Probe and use thereof

Abstract

The present invention belongs to the technical field of molecular biology. Provided are a probe and the use thereof. The probe comprises a fluorophore, a quencher group and an RNA base, wherein the quencher group is adapted for quenching the fluorophore; the RNA base is located between the fluorophore and the quencher group; and the RNA base is spaced apart from the quencher group by 5bp to 10bp.

Description

Probes and uses thereof TECHNICAL FIELD

[0001] The present application relates to the field of molecular biology, in particular, the present application relates to probes and uses thereof. BACKGROUND

[0002] Nucleic acid isothermal amplification technology is a new solution to overcome the various limitations and shortcomings of PCR technology. Common isothermal amplification technologies include loop-mediated amplification (LAMP), rolling circle amplification, strand displacement amplification, multiple displacement amplification, recombinase polymerase isothermal amplification, single primer isothermal amplification, helicase-dependent isothermal amplification, cross primer amplification technology, nucleic acid-dependent amplification detection technology, or nicking endonuclease isothermal amplification, etc.

[0003] However, current isothermal amplification technologies still face some challenges that need to be solved, such as high false positives. For example, LAMP amplification is mainly based on fluorescent dye method (such as Sybr green), pH indicator method (such as neutral red), metal ion indicator method (such as hydroxynaphthol blue, HNB), turbidity method (such as pyrophosphate precipitation turbidity), etc. The progress of the reaction is indicated by the fluorescence or color change of the corresponding marker substance. This method is often used to detect whether the amplification template exists in the sample. On the one hand, due to the complexity of LAMP primers, the aforementioned methods usually do not have good specificity and are easily affected by external or sample interference factors, resulting in false positive results. On the other hand, the aforementioned methods can only be used to determine whether the detection template exists, and cannot further detect mutations, which also hinders the application of LAMP in more fields. For example, in single nucleotide polymorphism (SNP) detection, the commonly used LAMP SNP detection technology generally uses 5' or 3' mismatched primers. However, since the Bst enzyme usually has low fidelity, the mismatched primers can still be extended, so the SNP genotyping technology also causes false positives.

[0004] Therefore, the existing isothermal amplification detection method still needs to be improved.

[0005] SUMMARY

[0006] The present application aims to at least one of the above technical problems or at least provide a useful commercial choice. To this end, the present application provides a high-specificity probe suitable for nucleic acid isothermal amplification detection.

[0007] Specifically, the technical solution of the present application is as follows:

[0008] In a first aspect, the present application provides a probe. According to embodiments of the present application, the probe comprises a fluorescent group, a quencher group and an RNA base; wherein the quencher group is adapted to quench the fluorescent group; the RNA base is located between the fluorescent group and the quencher group; and the RNA base is spaced apart from the quencher group by 5-10 base pairs. The aforementioned probe is less susceptible to external interference, and can effectively improve the specificity of nucleic acid isothermal amplification detection.

[0009] In a second aspect, the present application provides a method for detecting a target nucleic acid variation based on isothermal amplification. According to embodiments of the present application, the method comprises mixing a probe, an isothermal amplification primer, nucleotides, a polymerase, a RnaseH enzyme and a target nucleic acid; and performing fluorescence detection on the mixed product, and detecting the target nucleic acid variation based on the presence or absence or intensity of the fluorescence signal. The aforementioned probe design helps to accelerate the isothermal amplification reaction process, and can effectively improve the specificity of variation detection. In some examples of the present application, high-specificity variation detection can be achieved by naked eye.

[0010] In a third aspect, the present application provides a method for detecting a target nucleic acid based on isothermal amplification. According to embodiments of the present application, the method comprises mixing a probe, an isothermal amplification primer, nucleotides, a polymerase, a RnaseH enzyme and a target nucleic acid; and performing fluorescence detection on the mixed product, and detecting the target nucleic acid based on the presence or absence or intensity of the fluorescence signal. The aforementioned probe design helps to accelerate the isothermal amplification reaction process, and can effectively improve the specificity of variation detection.

[0011] In a fourth aspect, the present application provides a kit. According to embodiments of the present application, the kit comprises the probe of the first aspect. The aforementioned kit can be used for portable detection of target nucleic acid or its variation in isothermal amplification technology.

[0012] In a fifth aspect, the present application provides the use of the aforementioned kit in gene or pathogen detection, wherein the pathogen includes fungi, bacteria, parasites, viruses or protozoa. The aforementioned kit can accurately, quickly and specifically detect pathogens in samples.

[0013] Additional aspects and advantages of the present application will be in part apparent and in part pointed out hereinafter. BRIEF DESCRIPTION OF DRAWINGS

[0014] The above and / or additional aspects and advantages of the present application will become apparent and be readily appreciated from the following description, including the appended drawings.

[0015] Fig. 1 is a schematic diagram of a probe structure provided in the embodiments of the present application;

[0016] Fig. 2 is a schematic diagram of a probe structure provided in the embodiments of the present application;

[0017] Fig. 3 is a schematic diagram of a probe structure provided in the embodiments of the present application;

[0018] Fig. 4 is a schematic diagram of a nucleic acid detection result of LAMP provided in the embodiments of the present application;

[0019] Fig. 5 is a schematic diagram of a SNP detection result based on LAMP provided in the embodiments of the present application;

[0020] Fig. 6 is a schematic diagram of a SNP detection result based on LAMP provided in the embodiments of the present application;

[0021] Fig. 7 is a schematic diagram of a SNP naked-eye detection result based on LAMP provided in the embodiments of the present application. DETAILED DESCRIPTION

[0022] In the present application, the terms "first", "second" are only for the purpose of description, and cannot be understood as indicating or implying relative importance or implicitly indicating the number of the indicated technical features. Therefore, the features defined with "first", "second" can explicitly or implicitly include at least one of the features. In the description of the present application, the meaning of "a plurality of" is at least two, such as two, three, etc., unless otherwise specifically limited.

[0023] At present, the traditional LAMP detection method has the following disadvantages, such as false positive due to the dependence of non-specific marker binding; high requirement for sample nucleic acid purity, external factors such as buffer, metal ions will interfere with the detection, leading to false positive; and from the principle, it is impossible to effectively distinguish the mutation (such as SNP) site of the amplified fragment, and the design scheme of mismatch primer is also limited by the fidelity of Bst enzyme, which cannot clearly define the difference between wild type and mutant in high concentration sample.

