DNA compositions and related methods

DNA molecules with a circular single-stranded first strand and covalently linked linear second strand provide a novel therapeutic approach by enhancing effector delivery and expression, addressing unmet medical needs through reduced immune response and increased therapeutic efficacy.

WO2026055547A1PCT designated stage Publication Date: 2026-03-12FLAGSHIP PIONEERING INNOVATIONS VII LLC

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2025-09-05
Publication Date
2026-03-12

AI Technical Summary

Technical Problem

There is a need for novel therapeutic modalities to address unmet medical needs.

Method used

The development of DNA molecules comprising a circular single-stranded first strand and a linear second strand covalently linked via a reactive linker, where the second strand is complementary to a contiguous portion of the first strand, allowing for efficient delivery and expression of therapeutic effectors.

Benefits of technology

Enhances therapeutic efficacy by reducing immune response and increasing effector expression levels in target cells, while minimizing interference with cellular processes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000058_0001
    Figure IMGF000058_0001
  • Figure IMGF000059_0001
    Figure IMGF000059_0001
  • Figure IMGF000059_0002
    Figure IMGF000059_0002
Patent Text Reader

Abstract

The disclosure provides, for example, a DNA molecule comprising a first strand of DNA, wherein the first strand is circular and single stranded over at least 90% of its length, and a second strand of DNA covalently linked to the first strand as described herein. The DNA molecule may comprise an effector sequence encoding a therapeutic effector. In some embodiments, the DNA molecule shows improved conversion to double-stranded DNA relative to a DNA molecule that lacks the second strand.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0002] DNA COMPOSITIONS AND RELATED METHODS

[0003] RELATED APPLICATIONS

[0004] This application claims priority to U.S. Serial No.: 63 / 691,661, filed September 6, 2024, and U.S. Serial No.: 63 / 800,797, filed May 6, 2025, the entire contents of each of which are incorporated herein by reference.

[0005] SEQUENCE LISTING

[0006] The instant application contains a Sequence Listing which has been submited electronically in XML format and is hereby incorporated by reference in its entirety. Said XML copy, created on September 5, 2025, is named F2128-7023WO_SL.xml and is 31,062 bytes in size.

[0007] BACKGROUND

[0008] There is a need for novel therapeutic modalities to address unmet medical need.

[0009] SUMMARY OF THE INVENTION

[0010] Described herein are pharmaceutical DNA compositions, constructs, preparations, methods of using such compositions, constructs and preparations, and methods of making the same.

[0011] Enumerated Embodiments

[0012] 1. A DNA molecule comprising: a first strand of DNA, wherein the first strand is circular and is single stranded over at least 90% of its length; and a second strand of DNA, wherein the second strand is linear, has a length of less than 200 nucleotides, and at least a portion of the second strand is complementary to a contiguous portion of the first strand; wherein the second strand is covalently linked to the first strand.

[0013] 2. The DNA molecule of embodiment 1, wherein the second strand is covalently linked to the first strand via a reactive linker, e.g., a click linker.

[0014] 1601851989.1 1 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0015] 3. The DNA molecule of embodiment 2, wherein the reactive linker (e.g., click linker) is situated between a first nucleotide in the first strand and a second nucleotide in the second strand.

[0016] 4. The DNA molecule of embodiment 2 or 3, wherein the reactive linker (e.g., click linker) is situated between a first nucleobase in the first strand and a second nucleobase in the second strand.

[0017] 5. The DNA molecule of any of the preceding embodiments, wherein the linker is linked (e.g. directly covalently linked) to a first nucleobase on the first strand and a second nucleobase on the second strand.

[0018] 6. The DNA molecule of any of the preceding embodiments, wherein the linker is linked (e.g., directly covalently linked) to a nucleobase of the first strand, and no phosphorus-containing moiety (e.g., phosphate) or sugar is situated between the linker and the nucleobase.

[0019] 7. The DNA molecule of any of the preceding embodiments, wherein the linker is linked (e.g., directly covalently linked) to a nucleobase of the second strand, and no phosphorus- containing moiety (e.g., phosphate) or sugar is situated between the linker and the nucleobase.

[0020] 8. The DNA molecule of any of the preceding embodiments, wherein the linker is linked (e.g., directly covalently linked) to a nucleobase of the first strand, and no backbone moiety is situated between the linker and the nucleobase.

[0021] 9. The DNA molecule of any of the preceding embodiments, wherein the linker is linked

[0022] (e g., directly covalently linked) to a nucleobase of the second strand, and no backbone moiety is situated between the linker and the nucleobase.

[0023] 10. The DNA molecule of any of the preceding embodiments, wherein a first nucleobase of the first strand is covalently linked to a second nucleobase of the second strand, and no

[0024] 1601851989.1 2 Atorney Docket No.: F2128-7023WO(VL87022-W1) phosphorus-containing moiety (e.g., phosphate) or sugar is situated between the first nucleobase and the second nucleobase.

[0025] 11. The DNA molecule of any of the preceding embodiments, wherein a first nucleobase of the first strand is covalently linked to a second nucleobase of the second strand, and no backbone moiety is situated between the first nucleobase and the second nucleobase.

[0026] 12. The DNA molecule of any of the preceding embodiments, wherein the nucleobase (e.g., first nucleobase or second nucleobase) is an adenine (e.g., wherein the linker is linked to a canonical adenine moiety or to a chemically modified adenine moiety), cytosine (e.g., wherein the linker is linked to a canonical cytosine moiety or to a chemically modified cytosine moiety), guanine (e g., wherein the linker is linked to a canonical guanine moiety or to a chemically modified guanine moiety), thymine (e.g., wherein the linker is linked to a canonical thymine moiety or to a chemically modified thymine moiety), or uracil (e.g., wherein the linker is linked to a canonical uracil moiety or to a chemically modified uracil moiety).

[0027] 13. The DNA molecule of any of embodiments 2-12, wherein the reactive linker (e.g., click linker) is situated at the 5’ most nucleotide of the second strand, or within 1, 2, 3, 4, or 5 nucleotides of the 5’ end of the second strand.

[0028] 14. The DNA molecule of any of embodiments 2-12, wherein the reactive linker (e.g., click linker) is situated at least 1, at least 2, at least 3, at least 4, or at least 5 nucleotides away from the 5’ end of the second strand.

[0029] 15. The DNA molecule of any of embodiments 2-12, wherein the reactive linker (e.g., click linker) is situated 1-3 nucleotides, 3-5 nucleotides, 5-7 nucleotides, or 7-10 nucleotides away from the 5’ end of the second strand.

[0030] 16. The DNA molecule of any of embodiments 2-12, wherein the reactive linker (e.g., click linker) is situated at least 5, at least 10, at least 15, at least 20, at least 50, at least 100, at least 150, or at least 190 nucleotides away from the 3’ end of the second strand.

[0031] 1601851989.1 3 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0032] 17. The DNA molecule of any of embodiments 2-12, wherein the reactive linker (e.g., click linker) is situated 5-10, 10-20, 20-30, 30-40, or 40-50 nucleotides away from the 3’ end of the second strand.

[0033] 18. The DNA molecule of any of embodiments 2-17, wherein the click linker was formed by reaction of azide with DBCO.

[0034] 19. The DNA molecule of any of embodiments 2-18, wherein the click linker comprises a tri azole.

[0035] 20. The DNA molecule of any of the preceding embodiments, wherein the second strand and the first strand are covalently linked at exactly one location.

[0036] 21. The DNA molecule of any of the preceding embodiments, wherein the second strand and the first strand are covalently linked at exactly one base pair.

[0037] 22. The DNA molecule of any of the preceding embodiments, wherein at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of nucleotides of the second strand are paired with complementary nucleotides of the first strand.

[0038] 23. The DNA molecule of any of the preceding embodiments, wherein at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% of the length of the second strand is perfectly complementary to a contiguous portion of the first strand.

[0039] 24. The DNA molecule of any of the preceding embodiments, wherein each nucleotide of the second strand is paired with a complementary nucleotide of the first strand.

[0040] 25. The DNA molecule of any of the preceding embodiments, wherein the full length of the second strand is perfectly complementary to a contiguous portion of the first strand.

[0041] 1601851989.1 4 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0042] 26. The DNA molecule of any of embodiments 1 -23, wherein at most 1, 2, 3, 4, or 5 nucleotides of the second strand are not hybridized with the first strand.

[0043] 27. The DNA molecule of any of embodiments 1-23 or 26, wherein at most 1, 2, 3, 4, or 5 nucleotides of the second strand are not complementary to a contiguous portion of the first strand.

[0044] 28. The DNA molecule of any of the preceding embodiments, wherein the second strand comprises at least 5, 10, 15, 20, 50, 100, or 150 base pairs of perfect complementarity to the first strand, wherein the at least 5, 10, 15, 20, 50, 100, or 150 base pairs are situated at the 3’ end of the second strand, and wherein the covalent linkage is 5’ on the second strand of said 5, 10, 15, 20, 50, 100, or 150 base pairs.

[0045] 29. The DNA molecule of any of the preceding embodiments, wherein the second strand has a length of at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 120, at least 140, at least 160, or at least 180 nucleotides.

[0046] 30. The DNA molecule of any of the preceding embodiments, wherein the second strand has a length of 5-10, 10-15, 15-20, 20-25, 25-30, 30-35, 35-40, 40-50, 50-60, 60-70, 70-80, 80-90, 90-100, 100-120, 120-140, 140-160, 160-180, or 180-200 nucleotides.

[0047] 31. The DNA molecule of any of the preceding embodiments, wherein the first strand is covalently closed.

[0048] 32. The DNA molecule of any of the preceding embodiments, wherein the first strand is single stranded over at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of its length.

[0049] 33. The DNA molecule of any of the preceding embodiments, wherein the first strand has a length of at least 200, at least 300, at least 400, at least 500, at least 1000, at least 1500, at least

[0050] 1601851989.1 5 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0051] 2000, at least 3000, at least 4000, at least 5000, at least 6000, at least 7000, at least 8000, at least 9000, at least 10000, at least 11000, or at least 12000 nucleotides.

[0052] 34. The DNA molecule of any of the preceding embodiments, wherein the first strand has a length of 200-300, 300-400, 400-500, 500-1000, 1000-1500, 1500-2000, 2000-3000, 3000-4000, 4000-5000, 5000-6000, 6000-7000, 7000-8000, 8000-9000, 9000-10000, 10000-11000, or 11000-12000 nucleotides.

[0053] 35. The DNA molecule of any of the preceding embodiments, wherein the first strand comprises a promoter sequence and an effector sequence that encodes an effector (e.g., a therapeutic effector).

[0054] 36. The DNA molecule of embodiment 35, wherein the effector comprises a polypeptide (e.g., a DNA binding protein; an epigenetic modifying factor; an antigen; a hormone; an enzyme; a nuclease element of a CRISPR system; a mobile genetic element protein; a gene writer; an antibody; a signaling peptide; a receptor ligand; a receptor (e.g., a chimeric antigen receptor (CAR) or a T cell receptor); or a clotting factor).

[0055] 37. The DNA molecule of embodiment 35, wherein the effector comprises an RNA (e.g., an mRNA, miRNA, or siRNA).

[0056] 38. The DNA molecule of any of embodiments 31-37, which further encodes a second effector.

[0057] 39. The DNA molecule of embodiment 38, which further comprises a second promoter operatively linked to a second effector sequence that encodes the second effector.

[0058] 40. The DNA molecule of embodiment 38 or 39, wherein the effector and the second effector have the same sequence or different sequences.

[0059] 1601851989.1 6 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0060] 41 . The DNA molecule of any of embodiments 35-37, which comprises exactly one effector sequence.

[0061] 42. The DNA molecule of any of the preceding embodiments, wherein the first strand further comprises a nuclear targeting sequence (NTS).

[0062] 43. The DNA molecule of any of the preceding embodiments, wherein the first strand further comprises a maintenance sequence.

[0063] 44. The DNA molecule of any of the preceding embodiments, wherein the first strand further comprises a second strand motif (SSM).

[0064] 45. The DNA molecule of any of the preceding embodiments, wherein the first strand further comprises a post-transcriptional regulatory element (PRE), e.g., WPRE.

[0065] 46. The DNA molecule of any of the preceding embodiments, wherein the first strand is a sense strand.

[0066] 47. The DNA molecule of any of embodiments 1-45, wherein the first strand is an antisense strand.

[0067] 48. The DNA molecule of any of the preceding embodiments, wherein if the first strand forms a double stranded structure (e.g., a hairpin) between a first region of the first strand and a second region of the first strand, the double stranded structure is no longer than 100, 80, 60, 40, 20, 15, or 10 base pairs.

[0068] 49. The DNA molecule of any of the preceding embodiments, wherein when the DNA molecule is introduced to a cell, the cell exhibits a lower interferon beta mRNA level compared to a control cell of the same type that was contacted with a fully double stranded DNA having the same sequence as the DNA molecule at the same molar amount as the DNA molecule.

[0069] 1601851989.1 7 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0070] 50. The DNA molecule of any of the preceding embodiments, wherein when the DNA molecule is introduced to a cell, e.g., a fibroblast,, the cell exhibits a lower level (e.g., at least 3- fold, at least 5-fold, at least 10-fold, at least 20-fold, or at least 50-fold lower) of a cytokine (e.g., IFN-a2, IFN-P, IFN-y, IFN-X1, IP- 10, or IL- 1 p protein) compared to a control cell of the same type that was contacted with a fully double stranded DNA having the same sequence as the DNA molecule at the same molar amount as the DNA molecule.

[0071] 51. The DNA molecule of any of embodiments 35-50, wherein the effector is expressed when the DNA molecule is introduced into a target cell.

[0072] 52. The DNA molecule of any of the preceding embodiments, which is converted to circular double stranded DNA when the DNA molecule is introduced into a target cell.

[0073] 53. The DNA molecule of any of the preceding embodiments, which is a substrate for a mammalian DNA polymerase.

[0074] 54. The DNA molecule of any of embodiments 35-53, wherein when the DNA molecule is introduced to a cell, the cell expresses the effector at a higher level compared to a control cell of the same cell type that was contacted with a control DNA molecule, wherein the control DNA molecule consists of a covalently closed circular single stranded DNA having a sequence identical to the first strand of the DNA molecule, e.g., when measured 48 hours after the DNA molecule is introduced to the cell.

[0075] 55. The DNA molecule of any of embodiments 35-53, wherein when the DNA molecule is introduced to a cell, the effector is expressed at a level at least 80%, at least 100%, at least 120%, or at least 130% of the level of the effector in a control cell of the same type that was contacted with a control DNA molecule, wherein the control DNA molecule consists of a covalently closed circular single stranded DNA having a sequence identical to the first strand of the DNA molecule, e.g., when measured 48 hours after the DNA molecule is introduced to the cell.

[0076] 1601851989.1 8 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0077] 56. The DNA molecule of any of embodiments 35-53, wherein when the DNA molecule is introduced to a cell, the cell expresses the effector at a higher level compared to a control cell of the same cell type that was contacted with a control DNA molecule, wherein the control DNA molecule is identical to the DNA molecule except the control DNA molecule lacks the second strand, lacks the covalent linkage, and lacks any click handle.

[0078] 57. The DNA molecule of any of the preceding embodiments, which comprises a second nucleotide having a chemically modified nucleobase, wherein the chemically modified nucleobase is situated in the first strand or the second strand.

[0079] 58. The DNA molecule of any of the preceding embodiments, which comprises a second nucleotide having a chemically modified sugar, wherein the chemically modified sugar is situated in the first strand or the second strand.

[0080] 59. The DNA molecule of any of the preceding embodiments, which comprises a second nucleotide having a backbone modification (e g., phosphorothioate), wherein the backbone modification is situated in the first strand or the second strand.

[0081] 60. The DNA molecule of any of the preceding embodiments, wherein the second strand comprises one or more backbone modifications (e.g., phosphorothioate modifications).

[0082] 61. The DNA molecule of embodiment 59 or 60, wherein the second strand comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, or at least 12 phosphorothioate modifications.

[0083] 62. The DNA molecule of any of embodiments 59-61, wherein the second strand comprises 2-4, 4-6, 6-8, 8-10, or 10-12 phosphorothioate modifications.

[0084] 63. The DNA molecule of any of embodiments 60-62, wherein the one or more backbone modifications are situated between the 2, 3, 4, 5, or 6 nucleotides adjacent to the 5’ end of the second strand.

[0085] 1601851989.1 9 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0086] 64. The DNA molecule of any of embodiments 60-63, wherein the one or more backbone modifications are situated between the 2, 3, 4, 5, or 6 nucleotides adjacent to the 3’ end of the second strand.

[0087] 65. The DNA molecule of any of embodiments 59-64, wherein the reactive linker is between two or more backbone modifications.

[0088] 66. The DNA molecule of any of the preceding embodiments, wherein 1-2%, 2-5%, 5-10%, 10-20%, or 20-50% of the nucleotides of the DNA molecule are chemically modified nucleotides.

[0089] 67. The DNA molecule of any of the preceding embodiments, wherein the first strand comprises exactly one chemically modified nucleobase.

[0090] 68. The DNA molecule of any of the preceding embodiments, wherein the first strand comprises exactly one chemically modified nucleotide.

[0091] 69. The DNA molecule of any of embodiments 1-66, wherein the first strand comprises a plurality of chemically modified nucleobases.

[0092] 70. The DNA molecule of any of embodiments 1-66 or 69, wherein the first strand comprises a plurality of chemically modified nucleotides.

[0093] 71. The DNA molecule of any of the preceding embodiments, wherein the second strand comprises exactly one chemically modified nucleobase.

[0094] 72. The DNA molecule of any of the preceding embodiments, wherein the second strand comprises exactly one chemically modified nucleotide.

[0095] 1601851989.1 10 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0096] 73. The DNA molecule of any of embodiments 1 -70, wherein the second strand comprises a plurality of chemically modified nucleobases.

[0097] 74. The DNA molecule of any of embodiments 1-70 or 73 wherein the second strand comprises a plurality of chemically modified nucleotides.

[0098] 75. The DNA molecule of any embodiments 1-70, 73, or 74, wherein at least 25%, at least 40%, at least 60%, or at least 80% nucleobases of the second strand are chemically modified.

[0099] 76. The DNA molecule of any embodiments 1-70 or 73-75, wherein at least 25%, at least 40%, at least 60%, or at least 80% nucleotides of the second strand are chemically modified.

[0100] 77. The DNA molecule of any of embodiments 1-70 or 73-76, wherein all nucleobases of the second strand are chemically modified.

[0101] 78. The DNA molecule of any of embodiments 1-70 or 73-77, wherein all nucleotides of the second strand are chemically modified.

