without the risk of over inhibition. Furthermore, it was show n that knocking down Gabarap expression in the inner ear does not affect normal hearing. These findings suggest that Gabarap is one of the most promising therapeutic targets for preventing AG-induced hearing loss. However, further studies may uncover some unforeseen adverse effects resulting from inhibiting Gabarap expression.

[0197] Although both GABARAP and GABARAPL1 are abundantly expressed in cochlear hair cells, it was found that GABARAP plays a more prominent role in AG ototoxicity7(FIG. 8). qRT-PCR analysis (FIG. 2C) revealed that Gabarap is expressed at significantly higher levels than Gabarapll in the inner ear. Notably, previous RNA-seq studies, which provide 29920-427209 more detailed gene expression profiles of the inner ear, show that Gabarap is more abundantly expressed in hair cells compared with GabaraplI . The higher mRNA expression level of Gabarap may explain its more prominent role in AG ototoxicity.

[0198] The CDS regions of the mouse and human Gabarap mRNAs are highly conserved, whereas the 5' and 3' untranslated regions have low similarities. Only a few shRNAs can be designed against sequence-identical regions between mouse and human, due to the short length of the Gabarap CDS. The evolutionarily conserved regions, which have been preserved through evolution, frequently encode functionally important amino acids and represent areas of lower redundancy in genetic sequences. Thus, targeting conserved regions may have higher efficacy while minimizing off-target side effects. Importantly, shRNAs that target identical sequences of mouse and human genes can be validated in mouse models in preclinical studies. Thus, although alternative shRNAs that target nonevolutionarily conserved sequences in the CDS regions or untranslated regions can be designed and tested, they are probably not ideal candidates.

[0199] In summary, it has been shown that GabaraplI is another essential gene for AG ototoxicity. By comparing Gabarap and GabaraplI knockout mice, it was demonstrated that Gabarap is a more promising therapeutic target for preventing AG ototoxicity. Significantly, AG ototoxicity can be effectively prevented by inhibiting Gabarap expression specifically in the inner ear. This demonstrates the feasibility of locally administering a compound to inhibit Gabarap expression, offering numerous advantages over systemic delivery, including fewer systemic adverse effects.

Claims

29920-427209CLAIMS1. A method of preventing aminoglycoside (AG) induced hearing loss in a patient in need thereof the method comprising administering to the patient an effective amount of a short hairpin RNA (shRNA) composition comprising an shRNA that decreases GAB ARAP expression; and administering to the patient an aminoglycoside.

2. The method of claim 1, wherein GABARAP expression is decreased in the ear (e.g., in inner ear hair cells).

3. The method of claim 1, wherein the shRNA comprises a sequence having at least 90% (e.g., at least 95%) sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO:

3. SEQ ID NO: 4, and SEQ ID NO: 5.

4. The method of claim 1, wherein the shRNA consists of a sequence having at least 90% (e.g., at least 95%) sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5.

5. The method of claim 1, wherein the shRNA consists essentially of a sequence having at least 90% (e.g., at least 95%) sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5.

6. The method of claim 1, wherein the shRNA consists of a sequence having at least 90% (e.g., at least 95%) sequence identity to SEQ ID NO: 1 or SEQ ID NO: 2.

7. The method of claim 1, wherein the shRNA comprises a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO:

2. SEQ ID NO:

3. SEQ ID NO: 4, and SEQ ID NO: 5.

8. The method of claim 1, wherein the shRNA consists essentially of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5.

9. The method of claim 1, wherein the shRNA consists essentially of SEQ ID NO: 1 or SEQ ID NO: 2.

10. The method of claim 1, wherein the shRNA consists of SEQ ID NO: 1 or SEQ ID NO: 2.29920-42720911. The method of claim 1 , wherein the shRNA composition comprises a viral vector for delivering the shRNA.

12. The method of claim 1, wherein the viral vector is an Adeno- Associated Virus (AAV).

13. The method of claim 1, wherein the step of administering the shRNA composition is performed about 3 weeks before the step of administering the aminoglycoside.

14. The method of claim 1, wherein the step of administering the shRNA composition occurs concurrently with the step of administering the aminoglycoside.

15. The method of claim 1, wherein the shRNA composition is administered to the subject by injection.

16. The method of claim 1 , wherein the patient is a human.

17. The method of any one of the preceding claims, wherein the aminoglycoside is selected from the group consisting of gentamycin, tobramycin, amikacin, kanamycin, streptomycin, and any combination thereof.

18. A pharmaceutical composition for preventing aminoglycoside (AG) induced hearing loss, the composition comprising: an shRNA that decreases GABARAP expression; and a delivery vehicle.

19. The pharmaceutical composition of claim 18, wherein the delivery vehicle is an Adeno-Associated Virus (AAV).

20. The pharmaceutical composition of claim 18, wherein the shRNA and delivery vehicle are present in an unbuffered solution.

21. The pharmaceutical composition of claim 18, wherein the shRNA comprises a sequence having at least 90% (e.g., at least 95%) sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO:

4. and SEQ ID NO: 5.

22. The pharmaceutical composition of claim 18, wherein the shRNA comprises a sequence having at least 90% (e.g., at least 95%) sequence identity to SEQ ID NO: 1.29920-42720923. The pharmaceutical composition of claim 18, wherein the shRNA consists of a sequence having at least 90% (e.g., at least 95%) sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5.

24. The pharmaceutical composition of claim 18, wherein the shRNA consists of a sequence having at least 90% (e.g., at least 95%) sequence identity to SEQ ID NO: 1 or SEQ ID NO: 2.

25. The pharmaceutical composition of claim 18, wherein the shRNA comprises a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5.

26. The pharmaceutical composition of claim 18, wherein the shRNA consists essentially of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5.

27. The pharmaceutical composition of claim 18, wherein the shRNA consists essentially of SEQ ID NO: 1 or SEQ ID NO: 2.

28. The pharmaceutical composition of claim 18, wherein the shRNA consists of SEQ ID NO: 1 or SEQ ID NO: 2.

29. The pharmaceutical composition of claim 20, wherein the unbuffered solution is saline or water.

30. The pharmaceutical composition of claim 18, wherein the composition is administered with a buffer solution.

31. The pharmaceutical composition of claim 18, wherein the buffer solution is phosphate buffered saline (PBS).

32. A method for preventing hearing loss by administering a short hairpin RNA (shRNA) to a patient in need thereof, wherein the shRNA comprises a sequence of the formula X-L-Y, wherein:X is portion of an shRNA,L is a nucleic acid linker that connects X to Y, andY is a complementary strand of RNA to X.

33. The method of claim 32, wherein X comprises a portion (e.g., the first 5-10 nucleotides)of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO: 5.29920-42720934. The method of claim 32, wherein L is TTCAAGAGA or TCTCTTGAA.

35. The method of claim 32, wherein the shRNA consists of a sequence having at least 90% (e g., at least 95%) sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO:

4. and SEQ ID NO: 5.

36. The method of claim 32, wherein the shRNA consists of a sequence having at least 90% (e.g., at least 95%) sequence identity to SEQ ID NO: 1 or SEQ ID NO: 2.

Images