[0024] Therefore, the present application provides a probe, a target nucleic acid variation detection method based on isothermal amplification, a target nucleic acid detection method based on isothermal amplification, a kit and its application. They will be described in detail as follows:

[0025] Probe

[0026] In one aspect, the present application provides a probe, as shown in Fig. 1, which comprises a fluorescent group, a quencher group and an RNA base; wherein the quencher group is suitable for quenching the fluorescent group; the RNA base is located between the fluorescent group and the quencher group; the RNA base is spaced apart from the quencher group by 5-10 bp.

[0027] The aforementioned fluorescent or quencher group and RNA base are too close to affect the cleavage efficiency of Rnase H enzyme, and the distance is too large to cause the probe length to be too long to affect the efficiency of probe binding or form local secondary structure, and also cause the cost to rise. Therefore, in view of the probe binding efficiency and cost factors, the inventors found that the distance between the aforementioned RNA base and the aforementioned quencher group is preferably 5 bp, 6 bp, 7 bp, 8 bp, 9 bp or 10 bp.

[0028] In some examples of the present application, the aforementioned fluorescent group is located at the 5' end or 3' end of the probe, and the aforementioned quencher group is located at the 3' end or 5' end of the probe. Those skilled in the art can understand that the 5' end or 3' end referred to herein only represents the direction, and is not necessarily the 5' end or 3' end of the probe.

[0029] The aforementioned fluorescent group can be selected from at least one of FAM, HEX, ROX, and CY5 Cy5, Atto 425, TET, JOE, VIC, R6G, Yakima Yellow, Quasar570, Quasar670, Cy3, NED, Cy5.5, Cy7, Texas Red, Atto590, IR Dye 650 and IR Dye 750.

[0030] The aforementioned quencher group can be selected from at least one of BHQ1, BHQ2, BHQ3, MGB, BBQ 650, Dabcyl, DBQ1, TAMRA, and Eclipse.

[0031] In the above-mentioned probe, there is one fluorescent group and one quencher group, and the quencher group is suitable for quenching the fluorescent group. In the intact state, the probe does not produce a fluorescent signal; after the probe is cut at the enzyme cutting site, the fluorescent group is separated from the quencher group, and a fluorescent signal is produced. Those skilled in the art can understand that one or more probes can be used in the nucleic acid detection process, and the selection of the fluorescent group is based on the type of nucleic acid to be detected, for example, two nucleic acids are detected, and a probe carrying two different fluorescent groups is selected.

[0032] The aforementioned enzyme capable of cutting the RNA base in the hybrid double-stranded in the aforementioned probe is suitable for the probe of the present application. In a specific example, the aforementioned enzyme for cutting the RNA base is selected from RnaseH enzyme, preferably RnaseH II, more preferably heat-resistant RnaseH II enzyme to adapt to different temperature of isothermal amplification.

[0033] In some examples of the present application, the probe further comprises at least one mismatched base, as shown in Fig. 2. The inventors have found that the specificity of nucleic acid detection can be effectively improved by increasing the number of mismatched bases. However, the number of mismatched bases also affects the specificity of nucleic acid detection. Therefore, the inventors have found through experiments that the specificity of nucleic acid detection is higher when the number of mismatched bases in the probe is maintained at 1-5.

[0034] The position of the mismatched base also affects the specificity of nucleic acid detection. The inventors have found that the specificity of nucleic acid detection is higher when the mismatched base is spaced apart from the RNA base by 1-5 base pairs (e.g., 1 bp, 2 bp, 3 bp, 4 bp, or 5 bp).

[0035] It should be noted that the aforementioned mismatched base can be located at the 5' end of the aforementioned RNA base; can also be located at the 3' end of the aforementioned RNA base; or can be partially located at the 5' end of the aforementioned RNA base and partially located at the 3' end of the aforementioned RNA base. Here, the 5' end or the 3' end only represents the direction.

[0036] In the aforementioned probe, the fluorescent group and the quencher group are spaced apart by 16-24 base pairs, such as 16 bp, 17 bp, 18 bp, 19 bp, 20 bp, 21 bp, 22 bp, 23 bp, or 24 bp.

[0037] In some examples of the present application, the probe further comprises at least one locked nucleic acid base or minor groove binder MGB, as shown in Fig. 3. In the case of a short probe, the addition of a locked nucleic acid base or a minor groove binder MGB enables the probe to tolerate the Tm value of the amplification reaction, thereby increasing the specificity of the hybridization reaction. In some preferred examples of the present application, the number of aforementioned locked nucleic acid bases in the probe is generally not more than 8, and can alternatively be 1, 2, 3, 4, 5, 6, 7, or 8.

[0038] In the aforementioned probe, the fluorescent group and the quencher group are spaced apart by 10-16 base pairs, such as 10 bp, 11 bp, 12 bp, 13 bp, 14 bp, 15 bp, or 16 bp.

[0039] The probe having the aforementioned structure has higher cleavage efficiency and better detection specificity in nucleic acid detection.

[0040] Target nucleic acid variant detection method based on isothermal amplification

[0041] In another aspect, the present application provides a target nucleic acid variant detection method based on isothermal amplification. The method comprises mixing a probe, an isothermal amplification primer, nucleotides, a polymerase, an RnaseH enzyme, and a target nucleic acid; and performing fluorescence detection on the mixed product to detect the target nucleic acid variant based on the presence or absence or intensity of the fluorescence signal.

[0042] The mutation includes at least one of single nucleotide polymorphism, insertion, deletion and fusion.

[0043] Referring to FIG. 2, in some examples of the present application, the aforementioned probe includes a fluorescent group, a quencher group and an RNA base; wherein the quencher group is adapted to quench the fluorescent group; the RNA base is located between the fluorescent group and the quencher group; the RNA base is spaced apart from the quencher group by 5-10 base pairs.

[0044] In some examples of the present application, the enzyme for cutting the RNA base is selected from RnaseH, preferably RnaseH II, more preferably a heat-resistant RnaseH II enzyme.

[0045] In some examples of the present application, the probe further includes at least one mismatch base, preferably 1-5. Wherein the mismatch base is spaced apart from the RNA base by 1-5 base pairs; the fluorescent group is spaced apart from the quencher group by 16-24 base pairs.

[0046] The relevant description of the probe in the present method can refer to the description of the aforementioned probe, which will not be repeated here.

[0047] In some examples of the present application, the aforementioned constant temperature is selected from 63-68°C (such as 63°C, 64°C, 65°C, 66°C, 67°C or 68°C). In some preferred examples of the present application, the aforementioned constant temperature is 65°C.