[0102] 79. The DNA molecule of any of the preceding embodiments, wherein the second strand is covalently linked to the first strand at a position that is inside the promoter sequence or outside the promoter sequence.

[0103] 80. The DNA molecule of any of embodiments 35-79, wherein the second strand is covalently linked to the first strand at a position that is inside the effector sequence or outside the effector sequence.

[0104] 81. The DNA molecule of any of the preceding embodiments, wherein the DNA molecule lacks a material portion of vector backbone (e.g., plasmid backbone).

[0105] 82. The DNA molecule of any of the preceding embodiments, which does not comprise a non-human (e g., bacterial) origin of replication.

[0106] 1601851989.1 11 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0107] 83. The DNA molecule of any of the preceding embodiments, which does not comprise an antibiotic resistance selectable marker.

[0108] 84. The DNA molecule of any of embodiments 35-83, wherein the effector sequence does not encode a viral protein.

[0109] 85. The DNA molecule of any of embodiments 35-83, wherein the effector sequence encodes a viral protein.

[0110] 86. The DNA molecule of any of the preceding embodiments, which is unencap si dated.

[0111] 87. The DNA molecule of any of the preceding embodiments, which does not comprise a viral packaging signal.

[0112] 88. The DNA molecule of any of the preceding embodiments, which does not comprise a viral ITR.

[0113] 89. The DNA molecule of any of the preceding embodiments, which is essentially free of viral proteins.

[0114] 90. The DNA molecule of any of the preceding embodiments, which does not comprise a polypeptide or a small molecule drug.

[0115] 91. A pharmaceutical composition comprising a DNA molecule of any of the preceding embodiments.

[0116] 92. The pharmaceutical composition of embodiment 91, wherein the DNA molecule is comprised in a lipid nanoparticle (LNP).

[0117] 1601851989.1 12 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0118] 93. The pharmaceutical composition of embodiment 91, which is substantially free of (e.g., is free of) LNPs.

[0119] 94. The pharmaceutical composition of embodiment 91 or 93, which is substantially free of (e g., is free) of lipids.

[0120] 95. The pharmaceutical composition of any of embodiments 91-94, which is free of a solid support.

[0121] 96. The pharmaceutical composition of any of embodiments 91-95, which is free of a solid material.

[0122] 97. The pharmaceutical composition of any of embodiments 91-96, which is in a solution.

[0123] 98. The pharmaceutical composition of any of embodiments 91-97, which is not a suspension.

[0124] 99. The pharmaceutical composition of any of embodiments 91-98, wherein at least 70% by mass of total DNA in the composition is the DNA molecule according to any of embodiments 1- 90.

[0125] 100. The pharmaceutical composition of any of embodiments 91-99, which is free of polypeptides.

[0126] 101. The pharmaceutical composition of any of embodiments 91-100, which is free of one or more of: endotoxin, mononucleotides, and modified mononucleotides.

[0127] 102. A method of making a DNA molecule, the method comprising: providing a first strand of DNA, wherein the first strand is circular and is single stranded over at least 90% of its length;

[0128] 1601851989.1 13 Atorney Docket No.: F2128-7023WO(VL87022-W1) contacting the first strand with a second strand of DNA, wherein the second strand is linear, has a length of less than 200 (e.g., less than 40) nucleotides, and at least a portion of the second strand base pairs with a contiguous portion of the first strand; and covalently linking the first strand to the second strand, thereby making the DNA molecule.

[0129] 103. The method of embodiment 102, wherein the second strand has a length of less than 150 nucleotides, less than 125 nucleotides, less than 100 nucleotides, less than 90 nucleotides, less than 80 nucleotides, less than 70 nucleotides, less than 60 nucleotides, or less than 50 nucleotides.

[0130] 104. The method of embodiment 102 or 103, wherein the second strand has a length of 40-50, 50-60, 60-70, 70-80, 80-90, 90-100, 100-120, 120-140, 140-160, 160-180, or 180-190 nucleotides.

[0131] 105. The method of any of embodiments 102-104, wherein the DNA molecule is the DNA molecule of any of embodiments 1-90.

[0132] 106. A DNA molecule produced by the method of any of embodiments 102-105.

[0133] 107. A method of modulating (e.g., increasing or decreasing) a biological activity in a target cell, the method comprising:

[0134] (i) contacting a target cell with the DNA molecule of any of embodiments 1-90 or 106, or the pharmaceutical composition of any of embodiments 91-101, wherein the effector modulates a biological activity in the target cell; and

[0135] (ii) maintaining (e.g., incubating) the cell under conditions suitable for expressing the effector from the DNA molecule; thereby modulating the biological activity in the target cell.

[0136] 108. A method of modulating (e.g., increasing or decreasing) a biological activity in a target cell, the method comprising:

[0137] 1601851989.1 14 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0138] (i) providing a target cell comprising the DNA molecule of any of embodiments 1 -90 or 106, or the pharmaceutical composition of any of embodiments 91-101, wherein the effector modulates a biological activity in the target cell; and

[0139] (ii) maintaining (e.g., incubating) the cell under conditions suitable for expressing the effector from the DNA molecule; thereby modulating the biological activity in the target cell.

[0140] 109. The method of embodiment 108, wherein (i) comprises contacting the target cell with the DNA molecule.

[0141] 110. The method of any of embodiments 107-109, wherein the biological activity comprises cell growth, cell metabolism, cell signaling, cell movement, specialization, interactions, division, transport, homeostasis, osmosis, or diffusion.

[0142] 111. A method of delivering a DNA molecule to a target cell, the method comprising: contacting a target cell with the DNA molecule of any of embodiments 1-90 or 106, or the pharmaceutical composition of any of embodiments 91-101; thereby delivering the DNA molecule to the target cell.

[0143] 112. A method of delivering an effector to a target cell, the method comprising: contacting a target cell with the DNA molecule of any of embodiments 1-90 or 106, or the pharmaceutical composition of any of embodiments 91-101; thereby delivering the effector to the target cell.

[0144] 113. A method of treating a cell, tissue, or subject in need thereof, the method comprising: administering to the cell, tissue, or subject the DNA molecule of any of embodiments 1-

[0145] 90 or 106, or the pharmaceutical composition of any of embodiments 91-101; thereby treating the cell, tissue, or subject.

[0146] 114. The method of any of embodiments 107-113, wherein the cell is an animal cell, e.g., a mammalian cell, e.g., a human cell.

[0147] 1601851989.1 15 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0148] 115. The method of any of embodiments 107-114, which is performed ex vivo or in vivo.

[0149] 116. The method of any of embodiments 113-115, which further comprises administering to the subject a plurality of bubbles having an average diameter less than 10 pm.

[0150] 117. The method of any of embodiments 113-116, which further comprises performing ultrasound, e.g., focused ultrasound (FUS), on a tissue in the subject.

[0151] 118. A method of delivering a DNA molecule into a target cell of a tissue in a subject, the method comprising, in combination: a) administering to the subject a DNA molecule, wherein the DNA molecule comprises: a first strand of DNA, wherein the first strand is circular and is single stranded over at least 90% of its length; and b) administering to the subject a plurality of bubbles having an average diameter less than 10 pm; and c) performing ultrasound, e.g., focused ultrasound (FUS), on the tissue; thereby delivering the DNA molecule into the target cell.

[0152] 119. A method of delivering a DNA molecule into a target cell of a tissue in a subject, the method comprising, in combination: a) administering to the subject the DNA molecule of any of embodiments 1-90 or 106, or the pharmaceutical composition of any of embodiments 91-101; b) administering to the subject a plurality of bubbles having an average diameter less than 10 pm; and c) performing ultrasound (e.g., FUS) on the tissue; thereby delivering the DNA molecule into the target cell.

[0153] 120. A composition comprising: a) a DNA molecule, wherein the DNA molecule comprises:

[0154] 1601851989.1 16 Atorney Docket No.: F2128-7023WO(VL87022-W1) a first strand of DNA, wherein the first strand is circular and is single stranded over at least 90% of its length; and b) a plurality of bubbles having an average diameter of 10 pm or less.

[0155] 121. A composition comprising: a) the DNA molecule of any of embodiments 1-90 or 106, or the pharmaceutical composition of any of embodiments 91-101; and b) a plurality of bubbles having an average diameter less than 10 pm.

[0156] 122. A kit comprising: a) a DNA molecule, wherein the DNA molecule comprises: a first strand of DNA, wherein the first strand is circular and is single stranded over at least 90% of its length; and b) a plurality of bubbles having an average diameter of 10 pm or less.

[0157] 123. A kit comprising: a) a DNA molecule, wherein the DNA molecule comprises: a first strand of DNA, wherein the first strand is circular and is single stranded over at least 90% of its length; and b) a means for performing ultrasound (e g., FUS).

[0158] 124. A kit comprising: a) the DNA molecule of any of embodiments 1-90 or 106, or the pharmaceutical composition of any of embodiments 91-101; and b) a plurality of bubbles having an average diameter less than 10 pm.

[0159] 125. The method of embodiment 118, composition of embodiment 120, or kit of embodiment 122 or 123, wherein the DNA molecule further comprises: a second strand of DNA, wherein the second strand is linear, has a length of less than 200 nucleotides, and at least a portion of the second strand is complementary to a contiguous portion of the first strand;

[0160] 1601851989.1 17 Atorney Docket No.: F2128-7023WO(VL87022-W1) wherein the second strand is covalently linked to the first strand.

[0161] 126. The method, composition, or kit of any of embodiments 118-125, wherein the DNA molecule comprises a promoter sequence and an effector sequence that encodes an effector (e.g., a therapeutic effector).

[0162] 127. The method, composition, or kit of embodiment 126, wherein the effector is an exogenous agent.

[0163] 128. The method of any of embodiments 118, 119, or 125-127, wherein step b) is performed after step a), and step c) is performed after step b).

[0164] 129. The method of any of embodiments 118, 119, or 125-127, wherein step a) is performed after step b), and step c) is performed after step a).

[0165] 130. The method of any of embodiments 118, 119, or 125-127, wherein steps a) and b) are performed concurrently, e.g., simultaneously, and wherein step c) is performed after steps a) and b).

[0166] 131. The method of any of embodiments 118, 119, or 125-127, wherein steps a), b), and c) are performed concurrently, e.g., simultaneously.

[0167] 132. The method of any of embodiments 118, 119, or 125-127, wherein steps b) and c) are performed concurrently, e.g., simultaneously, and wherein steps b) and c) are performed after step a).

[0168] 133. The method of any of embodiments 118, 119, or 125-127, wherein steps a) and c) are performed concurrently, e.g., simultaneously, and wherein steps a) and c) are performed after step b).

[0169] 1601851989.1 18 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0170] 134. The method of any of embodiments 118, 119, or 125-133, wherein step c) is initiated less than 70 minutes after step a) is initiated, e.g., less than 1 second, less than 5 seconds, less than 10 seconds, less than 20 seconds, less than 30 seconds, less than 1 minute, less than 2 minutes, less than 3 minutes, less than 4 minutes, less than 5 minutes, less than 6 minutes, less than 7 minutes, less than 8 minutes, less than 9 minutes, less than 10 minutes, less than 15 minutes, less than 20 minutes, less than 25 minutes, less than 30 minutes, less than 35 minutes, less than 40 minutes, less than 45 minutes, less than 50 minutes, less than 55 minutes, less than 60 minutes, or less than 65 minutes after step a) is initiated.

[0171] 135. The method of any of embodiments 118, 119, or 125-134, wherein step c) is initiated between 0 seconds and 5 seconds, between 5 seconds and 10 seconds, between 10 seconds and 20 seconds, between 20 seconds and 30 seconds, between 30 seconds and 1 minute, between 1 minute and 5 minutes, between 5 minutes and 10 minutes, between 10 minutes and 20 minutes, between 20 minutes and 30 minutes, between 30 minutes and 40 minutes, between 40 minutes and 50 minutes, between 50 minutes and 60 minutes, between 60 minutes and 70 minutes, between 0 seconds and 30 seconds, between 0 seconds and 5 minutes, or between 0 seconds and 10 minutes after step a) is initiated.

[0172] 136. The method of any of embodiments 118, 119, or 125-135, wherein step c) is initiated less than 70 minutes after step b) is initiated, e g., less than 1 second, less than 5 seconds, less than 10 seconds, less than 20 seconds, less than 30 seconds, less than 1 minute, less than 2 minutes, less than 3 minutes, less than 4 minutes, less than 5 minutes, less than 6 minutes, less than 7 minutes, less than 8 minutes, less than 9 minutes, less than 10 minutes, less than 15 minutes, less than 20 minutes, less than 25 minutes, less than 30 minutes, less than 35 minutes, less than 40 minutes, less than 45 minutes, less than 50 minutes, less than 55 minutes, less than 60 minutes, or less than 65 minutes after step b) is initiated.

[0173] 137. The method of any of embodiments 118, 119, or 125-136, wherein step c) is initiated between 0 seconds and 5 seconds, between 5 seconds and 10 seconds, between 10 seconds and 20 seconds, between 20 seconds and 30 seconds, between 30 seconds and 1 minute, between 1 minute and 5 minutes, between 5 minutes and 10 minutes, between 10 minutes and 20 minutes,

[0174] 1601851989.1 19 Atorney Docket No.: F2128-7023WO(VL87022-W1) between 20 minutes and 30 minutes, between 30 minutes and 40 minutes, between 40 minutes and 50 minutes, between 50 minutes and 60 minutes, between 60 minutes and 70 minutes, between 0 seconds and 30 seconds, between 0 seconds and 5 minutes, or between 0 seconds and 10 minutes after step b) is initiated.

[0175] 138. The method of any of embodiments 118, 119, or 125-137, wherein step c) is initiated less than 70 minutes after step a) and step b) are initiated, e.g., less than 1 second, less than 5 seconds, less than 10 seconds, less than 20 seconds, less than 30 seconds, less than 1 minute, less than 2 minutes, less than 3 minutes, less than 4 minutes, less than 5 minutes, less than 6 minutes, less than 7 minutes, less than 8 minutes, less than 9 minutes, less than 10 minutes, less than 15 minutes, less than 20 minutes, less than 25 minutes, less than 30 minutes, less than 35 minutes, less than 40 minutes, less than 45 minutes, less than 50 minutes, less than 55 minutes, less than 60 minutes, or less than 65 minutes after step a) and step b) are initiated.

[0176] 139. The method of any of embodiments 118, 119, or 125-138, wherein step c) is initiated between 0 seconds and 5 seconds, between 5 seconds and 10 seconds, between 10 seconds and 20 seconds, between 20 seconds and 30 seconds, between 30 seconds and 1 minute, between 1 minute and 5 minutes, between 5 minutes and 10 minutes, between 10 minutes and 20 minutes, between 20 minutes and 30 minutes, between 30 minutes and 40 minutes, between 40 minutes and 50 minutes, between 50 minutes and 60 minutes, between 60 minutes and 70 minutes, between 0 seconds and 30 seconds, between 0 seconds and 5 minutes, or between 0 seconds and 10 minutes after step a) and step b) are initiated.

[0177] 140. The method of any of embodiments 118, 119, 125-128, 130-132, or 134-139, wherein step b) is initiated less than 85 minutes after step a), e.g., less than 1 second, less than 5 seconds, less than 10 seconds, less than 20 seconds, less than 30 seconds, less than 1 minute, less than 2 minutes, less than 3 minutes, less than 4 minutes, less than 5 minutes, less than 6 minutes, less than 7 minutes, less than 8 minutes, less than 9 minutes, less than 10 minutes, less than 15 minutes, less than 20 minutes, less than 25 minutes, less than 30 minutes, less than 35 minutes, less than 40 minutes, less than 45 minutes, less than 50 minutes, less than 55 minutes, less than

[0178] 1601851989.1 20 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0179] 60 minutes, less than 65 minutes, less than 70 minutes, less than 75 minutes, or less than 80 minutes after step a) is initiated.

[0180] 141. The method of any of embodiments 118, 119, 125-128, 130-132, or 134-140, wherein step b) is initiated between 0 seconds and 5 seconds, between 5 seconds and 10 seconds, between 10 seconds and 20 seconds, between 20 seconds and 30 seconds, between 30 seconds and 1 minute, between 1 minute and 5 minutes, between 5 minutes and 10 minutes, between 10 minutes and 20 minutes, between 20 minutes and 30 minutes, between 30 minutes and 40 minutes, between 40 minutes and 50 minutes, between 50 minutes and 60 minutes, between 60 minutes and 70 minutes, between 0 seconds and 30 seconds, between 0 seconds and 5 minutes, or between 0 seconds and 10 minutes after step a) is initiated.

[0181] 142. The method of any of embodiments 118, 119, 125-127, 129-131, or 133-139, wherein step a) is initiated less than 85 minutes after step b), e.g., less than 1 second, less than 5 seconds, less than 10 seconds, less than 20 seconds, less than 30 seconds, less than 1 minute, less than 2 minutes, less than 3 minutes, less than 4 minutes, less than 5 minutes, less than 6 minutes, less than 7 minutes, less than 8 minutes, less than 9 minutes, less than 10 minutes, less than 15 minutes, less than 20 minutes, less than 25 minutes, less than 30 minutes, less than 35 minutes, less than 40 minutes, less than 45 minutes, less than 50 minutes, less than 55 minutes, less than 60 minutes, less than 65 minutes, less than 70 minutes, less than 75 minutes, or less than 80 minutes after step b) is initiated.

[0182] 143. The method of any of embodiments 118, 119, 125-127, 129-131, 133-139, or 142, wherein step a) is initiated between 0 seconds and 5 seconds, between 5 seconds and 10 seconds, between 10 seconds and 20 seconds, between 20 seconds and 30 seconds, between 30 seconds and 1 minute, between 1 minute and 5 minutes, between 5 minutes and 10 minutes, between 10 minutes and 20 minutes, between 20 minutes and 30 minutes, between 30 minutes and 40 minutes, between 40 minutes and 50 minutes, between 50 minutes and 60 minutes, between 60 minutes and 70 minutes, between 0 seconds and 30 seconds, between 0 seconds and 5 minutes, or between 0 seconds and 10 minutes after step b) is initiated.

[0183] 1601851989.1 21 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0184] 144. The method of any of embodiments 116-1 19 or 125-143, wherein the DNA molecule is delivered into a plurality of target cells of the tissue.

[0185] 145. The method or kit of any of embodiments 116-119 or 122-144, wherein the DNA molecule and the plurality of bubbles are present in the same volume.

[0186] 146. The method or kit of any of embodiments 116-119 or 122-144, wherein the DNA molecule in a first volume, and the plurality of bubbles is present in a second volume.

[0187] 147. The method, composition, or kit of any of embodiments 116-146, wherein the bubbles comprise a gas comprising octafluoropropane, sulfur hexafluoride, perfluorobutane, perfluoropentane, perfluorohexane, nitrogen, a noble gas (e.g., xenon, helium, or argon), or air.

[0188] 148. The method, composition, or kit of any of embodiments 116-147, wherein the bubbles comprise an exterior layer comprising a lipid (e.g., phospholipid), albumin (e.g., human albumin or bovine albumin), palmitic acid, lysozyme, casein, or PEG (polyethylene glycol).

[0189] 149. The method, composition, or kit of any embodiments 116-148, wherein the exterior layer comprises DPPC, l,2-Dipalmitoyl-sn-glycero-3-phosphate (DPP A), DPPE-m ethoxy PEG5000 (DPPE-MPEG5000), DSPC, DPPG-Na, hydrogenated egg yolk phosphatidylserine, DSPG, DSPE, or DSPE-PEG2000.

[0190] 150. The method, composition, or kit of any of embodiments 116-149, wherein the bubbles are situated in a solvent, e.g., a biocompatible solvent.

[0191] 151. The method of any of embodiments 118, 119, or 125-150, wherein step c) comprises performing FUS on the tissue.

[0192] 152. The method of any of embodiments 117-119 or 125-151, wherein the ultrasound (e.g., focused ultrasound) is performed at a frequency of 0.2-3 MHz.

[0193] 1601851989.1 22 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0194] 153. The method of any of embodiments 117-1 19 or 125-151 , wherein the ultrasound (e.g., focused ultrasound) is performed at a frequency of about 2 MHz to about 40 MHz (e.g., about 20 MHz).

[0195] 154. The method of any of embodiments 117-119 or 125-152, wherein the ultrasound (e.g., focused ultrasound) is performed at a frequency of 0.2 to 0.5 MHz, 0.5 to 1.0 MHz, 1.0 to 1.5 MHz, 1.5 to 2.0 MHz, 2.0 to 2.5 MHZ, or 2.5 to 3.0 MHz.

[0196] 155. The method of any of embodiments 117-119 or 125-154, wherein the ultrasound is performed with a focused ultrasound transducer.

[0197] 156. The method of any of embodiments 117-119 or 125-155, wherein the ultrasound (e.g., focused ultrasound) is performed at 5 ps to 0.5 s, e.g., 100 ps to 0.5 s, e.g., 5 ms to 20 ms, e.g., 10 ms, bursts.

[0198] 157. The method of any of embodiments 117-119 or 125-156, wherein the ultrasound (e.g., focused ultrasound) is performed at a pulse repetition frequency of 0.1 to 10 Hz, e.g., 0.1 to 1.0 Hz, e.g., 0.5 Hz.

[0199] 158. The method of any of embodiments 117-119 or 125-157, wherein the ultrasound (e g., focused ultrasound) is performed at a peak negative pressure of 0.1 to 2.0 MPa.

[0200] 159. The method of any of embodiments 117-119or 125-158, wherein the ultrasound (e.g., focused ultrasound) is performed at a peak negative pressure of 0.1 to 0.5 MPa, 0.5 to 1.0 MPa, 1.0 to 1.5 MPa, or 1.5 to 2.0 MPa.

[0201] 160. The method of any of embodiments 117-119 or 125-159, wherein the ultrasound (e.g., focused ultrasound) is performed for 1 minute to 10 minutes, e.g., 1 minute to 3 minutes, 3 minutes to 5 minutes, or 5 minutes to 10 minutes, e.g., about 2 minutes.

[0202] 1601851989.1 23 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0203] 161 . The method of any of embodiments 116-1 19 or 125-160, wherein the DNA molecule is delivered into the nucleus of the target cell.

[0204] 162. The method of any of embodiments 116-119 or 125-161, wherein the target cell is a nondividing cell.

[0205] 163. The method of any of embodiments 116-119 or 125-161, wherein the target cell is a dividing cell.

[0206] 164. The method of any of embodiments 116-119 or 125-163, wherein the target cell is a hepatocyte, immune cell, neuron, glial cell, ependymal cell, pancreatic islet cell (e.g., alpha, beta, or delta cell), cardiomyocyte, skeletal myocyte, skeletal satellite cell, podocytes, tubular epithelial cell, endothelial cell, fibroblast, or tumor cell.

[0207] 165. The method of any of embodiments 116-119 or 125-164, wherein the tissue is liver tissue, spleen tissue, brain tissue, pancreatic tissue, heart tissue, skeletal muscle tissue, kidney tissue, tumor tissue, breast tissue, or skin tissue.

[0208] 166. The method, composition, or kit of any of embodiments 116-165, wherein the DNA molecule is comprised in a lipid nanoparticle (LNP).

[0209] 167. The method, composition, or kit of any of embodiments 116-165, wherein the DNA molecule is not comprised in an LNP.

[0210] 168. The method of any of embodiments 116-119 or 125-167, wherein the bubbles are administered to the subject at a concentration of 107bubbles / mL solvent to 1010bubbles / mL solvent, e.g., about 109bubbles / mL solvent.

[0211] 169. The method of any of embodiments 116-119 or 125-168, wherein the bubbles are administered to the subject at a volume of about 0.5 mL to about 5 mL.

[0212] 1601851989.1 24 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0213] 170. The method of any of embodiments 116-1 19 or 125-169, wherein the bubbles are administered to the subject at a final concentration of 1 x 104bubbles / g to 1 x 107bubbles / g.

[0214] 171. The method of any of embodiments 116-119 or 125-170, wherein the DNA molecule and bubbles are administered to the subject at a ratio of between 105: 1 to 1010: 1 DNA molecules:microbubbles.

[0215] 172. The method, composition, or kit of any of embodiments 116-171, wherein the plurality of bubbles have an average diameter of 50 nm to 10 pm, 50 nm to 100 nm, or 1 pm to 10 pm.

[0216] 173. The method of any of embodiments 116-119 or 125-172, which further comprises performing an imaging step.

[0217] 174. The method of embodiment 173, wherein the imaging step comprises magnetic resonance imaging (MRI).

[0218] 175. The method of any of embodiments 116-119 or 125-174, wherein the DNA molecule and / or the plurality of bubbles are administered intravenously.

[0219] 176. The method of any of embodiments 116-119 or 125-175, wherein the DNA molecule and / or the plurality of bubbles are administered to the tissue via intravenous (IV) infusion or IV bolus.

[0220] 177. The method of any of embodiments 118, 119, or 125-176, wherein step (a) comprises intravenously injecting the DNA molecule such that the DNA molecule reaches the tissue.

[0221] 178. The method of any of embodiments 116-119 or 125-174, wherein the DNA molecule is administered by injection into the tissue.

[0222] 179. The method of any of embodiments 116-119, 125-174, or 178, wherein the DNA molecule is administered intramuscularly or intratumorally.

[0223] 1601851989.1 25 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0224] 180. The method of any of embodiments 118, 119, or 125-179, wherein step c) is performed on a volume of the tissue of between 10 - 50,000 mm3.

[0225] In some aspects, the present disclosure provides a DNA molecule comprising a first strand of DNA, wherein the first strand is circular and is single stranded over at least 90% of its length; and a second strand of DNA, wherein the second strand is linear, has a length of less than 200 nucleotides, and at least a portion of the second strand is complementary to a contiguous portion of the first strand; wherein the second strand is covalently linked to the first strand. In some embodiments, the second strand is linked to the first strand by a click reaction.

[0226] In some aspects, the present disclosure provided a method of producing a DNA molecule as described herein, wherein the method comprises: 1) providing (e.g., producing or obtaining) a first strand of DNA, e.g., a circular single-stranded DNA (cssDNA), comprising a reactive handle, e.g., click handle, and a second strand of DNA, e.g., a oligonucleotide, comprising a reactive handle, e.g., a click handle, that is capable of reacting with the reactive handle on the first strand; b) covalently linking the first strand of DNA to the second strand of DNA by a covalent conjugation reaction, e.g., a click reaction.

[0227] In some embodiments, a DNA molecule described herein can express an effector, e.g., a therapeutic effector, in a cell, tissue, or subject, e.g., human cell, human tissue, or human subject. Without wishing to be bound by theory, in some embodiments, a cell, tissue or subject comprising a DNA molecule as described herein will synthesize a second strand that is complementary to the first strand of the DNA molecule, e.g., using the second strand of the DNA molecular as a primer. In some embodiments, the DNA molecule described herein forms a circular double-stranded DNA (dsDNA), e.g., a minicircle, in a cell, tissue, or subject, e.g., human cell, human tissue or human subject. Without wishing to be bound by theory, in some embodiments, a DNA molecule described herein expresses an effector, e.g., a therapeutic effector, in a cell, tissue, or subject after forming a circular dsDNA (e.g., minicircle).

[0228] Without wishing to be bound by theory, in some embodiments, a DNA molecule described herein has decreased immunogenicity, e.g., when delivered to a cell, tissue, or subject, e.g., as compared to an otherwise similar dsDNA (e.g., minicircle). In some embodiments, a

[0229] 1601851989.1 26 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0230] DNA molecule described herein shows decreased activation of the innate immune system compared to an otherwise similar dsDNA (e.g., minicircle).

[0231] Definitions

[0232] As used herein, the term "antibody" refers to a molecule that specifically binds to, or is immunologically reactive with, a particular antigen and includes at least the variable domain of a heavy chain, and normally includes at least the variable domains of a heavy chain and of a light chain of an immunoglobulin. Antibodies and antigen-binding fragments, variants, or derivatives thereof include, but are not limited to, polyclonal, monoclonal, multispecific, human, humanized, primatized, or chimeric antibodies, heteroconjugate antibodies (e.g., bi- tri- and quad-specific antibodies, diabodies, triabodies, and tetrabodies), single-domain antibodies (sdAb), epitopebinding fragments, e.g., Fab, Fab' and F(ab')2, Fd, Fvs, single-chain Fvs (scFv), rlgG, singlechain antibodies, disulfide-linked Fvs (sdFv), nanobody, fragments including either a VL or VH domain, fragments produced by an Fab expression library, and anti-idiotypic (anti-Id) antibodies. Antibodies described herein can be of any type (e.g., IgG, IgE, IgM, IgD, IgA, and IgY), class (e.g., IgGl, IgG2, IgG3, IgG4, IgAl and IgA2) or subclass of immunoglobulin molecule. Moreover, unless otherwise indicated, the term "monoclonal antibody" (mAb) is meant to include both intact molecules as well as antibody fragments (such as, for example, Fab and F(ab')2 fragments) that are capable of specifically binding to a target protein. Fab and F(ab')2 fragments lack the Fc fragment of an intact antibody.

[0233] As used herein, the term “carrier” means a compound, composition, reagent, or molecule that facilitates or promotes the transport or delivery of a composition (e.g., a DNA molecule described herein) into a cell. For example, a carrier may be a partially or completely encapsulating agent.

[0234] As used herein, the term “chemically modified nucleotide,” as used herein with respect to DNAs, refers to a nucleotide comprising one or more structural differences relative to the canonical deoxyribonucleotides (i.e., G, T, C, and A). A chemically modified nucleotide may have (relative to a canonical nucleotide) a chemically modified nucleobase, a chemically modified sugar, a chemically modified phosphodiester linkage, or a combination thereof. No particular process of making is implied; for instance, a chemically modified nucleotide can be produced directly by chemical synthesis, or by covalently modifying a canonical nucleotide.

[0235] 1601851989.1 27 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0236] A “click handle,” as that term is used herein, refers to a chemical moiety that is capable of reacting with a second click handle in a click reaction to produce a click linker.

[0237] A “click linker,” as that term is used herein, refers to a plurality of atoms disposed between and covalently linking entity A and entity B, wherein the click linker is formed as the product of a click reaction that links entity A and entity B. In some embodiments, the click linker has the structure of a click linker that is formed as the product of a click reaction that links entity A and entity B, but is not limited to a click linker made by any particular process. For example, a click linker may be formed by a click reaction, but a click linker can also be formed or provided by a process other than a click reaction. In an embodiment, the click linker is an alkyne / azide click linker, e.g., the click linker comprises a triazole.

[0238] A “click reaction”, as that term is used herein, refers to a range of reactions used to covalently link a first moiety and a second moiety, for convenient production of linked products. It typically has one or more of the following characteristics: it is fast, is specific, is high-yield, is efficient, is spontaneous, does not significantly alter biocompatibility of the linked entities, has a high reaction rate, produces a stable product, favors production of a single reaction product, has high atom economy, is chemoselective, is modular, is stereoselective, is insensitive to oxygen, is insensitive to water, is high purity, generates only inoffensive or relatively non-toxic byproducts that can be removed by nonchromatographic methods (e.g., crystallization or distillation), needs no solvent or can be performed in a solvent that is benign or physiologically compatible, e.g., water, stable under physiological conditions. Examples include an alkyne / azide reaction, a diene / dienophile reaction, or a thiol / alkene reaction. Other reactions can be used. In some embodiments, the click reaction is fast, specific, and high-yield. For instance, in embodiments, a fast click reaction has a second order forward rate constant of 10-200 M^s’1, 1-20 M^s’1, or at least 1, at least 2, at least 3, at least 5, at least 10, at least 20, at least 50, at least 60, at least 100, at least 200, at least 500, at least 1E3, at least 2E3, at least 5E3, at least 1E4, at least 2E4, at least 5E4, at least 1E5, at least 2E5, at least 5E5, or at least 1E6 NT's’1, e.g., at 20°C in PBS. In some embodiments, a high-yield click reaction is one which has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% yield, e.g., for a reaction time of 1 hour at 20°C in PBS.

[0239] As used herein the term “circular” in reference to a ssDNA described herein, means a ssDNA that lacks a free end. A circular ssDNA may be covalently closed or may form a closed

[0240] 1601851989.1 28 Atorney Docket No.: F2128-7023WO(VL87022-W1) structure without free DNA ends through non-covalent interactions, e.g., the ssDNA may be closed through a splint, e.g., a nucleic acid (e.g., DNA or RNA) splint, through a moiety such as a protein that binds and brings together both ends of a linear ssDNA, or through binding of a plurality of proteins, each of two of the plurality binding to a different ssDNA end, and then binding to each other or a third moiety to close the DNA structure. The term circular does not imply a circular physical configuration or an ssDNA structure lacking any intramolecular structure; a circular ssDNA may have regions of intramolecular double stranded regions or other structures.

[0241] Administered or performed “in combination”, as used herein, means that two or more different compositions (e.g., a DNA molecule as described herein or a plurality of bubbles) and / or treatments (e.g., ultrasound, e.g., FUS) are administered to and / or performed on a subject such that a tissue in the subject is in contact with or exposed to both or all of the compositions and / or treatments for a period of time. In some embodiments, the administration of one composition or performance of one treatment is still occurring when the administration or performance of a second composition or treatment begins, so that there is overlap in terms of administration or performance. In some embodiments, the administration of a composition ends before the performance of a treatment or administration of a second composition begins; however the tissue is still in contact with the first- administered composition when the treatment is performed or when the tissue is in contact with the second-administered composition. In some embodiments, the treatment or composition is more effective because of combined performance or administration. For example, one of the treatments or compositions is more effective, e.g., an equivalent effect is seen with less of the treatment or composition, or the treatment or composition reduces symptoms to a greater extent, than would be seen if the treatment or composition were performed or administered in the absence of at least one of the other treatments or compositions. In some embodiments, administration or performance is such that the reduction in a symptom, or other parameter related to a disorder is greater than what would be observed with one treatment performed or composition administered in the absence of at least one of the other treatments or compositions. The effect of the two treatments or compositions can be partially additive, wholly additive, or greater than additive. The administration or performance can be such that an effect of the first composition administered is still detectable when a treatment is performed or administration of a second composition is administered.

[0242] 1601851989.1 29 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0243] As used herein, the term “covalently closed” in reference to a ssDNA means the ssDNA is a continuous strand lacking a free 5' or 3' end.

[0244] As used herein, the term “DNA molecule” refers to any compound and / or substance that comprises at least two (e.g., at least 10, at least 20, at least 50, at least 100) covalently linked deoxyribonucleotides. In some embodiments, the DNA molecule is a single oligonucleotide chain, while in other embodiments, the DNA molecule comprises a plurality of oligonucleotide chains (e.g., the DNA molecule comprises a first strand of DNA, wherein the first strand is circular and is single stranded over at least 90% of its length, and a second strand of DNA, wherein the second strand is linear, has a length of less than 40 or 200 nucleotides, and at least a portion of the second strand base pairs with a contiguous portion of the first strand), while in yet other embodiments the DNA molecule is a portion of a larger molecule, e.g., the DNA molecule may be a portion of a longer DNA molecule. In some embodiments, the DNA molecule comprises solely canonical nucleotides. In some embodiments, the DNA comprises one or more chemically modified nucleotides. In some embodiments, the DNA molecule comprises one or more noncanonical nucleobases or abasic sites. In some embodiments, the DNA molecule comprises a canonical backbone or a backbone analog. In some embodiments, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% of the sugars of the DNA molecule are deoxyribose sugars. In some embodiments, the DNA molecule was prepared by one or more of: isolation from a natural source, enzymatic synthesis by polymerization based on a complementary template (in vivo or in vitro reproduction in a recombinant cell or system, and chemical synthesis. In some embodiments, the DNA molecule comprises a non-nucleotide conjugate.

[0245] As used herein, the term “heterologous”, when used to describe a first element in reference to a second element means that the first element and second element do not exist in nature disposed as described. For example, a heterologous polypeptide, nucleic acid molecule, construct or sequence refers to (a) a polypeptide, nucleic acid molecule or portion of a polypeptide or nucleic acid molecule sequence that is not native to a cell in which it is expressed, (b) a polypeptide or nucleic acid molecule or portion of a polypeptide or nucleic acid molecule that has been altered or mutated relative to its native state, or (c) a polypeptide or nucleic acid molecule with an altered expression as compared to the native expression levels under similar conditions. For example, a heterologous regulatory sequence (e.g., promoter, enhancer) may be

[0246] 1601851989.1 30 Atorney Docket No.: F2128-7023WO(VL87022-W1) used to regulate expression of a gene or a nucleic acid molecule in a way that is different than the gene or a nucleic acid molecule is normally expressed in nature. In another example, a heterologous domain of a polypeptide or nucleic acid sequence (e.g., a DNA binding domain of a polypeptide or nucleic acid encoding a DNA binding domain of a polypeptide) may be disposed relative to other domains or may be a different sequence or from a different source, relative to other domains or portions of a polypeptide or its encoding nucleic acid. In certain embodiments, a heterologous nucleic acid molecule may exist in a native host cell genome, but may have an altered expression level or have a different sequence or both. In other embodiments, heterologous nucleic acid molecules may not be endogenous to a host cell or host genome but instead may have been introduced into a host cell by transformation (e.g., transfection, electroporation), wherein the added molecule may integrate into the host genome or can exist as extra-chromosomal genetic material either transiently (e.g., mRNA) or semi-stably for more than one generation (e.g., episomal viral vector, plasmid or other self-replicating vector).