[0048] The isothermal amplification technology of the present application includes loop-mediated amplification, rolling circle amplification, strand displacement amplification, multiple displacement amplification, recombinase polymerase isothermal amplification, single primer isothermal amplification, helicase-dependent isothermal amplification, cross primer amplification technology, nucleic acid-dependent amplification detection technology or nicking endonuclease isothermal amplification.

[0049] In some examples of the present application, loop-mediated amplification is used as an exemplary detailed description of the isothermal amplification technology for the present method, and those skilled in the art can obtain the specific implementation steps of the remaining isothermal amplification methods based on this method, which will not be repeated here due to the limited space.

[0050] In the loop-mediated amplification system, the aforementioned isothermal amplification primer is selected from any one of the inner primer, the outer primer and the loop primer, the aforementioned RnaseH enzyme is selected from RnaseH II, the aforementioned target nucleic acid is selected from DNA, and the aforementioned polymerase is selected from Bst polymerase.

[0051] Those skilled in the art can understand that if the target nucleic acid is selected from RNA, a reverse transcriptase needs to be added to the reaction system. In some examples of the present application, the aforementioned reverse transcriptase can be selected from AMV reverse transcriptase.

[0052] The aforementioned inner primers are forward inner primer FIP and reverse inner primer BIP; the aforementioned outer primers are forward outer primer F3 and reverse outer primer B3; and the aforementioned loop primers are loop forward primer LF or loop backward primer LB. It should be noted that the aforementioned probe can be used as a primer paired with any of the aforementioned loop primers, for example, any of the aforementioned loop primers is loop forward primer LF, and the aforementioned probe is loop backward primer LB.

[0053] Those skilled in the art can understand that the probe can also be designed as an inner primer or an amplified product nucleic acid fragment, and the principle is the same, which will not be repeated here.

[0054] In the aforementioned loop-mediated amplification system, the concentration of the Bst polymerase is 5U-7U; the concentration of the nucleotide is 1mM-1.5mM; the concentration of the RnaseH II is 28mU-32mU; the concentration of the inner primer is 1.5μM-1.7μM; the concentration of the outer primer is 0.1μM-0.3μM; the concentration of the probe is 0.7μM-0.9μM; the concentration of the loop forward primer LF or loop backward primer LB is 0.7-0.9μM; wherein the probe includes a predetermined site probe, such as an A-site probe, a T-site probe, or a U-site probe, a C-site probe, and a G-site probe.

[0055] It should be noted that in the aforementioned loop-mediated amplification system, the concentration of the inner primer is 1.5μM-1.7μM, which means that the concentration of the forward inner primer is 1.5μM-1.7μM, and the concentration of the reverse inner primer is also 1.5μM-1.7μM; similarly, taking the A-site probe and the G-site probe as an example, the concentration of the A-site probe is 0.7μM-0.9μM, and the concentration of the G-site probe is also 0.7μM-0.9μM, and the rest will not be repeated.

[0056] In the aforementioned loop-mediated amplification system, further comprising magnesium sulfate, and the concentration of the magnesium sulfate is 5mM-7mM.

[0057] The inventors have found, after a large number of experiments, that the preferred loop-mediated amplification system has the following concentrations: the concentration of the Bst polymerase is 6U; the concentration of the nucleotide is 1.25mM; the concentration of the RnaseH II is 30mU; the concentration of the inner primer is 1.6μM; the concentration of the outer primer is 0.2μM; the concentration of the probe is 0.8μM; the concentration of the loop forward primer LF or loop backward primer LB is 0.8μM; and the concentration of the magnesium sulfate is 6mM.

[0058] The design of the aforementioned probe helps to speed up the process of isothermal amplification reaction and effectively improve the specificity of variation detection.

[0059] For the convenience of understanding, the foregoing target nucleic acid variation detection method based on isothermal amplification is described in detail taking single nucleotide polymorphism detection as an example.

[0060] Reaction temperature: 65℃;

[0061] Reaction system: the concentration of Bst polymerase is 6U; the concentration of nucleotide is 1.25mM; the concentration of RnaseH II is 30mU; the concentration of inner primer is 1.6μM; the concentration of outer primer is 0.2μM; the concentration of probe is 0.8μM; the concentration of loop forward primer LF or loop backward primer LB is 0.8μM; the concentration of magnesium sulfate is 6mM.

[0062] In the presence of target nucleic acid, the outer primer, the inner primer and the loop primer mediate the LAMP reaction to proceed, and the primers are extended to produce nucleic acid products. At this time, the probe can specifically bind to the complementary strand in the nucleic acid product, and the RNA base in the probe is cut under the action of RnaseH II, so that the fluorescent group and the quenching group in the probe are separated to produce a report signal. Since the probe itself introduces a mismatched base, the cutting efficiency of RnaseH II is reduced, so only when the RNA base position is completely complementary to the corresponding position of the target fragment can it be cut, and when it is not complementary, the cutting efficiency of RnaseH II is further reduced. Thus, the signal-to-noise ratio (specificity) of different genotypes can be greatly improved, thereby increasing the specificity of the reaction and distinguishing different SNPs. Further, after cutting, the 3' end of the probe without the quenching group can act as a primer to participate in and accelerate the progress of the LAMP reaction.

[0063] Referring to FIG. 3, in some examples of the present application, the foregoing probe comprises: a fluorescent group, a quenching group and an RNA base; wherein the quenching group is adapted to quench the fluorescent group; the RNA base is located between the fluorescent group and the quenching group; the RNA base is spaced apart from the quenching group by 5bp-10bp.

[0064] In some examples of the present application, the RNA base is used to cut the RNA base in the hybridized double strand of the probe and the target nucleic acid. In some examples of the present application, the enzyme of the RNA base is selected from RnaseH, preferably RnaseH II, more preferably heat-resistant RnaseH II enzyme.

[0065] In some examples of the present application, the probe further comprises: at least 1 locked nucleic acid base or minor groove binder MGB. Wherein the locked nucleic acid base is selected from 1-8; the fluorescent group and the quenching group are spaced apart by 10bp-16bp.

[0066] The related description of the probe in the present method can refer to the foregoing description of the probe, which will not be described here again.

[0067] In some examples of the present application, the constant temperature is selected from 63-68°C (e.g. 63°C, 64°C, 65°C, 66°C, 67°C or 68°C). In some preferred examples of the present application, the constant temperature is 65°C.

[0068] The constant temperature amplification technology of the present application includes loop-mediated amplification, rolling circle amplification, strand displacement amplification, multiple displacement amplification, recombinase polymerase isothermal amplification, single primer isothermal amplification, helicase-dependent isothermal amplification, cross primer amplification technology, nucleic acid-dependent amplification detection technology or nicking endonuclease isothermal amplification.

[0069] In some examples of the present application, loop-mediated amplification is used as a constant temperature amplification technology to exemplarily and in detail describe the present method, and those skilled in the art can obtain the specific implementation steps of the remaining constant temperature amplification methods based on the method. Due to the limited space, it will not be described here.

[0070] In the loop-mediated amplification system, the aforementioned constant temperature amplification primer is selected from any one of the inner primer, the outer primer and the loop primer, the aforementioned RnaseH enzyme is selected from RnaseH II, the aforementioned target nucleic acid is selected from DNA, and the aforementioned polymerase is selected from Bst polymerase.

[0071] Those skilled in the art can understand that if the target nucleic acid is selected from RNA, a reverse transcriptase also needs to be added to the reaction system. In some examples of the present application, the aforementioned reverse transcriptase can be selected from AMV reverse transcriptase.

[0072] The aforementioned inner primer is a forward inner primer FIP and a reverse inner primer BIP; the aforementioned outer primer is a forward outer primer F3 and a reverse outer primer B3; and the aforementioned any one of the loop primer is a loop forward primer LF or a loop backward primer LB. It should be noted that the aforementioned probe can be used as a primer paired with the aforementioned any one of the loop primer, for example, the aforementioned any one of the loop primer is the loop forward primer LF, and the aforementioned probe is the loop backward primer LB.

[0073] Those skilled in the art can understand that the probe can also be designed as an inner primer or an amplification product nucleic acid fragment, and the principle is the same, which will not be described here.

[0074] In the aforementioned loop-mediated amplification system, the concentration of the aforementioned Bst polymerase is 5U-7U; the concentration of the aforementioned nucleotide is 1mM-1.5mM; the concentration of the aforementioned RnaseH II is 28mU-32mU; the concentration of the aforementioned inner primer is 1.5μM-1.7μM; the concentration of the aforementioned outer primer is 0.1μM-0.3μM; the concentration of the aforementioned probe is 0.7μM-0.9μM; the concentration of the aforementioned loop forward primer LF or loop backward primer LB is 0.7-0.9μM; wherein the aforementioned probe includes a predetermined site probe, such as an A site probe, a T site probe or a U site probe, a C site probe and a G site probe.

[0075] It should be noted that in the foregoing loop-mediated amplification system, the concentration of the inner primer is 1.5-1.7 μM, which means that the concentration of the front inner primer is 1.5-1.7 μM, and the concentration of the rear inner primer is also 1.5-1.7 μM; similarly, taking the A-site probe and the G-site probe as examples, the concentration of the A-site probe is 0.7-0.9 μM, and the concentration of the G-site probe is also 0.7-0.9 μM, and the rest is not described in detail.

[0076] In the foregoing loop-mediated amplification system, further comprising magnesium sulfate, and the concentration of the foregoing magnesium sulfate is 5-7 mM.

[0077] The inventors have found, after a large number of experiments, that the preferred loop-mediated amplification system has the following concentrations: the concentration of the foregoing Bst polymerase is 6 U; the concentration of the foregoing nucleotide is 1.25 mM; the concentration of the foregoing RnaseH II is 30 mU; the concentration of the foregoing inner primer is 1.6 μM; the concentration of the foregoing outer primer is 0.2 μM; the concentration of the foregoing probe is 0.8 μM; the concentration of the foregoing loop front primer LF or loop rear primer LB is 0.8 μM, and the concentration of the foregoing magnesium sulfate is 6 mM.

[0078] Based on the above method, the target nucleic acid variation detection can be realized under naked eye state by using ultraviolet light excitation. In the probe used in the naked eye detection technology scheme, the fluorescent group carried therein is selected from at least one of FAM, HEX, ROX, CY5Cy5, Atto 425, TET, JOE, VIC, R6G, Yakima Yellow, Quasar570, Quasar670, Cy3, NED, Cy5.5, Cy7, Texas Red, Atto 590, IR Dye 650 and IR Dye 750; and the quenching group is selected from at least one of BHQ1, BHQ2, BHQ3, MGB, BBQ 650, Dabcyl, DBQ1, TAMRA and Eclipse. In some preferred examples of the present application, the foregoing fluorescent group is selected from ROX and / or FAM; and the foregoing quenching group is preferably BHQ1 and / or BHQ2. In some examples of the present application, the wavelength of the foregoing ultraviolet light excitation is selected from 365 nm.

[0079] For the convenience of understanding, the foregoing target nucleic acid variation detection method based on isothermal amplification is described in detail taking single nucleotide polymorphism detection as an example.

[0080] Reaction temperature: 65℃;

[0081] The reaction system: the concentration of Bst polymerase is 6U; the concentration of nucleotide is 1.25mM; the concentration of RnaseH II is 30mU; the concentration of inner primer is 1.6μM; the concentration of outer primer is 0.2μM; the concentration of probe is 0.8μM; the concentration of pre-loop primer LF or post-loop primer LB is 0.8μM; the concentration of magnesium sulfate is 6mM.

[0082] In the presence of target nucleic acid, the outer primer, inner primer and loop primer mediate the LAMP reaction, and the primers are extended to produce nucleic acid products. At this time, the probe can specifically bind to the complementary strand in the nucleic acid product, and the RNA base in the probe is cut under the action of RnaseH II, so that the fluorescent group and the quenching group in the probe are separated to produce a report signal. Because the probe is short in length, when the probe has a mismatch with the target fragment, it cannot be complementary to the target fragment and is in a single-stranded free state, at which time RnaseH II cannot cut the probe; when the probe has no mismatch with the target fragment, it can be complementary to the target fragment and RnaseH II cuts to produce a signal. After the reaction is completed, a 365nm ultraviolet lamp is used for irradiation, and naked-eye SNP detection can be realized according to the presence or absence of fluorescence.

[0083] Target nucleic acid detection method based on isothermal amplification

[0084] In another aspect, the present application provides a target nucleic acid detection method based on isothermal amplification, which comprises: mixing a probe, an isothermal amplification primer, a nucleotide, a polymerase, a RnaseH enzyme and a target nucleic acid; and performing fluorescence detection on the mixed product, and detecting the target nucleic acid mutation based on the presence or absence or strength of the fluorescence signal.