[0247] As used herein, the term “heterologous functional sequence” refers to a nucleic acid sequence that is heterologous to an adjacent (e.g., directly adjacent) nucleic acid sequence and has one or more biological function.

[0248] As used herein, the terms "increasing" and "decreasing" refer to modulating resulting in, respectively, greater or lesser amounts, of function, expression, or activity of a metric relative to a reference. For example, subsequent to administration of a DNA molecule in a method described herein, the amount of the metric described herein (e.g., the level of gene expression, or a marker of innate immunity) may be increased or decreased in a subject by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 98% or more relative to the amount of the marker prior to administration, or relative to administration of a control DNA molecule. Generally, the metric is measured subsequent to administration at a time that the administration has had the recited effect, e.g., at least one day, at least one week, at least one month, at least 3 months, or 6 at least months, after a treatment regimen has begun.

[0249] As used herein, when two entities are “linked”, the two entities are physically connected by means of one or more covalent or noncovalent bond. In some embodiments, the two entities are directly linked, i .e., an atom of the first entity forms a covalent or noncovalent bond with an

[0250] 1601851989.1 31 Atorney Docket No.: F2128-7023WO(VL87022-W1) atom of the second entity. In some embodiments, the two entities are indirectly linked through a third entity; for example, A is linked to C by virtue of A being directly linked to B and B being directly linked to C.

[0251] As used herein, the terms “linker” refers to a moiety that connects two parts of a compound, e.g., covalently attaches two parts of a compound. The linker may be a click linker.

[0252] As used herein, the term “loop” refers to a nucleic acid sequence that is single stranded. A loop is connected at both ends by a double stranded region referred to as a “stem”, to form a “stem-loop”.

[0253] As used herein, the term “maintenance sequence” is a DNA sequence or motif that enables or facilitates retention of a DNA molecule in the nucleus through cell division. A maintenance sequence typically enables replication and / or transcription of DNA in the nucleus by interacting with proteins that facilitate chromatin looping. An example of a maintenance sequence is a scaffold / matrix attached region (S / MAR element).

[0254] As used herein, a "pharmaceutical composition" or "pharmaceutical preparation" is a composition or preparation which is indicated for animal, e.g., human or veterinary pharmaceutical use, for example, non-human animal or human prophylactic or therapeutic use. A pharmaceutical preparation comprises an active agent having a biological effect on a cell or tissue of a subject, e.g., having pharmacological activity or an effect in the mitigation, treatment, or prevention of disease, in combination with a pharmaceutically acceptable excipient or diluent. A pharmaceutical composition also means a finished dosage form or formulation of a prophylactic or therapeutic composition.

[0255] As used herein, the terms “peptide,” “polypeptide,” and “protein” are used interchangeably and refer to a compound comprising amino acid residues covalently linked by peptide bonds, or by means other than peptide bonds. A protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids that can comprise a protein’s or peptide’s sequence. Polypeptides include any peptide or protein comprising two or more amino acids joined to each other by peptide bonds or by means other than peptide bonds. As used herein, the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types. In some embodiments, a polypeptide comprises a non-canonical amino acid residue.

[0256] 1601851989.1 32 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0257] As used herein, the term “protelomerase sequence” refers to a nucleotide sequence capable of being generated by a protelomerase that joins a first protelomerase recognition sequence (PRS) to a second PRS. In some embodiments, the protelomerase sequence was produced by a process involving protelomerase, and in other embodiments the protelomerase sequence was produced by a process that does not involve protelomerase (e.g., by solid phase synthesis).

[0258] As used herein, the term “single stranded” when used to describe a DNA strand means that the DNA strand is predominantly not hybridized to a second strand of DNA. For instance, a single stranded DNA may be hybridized to a second stand of DNA over less than 20%, 10%, or 5% of the length of the single stranded DNA. In some embodiments, a single stranded DNA is hybridized to a second stand of DNA over a region of less than 200, 100, 50, 40, 30, or 20 nucleotides. A single-stranded DNA (ssDNA) may have paired regions of self-complementarity that form intramolecular / intrastrand double stranded motifs in a folded configuration. Depending on how close together the parts of the sequence are that are self-complementary, the ssDNA may form, e.g., hairpin loops, junctions, bulges or internal loops.

[0259] As used herein, a “sense strand” of a DNA molecule is a strand which has the same sequence as an mRNA or pre-mRNA which encodes for a functional RNA or protein, and does not serve as a template for transcription. An “antisense strand” of a DNA molecule is a strand that has a sequence complementary to an mRNA or pre-mRNA which encodes for a functional RNA or protein and / or can serve as a template for transcription.

[0260] As used herein, the term “double-stranded DNA” or dsDNA means a DNA composition, or a region of DNA, comprising two complementary chains of deoxyribonucleotides that base pair to each other. The two complementary strands may have perfect complementarity or may have one or more mismatches, e.g., forming bulges. Either of the two strands may, in some embodiments, have paired regions of self-complementarity that form intramolecular / intrastrand double stranded motifs in a folded configuration, for example, may form hairpin loops, junctions, bulges or internal loops. In some embodiments, a DNA molecule is predominantly single stranded and comprises a dsDNA region.

[0261] As used herein, the term “spacer domain” refers to a portion of a linker, the portion comprising one or more atoms. The spacer domain increases the length of the linker relative to an otherwise similar linker that lacks the spacer domain. In some embodiments, the spacer

[0262] 1601851989.1 33 Atorney Docket No.: F2128-7023WO(VL87022-W1) domain comprises a PEG moiety. In some embodiments, the PEG moiety has a structure of -(O- CH2-CH2)n, wherein n=2-24, e.g., wherein n=2-8 or n=2-4. In some embodiments, the spacer domain comprises a PEG2 moiety.

[0263] As used herein, the term “second strand motif’ or SSM is a sequence or structural motif in a ssDNA that promotes or enables second strand synthesis. An SSM may comprise a binding site(s) for proteins that initiate DNA synthesis of a second strand, and / or places the DNA in the correct orientation for DNA polymerase binding.

[0264] As used herein, the term “terminal nucleotide” refers to a nucleotide that is covalently attached to exactly one other nucleotide. In some embodiments, the terminal nucleotide comprises a free 5’ phosphate. In some embodiments, the terminal nucleotide comprises a free 3’ OH.

[0265] As used herein, "treatment" and "treating" refer to the medical management of a subject with the intent to improve, ameliorate, stabilize (i.e., not worsen), prevent or cure a disease, pathological condition, or disorder. This term includes active treatment (treatment directed to improve the disease, pathological condition, or disorder), causal treatment (treatment directed to the cause of the associated disease, pathological condition, or disorder), palliative treatment (treatment designed for the relief of symptoms), preventative treatment (treatment directed to minimizing or partially or completely inhibiting the development of the associated disease, pathological condition, or disorder); and supportive treatment (treatment employed to supplement another therapy). Treatment also includes diminishment of the extent of the disease or condition; preventing spread of the disease or condition; delay or slowing the progress of the disease or condition; amelioration or palliation of the disease or condition; and remission (whether partial or total), whether detectable or undetectable. "Ameliorating" or "palliating" a disease or condition means that the extent and / or undesirable clinical manifestations of the disease, disorder, or condition are lessened and / or time course of the progression is slowed or lengthened, as compared to the extent or time course in the absence of treatment. "Treatment" can also mean prolonging survival as compared to expected survival if not receiving treatment. Those in need of treatment include those already with the condition or disorder, as well as those prone to have the condition or disorder or those in which the condition or disorder is to be prevented.

[0266] 1601851989.1 34 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0267] BRIEF DESCRIPTION OF THE DRAWINGS

[0268] Figs. 1A-1B illustrate the production of a DNA molecule as described herein. Fig. 1A describes the production of an exemplary first strand of the DNA molecule, wherein the first strand of the DNA molecule is a circular single-stranded DNA (cssDNA). A template DNA, comprising the sequence of the first strand of the DNA molecule, is amplified by PCR, using a forward primer and a reverse primer, wherein one of the primers comprises a functional group, e.g., a click handle, e.g., an Azido dNTP. The PCR product, which is a double-stranded DNA (dsDNA) comprising the functional group, is digested with an enzyme, e.g., a restriction enzyme, e.g., a Bsal enzyme, to produce compatible overhangs. The dsDNA is then circularized by DNA ligation. The circular dsDNA is then treated with a specific nickase, e.g., Nb.BsrDI enzyme, to introduce a nick on one DNA strand, followed by removal of the nicked DNA strand, e.g., using an exonuclease, thereby producing a cssDNA. Fig. IB describes the production of an exemplary DNA molecule as described herein. An oligonucleotide, comprising the sequence that is complementary to a portion of the cssDNA, e.g., a portion of the cssDNA comprising or adjacent to the functional group, e.g., at 5’ direction of the first strand of DNA, and a compatible functional group, e.g., a reactive handle, is covalently bound to the cssDNA, e.g., by a chemical reaction, e.g., by a click reaction. Without wishing to be bound by theory, the DNA molecule produced, e.g., as described by Figs. 1A and IB, can be enriched without risking losing the attached second strand.

[0269] Fig. 2A illustrates an exemplary method for production of PrimeCS molecules, which comprise a cssDNA and an oligonucleotide complementary to a portion of cssDNA, wherein the oligonucleotide is covalently linked to the cssDNA. cssDNA precursor comprising a conjugation handle, such as an azido group, is contacted with an oligonucleotide comprising a complementary conjugation handle, such as DBCO, wherein the complementary conjugation handle is located on a nucleotide internal to the oligonucleotide (e.g., proximal to the 5’ end) or on a terminal nucleotide (e.g., at the 5’ end) of the oligonucleotide. A covalent linkage is formed between the cssDNA and the oligonucleotide, producing PrimeCS-A molecules (where the linkage is situated on a nucleotide internal to the oligonucleotide) or PrimeCS-B molecules (where the linkage is situated at the 5’ most nucleotide of the oligonucleotide).

[0270] 1601851989.1 35 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0271] Figs. 2B-2D depict TapeStation traces of cssDNA comprising a clickable functional group (Fig. 2B), PrimeCS-A molecules (Fig. 2C) or PrimeCS-B molecules (Fig. 2D). Peaks corresponding to these molecules are indicated with arrows.

[0272] Fig- 3 is a graph depicting the eGFP mean fluorescence intensity of Fa2N cells transfected with cssDNA comprising a clickable functional group (“cssDNA”), PrimeCS-A molecules, or PrimeCS-B molecules.

[0273] Figs. 4A-B are graphs depicting the cGAMP levels ([2’ -3’ cGAMP] pmol / ml; Fig. 4A) or levels of cytokines IFN-a2, IFN-P, FFN-y, IFN- 1, IP-10, and IL-ip (pg / mL; Fig. 4B) for fibroblasts transfected with circular double- stranded DNA molecules that lack chemically modified nucleotides (“cdsDNA”), cssDNA molecules comprising a clickable functional group (“cssDNA”), PrimeCS-A molecules, or PrimeCS-B molecules.

[0274] DETAILED DESCRIPTION

[0275] This disclosure relates to compositions and methods for providing an effector, e.g., a therapeutic effector, to a cell, tissue or subject, e.g., in vivo or in vitro. The effector may be a DNA sequence, a polypeptide, e.g., a therapeutic protein, or an RNA, e g., a regulatory RNA or an mRNA.

[0276] Elements of DNA molecules

[0277] The DNA molecule described herein can contain elements sufficient to deliver an effector sequence to a target cell, tissue or subject. In some embodiments, the effector sequence is a DNA sequence. In some embodiments, the DNA molecule drives expression of an effector, e.g., the DNA molecule comprises a promoter and a sequence encoding an RNA or a polypeptide, e.g., a therapeutic RNA or polypeptide. In some embodiments, the DNA molecules described herein further contain a maintenance sequence. In some embodiments, the DNA molecules described herein further contain a second strand motif (SSM).

[0278] In some embodiments, the DNA molecule comprises a first strand of DNA, which is a circular single-stranded DNA (ssDNA), in which the ssDNA lacks a free end. A circular ssDNA may be covalently closed or may form a closed structure without free DNA ends through non- covalent interactions, e.g., the ssDNA may be closed through a splint, e.g., a nucleic acid (e.g., DNA or RNA) splint, through a moiety such as a protein that binds and brings together both ends

[0279] 1601851989.1 36 Atorney Docket No.: F2128-7023WO(VL87022-W1) of a linear ssDNA, or through binding of a plurality of proteins, each of two of the plurality binding to a different ssDNA end, and then binding to each other or a third moiety to close the DNA structure. In the case of circular ssDNA, the term circular does not imply that the ssDNA structure lacks all intramolecular structure; rather, a circular ssDNA may have short regions of intramolecular double stranded regions or other structures.

[0280] In some embodiments, the first stand of the DNA molecule is single stranded over at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of its length.

[0281] In some embodiments, the DNA molecule comprises a second strand of DNA. In some embodiments, the second strand comprises at least 5, at least 10, at least 15, at least 20, at least 50, at least 100, or at least 150 base pairs of perfect complementarity to the first strand, wherein the at least 5, at least 10, at least 15, at least 20, at least 50, at least 100, or at least 150 base pairs are situated at the 3’ end of the second strand.

[0282] In some embodiments, the DNA molecule comprises a double-stranded DNA region. In some embodiments, the dsDNA region is formed by the first strand and the second strand at the position where the second strand is complementary to the first strand. In some embodiments, the dsDNA region has a length of at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 120, at least 140, at least 160, at least 180, or at least 200 nucleotides. In some embodiments, the dsDNA region has a length of 5-10, 10-15, 15-20, 20-25, 25-30, 30-35, or 35-40, 40-50, 50-60, 60-70, 70-80, 80-90, 90-100, 100-120, 120-140, 140-160, 160-180, or 180-200 nucleotides.

[0283] In some embodiments, the first strand and the second strand of the DNA molecule are covalently linked. In some embodiments, the first strand and the second strand of the DNA molecule are linked by a click reaction.

[0284] In some embodiments, the first strand disclosed herein is at least about 100 nucleotides, at least about 200 nucleotides, at least about 300 nucleotides, at least about 500 nucleotides, at least about 1000 nucleotides, at least about 2000 nucleotides, at least about 3000 nucleotides, at least about 4000 nucleotides, at least about 5000 nucleotides, at least about 6000 nucleotides, at least about 7000 nucleotides, at least about 8000 nucleotides, at least about 9000 nucleotides, at least about 10,000 nucleotides, at least about 11,000, or at least about 12,000 nucleotides in length. In some embodiments, the first strand disclosed herein is between 100-200, 200-300, 300-500, 500-1000, 1000-2000, 2000-3000, 3000-4000, 4000-5000, 5000-6000, 6000-7000,

[0285] 1601851989.1 37 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0286] 7000-8000, 8000-9000, 9000-10,000, 10,000-11,000, or 11,000-12,000 nucleotides in length. In some embodiments, the size of a first strand disclosed herein is a length sufficient to encode useful polypeptides or RNAs.

[0287] In some embodiments, a DNA molecule described herein is resistant to endonuclease digestion and / or resistant to immune sensor recognition. In some embodiments, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% of the sugars of a DNA molecule described herein are deoxyribose sugars.

[0288] In some embodiments, a DNA molecule described herein can be replicated (e.g., by a DNA polymerase native to a cell comprising the DNA molecule). In some embodiments, a DNA molecule described herein cannot be replicated. In some embodiments, a DNA molecule or a portion thereof can be integrated into the genome. In some embodiments, a DNA molecule or a portion thereof cannot be integrated into the genome.

[0289] In some embodiments, a double-stranded DNA region is at least 10, at least 15, at least 20, at least 25, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, or 100 nucleotides in length. In some embodiments, a double-stranded DNA region is less than 50, less than 60, less than 70, less than 80, less than 90, less than 100, less than 200, less than 300, less than 400, or less than 500 nucleotides in length. In some embodiments, the double stranded DNA region is 10-15, 15-20, 20-25, 25-30, 30-35, 35-40, 40-45, 45-50, 50-55, 55-60, 60-70, 70- 80, 80-90, 90-100, 100-200, 200-300, 300-400, or 400-500 nucleotides in length.

[0290] A double-stranded DNA region described herein may have less than a threshold level of single stranded structures. In one embodiment, the double-stranded DNA region does not comprise more than 20, 18, 16, 14, 12, 10, 8, 7, 5, 4, 3, 2, or 1 single stranded region longer than 10, 5, 2, or 1 bases, e.g., does not comprise single stranded regions longer than 10, 5, 2, or 1 bases.

[0291] In some embodiments, a double-stranded DNA region comprises a sense strand and an antisense strand.

[0292] In some embodiments, a dsDNA region described herein is asymmetrically modified, where one strand comprises chemically modified nucleobases and the other strand is substantially free of chemically modified nucleobases. In some embodiments, the hemimodified DNA may be completely free of chemically modified nucleotides on the antisense strand, and in other embodiments, the hemi-modified DNA may comprise a few chemical

[0293] 1601851989.1 38 Atorney Docket No.: F2128-7023WO(VL87022-W1) modifications (such as backbone modifications, e.g., phosphorothioate) on the antisense strand. In some embodiments, the hemi-modified DNA molecule comprises chemically modified nucleotides (e.g., nucleotides comprising chemically modified nucleobases) on the sense strand.

[0294] Structural elements of single-stranded DNA regions

[0295] A single-stranded DNA (ssDNA) region described herein may be circular, e.g., covalently closed. Exemplary production of ssDNA constructs may be found, for example, in WO / 2023 / 069948, incorporated herein by reference in its entirety.

[0296] A single-stranded DNA region described herein may have less than a threshold level of intramolecular complementarity or double stranded structures. In one embodiment, the ssDNA does not comprise more than 50, 40, 30, 20, 18, 16, 14, 12, 10, 8, 7, 5, 4, 3, 2, or 1 double stranded region longer than 100, 80, 70, 60, 50, 40, 30, 20 or 10 base pairs. In some embodiments, the ssDNA does not comprise any regions of intramolecular complementarity longer than 100, 80, 70, 60, 50, 40, 30, 20 or 10 base pairs. In some embodiments, the ssDNA comprises 1, 2, 3, 4, 5, 7, 8, 10, 21, 14, 15, 18, or 20 double stranded regions, e.g., wherein the double stranded regions are no more than 100, 80, 70, 60, 50, 40, 30, 20 or 10 base pairs. For example, the single-stranded DNA region is not a doggybone structure, i.e., it is not a primarily double stranded, closed ended construct.