[0085] In some examples of the present application, the probe comprises: a fluorescent group, a quenching group and an RNA base; wherein the quenching group is adapted to quench the fluorescent group; the RNA base is located between the fluorescent group and the quenching group; and the RNA base is spaced apart from the quenching group by 5bp-10bp.

[0086] In some examples of the present application, the enzyme for cutting the RNA base is selected from RnaseH, preferably RnaseH II, and more preferably a heat-resistant RnaseH II enzyme.

[0087] The description of the probe in the present method can refer to the description of the aforementioned probe, which will not be repeated here.

[0088] In some examples of the present application, the isothermal temperature is selected from 63℃-68℃ (such as 63℃, 64℃, 65℃, 66℃, 67℃ or 68℃). In some preferred examples of the present application, the isothermal temperature is 65℃.

[0089] The isothermal amplification technology of the present application includes loop-mediated amplification, rolling circle amplification, strand displacement amplification, multiple displacement amplification, recombinase polymerase isothermal amplification, single primer isothermal amplification, helicase-dependent isothermal amplification, cross primer amplification technology, nucleic acid-dependent amplification detection technology, or nicking endonuclease isothermal amplification.

[0090] In some examples of the present application, loop-mediated amplification is used as an isothermal amplification technology to exemplarily and specifically describe the present method, and those skilled in the art can obtain the specific implementation steps of the remaining isothermal amplification methods based on the method. Due to the limited space, they will not be described here.

[0091] In the loop-mediated amplification system, the aforementioned isothermal amplification primer is selected from any one of the inner primer, the outer primer, and the loop primer, the aforementioned RnaseH enzyme is selected from RnaseH II, the aforementioned target nucleic acid is selected from DNA, and the aforementioned polymerase is selected from Bst polymerase.

[0092] Those skilled in the art can understand that if the target nucleic acid is selected from RNA, a reverse transcriptase also needs to be added to the reaction system. In some examples of the present application, the aforementioned reverse transcriptase can be selected from AMV reverse transcriptase.

[0093] The aforementioned inner primer is a forward inner primer FIP and a reverse inner primer BIP; the aforementioned outer primer is a forward outer primer F3 and a reverse outer primer B3; and the aforementioned any one of the loop primer is a loop forward primer LF or a loop backward primer LB. It should be noted that the aforementioned probe can be used as a primer paired with the aforementioned any one of the loop primer, for example, the aforementioned any one of the loop primer is the loop forward primer LF, and the aforementioned probe is the loop backward primer LB.

[0094] Those skilled in the art can understand that the probe can also be designed as an inner primer or an amplification product nucleic acid fragment, and the principle is the same, which will not be described here.

[0095] In the aforementioned loop-mediated amplification system, the concentration of the aforementioned Bst polymerase is 5U-7U; the concentration of the aforementioned nucleotide is 1mM-1.5mM; the concentration of the aforementioned RnaseH II is 28mU-32mU; the concentration of the aforementioned inner primer is 1.5μM-1.7μM; the concentration of the aforementioned outer primer is 0.1μM-0.3μM; the concentration of the aforementioned probe is 0.7μM-0.9μM; and the concentration of the aforementioned loop forward primer LF or loop backward primer LB is 0.7μM-0.9μM.

[0096] It should be noted that in the aforementioned loop-mediated amplification system, the concentration of the inner primer is 1.5μM-1.7μM, which means that the concentration of the front inner primer is 1.5μM-1.7μM, and the concentration of the rear inner primer is also 1.5μM-1.7μM, and the rest will not be described here.

[0097] In the foregoing loop-mediated amplification system, further comprising magnesium sulfate, and the concentration of the foregoing magnesium sulfate is 5 mM-7 mM.

[0098] The inventors have found, after a large number of experiments, that the preferred loop-mediated amplification system has the following concentrations: 6 U of the foregoing Bst polymerase; 1.25 mM of the foregoing nucleotides; 30 mU of the foregoing RnaseH II; 1.6 μM of the foregoing inner primer; 0.2 μM of the foregoing outer primer; 0.8 μM of the foregoing probe; 0.8 μM of the foregoing pre-loop primer LF or post-loop primer LB; and 6 mM of the foregoing magnesium sulfate.

[0099] The foregoing probe design improves the cleavage efficiency, helps to speed up the process of isothermal amplification reaction, and effectively improves the specificity of variation detection.

[0100] For the convenience of understanding, the foregoing target nucleic acid detection method based on isothermal amplification is described in detail taking the target nucleic acid detection as an example.

[0101] Reaction temperature: 65°C;

[0102] Reaction system: 6 U of Bst polymerase; 1.25 mM of nucleotides; 30 mU of RnaseH II; 1.6 μM of inner primer; 0.2 μM of outer primer; 0.8 μM of probe; 0.8 μM of pre-loop primer LF or post-loop primer LB; and 6 mM of magnesium sulfate.

[0103] In the presence of the target nucleic acid, the outer primer, the inner primer, and the loop primer mediate the LAMP reaction, the primers are extended and nucleic acid products are produced. At this time, the probe can specifically bind to the complementary strand in the nucleic acid product, and the RNA base in the probe is cleaved under the action of RnaseH II, so that the fluorescent group and the quenching group in the probe are separated to produce a reporter signal. Further, the 3' end of the cleaved probe has no quenching group, which can act as a primer to participate in and accelerate the process of LAMP reaction.

[0104] Kit

[0105] In another aspect, the present application provides a kit, which comprises the probe of any of the foregoing examples.

[0106] In some examples of the present application, the foregoing kit further comprises at least one of a constant temperature amplification primer, a nucleotide, a polymerase, a RnaseH enzyme, magnesium sulfate, and a polymerase buffer. The foregoing constant temperature amplification primer comprises at least one of any one of an inner primer, an outer primer, and a loop primer; the foregoing nucleotide comprises at least one of dATP, dTTP or dUTP, dCTP, and dGTP; the foregoing polymerase is selected from Bst; and the foregoing RnaseH enzyme is selected from RnaseH II.

[0107] In some examples of the present application, the foregoing kit further comprises an instruction manual and other commonly used components of a kit.

[0108] The foregoing kit can achieve portable and low-cost detection of target nucleic acids or variations thereof.

[0109] Pathogen detection purposes

[0110] In another aspect, the present application provides a use of the foregoing kit of any one of the examples in gene or pathogen detection, the pathogen including fungi, bacteria, parasites, viruses, or protozoa.

[0111] Embodiments of the present application will be described in more detail below, examples of which are shown in the accompanying drawings. The embodiments described below by reference to the drawings are exemplary and are intended to explain the present application, and are not to be understood as limiting the present application. In the embodiments, specific techniques or conditions not described are performed according to techniques or conditions described in the literature in the art or according to product instructions. The reagents or instruments used are not specified by the manufacturer, and are all conventional products that can be obtained commercially.

[0112] Example 1: Nucleic acid detection by LAMP

[0113] This embodiment utilizes LAMP combined with an RNA-containing probe to achieve detection of the ALDH2 gene. Design of outer primers (F3 / B3), inner primers (FIP / BIP), loop primers, and probes (LF / LB-probe P) for the ALDH2 gene is performed. The LB-probe P is labeled with an A RNA base at the RS671 site. The reaction system is shown in Table 1, and the primer and probe sequences are as follows:

[0114] F3 (5'-3'): GGGTCCTGGGAGTGTAACC (SEQ ID NO: 1);

[0115] B3 (5'-3'): CAACAGGCCCTGAGCCCC (SEQ ID NO: 2);

[0116] LF (5'-3'): CAGTTGACCCTGTAATTTGAAACG (SEQ ID NO: 3);

[0117] FIP (5'-3'): GGTGACTGGGCTCCAAACACATCCCCCAAGAGTGATTTCTGC (SEQ ID NO: 4);

[0118] BIP (5'-3'): GCTACAAGATGTCGGGGAGTGGAGGTCCCACACTCACAGTT (SEQ ID NO: 5);

[0119] LB-probe P (5'-3'): GGGC / i6FAMdT / GCAGGCATACACT / rA / AAGTG-BHQ1 (SEQ ID NO: 6);

[0120] Table 1

[0121] The experimental procedure is as follows:

[0122] 1. The ALDH2 (RS671-A) plasmid is diluted to 1000 copies / ml using nuclease-free water as the AA homozygous mutant template; the ALDH2 (RS671-G) plasmid is diluted to 1000 copies / ml using nuclease-free water as the GG homozygous wild type template;

[0123] 2. The above-mentioned primer probe and reaction system are supplemented to 30 μL, and the nucleic acid amplification of the sample to be tested is carried out;

[0124] 3. The reaction is carried out in a real-time fluorescence detection device at 65°C for 60 min.

[0125] The result is determined as shown in Figure 4. The sample combination of AA homozygous mutant template or GG homozygous wild type template shows obvious amplification curve, and the blank sample group has no amplification curve, indicating that the method can be used for detection of ALDH2 gene, but cannot be used for SNP typing of the gene.

[0126] Example 2: SNP detection based on LAMP

[0127] This example uses LAMP combined with RNA-containing probes to realize SNP typing detection of ALDH2 gene. The LB-probe PA marks the RNA base of A at the RS671 site, and the LB-probe PG marks the RNA base of G at the RS671 site. The mismatched base is marked in bold. The reaction system is shown in Table 2, and the primer and probe sequences are as follows:

[0128] F3 (5'-3'): GGGTCCTGGGAGTGTAACC (SEQ ID NO: 1);

[0129] B3 (5'-3'): CAACAGGCCCTGAGCCCC (SEQ ID NO: 2);

[0130] LF (5'-3'): CAGTTGACCCTGTAATTTGAAACG (SEQ ID NO: 3);

[0131] FIP (5'-3'): GGTGACTGGGCTCCAAACACATCCCCCAAGAGTGATTTCTGC (SEQ ID NO: 4);

[0132] BIP (5'-3'): GCTACAAGATGTCGGGGAGTGGAGGTCCCACACTCACAGTT (SEQ ID NO: 5);

[0133] LB-probe PA (5'-3'): GGGC / i6FAMdT / GCAGGCATACACT / rA / TAGTG-BHQ1 (SEQ ID NO: 7);

[0134] LB-probe PG1 (5'-3'): GGGC / iROXdT / GCAGGCATACACT / rG / TAGTG-BHQ2 (SEQ ID NO: 8);

[0135] Table 2

[0136] The specific steps are as follows:

[0137] 1. The ALDH2 (RS671-A) plasmid is diluted to 1000 copies / ml with nuclease-free water as the AA homozygous mutant template; the ALDH2 (RS671-G) plasmid is diluted to 1000 copies / ml with nuclease-free water as the GG homozygous wild type template; the ALDH2 (RS671-A) plasmid and the ALDH2 (RS671-G) plasmid are mixed at a ratio of 1:1, and diluted to 1000 copies / ml with nuclease-free water as the AG heterozygous mutant;

[0138] 2. The above-mentioned primer probe and reaction system are supplemented to 30 μL, and the nucleic acid amplification of the sample to be tested is carried out;

[0139] 3. The reaction is carried out in a real-time fluorescence detection device at 65°C for 45 min.

[0140] Result determination: As shown in Figure 5, only LB-probe PA showed obvious amplification curve in AA homozygous mutant samples, only LB-probe PG1 showed obvious amplification curve in GG homozygous wild type samples, LB-probe PA and LB-probe PG1 both showed amplification signal in AG heterozygous mutant samples, and the blank sample group had no amplification curve, indicating that this method can be used for ALDH2 gene RS671 genotyping detection.

[0141] Example 3: SNP detection based on LAMP

[0142] This example uses LAMP combined with RNA-containing probes to achieve SNP genotyping detection of ALDH2 gene. Among them, LB-probe PA labels A RNA base at RS671 site, and LB-probe PG labels G RNA base at RS671 site. The mismatched base is marked in bold. The reaction system is shown in Table 3, and the primer and probe sequences are as follows:

[0143] F3 (5'-3'): GGGTCCTGGGAGTGTAACC (SEQ ID NO: 1);

[0144] B3 (5'-3'): CAACAGGCCCTGAGCCCC (SEQ ID NO: 2);

[0145] LF (5'-3'): CAGTTGACCCTGTAATTTGAAACG (SEQ ID NO: 3);

[0146] FIP (5'-3'): GGTGACTGGGCTCCAAACACATCCCCCAAGAGTGATTTCTGC (SEQ ID NO: 4);

[0147] BIP (5'-3'): GCTACAAGATGTCGGGGAGTGGAGGTCCCACACTCACAGTT (SEQ ID NO: 5);

[0148] LB-probe PG1 (5'-3') GGGC / iROXdT / GCAGGCATACACT / rG / TAGTG-BHQ2 (SEQ ID NO: 9);

[0149] LB-probe PG2 (5'-3') GGGC / iROXdT / GCAGGCATACACG / rG / AGTG-BHQ2 (SEQ ID NO: 10);

[0150] LB-probe PG3 (5'-3') GGGC / iROXdT / GCAGGCATACACT / rG / TTCAC -BHQ2 (SEQ ID NO: 11).