[0297] In some embodiments, the circular single-stranded DNA comprises a functional group, e g., a click handle. In some embodiments, the functional group is not located in, e.g., 10, 20, 40, 60, 80, 100, 200, 500, 1000, 2000, 3000, or 4000 nucleotides away, the effector sequence, e.g., the region encoding a therapeutic effector. In some embodiments, the functional group is not located in the effector sequence. In some embodiments, the functional group is located at least 10, at least 20, at least 40, at least 60, at least 80, at least 100, at least 200, at least 500, at least 1000, at least 2000, at least 3000, or at least 4000 nucleotides away from the effector sequence. In some embodiments, the functional group is located inside the effector sequence.

[0298] In some embodiments, the single-stranded DNA region does not form a double stranded structure longer than 100 base pairs. In some embodiments, the single-stranded DNA region does not form a double stranded structure longer than 80 base pairs. In some embodiments, the single-stranded DNA region does not form a double stranded structure longer than 60 base pairs. In some embodiments, the single-stranded DNA region does not form a double stranded structure

[0299] 1601851989.1 39 Atorney Docket No.: F2128-7023WO(VL87022-W1) longer than 50 base pairs. In some embodiments, the single-stranded DNA region does not form a double stranded structure longer than 45 base pairs. In some embodiments, the single-stranded DNA region does not form a double stranded structure longer than 40 base pairs. In some embodiments, the single-stranded DNA region does not form a double stranded structure longer than 35 base pairs. In some embodiments, the single-stranded DNA region does not form a double stranded structure longer than 30 base pairs. In some embodiments, the single-stranded DNA region does not form a double stranded structure longer than 25 base pairs. In some embodiments, the single-stranded DNA region does not form a double stranded structure longer than 20 base pairs. In some embodiments, the single-stranded DNA region does not comprise a length of double strandedness that is recognized by cyclic GMP-AMP synthase (cGAS) in a cell. Without wishing to be bound by theory, cGAS is thought to mediate innate immunity to foreign double stranded DNA.

[0300] In some embodiments, the single-stranded DNA region does not comprise a first sequence that hybridizes with a second sequence, wherein the first sequence and the second sequence are at least 5, at least 10, at least 15, at least 20, or at least 25 nucleotides long, and wherein the first sequence and the second sequence are positioned less than 6, 5, 4, 3, 2, or 1 nucleotides apart from each other.

[0301] In some aspects, the present disclosure provides a pharmaceutical formulation comprising: an LNP comprising a DNA molecule described herein, e.g., wherein the DNA molecule comprises a single- stranded DNA region. In some embodiments, the single-stranded DNA region: (a) encodes a therapeutic protein, (b) is covalently closed, (c) does not form a double stranded structure longer than 100 base pairs, and (d) is more than 200 nucleotides in length. In some embodiments, the single-stranded DNA region does not comprise a protelomerase target sequence. In some embodiments, the pharmaceutical formulation is substantially free of protein. In some embodiments, the single stranded DNA region does not form a double stranded structure longer than 40 base pairs.

[0302] In some embodiments, the ssDNA region has a GC content of 30-40%, 40-50%, 50-60%, or 60-70%. In some embodiments, the ssDNA region lacks one or both of a bacteriophage packaging site and a bacteriophage origin of replication, or wherein the ssDNA region does not encode a bacteriophage capsid gene. In some embodiments, the ssDNA region was not produced by rolling circle amplification. In some embodiments, the ssDNA region was not produced by

[0303] 1601851989.1 40 Atorney Docket No.: F2128-7023WO(VL87022-W1) strand displacement amplification. In some embodiments, the ssDNA region comprises between 200-3,000 nucleotides. In some embodiments, the ssDNA region comprises between 500 and 2,000 nucleotides. In some embodiments, the ssDNA region is a sense ssDNA strand. In some embodiments, the ssDNA region is an antisense ssDNA strand.

[0304] In one aspect the invention features a composition, e.g., a pharmaceutical composition, that comprises a DNA molecule as described herein. In some embodiments, the DNA molecule comprises a single stranded DNA region comprising an effector sequence, the single stranded DNA region having one, two or three of the following characteristics: the ssDNA region is covalently closed; the ssDNA region does not form a double stranded structure longer than 100 base pairs; or the ssDNA region comprises at least one covalent modification.

[0305] In an embodiment, the single stranded DNA region has at least 15 nucleotides, at least 30 nucleotides, at least 50 nucleotides, at least 75 nucleotides, 100 nucleotides, at least 200 nucleotides, at least 300 nucleotides, at least 500 nucleotides, at least 750 nucleotides, at least 1,000 nucleotides, at least 2,000 nucleotides, at least 3,000 nucleotides, at least 4,000 nucleotides, at least 5,000 nucleotides, at least 6,000 nucleotides, at least 7,000 nucleotides, at least 8,000 nucleotides, at least 9,000 nucleotides, at least 10,000 nucleotides, at least 11,000 nucleotides, or at least 12,000 nucleotides.

[0306] In an embodiment, the single stranded DNA region has between 20 and 1000 nucleotides, between 20 and 50 nucleotides, between 100 and 500 nucleotides, between 500 and 12,000 nucleotides, between 500 and 10,000 nucleotides, between 1,000 and 12,000 nucleotides, between 2,000 and 12,000 nucleotides, between 5,000 and 12,000 nucleotides, between 5,000 and 10,000 nucleotides, between 1,000 and 10,000 nucleotides, between 200 and 1,000 nucleotides, between 200 and 2,000 nucleotides, between 200 and 3,000 nucleotides, between 500 and 1,000 nucleotides, between 500 and 2,000 nucleotides, between 500 and 3,000 nucleotides, between 1,000 and 2,000 nucleotides, between 1,000 and 3,000 nucleotides, or between 2,000 and 3,000 nucleotides. In some embodiments, the ssDNA region comprises between 20-12,000 nucleotides. In some embodiments the ssDNA region comprises between SO- 12, 000 nucleotides.

[0307] In an embodiment, the single stranded DNA region is a sense ssDNA strand. In an embodiment, the single stranded DNA region is an antisense ssDNA strand.

[0308] 1601851989.1 41 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0309] In some embodiments, a ssDNA described herein is provided as a sense strand or an antisense strand. The single stranded antisense strand has a sequence complementary to an mRNA or pre-mRNA which encodes an effector (e.g., an effector protein) and / or can serve as a template for transcription. The single stranded sense strand has the same sequence as an mRNA or pre-mRNA which encodes an effector (e.g., an effector protein), and does not serve as a template for transcription. Rather, without wishing to be bound by theory, in some embodiments, the cell converts the single stranded sense strand into double stranded DNA via replication machinery, and the newly formed antisense strand may serve as a template for transcription. Thus, a sense strand may “encode” an effector by providing the sequence necessary for the cell to produce the complementary DNA strand which may then be transcribed.

[0310] In some embodiments, when a DNA molecule described herein is introduced to a cell, the cell exhibits a lower cytokine mRNA or protein level increase (e.g., normalized to GAPDH mRNA levels) compared to a control cell of the same type that was contacted with a dsDNA having the same sequence as the single stranded DNA region at the same molar amount as the DNA molecule. In some embodiments, the cytokine comprises IFN-b, IL-6, IL-lb, TNF-a, CXCL10, IFN-a2, IFN-y, IFN- 1, or IP-10. In some embodiments, the cytokine increase in the control cells is less than 50%, less than 40%, less than 30%, less than 20%, or less than 10% of the cytokine increase in the control cells. In some embodiments, when a DNA molecule described herein is introduced to a cell, the cell exhibits a lower level of the cytokine protein compared to a control cell of the same type that was contacted with a fully double stranded DNA having the same sequence as the DNA molecule at the same molar amount as the DNA molecule.

[0311] In some embodiments, a DNA molecule described herein has an A260 / A280 ratio of 1.6- 1.7, 1.7-1.8, or 1.63-1.76. In some embodiments, a DNA molecule described herein has an A230 / A260 ratio of 0.3-l, 1-1.5, 1.5-1.8, or O.34-1.79.

[0312] In any embodiment described herein, the single stranded DNA region may be covalently closed, e.g., the ssDNA is circularized.

[0313] Sequence elements of DNA molecules

[0314] A DNA molecule described herein, e.g., a part of a single stranded, circular DNA strand, can contain various sequence elements. In some embodiments, a DNA molecule described

[0315] 1601851989.1 42 Atorney Docket No.: F2128-7023WO(VL87022-W1) herein comprises a promoter sequence. In some embodiments, a DNA molecule described herein comprises an effector sequence (e.g., a therapeutic effector sequence) operably linked to the promoter sequence. In some embodiments, a DNA molecule described herein comprises a heterologous functional sequence. In some embodiments, a DNA molecule described herein comprises a maintenance sequence. In some embodiments, a DNA molecule described herein comprises an origin of replication. In some embodiments, the DNA molecule comprises one, two, three, four, or all of a promoter sequence, an effector sequence, a heterologous functional sequence, a maintenance sequence, or an origin of replication. In some embodiments, the DNA molecule comprises a promoter sequence, an effector sequence, and a heterologous functional sequence. In some embodiments, the DNA molecule comprises a promoter sequence, an effector sequence, and a maintenance sequence. In some embodiments, the DNA molecule comprises a promoter sequence, an effector sequence, and an origin of replication. In some embodiments, the DNA molecule comprises a promoter sequence, an effector sequence, a heterologous functional sequence, and a maintenance sequence. In some embodiments, the DNA molecule comprises a promoter sequence, an effector sequence, a heterologous functional sequence, and an origin of replication. In some embodiments, the DNA molecule comprises a promoter sequence, an effector sequence, a maintenance sequence, and an origin of replication. In some embodiments, the DNA molecule comprises a promoter sequence, an effector sequence, a heterologous functional sequence, a maintenance sequence, and an origin of replication. In the case of doublestranded DNA, in some embodiments, the promoter and / or effector sequence is in the doublestranded region.

[0316] In some embodiments, the effector sequence encodes a polypeptide (e.g., a protein). In some embodiments, the effector sequence encodes a functional RNA (e.g., a miRNA, siRNA, or tRNA). In some embodiments, the effector sequence is heterologous to a target cell.

[0317] In some embodiments, the DNA molecule described herein further comprises an enhancer. In some embodiments, a DNA molecule comprises two enhancers. In some embodiments, a DNA molecule described herein comprises a SSM (e.g., an Anellovirus hairpin). In some embodiments, a DNA molecule described herein comprises a promoter, e.g., an EFla promoter. In some embodiments, the enhancer is situated upstream of the promoter. In some embodiments, the SSM (e.g., Anellovirus hairpin) is situated upstream of the promoter. In some embodiments, the promoter is situated between the enhancer and the effector sequence. In some

[0318] 1601851989.1 43 Atorney Docket No.: F2128-7023WO(VL87022-W1) embodiments, the SSM (e.g., anellovirus hairpin) is situated between the enhancer and the promoter.

[0319] In embodiments, the DNA molecule can include a plurality of effector sequences. The plurality may be the same or different types, e.g., a DNA molecule can include an effector sequence that is a structural DNA and a second effector sequence that is a DNA sequence encoding a functional RNA or polypeptide. In some embodiments, the DNA molecule comprises a second effector sequence which is the same as or different than the first effector sequence. A DNA molecule can include an effector sequence that is a DNA sequence encoding a functional RNA and a second effector sequence that is a DNA sequence encoding a functional polypeptide. The plurality of effector sequences may be the same or different sequences of the same type.

[0320] Promoters and Other Regulatory Sequences

[0321] A DNA molecule described herein may contain a promoter sequence (a DNA sequence at which RNA polymerase and transcription factors bind to, directly or indirectly, to initiate transcription) operably linked to an effector sequence. A promoter may be found in nature operably linked to the effector sequence, or may be heterologous to the effector sequence. A promoter described herein may be native to the target cell or tissue, or heterologous to the target cell or tissue. A promoter may be constitutive, inducible and / or tissue-specific. It is understood that when a single-stranded DNA molecule is said to comprise a promoter sequence, in some embodiments the promoter is only active after the single-stranded DNA has been converted to double stranded DNA, e.g., by replication machinery within the cell to which the single-stranded DNA molecule was delivered.

[0322] Examples of constitutive promoters include the retroviral Rous sarcoma virus (RSV) LTR promoter (optionally with the RSV enhancer), the cytomegalovirus (CMV) promoter (optionally with the CMV enhancer) (see, e.g., Boshart et al, Cell, 41 :521-530 (1985), the dihydrofolate reductase promoter, the beta-actin promoter, the phosphoglycerol kinase (PGK) promoter, and the EFl alpha promoter.

[0323] Inducible promoters allow regulation of expression and can be regulated by exogenously supplied compounds, environmental factors such as temperature, or the presence of a specific physiological state, e.g., acute phase, a particular differentiation state of the cell, or in replicating cells only. Inducible promoters and inducible systems are available from a variety of sources.

[0324] 1601851989.1 44 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0325] Examples of inducible promoters regulated by exogenously supplied promoters include the zinc- inducible sheep metallothionine (MT) promoter, the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter, the T7 polymerase promoter system (WO 98 / 10088); the ecdysone insect promoter (No et al., Proc. Natl. Acad. Sci. USA, 93:3346-3351 (1996)), the tetracycline-repressible system (Gossen et al., Proc. Natl. Acad. Sci. USA, 89:5547-5551 (1992)), the tetracycline-inducible system (Gossen et al., Science, 268: 1766-1769 (1995), see also Harvey et al, Curr. Opin. Chem. Biol., 2:512-518 (1998)), the RU486-inducible system (Wang et al., Nat. Biotech., 15:239-243 (1997) and Wang et al., Gene Ther., 4:432-441 (1997)) and the rapamycin-inducible system (Magari et al., J. Clin. Invest., 100:2865-2872 (1997)).

[0326] In some embodiments, the native promoter for the sequence encoding the effector can be used.

[0327] In some embodiments, the regulatory sequences impart tissue-specific gene expression capabilities. In some cases, the tissue-specific regulatory sequences bind tissue-specific transcription factors that induce transcription in a tissue specific manner. Such tissue-specific regulatory sequences (e.g., promoters, enhancers, etc.) are known in the art. Exemplary tissuespecific regulatory sequences include, but are not limited to the following tissue specific promoters: a liver-specific thyroxin binding globulin (TBG) promoter, an insulin promoter, a glucagon promoter, a somatostatin promoter, a pancreatic polypeptide (PPY) promoter, a synapsin-1 (Syn) promoter, a creatine kinase (MCK) promoter, a mammalian desmin (DES) promoter, a alpha-myosin heavy chain (a-MHC) promoter, or a cardiac Troponin T (cTnT) promoter. Other exemplary promoters include Beta-actin promoter, hepatitis B virus core promoter, Sandig et al., Gene Ther., 3: 1002-9 (1996); alpha-fetoprotein (AFP) promoter, Arbuthnot et al., Hum. Gene Ther., 7: 1503-14 (1996)), bone osteocalcin promoter (Stein et al., Mol. Biol. Rep., 24: 185-96 (1997)); bone sialoprotein promoter (Chen et al., J. Bone Miner. Res., 11 :654-64 (1996)), CD2 promoter (Hansal et al., J. Immunol., 161 : 1063-8 (1998); immunoglobulin heavy chain promoter; T cell receptor alpha-chain promoter, neuronal such as neuron-specific enolase (NSE) promoter (Andersen et al., Cell. Mol. Neurobiol., 13:503-15 (1993)), neurofilament light-chain gene promoter (Piccioli et al., Proc. Natl. Acad. Sci. USA, 88:5611-5 (1991)), and the neuron-specific vgf gene promoter (Piccioli et al., Neuron, 15:373-84 (1995)), among others which will be known to the skilled artisan.

[0328] Examples of tissue / cell specific promoters are listed in Table 1 :

[0329] 1601851989.1 45 Attorney Docket No.: F2128-7023WO(VL87022-W1)

[0330] Table 1: Tissue or cell specific promoters

[0331] 1601851989.1 46 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0332] The DNA molecules described herein may also include other native or heterologous expression control elements, such as enhancer elements, polyadenylation sites or Kozak consensus sequences.

[0333] Effector sequence

[0334] The effector sequence of a DNA molecule described herein may be, e.g., a functional DNA sequence, e.g., a therapeutically functional DNA sequence; a DNA sequence encoding a therapeutic peptide, polypeptide or protein; or a DNA sequence encoding a therapeutic RNA (e.g., a non-coding RNA).

[0335] DNA effectors:

[0336] A therapeutically functional DNA sequence may be a DNA sequence that forms a functional structure, e.g., a DNA sequence comprising a DNA aptamer, DNAzyme or allelespecific oligonucleotide (a DNA ASO). A therapeutically functional DNA sequence typically lacks a promoter operably linked. In embodiments, a DNA molecule described herein may include one or a plurality of functional DNA sequences, e.g., 2, 3, 4, 5, 6, or more sequences, which may be the same or different.

[0337] Polypeptide effectors:

[0338] A DNA sequence encoding a therapeutic polypeptide may be a DNA sequence encoding one or more effectors which is a peptide, protein, or combinations thereof. For example, the DNA sequence encodes an mRNA. The peptide or protein may be: a DNA binding protein; an RNA binding protein; a transporter; a transcription factor; a translation factor; a ribosomal protein; a chromatin remodeling factor; an epigenetic modifying factor; an antigen; a hormone; an enzyme (such as a nuclease, e.g., an endonuclease, e.g., a nuclease element of a CRISPR system, e.g., a Cas9, dCas9, aCas9-nickase, Cpf / Casl2a); a CRISPR-linked enzyme, e.g. a base editor or prime editor; a mobile genetic element protein (e.g., a transposase, a retrotransposase, a

[0339] 1601851989.1 47 Atorney Docket No.: F2128-7023WO(VL87022-W1) recombinase, an integrase); a gene writer; a polymerase; a methylase; a demethylase; an acetylase; a deacetylase; a kinase; a phosphatase; a ligase; a deubiquitinase; a protease; an integrase; a recombinase; a topoisomerase; a gyrase; a helicase; a lysosomal acid hydrolase); an antibody (e.g., an intact antibody, a fragment thereof, or a nanobody); a signaling peptide; a receptor ligand; a receptor; a clotting factor; a coagulation factor; a structural protein; a caspase; a membrane protein; a mitochondrial protein; a nuclear protein; or an engineered binder such as a centyrin, darpin, or adnectin. See, e.g., Gebauer & Skerra. 2020. Annual Review of Pharmacology and Toxicology 60: 1, 391-415.