[0151] Table 3

[0152] The specific steps are as follows:

[0153] 1. The ALDH2 (RS671-A) plasmid is diluted to 1000 copies / ml using nuclease-free water as the AA homozygous mutant template; the ALDH2 (RS671-G) plasmid is diluted to 1000 copies / ml using nuclease-free water as the GG homozygous wild type template;

[0154] 2. The above-mentioned primer probe and reaction system are supplemented to 30 μL, and the nucleic acid amplification of the sample to be tested is carried out;

[0155] 3. The reaction is carried out in a real-time fluorescence detection device at 65°C for 60 min.

[0156] The results are determined as shown in FIG. 6. The AA homozygous mutant template has no obvious amplification curve, but the sample combination of the GG homozygous wild type template has obvious amplification curves whether it is LB-probe PG1, LB-probe PG2 or LB-probe PG3, indicating that the mismatch site can be located upstream and downstream of the RNA base and can be composed of multiple mismatches.

[0157] Example 4: SNP naked eye detection based on LAMP

[0158] This example uses LAMP combined with RNA-containing probes to realize SNP genotyping detection of the ALDH2 gene. The LB-probe PA marks the RNA base of A at the RS671 site, and the LB-probe PG marks the RNA base of G at the RS671 site. The LNA base is marked in bold. The reaction system is shown in Table 4, and the primer and probe sequences are as follows:

[0159] F3 (5'-3'): GGGTCCTGGGAGTGTAACC (SEQ ID NO: 1);

[0160] B3 (5'-3'): CAACAGGCCCTGAGCCCC (SEQ ID NO: 2);

[0161] LF (5'-3'): CAGTTGACCCTGTAATTTGAAACG (SEQ ID NO: 3);

[0162] FIP (5'-3'): GGTGACTGGGCTCCAAACACATCCCCCAAGAGTGATTTCTGC (SEQ ID NO: 4);

[0163] BIP (5'-3'): GCTACAAGATGTCGGGGAGTGGAGGTCCCACACTCACAGTT (SEQ ID NO: 5);

[0164] LB-probe PAN (5'-3'): ROX-CATACACT / rA / AAGTGA-BHQ2 (SEQ ID NO: 12);

[0165] LB-probe PGN (5'-3'): ROX-CATACACT / rG / AAGTGA-BHQ2 (SEQ ID NO: 13).

[0166] Table 4

[0167] The specific steps are as follows:

[0168] 1. Using nuclease-free water to dilute the ALDH2 (RS671-A) plasmid to 1000 copies / ml as the AA homozygous mutant template; using nuclease-free water to dilute the ALDH2 (RS671-G) plasmid to 1000 copies / ml as the GG homozygous wild type template; mixing the ALDH2 (RS671-A) plasmid and the ALDH2 (RS671-G) plasmid according to 1:1, and using nuclease-free water to dilute to 1000 copies / ml as the AG heterozygous mutant;

[0169] 2. Using the above-mentioned primer probe and reaction system, supplementing the volume to 30 μL, and performing nucleic acid amplification on the sample to be tested;

[0170] 3. Reacting in a 65°C constant temperature device for 45 min;

[0171] 4. Using an ultraviolet lamp to irradiate the reaction product, and observing the results.

[0172] Result determination: as shown in FIG. 7, only the LB-probe PAN appeared a fluorescent signal (pink) in the AA homozygous mutant sample, only the LB-probe PGN appeared a fluorescent signal (pink) in the GG homozygous wild type sample, and both the LB-probe PAN and the LB-probe PGN appeared a fluorescent signal (pink) in the AG heterozygous mutant sample, indicating that the method can be used for naked-eye SNP typing detection of the ALDH2 gene RS671.

[0173] In the description of the specification, the description of the terms "one embodiment", "some embodiments", "an example", "a specific example", or "some examples" etc. means that the specific features, structures, materials or characteristics described in connection with the embodiment or example are contained in at least one embodiment or example of the present application. In the specification, the illustrative description of the above terms does not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any appropriate manner in any one or more embodiments or examples. In addition, the person skilled in the art can combine and combine the different embodiments or examples described in the specification and the features of the different embodiments or examples without contradiction.

[0174] Although the embodiments of the present application have been shown and described above, it is understood that the above-described embodiments are exemplary and are not to be construed as limiting the present application, and the person skilled in the art can make changes, modifications, replacements and variations to the above-described embodiments within the scope of the present application.

Claims

1. A probe, characterized in that, Comprising: a fluorescent group, a quencher group and an RNA base; wherein, the quencher group is adapted to quench the fluorescent group; the RNA base is located between the fluorescent group and the quencher group; the RNA base is spaced 5bp-10bp from the quencher group.

2. The probe of claim 1, wherein The enzyme for cleaving the RNA base is selected from RnaseH.

3. The probe of claim 2, wherein Further comprising: at least 1 mismatch base; Preferably, the mismatch base is selected from 1-5. Optionally, the mismatch base is spaced 1bp-5bp from the RNA base.

4. The probe of claim 2, wherein Further comprising: at least 1 locked nucleic acid base or minor groove binder MGB; Preferably, the locked nucleic acid base is selected from 1-8.

5. The probe according to any one of claims 1 to 3, wherein The fluorescent group is spaced 16bp-24bp from the quencher group.

6. The probe according to any of claims 1-2, 4, wherein, The fluorescent group is spaced 10bp-16bp from the quencher group.

7. A method for detecting a variation in a target nucleic acid based on isothermal amplification, characterized by, Comprising: mixing the probe, the isothermal amplification primer, the nucleotide, the polymerase, the RnaseH enzyme and the target nucleic acid; fluorescence detecting the mixing product, based on the presence or absence or strength of the fluorescence signal, to realize the detection of the mutation of the target nucleic acid.

8. The method of claim 7, wherein, The probe comprises: a fluorescent group, a quencher group and an RNA base; wherein, the quencher group is adapted to quench the fluorescent group; the RNA base is located between the fluorescent group and the quencher group; the RNA base is spaced 5bp-10bp from the quencher group; Optionally, the enzyme for cleaving the RNA base is selected from RnaseH.

9. The method of claim 8, wherein, The probe further comprises: at least 1 mismatch base; Preferably, the mismatch base is selected from 1-5. Optionally, the mismatch base is spaced 1bp-5bp from the RNA base. Preferably, the fluorescent group is spaced 16bp-24bp from the quencher group.