[0340] In some embodiments, a DNA molecule described herein may include one or a plurality of sequences encoding a polypeptide, e.g., 2, 3, 4, 5, 6, or more sequences encoding a polypeptide. Each of the plurality may encode the same or different protein. For example, a sequence described herein may include multiple sequences encoding multiple proteins, e g., a plurality of proteins in a biological pathway.

[0341] In some embodiments, a DNA molecule or sequence described herein may include a plurality of sequences encoding a polypeptide, e.g., 2, 3, 4, 5, 6, or more sequences encoding a polypeptide, separated by a self-cleaving peptide, e g., P2A, T2A, E2A or F2A. self-cleaving peptides are 18-22 amino acids long, and can induce ribosomal skipping during protein translation so that two polypeptides can be encoded in the same transcript. Each of the polypeptides may encode the same or different protein. In one embodiment, a DNA molecule or sequence described herein may include a promoter followed by a sequence encoding a first polypeptide of interest, a sequence encoding a 2A self-cleaving peptide, a sequence encoding a second polypeptide of interest, and a polyA site. In another embodiment, a DNA molecule or sequence described herein may include a promoter followed by a sequence encoding the first polypeptide of interest, a first 2A self-cleaving peptide, a second polypeptide of interest, a sequence encoding a second 2A self-cleaving peptide, a sequence encoding a third polypeptide of interest, and a polyA site.

[0342] In some embodiments, the effector comprises a cell penetrating polypeptide. In some embodiments, the effector is a fusion protein that comprises a cell penetrating polypeptide and a second amino acid sequence. In some embodiments, the DNA molecule does not comprise a cell penetrating polypeptide. For example, in some embodiments, the DNA molecule does not comprise a fusion protein that comprises a cell penetrating polypeptide.

[0343] 1601851989.1 48 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0344] In some embodiments, an effector described herein comprises an immunogen. In some embodiments, an effector described herein comprises a viral antigen, a bacterial antigen, a fungal antigen, or a tumor antigen. In some embodiments, an effector described herein comprises a peptide antigen. In some embodiments, a composition described herein is administered to a subject as a vaccine. In some aspects, the present disclosure provides a method of vaccinating a subject, comprising administering to the subject a composition described herein.

[0345] In some embodiments, an effector sequence described herein does not encode viral protein.

[0346] RNA effectors:

[0347] An effector sequence may be a DNA sequence encoding a non-coding RNA, e.g., one or more of a short interfering RNA (siRNA), a microRNA (miRNA), long non-coding RNA, a piwi-interacting RNA (piRNA), a small nucleolar RNA (snoRNA), a small Cajal body-specific RNA (scaRNA), a transfer RNA (tRNA), a ribosomal RNA (rRNA), an RNA aptamer, and a small nuclear RNA (snRNA). In some embodiments, a DNA molecule described herein comprises a sequence encoding an RNA (e.g., an mRNA, siRNA, or miRNA). In some embodiments, a DNA molecule described herein does not comprise a sequence encoding an RNA.

[0348] In some embodiments, a DNA molecule disclosed herein comprises one or more expression sequences that encode a regulatory RNA, e.g., an RNA that modifies expression of an endogenous gene and / or an exogenous gene. In some embodiments, the DNA molecule disclosed herein can comprise a sequence that is antisense to a regulatory nucleic acid like a non-coding RNA, such as, but not limited to, tRNA, IncRNA, miRNA, rRNA, snRNA, microRNA, siRNA, piRNA, snoRNA, snRNA, exRNA, scaRNA, Y RNA, and hnRNA. In one embodiment, the regulatory nucleic acid targets a host gene. A regulatory nucleic acid may include, but is not limited to, a nucleic acid that hybridizes to an endogenous gene, e.g., an antisense RNA, a guide RNA, a nucleic acid that hybridizes to an exogenous nucleic acid such as a viral DNA or RNA, nucleic acid that hybridizes to an RNA, nucleic acid that interferes with gene transcription, nucleic acid that interferes with RNA translation, nucleic acid that stabilizes RNA or destabilizes RNA such as through targeting for degradation, and nucleic acid that modulates a DNA or RNA binding factor. In one embodiment, the sequence is an miRNA. In some embodiments, the

[0349] 1601851989.1 49 Atorney Docket No.: F2128-7023WO(VL87022-W1) regulatory nucleic acid targets a sense strand of a host gene. In some embodiments, the regulatory nucleic acid targets an antisense strand of a host gene.

[0350] In some embodiments, a DNA molecule disclosed herein encodes a guide RNA. Guide RNA sequences are generally designed to have a sequence having a length of between 15-30 nucleotides (e.g., 17, 19, 20, 21, 24 nucleotides) that is complementary to the targeted nucleic acid sequence, and a region that facilitates complex formation (e.g., with a tracrRNA or a nuclease). Custom gRNA generators and algorithms are available commercially for use in the design of effective guide RNAs. Gene editing has also been achieved using a chimeric "single guide RNA" ("sgRNA"), an engineered (synthetic) single RNA molecule that mimics a naturally occurring crRNA-tracrRNA complex and contains both a tracrRNA (for binding the nuclease) and at least one crRNA (to guide the nuclease to the sequence targeted for editing). Chemically modified sgRNAs have also been demonstrated to be effective in genome editing; see, for example, Hendel et al. (2015) Nature Biotechnol., 985-991. The gRNA may recognize specific DNA sequences (e.g., sequences adjacent to or within a promoter, enhancer, silencer, or repressor of a gene). In one embodiment, the gRNA is used as part of a CRISPR system for gene editing. For the purposes of gene editing, the DNA molecule disclosed herein may be designed to include one or multiple sequences encoding guide RNA sequences corresponding to a desired target DNA sequence; see, for example, Cong et al. (2013) Science, 339:819-823; Ran et al. (2013) Nature Protocols, 8:2281-2308.

[0351] A DNA molecule disclosed may encode certain regulatory nucleic acids that can inhibit gene expression through the biological process of RNA interference (RNAi). RNAi molecules comprise RNA or RNA-like structures typically containing 15-50 base pairs (such as about 18- 25 base pairs) and having a nucleobase sequence identical (complementary) or nearly identical (substantially complementary) to a coding sequence in an expressed target gene within the cell. Such RNAi molecules include, but are not limited to: short interfering RNAs (siRNAs), doublestrand RNAs (dsRNA), micro RNAs (miRNAs), short hairpin RNAs (shRNA), meroduplexes, dicer substrates (U.S. Pat. Nos. 8,084,599 8,349,809 and 8,513,207), and RNA antisense oligonucleotides (RNA ASOs).

[0352] In one embodiment, a DNA molecule disclosed herein comprises a sequence comprising a sense strand of a IncRNA. In one embodiment, the DNA molecule or sequence disclosed herein comprises a sequence encoding an antisense strand of a IncRNA.

[0353] 1601851989.1 50 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0354] A DNA molecule disclosed herein may encode a regulatory nucleic acid substantially complementary, or fully complementary, to a fragment of an endogenous gene or gene product (e.g., mRNA). The regulatory nucleic acids may complement sequences at the boundary between introns and exons, in between exons, or adjacent to exon, to prevent the maturation of newly- generated nuclear RNA transcripts of specific genes into mRNA for transcription. The regulatory nucleic acids that are complementary to specific genes can hybridize with the mRNA for that gene and prevent its translation. The antisense regulatory nucleic acid can be DNA, RNA, or a derivative or hybrid thereof. In some embodiments, the regulatory nucleic acid comprises a protein-binding site that can bind to a protein that participates in regulation of expression of an endogenous gene or an exogenous gene.

[0355] The length of a DNA molecule disclosed herein that may encode a regulatory nucleic acid that hybridizes to a transcript of interest and may be, for instance, between about 5 to 30 nucleotides, between about 10 to 30 nucleotides, or about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30 or more nucleotides. The degree of identity of the regulatory nucleic acid to the targeted transcript should be at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%.

[0356] A DNA molecule disclosed herein may encode a micro-RNA (miRNA) molecule identical to about 5 to about 30 contiguous nucleotides of a target gene. In some embodiments, the miRNA sequence targets a mRNA and commences with the dinucleotide AA, comprises a GC-content of about 30-70% (about 30-60%, about 40-60%, or about 45%-55%), and does not have a high percentage identity to any nucleotide sequence other than the target in the genome of the mammal in which it is to be introduced, for example as determined by standard BLAST search. In some embodiments, the DNA molecule disclosed herein encodes at least one miRNA, e.g., 2, 3, 4, 5, 6, or more. In some embodiments, the DNA molecule disclosed herein comprises a sequence that encodes an miRNA having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% nucleotide sequence identity to any one of the nucleotide sequences or a sequence that is complementary to a target sequence. Lists of known miRNA sequences can be found in databases maintained by research organizations, such as Wellcome Trust Sanger Institute, Penn Center for Bioinformatics, Memorial Sloan Ketering

[0357] 1601851989.1 51 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0358] Cancer Center, and European Molecule Biology Laboratory, among others. Known effective siRNA sequences and cognate binding sites are also well represented in the relevant literature. RNAi molecules are readily designed by technologies known in the art. In addition, there are computational tools that increase the chance of finding effective and specific sequence motifs (see, e.g., Lagana et al., Methods Mol. Bio., 2015, 1269:393-412).

[0359] A DNA molecule disclosed herein may modulate expression of RNA encoded by a gene. Because multiple genes can share some degree of sequence homology with each other, in some embodiments, the DNA molecule disclosed herein can be designed to target a class of genes with sufficient sequence homology. In some embodiments, the DNA molecule disclosed herein can contain a sequence that has complementarity to sequences that are shared amongst different gene targets or are unique for a specific gene target. In some embodiments, the DNA molecule disclosed herein can be designed to target conserved regions of an RNA sequence having homology between several genes thereby targeting several genes in a gene family (e.g., different gene isoforms, splice variants, mutant genes, etc.). In some embodiments, the DNA molecule disclosed herein can be designed to target a sequence that is unique to a specific RNA sequence of a single gene.

[0360] In embodiments, the effector sequence encoding a regulatory RNA has a length less than 5000 bps (e.g., less than about 5000 bps, about 4000 bps, about 3000 bps, about 2000 bps, about 1000 bps, about 900 bps, about 800 bps, about 700 bps, about 600 bps, about 500 bps, about 400 bps, about 300 bps, about 200 bps, about 100 bps, about 50 bps, about 40 bps, about 30 bps, about 20 bps, about 10 bps, or less). In some embodiments, the effector sequence has, independently or in addition to, a length greater than 10 bps (e.g., at least about 10 bps, at least about 20 bps, at least about 30 bps, at least about 40 bps, at least about 50 bps, at least about 60 bps, at least about 70 bps, at least about 80 bps, at least about 90 bps, at least about 100 bps, at least about 200 bps, at least about 300 bps, at least about 400 bps, at least about 500 bps, at least about 600 bps, at least about 700 bps, at least about 800 bps, at least about 900 bps, at least about 1000 kb, at least about 1.1 kb, at least about 1.2 kb, at least about 1.3 kb, at least about 1.4 kb, at least about 1.5 kb, at least about 1.6 kb, at least about 1.7 kb, at least about 1.8 kb, at least about 1.9 kb, at least about 2 kb, at least about 2.1 kb, at least about 2.2 kb, at least about 2.3 kb, at least about 2.4 kb, at least about 2.5 kb, at least about 2.6 kb, at least about 2.7 kb, at least about 2.8 kb, at least about 2.9 kb, at least about 3 kb, at least about 3.1 kb, at least about 3.2 kb, at

[0361] 1601851989.1 52 Atorney Docket No.: F2128-7023WO(VL87022-W1) least about 3.3 kb, at least about 3.4 kb, at least about 3.5 kb, at least about 3.6 kb, at least about 3.7 kb, at least about 3.8 kb, at least about 3.9 kb, at least about 4 kb, at least about 4.1 kb, at least about 4.2 kb, at least about 4.3 kb, at least about 4.4 kb, at least about 4.5 kb, at least about 4.6 kb, at least about 4.7 kb, at least about 4.8 kb, at least about 4.9 kb, at least about 5 kb or greater).

[0362] In some embodiments, a DNA molecule disclosed herein comprises one or more of the features described herein, e.g., one or more structural DNA sequence, a sequence encoding one or more peptides or proteins, a sequence encoding one or more regulatory element, a sequence encoding one or more regulatory nucleic acids, e.g., one or more non-coding RNAs, other expression sequences, and any combination of the aforementioned. A construct described herein may have one or a plurality of effector sequences, e.g., 2, 3, 4, 5 or more effector sequences. In the case of a plurality of effector sequences in a single construct, the effector sequences may be the same or different.

[0363] In one embodiment, the DNA molecule includes a therapeutically functional, structural DNA sequence. In one embodiment, the DNA molecule includes a promoter and a sequence encoding a therapeutic peptide, polypeptide, or protein described herein. In one embodiment, the DNA molecule includes a promoter and a sequence encoding a regulatory RNA described herein.

[0364] In some embodiments, the effector sequence that encodes a polypeptide or protein is codon optimized, e.g., codon optimized for expression in a mammal, e.g., a human. In general, codon optimization means modifying a nucleic acid sequence for enhanced expression in the host cells of interest by replacing at least one codon (e.g., one or more, e.g., 1, 2, 3, 4, 5, 10, 15, 20, 25, 50, or more codons; e.g., at least 1%, at least 5%, at least 10%, at least 20%, at least 25%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100%) of the native sequence with codons that are more frequently or most frequently used in the genes of that host cell while maintaining the native amino acid sequence. Codon usage tables are available, for example, at the "Codon Usage Database" available at www.kazusa.or.jp / codon / . These tables can be adapted in a number of ways, see, e.g., Nakamura et al., 2000, Nucl. Acids Res. 28:292. Computer algorithms for codon optimizing a particular sequence for expression in a particular host cell are also available, such as Gene Forge.

[0365] 1601851989.1 53 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0366] Maintenance sequence

[0367] A DNA molecule disclosed herein may include a maintenance sequence that supports or enables sustained gene expression through successive rounds of cell division and / or progenitor differentiation in a host cell for a DNA described herein. In embodiments, a maintenance sequence is a nuclear scaffold / matrix attachment region (S / MAR). S / MAR elements are diverse, AT -rich sequences ranging from 60-500 bp that are conserved across species, thought to anchor chromatin to nuclear matrix proteins during interphase (Bode et al. 2003. Chromosome Res 11, 435-445). An S / MAR can be incorporated into a DNA molecule described herein to facilitate long-term transgene expression and extra-chromosomal maintenance. In one embodiment, the maintenance sequence is human interferon-beta MAR (5’tataattcactggaatttttttgtgtgtatggtatgacatatgggttcccttttatttttacatataaatatatttccctgtttttctaaaaaagaaaa agatcatcattttcccattgtaaaatgccatatttttttcataggtcacttacata-3’ (SEQ ID NO: 39)), or a functional sequence having at least 80%, at least 90%, at least 95%, or at least 98% identity thereto. In embodiments, S / MARs useful in the constructs described herein can be found by searching the MARome at www.bioinfo.net.in / MARome, described also by Narwade et al. 2019. Nucleic Acids Research. Volume 47, Issue 14: 7247-7261.

[0368] In embodiments, a DNA molecule described herein is capable of replicating in a mammalian cell, e.g., human cell. In some embodiments, a DNA molecule described herein is maintained in a host cell, tissue or subject through at least one cell division. For example, a DNA molecule described herein is maintained in a host cell, tissue or subject through at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 10, at least 15, at least 20, at least 40, at least 50 or more cell divisions. In vitro, cell division may be tracked by flow cytometry or microscopy. In vivo, cell division may be tracked by intravital microscopy.

[0369] Second strand motif

[0370] A ssDNA molecule disclosed herein may also include a second strand motif (SSM). An example of a SSM is derived from a virus or mobile genetic element. In some embodiments the SSM is an inverted repeat or hairpin sequence, e.g., an inverted terminal repeat (ITR) from a virus, e.g., from an AAV, or a conserved 8-nucleotide hairpin in the anellovirus origin of replication. Examples of SSM’s are listed below in Table 2:

[0371] 1601851989.1 54 Attorney Docket No.: F2128-7023WO(VL87022-W1)

[0372] Table 2: Exemplary second strand motifs

[0373] In some embodiments, an SSM is a short sequence of RNA or DNA that is complementary to a region of the ssDNA, e.g., an RNA primer or a DNA primer. In some embodiments, the primer is a splint sequence connecting ends of a ssDNA described herein. In some embodiments the RNA or DNA primer is less than 100, less than 75, less than 50, less than 40, less than 30, less than 25, less than 20, less than 15, less than 10, or less than 5 nucleotides. In some embodiments the RNA or DNA primer is between 5-100 nucleotides, between 10-100 nucleotides, between 20-80 nucleotides, or between 20-60 nucleotides.

[0374] Other elements

[0375] A DNA molecule disclosed herein may also include other control elements operably linked to the effector sequence, e g., the sequence encoding an effector, in a manner which permits its transport, localization, transcription, translation and / or expression in a target cell, or which promotes its degradation or repression of expression in a non-target cell. As used herein, "operably linked" sequences include both expression control sequences that are contiguous with the sequence encoding the effector and expression control sequences that act in trans or at a distance to control the sequence encoding the effector. The precise nature of regulatory

[0376] 1601851989.1 55 Atorney Docket No.: F2128-7023WO(VL87022-W1) sequences needed for gene expression in host cells may vary between species, tissues or cell types, but in general may include, as necessary, 5' non-transcribed and 5' non-translated sequences involved with the initiation of transcription and translation respectively, such as a TATA box, capping sequence, CAAT sequence, enhancer elements and the like. Regulatory sequences may also include enhancer sequences or upstream activator sequences as desired. The constructs described herein may optionally include 5' leader or signal sequences. In some embodiments, the DNA molecule may comprise a sequence encoding a 5’ untranslated region and / or a sequence encoding a 3’ untranslated region.

[0377] The DNA molecule may comprise a non-coding region. In some embodiments, the noncoding region is completely free of predicted ORFs. In some embodiments, the non-coding region does not encode a protein sequence. In some embodiments, the non-coding region is not translated or is not translated at a substantial level.

[0378] In some embodiments, the DNA molecule comprises one or both of a maintenance sequence and a second strand motif (SSM).

[0379] Click handles, click linkers, and click reactions

[0380] In some embodiments, click chemistry is used to link a first moiety, e.g., a first strand of a DNA molecule as described herein, to a second moiety, e.g., a second strand of a DNA molecule as described herein. For example, in some embodiments, the first strand of the DNA molecule described herein is linked to a second strand of the DNA molecule as described herein through a covalent bond. In some embodiments, the first strand of a DNA molecule as described herein is linked to a second strand of the DNA molecule as described herein, e.g., via a click linker. In some embodiments, the click linker is formed as a product of a click reaction between a first click handle and a second click handle. A variety of reactions that fulfill the criteria for click chemistry are known, a wide range of commercially available reagents for click chemistry can be used, and one skilled in the art could use (for example) any one of a number of published methodologies (see, e.g., www.pubs.acs.org / doi / 10.1021 / acs.chemrev.lc00469 or www.ncbi.nlm.nih.gov / pmc / rticles / PMC2562613 / , which are herein incorporated by reference in their entirety). In some embodiments, conjugation is performed using click chemistry.

[0381] 1601851989.1 56 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0382] In some embodiments, a linker comprises a spacer domain, wherein optionally the spacer domain comprises a PEG moiety.

[0383] Click handles

[0384] For example, in some embodiments, a first click handle is affixed to a DNA molecule.

[0385] For example, the first click handle may be covalently bound (e.g., directly bound) to a nucleotide of the first strand of a DNA molecule as described herein. In some embodiments, a second click handle is bound to a second strand of a DNA molecule as described herein. For example, the second click handle may be covalently bound (e.g., directly bound) to the 5’ most nucleotide of the second strand of the DNA molecule, or within 1, 2, 3, 4, or 5 nucleotides of the 5’ end of the second strand. In some embodiments, the click handle is situated at least 5, at least 10, or at least 15 nucleotides away from the 3’ end of the second strand. The first strand of the DNA molecule comprising the first click handle may be contacted with the second strand of the DNA molecule comprising the second click handle under conditions that allow the first click handle to react with the second click handle in a click reaction.

[0386] In some embodiments, the first click handle is incorporated into the first strand of the DNA molecule by using PCR to produce the DNA molecule or a fragment thereof, wherein a nucleotide in a primer of the PCR reaction comprises a click handle. In some embodiments, the second click handle is incorporated into the second strand of the DNA molecule by DNA synthesis techniques.

[0387] A variety of molecules that comprise a click handle can be used. For instance, in some embodiments, the molecule is chosen from:

[0388] 1601851989.1 57 Attorney Docket No.: F2128-7023WO(VL87022-W1)

[0389] SCO-Lysine, e.g., for use in a strain-promoted alkyne-azide cycloaddition (SPAAC) reaction or a strain-promoted inverse-electron-demand Diels-Alder cycloaddition (SPIED AC) reaction;

[0390] Cyclopropene lysine, e.g., for use in a SPIED AC reaction;

[0391] Exo-BCN-Lysine, e.g., for use in a SPAAC or SPIED AC reaction;

[0392] 1601851989.1 58 Attorney Docket No.: F2128-7023WO(VL87022-WI)

[0393] NBO-Lysine, e.g., for use in a SPIED AC reaction; rac-BCN-Lysine, e.g., for use in a SPAAC or SPIED AC reaction;

[0394] TCO-Lysine, e.g., for use in a SPIED AC reaction;

[0395] 1601851989.1 59 Attorney Docket No.: F2128-7023WO(VL87022-W1)

[0396] Endo-BCN-Lysine, e.g., for use in a SPAAC or SPIEDAC reaction PrK-HCl-salt;

[0397] N3 -Lysine, e.g., for use in a SPAAC or SPIEDAC reaction;

[0398] 1601851989.1 60 Attorney Docket No.: F2128-7023WO(VL87022-W1) p-acetylphenyl alanine, e.g., for use with a site-specific oxime ligation (e g., mediated by DBCO- amine), followed by SPAAC; seleno-cysteine, e.g., for reaction with maleimide; or methyltetrazine-PEG3-maleimide, e.g., for use in SPIEDAC or reaction with thiol;

[0399] BCN-PEG3-oxyamine, e.g., for use in SPAAC or SPIEDAC reaction or an oxime ligation.

[0400] 1601851989.1 61 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0401] A click handle may comprise an azide or an alkyne. In some embodiments, a first strand of a DNA molecule described herein is linked to a first click handle that reacts specifically with a second click handle linked to a second strand of the DNA molecule, thereby producing a click linker between the strands of the DNA molecule. In some embodiments, the first click handle comprises an azide moiety, and the second click handle comprises an alkyne moiety. In some embodiments, the first click handle comprises an alkyne moiety, and the second click handle comprises an azide moiety.

[0402] In some embodiments, the click handle comprises an alkyne moiety. In some embodiments, the alkyne moiety comprises a propargyl moiety or a cyclooctynyl moiety. Exemplary alkyne moieties include diarylcyclooctyne (DBCO)-sulfo-NHS-ester, diarylcyclooctyne (DBCO)-PEG-NHS-ester, diarylcyclooctyne (DBCO)-C6-NHS-ester, di aryl cyclooctyne (DBCO)-NHS-ester, di aryl cyclooctyne (DBCO)-amine, di aryl cyclooctyne (DBCO)-acid, sulfo diarylcyclooctyne (DBCO)-maleimide, diarylcyclooctyne (DBCO)- maleimide, bis-sulfone-PEG-diarylcyclooctyne (DBCO), propargyl-NHS ester, propargyl- maleimide, alkyne-PEG-NHS ester, alkyne-PEG-maleimide, or a derivative thereof. In some embodiments, the alkyne moiety comprises DBCO provided as a dibenzocyclooctyne-acid (CAS 1353016-70-2).

[0403] In some embodiments, the click handle comprises an azide moiety. In some embodiments, the azide moiety comprises an azidoalkyl moiety, azidoaryl moiety, or an azidoheteroaryl moiety. Exemplary azide moieties include 3 -azidopropionic acid sulfo-NHS ester, azidoacetic acid NHS ester, azido-PEG-NHS ester, azidopropylamine, azido-PEG-amine, azido-PEG-maleimide, bis-sulfone-PEG-azide, or a derivative thereof.

[0404] Click handles may also comprise an alkene moiety, e.g., a transcycloalkene moiety, an oxanorb ornadiene moiety, or a tetrazine moiety. Additional click handles can be found in Click Chemistry Tools (www.clickchemistrytools.com / ), Lahann, J (ed) (2009) Click Chemistry for Biotechnology and Materials Science, McKay et al, “Click chemistry in complex mixtures: bioorthogonal bioconjugation” Chem Biol. 2014 Sep 18;21(9): 1075-101, Becer et al. “Click chemistry beyond metal-catalyzed cycloaddition” Angew Chem Int Ed Engl. 2009;48(27):4900-

[0405] 1601851989.1 62 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0406] 8., and Hein et al. “Click chemistry, a powerful tool for pharmaceutical sciences” Pharm Res. 2008 Oct;25(10):2216-30, each of which is incorporated herein by reference in its entirety.

[0407] In embodiments, the click handle comprises a tetrazine moiety, e.g., for reaction with an alkene moiety. For instance, in embodiments, the tetrazine is a 1,2, 4, 5 tetrazine and the alkene is a strained alkene. In embodiments, the alkene moiety comprises a trans-cyclooctene, (E)- Cyclooct-4-enol, (E)-Cyclooct-4-enyl 2,5-dioxo-l-pyrrolidinyl carbonate, 5-Norbornene-2-acetic acid succinimidyl ester, 5-Norbornene-2-endo-acetic acid, TCO PEG4 succinimidyl ester, TCO- amine, or TCO-PEG3-maleimide. In embodiments, the tetrazine click handle comprises (4- (l,2,4,5-Tetrazin-3-yl)phenyl)methanamine or 2,5-Dioxo-l-pyrrolidinyl 5-[4-(l,2,4,5-tetrazin-3- yl)benzylamino]-5-oxopentanoate, 5-[4-(l,2,4,5-Tetrazin-3-yl)benzylamino]-5-oxopentanoic acid. In embodiments, the tetrazine and alkene react in a Diels- Alder cycloaddition to yield a stable covalent linkage. In embodiments, a catalyst is not needed. In embodiments, the only byproduct is dinitrogen. In embodiments, the reaction at least one order of magnitude faster than azide-cyclooctyne based click chemistry. Without wishing to be bound by theory, tetrazine / alkene reactions can be used with low concentrations of reactant.

[0408] In some embodiments, the click handles react via an azide-alkyne Huisgen cycloaddition. In some embodiments, an azide-alkyne Huisgen cycloaddition comprises a copper(I)-catalyzed azide-alkyne cycloaddition or a strain-promoted azide-alkyne cycloaddition.

[0409] In some embodiments, the click handles react to form a heteroaryl, e.g., a triazole. In some embodiments, the triazole comprises a 1,2,3-triazole, e.g., a 1,4-di substituted 1,2,3-triazole or a 1,5 -di substituted 1,2,3-triazole.

[0410] In some embodiments, the click handle comprises an alkyne and reacts with an amine. In some embodiments, the click handle comprises a cyclooctyne and reacts with an amine. In some embodiments, the click handle comprises di aryl cyclooctyne (DBCO)-sulfo-NHS-ester or diarylcyclooctyne (DBCO)-PEG5-NHS-ester.

[0411] In some embodiments, the click handle comprises an azide and reacts with an amine. In some embodiments, the click handle is 3-azidopropionic acid sulfo-NHS ester or azido-PEG4- NHS-ester.

[0412] In an embodiment, the click handle is water soluble. In an embodiment, the click handle is membrane impermeable, e.g., has sufficient charge to render it membrane impermeable. In an embodiment the click handle is charged, e.g., positively charged or negatively charged. In an

[0413] 1601851989.1 63 Atorney Docket No.: F2128-7023WO(VL87022-W1) embodiment, the click handle comprises a cationic moiety or an anionic moiety, e.g., a SO3 moiety.

[0414] In some embodiments, the click handle comprises a detection agent, e.g., useful for detection of the DNA molecule. Exemplary detection agents may include a fluorescent molecule (e.g., a cyanine dye, e.g., Cy3, Cy 3.5, Cy5, Cy5.5, Cy7, or Cy7.5), a metal chelate, a contrast agent, a radionuclide, a positron emission tomography (PET) imaging agent, an infrared imaging agent, a near-IR imaging agent, a computer assisted tomography (CAT) imaging agent, a photon emission computerized tomography imaging agent (e.g., DIBO-DFO, where DFO chelates Zirconium-89), an X-ray imaging agent, or a magnetic resonance imaging (MRI) agent.

[0415] Suitable click handles may comprise, for example, an amine, sulfate, thiol, hydroxyl, azide, alkyne, alkene, carboxyl groups aldehyde groups, sulfone groups, vinylsulfone groups, isocyanate groups, acid anhydride groups, epoxide groups, aziridine groups, episulfide groups, groups such as -CO2N(COCH2)2, -CO2N(COCH2)2, -CO2H, -CHO, -CHOCH2, - N.dbd.C.dbd.O, —SO2CH.dbd.CH2, — N(COCH)2, — S— S-(CsH4N) and groups of the following structures wherein X is halogen and R is hydrogen or Ci to C4 alkyl:

[0416] In an embodiment, a coupling reagent or click handle a GMP grade material.

[0417] Click linkers

[0418] Linkage of the two substrates (e.g., the first DNA strand and second DNA strand) typically results in a residual linker between the first and second substrate. For example, in the case of click handles comprising an azide and an alkyne, a click linker may be formed comprising a triazole (e.g., a 1,2,3-triazole).

[0419] In some embodiments, the linker is situated between the second strand and a nucleotide of a sequence on the first DNA strand that comprises a promoter, a maintenance sequence, or an origin of replication. In some embodiments, the linker is situated between the second strand and a nucleotide of a sequence on the first DNA strand that is outside of the effector sequence that

[0420] 1601851989.1 64 Atorney Docket No.: F2128-7023WO(VL87022-W1) encodes an effector. In some embodiments, the linker is situated between the second strand and a nucleotide of a sequence on the first DNA strand of the promoter. In some embodiments, the linker is situated between the second strand and a nucleotide of a sequence on the first DNA strand that is outside of the promoter. In some embodiments, the linker is situated between the second strand and a nucleotide of a sequence on the first DNA strand of the maintenance sequence. In some embodiments, the linker is situated between the second strand and a nucleotide of a sequence on the first DNA strand that is outside of the maintenance sequence. In some embodiments, the linker is situated between the second strand and a nucleotide of a sequence on the first DNA strand of the origin of replication. In some embodiments, the linker is situated between the second strand and a nucleotide of a sequence on the first DNA strand that is outside of the origin of replication. In some embodiments, the linker is situated between the second strand and a nucleotide of a sequence on the first DNA strand of a single stranded region of the DNA molecule. In some embodiments, the linker is situated between the second strand and a nucleotide of a sequence on the first DNA strand of a double stranded region of the DNA molecule. In some embodiments, the linker is situated between the second strand and a nucleotide of a sequence on the first DNA strand of a region encoding a 5’ UTR. In some embodiments, the linker is situated between the second strand and a nucleotide of a sequence on the first DNA strand of a region encoding a 3’ UTR. In some embodiments, the linker is situated between the second strand and a nucleotide of a sequence on the first DNA strand of a polyA site.

[0421] Exemplary click linkers suitable for use in the composition and methods described herein include, for example

[0422] 1601851989.1 65 Attorney Docket No.: F2128-7023WO(VL87022-W1) wherein R is H, a hydrocarbon or heteroatom which may be further optionally substituted, and A is a C3-C12 cycloalkane, cycloalkene, cycloalkyne, or a heterocycle, all of which may be further optionally substituted; wherein R is H, a hydrocarbon or heteroatom which may be further optionally substituted, and A is a C3-C12 cycloalkane, cycloalkene, cycloalkyne, or a heterocycle, all of which may be further optionally substituted;

[0423] 1601851989.1 66 Attorney Docket No.: F2128-7023WO(VL87022-W1) wherein A is a C3-C20 cycloalkene, cycloalkyne, or a heterocycle, all of which may be further optionally substituted; wherein R is a hydrocarbon which is further optionally substituted.

[0424] In an embodiment, the click linker is an alkyne / azide click linker (e.g., wherein the alkyne is a cyclooctyne, activated alkyne, or electron-deficient alkyne), e.g., the click linker comprises a triazole, e.g., a 1,2, 3 -triazole and / or a disubstituted triazole. In an embodiment, the click linker is a diene / dienophile click linker (e.g., wherein the dienophile comprises an alkene moiety), e g., the click linker comprises a cycloalkene, e.g., a disubstituted alkene. In embodiments, the click linker is a tetrazine / alkene click linker, e.g., the click linker comprises a dihydropyrazine, e.g., a 1,2-dihydropyrazine. In embodiments, the click linker is a tetrazole / alkene click linker, e.g., the click linker comprises a diazole. In embodiments, the click linker is a dithioester / diene click linker, e.g., the click linker comprises a sulfur-containing ring, e.g., a tetrahdrothiophene, e.g., a disubstituted tetrahdrothiophene. In embodiments, the click linker is a dithioester / diene linker, e.g., the click linker comprises a sulfur-containing ring, e.g., a

[0425] 1601851989.1 67 Atorney Docket No.: F2128-7023WO(VL87022-W1) thiopyran. Tn embodiments, the click linker is a thiol / alkene click linker, e.g., the click linker comprises an alkyl sulfide.

[0426] Click reactions

[0427] In some embodiments, a method described herein comprises a step of performing a click reaction. In some embodiments, a DNA molecule described herein is produced using a click reaction.

[0428] In some embodiments, the click reaction is a cycloaddition (e.g., a 1,3-dipolar cycloaddition or hetero-Di els- Alder cycloaddition), nucleophilic ring-opening (e.g., openings of strained heterocyclic electrophiles such as aziridines, epoxides, cyclic sulfates, aziridinium ions, and episulfonium ions), carbonyl chemistry of no-aldol type (e.g., formation of ureas, thioureas, hydrazones, oxime ethers, amides, or aromatic heterocycles), or an addition to a carbon-carbon multiple bond (e.g., epoxidation, aziridination, dihydroxylation, sulfenyl halide addition, nitosyl halide addition, or Michael addition). Examples of these types of click reaction are described in greater detail in Hein et al., Pharm. Res. 2008 October; 25(10):2216-2230, which is herein incorporated by reference in its entirety. In embodiments, the click reaction is a metal-free [3+2] cycloaddition reaction, Diels-Alder reaction, or thiol-alkene radical reaction. Examples of these types of click reaction are described in greater detail in Becer et al., Angew. Chem. Int. Ed. 2009, 48, 4900-4908, which is herein incorporated by reference in its entirety.

[0429] In embodiments, the click reaction does not require a catalyst. In embodiments, the click reaction does not require copper ions, e.g., proceeds at substantially the same rate in the absence of copper ions as in the presence of copper ions, e.g., under conditions described in Tornoe, C. W. et al (2002). "Peptidotriazoles on Solid Phase: [1,2,3]-Triazoles by Regiospecific Copper(I)- Catalyzed 1,3-Dipolar Cycloadditions of Terminal Alkynes to Azides". In embodiments, the click reaction proceeds efficiently at a temperature of about 10-40, about 20-40, about 20-30, about 20-25, about 30-40, or about 35-40, or about 37 °C. In embodiments, the click reaction proceeds efficiently at a temperature of below 50, 45, 40, 35, 30, 25, or 20 °C.

[0430] In embodiments, the activation barrier for a click reaction is 24-30, 25-29, or 26-28 kcal / mol, e.g., about 27.8 kcal / mol or 26 kcal / mol. In embodiments, the activation barrier for a click reaction is the same as or no less than 50%, 40%, 30%, 20%, or 10%, different from the activation barrier of a Huisgen Cu-catalyzed cycloaddition reaction between an azide and a

[0431] 1601851989.1 68 Atorney Docket No.: F2128-7023WO(VL87022-W1) terminal alkene, e.g., as described in Hein et al. Click chemistry, a powerful tool for pharmaceutical sciences” Pharm Res. 2008 Oct;25(10):2216-30.

[0432] In embodiments, the click reaction is exergonic, e.g., having a AG° of between -10 and - 100, -20 and -90, -30 and -70, -40 and -70, -50 and -60, or about -61 kcal / mol. In embodiments, the AG° for a click reaction is the same as or no less than 50%, 40%, 30%, 20%, or 10%, different from the AG° of a Huisgen Cu-catalyzed cycloaddition reaction between an azide and a terminal alkene.