10. The method of claim 8, wherein, The probe further comprises: at least 1 locked nucleic acid base or minor groove binder MGB; Preferably, the locked nucleic acid base is selected from 1-8. Preferably, the fluorescent group is spaced 10bp-16bp from the quencher group.

11. The method according to claim 9 or 10, characterized in that, The isothermal temperature is selected from 63℃-68℃, preferably 65℃.

12. The method of claim 11, wherein, The isothermal amplification is selected from loop-mediated amplification, rolling circle amplification, strand displacement amplification, multiple displacement amplification, recombinase polymerase isothermal amplification, single primer isothermal amplification, helicase-dependent isothermal amplification, cross primer amplification technology, nucleic acid-dependent amplification detection technology or nicking endonuclease isothermal amplification, preferably loop-mediated amplification.

13. The method of claim 12, wherein, In the loop-mediated amplification system, the target nucleic acid is selected from DNA, the isothermal amplification primer is selected from any one of the inner primer, the outer primer and the loop primer, the RnaseH enzyme is selected from RnaseH II, and the polymerase is selected from Bst polymerase; Optionally, in the loop-mediated amplification system, the target nucleic acid is selected from RNA, the isothermal amplification primer is selected from any one of the inner primer, the outer primer and the loop primer, the RnaseH enzyme is selected from RnaseH II, the polymerase is selected from Bst polymerase, and the loop-mediated amplification system further comprises: reverse transcriptase.

14. The method of claim 13, wherein, The inner primers are forward inner primers FIP and reverse inner primers BIP; the outer primers are forward outer primers F3 and reverse outer primers B3; any one of the loop primers is loop forward primers LF or loop backward primers LB.

15. The method of claim 14, wherein, In the loop-mediated amplification system, the Bst polymerase concentration is 5U-7U; the nucleotide concentration is 1mM-1.5mM; the RnaseH II concentration is 28mU-32mU; the inner primer concentration is 1.5μM-1.7μM; the outer primer concentration is 0.1μM-0.3μM; the probe concentration is 0.7μM-0.9μM; the loop forward primer LF or loop backward primer LB concentration is 0.7-0.9μM; wherein the probe comprises a predetermined site probe; Optionally, the loop-mediated amplification system further comprises magnesium sulfate, and the magnesium sulfate concentration is 5mM-7mM.

16. The method of claim 10, wherein, The fluorescent group is selected from at least one of FAM, HEX, ROX, CY5Cy5, Atto 425, TET, JOE, VIC, R6G, Yakima Yellow, Quasar570, Quasar670, Cy3, NED, Cy5.5, Cy7, Texas Red, Atto 590, IR Dye 650 and IR Dye 750; preferably ROX, FAM or HEX; Optionally, the quenching group is selected from at least one of BHQ1, BHQ2, BHQ3, MGB, BBQ 650, Dabcyl, DBQ1, TAMRA and Eclipse; preferably BHQ1 or BHQ2; Optionally, the fluorescent detection process comprises naked eye detection after ultraviolet excitation; Optionally, the ultraviolet excitation wavelength is selected from 365nm.

17. The method of claim 7, wherein, The variation comprises at least one of single nucleotide polymorphism, insertion, deletion and fusion.

18. A method for detecting a target nucleic acid based on isothermal amplification, characterized by, Comprising: Mixing the probe, the isothermal amplification primer, the nucleotide, the polymerase, the RnaseH enzyme and the target nucleic acid; Performing fluorescent detection on the mixing product, and detecting the target nucleic acid based on the presence or absence or strength of the fluorescent signal.

19. The method of claim 18, wherein, The probe comprises a fluorescent group, a quenching group and an RNA base; wherein the quenching group is suitable for quenching the fluorescent group; the RNA base is located between the fluorescent group and the quenching group; the RNA base is spaced apart from the quenching group by 5bp-10bp; Optionally, the enzyme for cutting the RNA base is selected from RnaseH; Optionally, the isothermal amplification is selected from loop-mediated amplification, rolling circle amplification, strand displacement amplification, multiple displacement amplification, recombinase polymerase isothermal amplification, single primer isothermal amplification, helicase-dependent isothermal amplification, cross primer amplification technology, nucleic acid-dependent amplification detection technology or nicking endonuclease isothermal amplification, preferably loop-mediated amplification; Optionally, the isothermal temperature is selected from 63℃-68℃, preferably 65℃; Optionally, in the loop-mediated amplification system, the target nucleic acid is selected from DNA, the isothermal amplification primer is selected from any one of inner primer, outer primer and loop primer, the RnaseH enzyme is selected from RnaseH II, and the polymerase is selected from Bst polymerase; Optionally, in the loop-mediated amplification system, the target nucleic acid is selected from RNA, the isothermal amplification primer is selected from any one of inner primer, outer primer and loop primer, the RnaseH enzyme is selected from RnaseH II, and the polymerase is selected from Bst polymerase, and the loop-mediated amplification system further comprises: reverse transcriptase; Optionally, the inner primer is forward inner primer FIP and reverse inner primer BIP; the outer primer is forward outer primer F3 and reverse outer primer B3; and any one of the loop primer is loop forward primer LF or loop backward primer LB.

20. The method of claim 19, wherein, In the loop-mediated amplification system, the Bst polymerase concentration is 5U-7U; the nucleotide concentration is 1mM-1.5mM; the RnaseH II concentration is 28mU-32mU; the inner primer concentration is 1.5μM-1.7μM; the outer primer concentration is 0.1μM-0.3μM; the probe concentration is 0.7μM-0.9μM; and the loop forward primer LF or loop backward primer LB concentration is 0.7μM-0.9μM. Optionally, the loop-mediated amplification system further comprises magnesium sulfate, and the magnesium sulfate concentration is 5mM-7mM.

21. A kit comprising, Comprise: The probe of any one of claims 1-6.

22. The kit of claim 21, wherein Further comprise: At least one of isothermal amplification primer, nucleotide, polymerase, RnaseH enzyme, magnesium sulfate and polymerase buffer; Optionally, the isothermal amplification primer comprises at least one of any one of inner primer, outer primer and loop primer; Optionally, the nucleotide comprises at least one of dATP, dTTP or dUTP, dCTP and dGTP; Optionally, the polymerase is selected from Bst; Optionally, the RnaseH enzyme is selected from RnaseH II.

23. Use of the kit of claim 21 or 22 in gene or pathogen detection, wherein the pathogen comprises fungus, bacteria, parasite, virus or protozoan.

Images