[0433] In embodiments, the click reaction has a AG° of between -30 and -140, -40 and -130, -50 and -120, -60 and -110, -70 and -100, -80 and -90, or about 84 kJ / mol.

[0434] One example of a cycloaddition reaction is the Huisgen 1,3-dipolar cycloaddition of a dipolarophile with a 1,3 dipolar component that produce five membered (hetero)cycles. Examples of dipolarophiles are alkenes, alkynes, and molecules that possess related heteroatom functional groups, such as carbonyls and nitriles. Specifically, another example is the 2+3 cycloaddition of alkyl azides and acetylenes. Other cycloaddition reactions include Diels-Alder reactions of a conjugated diene and a dienophile (such as an alkyne or alkene). Examples of cycloaddition reactions are described, e.g., in US Pat. 9,517,291, which is herein incorporated by reference in its entirety.

[0435] Other examples of click reactions include a hydrosilation reaction of H— Si and simple non-activated vinyl compounds, urethane formation from alcohols and isocyanates, Menshutkin reactions of tertiary amines with alkyl iodides or alkyl trifluoromethanesulfonates, Michael additions, e.g., the very efficient maleimide-thiol reaction, atom transfer radical addition reactions between — SO2CI and an olefin (R1, R2— C=C — R3, R4), metathesis, Staudinger reaction of phosphines with alkyl azides, oxidative coupling of thiols, nucleophilic substitution, especially of small strained rings like epoxy and aziridine compounds, carbonyl chemistry like formation of ureas, and addition reactions to carbon-carbon double bonds like dihydroxylation. Therefore, attached functionality may be chosen from acetylene bond, an azido-group, a nitrile group, acetylenic, amino group, phosphino group. The click chemistry reaction may result in the addition of a functional group selected from amino, primary amino, hydroxyl, sulfonate, benzotriazole, bromide, chloride, chloroformate, trimethylsilane, phosphonium bromide or bio- responsive functional group including polypeptides, proteins and nucleic acids.

[0436] 1601851989.1 69 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0437] In some embodiments, a click reaction forms very energy-efficient carbon-heteroatom bonds, in particular a ring opening nucleophilic reaction or a cycloaddition reaction. A type of reaction which is widely represented in click chemistry is the abovementioned alkyne-azide cycloaddition catalyzed with Cu(I). Examples of click reactions are also described, e.g., in US Pat. 9,453,843, which is herein incorporated by reference in its entirety.

[0438] Click chemistry may generate substances quickly and reliably by joining small modular units together (see, e.g., Kolb et al. (2001) Angewandte Chemie Inti. Ed. 40:2004-2011; Evans (2007) Australian J. Chem. 60:384-395; Carlmark et al. (2009) Chem. Soc. Rev. 38:352-362; each herein incorporated by reference in its entirety).

[0439] Chemically modified nucleotides

[0440] The DNA molecules described herein may have chemical modifications of the nucleobases, sugars, and / or the phosphate backbone. While not wishing to be bound by theory, such modifications can be useful for protecting a DNA from degradation (e.g., from exonucleases) or from the immune system of a host tissue or subject. In general, a chemically modified nucleotide has the same base-pairing specificity as the unmodified nucleotide, e.g., a chemically modified adenine “A” can base-pair with thymine “T”. One or more atoms of a pyrimidine nucleobase may be replaced or substituted with optionally substituted amino, optionally substituted thiol, optionally substituted alkyl (e.g., methyl or ethyl), or halo (e.g., chloro or fluoro). In certain embodiments, chemical modifications (e.g., one or more modifications) are present in each of the sugar and the internucleoside linkage.

[0441] Examples of chemical modifications to DNA useful in the methods described herein include, e.g., N6-Methyladenosine (m6A, 6mA); 5-formylcytosine (5-formyl-2’-deoxycytosine, 5fC, f5C); 5-carboxylcytosine (5-carboxyl-2’-deoxycytosine, 5-carboxycytosine, ca5C, 5caC); 5- hydroxymethylcytosine (5-hydroxymethyl-2’-deoxycytosine, 5hmC, hm5C); 5- methyldeoxy cytosine (5-methylcytosine; 5-methyl-2’-deoxy cytosine; m5dC; 5mC, m5C); 5’- methylcytosine; 3 -methyl cytosine (m3C); 2'-fluoro-2'deoxynucleoside; 5- glucosylmethylcytosine; 5-methyl pyrimidine; 8-oxoguanine (8-oxoG); phosphorothioate; S and R phsophorothioate linkages; methylthymine; N3’-P5’ Phosphoroamidate (NP); cyclohexane nucleic acid (CeNA); tricyclo-DNA (tcDNA). See, e.g., Pu et al. 2020. An in-vitro DNA phosphorothioate modification reaction. Mol Microbiol. 113: 452 463; Zheng & Sheng. 2021.

[0442] 1601851989.1 70 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0443] Synthesis of N4-methylcytidine (m4C) and N4,N4-dimethylcytidine (m42C) modified RNA. Current Protocols, 1, e248; Ohkubo et al. 2021. Chemical synthesis of modified oligonucleotides containing 5'-amino-5'-deoxy-5’-hydroxymethylthymidine residues. Current Protocols, 1, e70; Bao & Xu. 2021. Observation ofZ-DNA structure via the synthesis of oligonucleotide DNA containing 8-trifluoromethyl-2-deoxyguanosine. Current Protocols, 1, e28; Skakujet al. 2020. Automated synthesis and purification of guanidine-backbone oligonucleotides. Current Protocols in Nucleic Acid Chemistry, 81, el 10.

[0444] In some embodiments, a DNA molecule described herein comprises a nucleotide comprising a chemically modified cytosine nucleobase.

[0445] In some embodiments, a DNA molecule comprises a sense strand and an antisense strand, wherein the antisense strand comprises one or more chemically modified nucleotides. In some embodiments, a DNA molecule comprises a sense strand and an antisense strand, wherein the sense strand does not comprise any chemically modified nucleotides. In some embodiments, a DNA molecule comprises a sense strand and an antisense strand, wherein the sense strand comprises one or more chemically modified nucleotides.

[0446] In some embodiments, a DNA molecule as described herein may comprise a phosphorothioate-modified nucleotide. In some embodiments, the DNA molecule described herein may include S and R phosphorothioate modified nucleotide linkages. In one embodiment, the phosphorothioate linkages are made according to Iwamoto et al, 2017, Nature Biotechnology, Volume 35:845-851. Briefly, monomers of nucleoside 3’-oxazaphospholidine derivates undergo stereocontrolled oligonucleotide synthesis with iterative capping and sulfurization to create stereocontrolled phosphorothioate linkages. The final sample is analyzed by reverse-phase high- performance liquid chromatography (RP-HPLC) and Ultraperformance liquid chromatography mass spectrometry (UPLC / MS) to determine stereochemistry of the modification. Nucleic acids containing phosphorothioate linkages are also commercially available.

[0447] In some embodiments, a DNA molecule described herein may include boranophosphate modified nucleotides, e.g., following the methods in Sergueev and Shaw, 1998, J Am Chem Soc, Volume 120, Issue 37:9417-9427. Briefly, H-phosphonate chain elongation is followed by boronation to substitute a borano group for a nonbridging oxygen in the phosphate backbone. The final sample is purified and analyzed by RP-HPLC to determine stereochemistry of the modification. Boranophosphate modified nucleotides are also commercially available.

[0448] 1601851989.1 71 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0449] In some embodiments, a DNA molecule described herein may include 5-methylcytosine modified nucleotides, e.g., made following the methods in Lin et al, 2002, Mol Cell Biol, Volume 22, Issue 3:704-723. Briefly, cytosine or the sequence containing cytosine is incubated with glutathione S-transferase fusion of wild-type Dnmt3a (GST-3 a) protein using unlabeled S- adenosylmethionine (AdoMet). The nucleotides are purified and analyzed by HPLC to determine that the nucleotides are methylated at the correct position. 5-methylcytosine modified nucleotides are also available commercially.

[0450] In some embodiments, a DNA molecule described herein may include 7-methylguanine modified nucleotides. In one embodiment, 7-methylguanine modified nucleotides are made following the methods in Jones and Robins, 1963, Purine nucleosides. III. Methylation studies of certain naturally occurring purine nucleosides, J Am Chem Soc, Volume 85: 193. Briefly, 2’- deoxyguanosine in dimethyl sulfoxide is treated with methyl iodide. The nucleotides are purified and analyzed by HPLC to determine that the nucleotides are methylated at the correct position. In another embodiment, 7-methylguanine modified nucleotides are made according to the methods described in Hendler et al, 1970, Volume 9, Issue 21:4141 :4153, and Kore and Parmar, 2006, Biochemistry, Volume 25, Issue 3:337-340. Briefly, instead of guanosine 5 ’ -diphosphate, guanine 5 ’-diphosphate in water is added to dimethyl sulfate to yield 7-methyl GDP. The nucleotides are purified and analyzed by HPLC to determine that the nucleotides are methylated at the correct position. 7-methylguanine modified nucleotides are also available commercially.

[0451] In some embodiments, a DNA molecule described herein comprises methylation at one or more CpG or GpC dinucleotide. In some embodiments, a DNA molecule described herein comprises a methylation introduced by an Alul methyltransferase. In some embodiments, a DNA molecule described herein comprises a methylation introduced by a BamHI methyltransferase. In some embodiments, a DNA molecule described herein comprises a methylation introduced by a CpG methyltransferase (M.Sssl). In some embodiments, a DNA molecule described herein comprises a methylation introduced by a dam methyltransferase. In some embodiments, a DNA molecule described herein comprises a methylation introduced by an EcoGII methyltransferase. In some embodiments, a DNA molecule described herein comprises a methylation introduced by an EcoRI methyltransferase. In some embodiments, a DNA molecule described herein comprises a methylation introduced by a GpC methyltransferase (M.CviPI). In some embodiments, a DNA molecule described herein comprises a methylation introduced by an

[0452] 1601851989.1 72 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0453] Haelll methyltransferase. In some embodiments, a DNA molecule described herein comprises a methylation introduced by an Hhal methyltransferase. In some embodiments, a DNA molecule described herein comprises a methylation introduced by an Hpall methyltransferase. In some embodiments, a DNA molecule described herein comprises a methylation introduced by a MspI methyltransferase. In some embodiments, a DNA molecule described herein comprises a methylation introduced by a TaqI methyltransferase. In some embodiments, a method described herein comprises contacting a dsDNA with an Alul methyltransferase, a BamHI methyltransferase, M.Sssl, a dam methyltransferase, an EcoGII methyltransferase, an EcoRI methyltransferase, M.CviPI, an Haelll methyltransferase, an Hhal methyltransferase, an Hpall methyltransferase, a MspI methyltransferase, or a TaqI methyltransferase.

[0454] In some embodiments, a DNA molecule described herein comprises a carboxyl modification or a formyl modification.

[0455] In embodiments, a DNA molecule described herein, or one strand (e.g., the sense strand or the antisense strand) of the DNA molecule, comprises between 1-100% chemically modified nucleotides, between l%-90% chemically modified nucleotides, between 1 %-80% chemically modified nucleotides, between 1 %-70% chemically modified nucleotides, between 1 %-60% chemically modified nucleotides, between l%-50% chemically modified nucleotides, between l%-40% chemically modified nucleotides, between 1 %-30% chemically modified nucleotides, between l%-20% chemically modified nucleotides, between 1%-15% chemically modified nucleotides, between 1%-10% chemically modified nucleotides, between 20%-90% chemically modified nucleotides, between 20%-80% chemically modified nucleotides. In embodiments, a DNA molecule described herein, or one strand (e.g., the sense strand or the antisense strand) of the DNA molecule, comprises at least 1% chemically modified nucleotides, at least 5% chemically modified nucleotides; at least 10% chemically modified nucleotides; at least 15% chemically modified nucleotides; at least 20% chemically modified nucleotides; at least 25% chemically modified nucleotides; at least 30% chemically modified nucleotides; at least 40% chemically modified nucleotides; at least 50% chemically modified nucleotides; at least 60% chemically modified nucleotides; at least 70% chemically modified nucleotides; at least 80% chemically modified nucleotides; at least 85% chemically modified nucleotides; at least 90% chemically modified nucleotides; at least 92% chemically modified nucleotides; at least 95% chemically modified nucleotides; or at least 97% chemically modified nucleotides. In

[0456] 1601851989.1 73 Atorney Docket No.: F2128-7023WO(VL87022-W1) embodiments, a DNA molecule described herein, or one strand (e.g., the sense strand or the antisense strand) of the DNA molecule, comprises chemically modified nucleotides at between 0%-100% of each distinct nucleotide, e.g., 0%-100% chemically modified T nucleotides, 0%- 100% chemically modified A nucleotides, 0%-100% chemically modified C nucleotides, and 0%-100% chemically modified G nucleotides for each construct. In embodiments, a DNA molecule described herein, or one strand (e.g., the sense strand or the antisense strand) of the double-stranded DNA molecule, comprises chemically modified nucleotides at between 0-100%, 10%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 10%-50% of each distinct nucleotide, e.g., between 0-100%, 10%-l 00%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 10%-50% of chemically modified T nucleotides; between 0-100%, 10%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 10%-50% of chemically modified A nucleotides; between 0-100%, 10%-100%, 20%-100%, 30%-100%, 40%- 100%, 50%-100%, 60%-100%, 10%-50% of chemically modified C nucleotides; or between 0- 100%, 10%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 10%-50% of chemically modified G nucleotides. For example, a DNA molecule could contain 100% chemically modified T nucleotides, 50% chemically modified A nucleotides, 0% chemically modified C nucleotides, and 25% chemically modified G nucleotides.

[0457] In embodiments, chemically modified nucleotides, e.g., modifications described herein, can be introduced in the DNA molecules described herein throughout the entire sequence; within an element of a sequence, e.g., an element described herein; at a 5'- or 3'- end; and / or between the last 10, 8, 6, 5, 4, 3, or 2 nucleotides at the 5’- or 3’- end.

[0458] In some embodiments, a double-stranded DNA region as described herein comprises chemically modified nucleotides on only one strand. In some embodiments, a double-stranded DNA region as described herein comprises chemically modified nucleotides on the antisense strand. In some embodiments, a double-stranded DNA molecule as described herein comprises chemically modified nucleotides on the sense strand.

[0459] In some embodiments, a double-stranded DNA region as described herein comprises chemically modified nucleotides on both strands. In certain embodiments, both strands comprise chemical modifications at the same positions (e.g., chemically modified nucleotides on one strand are base-paired with chemically modified nucleotides on the opposite strand, and / or non- chemically modified nucleotides on one strand are base-paired with non-chemically modified

[0460] 1601851989.1 74 Atorney Docket No.: F2128-7023WO(VL87022-W1) nucleotides on the opposite strand). In embodiments, the entirety of both strands are composed of chemically modified nucleotides. In other embodiments, the two strands of a double-stranded DNA region as described herein comprise different chemical modification patterns (e.g., one or more chemically modified nucleotides on one strand are base-paired with non-chemically modified nucleotides on the other strand). In embodiments, a double-stranded DNA region as described herein comprises one or more double-stranded regions in which both strands are chemically modified, and / or one or more double-stranded regions in which neither strand is chemically modified. In embodiments, a double-stranded DNA region as described herein comprises one or more double-stranded regions in which one strand is chemically modified and the other is not.

[0461] In embodiments, a double-stranded DNA region described herein has one or more chemical modification that disrupts the ability of a portion of the double-stranded DNA region to form a double stranded structure, e g., a double-stranded DNA region described herein has one or more chemical modification on a nucleotide present in a region having intramolecular complementarity. In embodiments, a double-stranded DNA region described herein has one or more chemical modification that disrupts base pairing of regions of intramolecular complementarity relative to the unmodified sequence of the double-stranded DNA region. In some embodiments the chemically modified nucleotides used herein have a reduced propensity to base-pair with chemically modified nucleotides compared to the propensity of unmodified nucleotides to base pair with unmodified nucleotides. In some embodiments the chemically modified nucleotides used herein have an increased propensity to base-pair with unmodified nucleotides compared to modified nucleotides.

[0462] In some embodiments, a chemically modified DNA molecule described herein exhibits decreased recognition by DNA sensors in a host tissue or subject compared to an unmodified DNA molecule of the same sequence, e.g., at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or more decreased recognition by DNA sensors in a host tissue or subject compared to an unmodified DNA molecule of the same sequence. In some embodiments, a chemically modified DNA molecule described herein exhibits decreased degradation by DNA nucleases compared to an unmodified DNA molecule of the same sequence, e.g., at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or

[0463] 1601851989.1 75 Atorney Docket No.: F2128-7023WO(VL87022-W1) more decreased degradation by DNA nucleases in a host tissue or subject compared to an unmodified DNA molecule. In some embodiments, a chemically modified DNA molecule described herein shows decreased activation of the innate immune system in a target / host tissue or subject compared to an unmodified DNA molecule of the same sequence, e.g., at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or more decreased activation of the innate immune system in a target / host tissue or subject compared to an unmodified DNA molecule of the same sequence.

[0464] In some embodiments, a DNA molecule comprising chemically modified nucleotides described herein exhibits any of the following properties in a target / host tissue or subject compared to a DNA molecule of the same sequence that does not comprise chemically modified nucleotides (e.g., unmodified dsDNA): increased integration of exogenous construct in genome of target cell; increased retention in a target cell through replication; reduced secondary or tertiary structure formation; reduced interaction with innate immune sensors; reduced interaction with nucleases; enhanced stability; enhanced longevity; reduced toxicity; enhanced delivery; increased expression; increased transport across membranes; increased binding to DNA binding moieties such as nuclear DNA binding proteins, transcription factors, chaperones, or DNA polymerases. In embodiments, any of the above listed properties is modulated at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or more in a target / host tissue or subject compared to an unmodified DNA molecule of the same sequence.

[0465] Production

[0466] In some aspects, the present disclosure provides methods of making a DNA molecule as described herein. In some embodiments, the method comprises (a) providing a first strand of DNA comprising a first click handle, (b) providing a second strand of DNA comprising a second click handle that is capable of reacting with the first click handle; (c) contacting (a) with (b) under conditions that allow for reaction of the first click handle with the second click handle, thereby producing a click linker between the first strand and the second strand, thereby making the DNA molecule.

[0467] In some embodiments, the first click handle comprises an azide moiety, and the second click handle comprises a DBCO moiety. In some embodiments, the second click handle is

[0468] 1601851989.1 76 Atorney Docket No.: F2128-7023WO(VL87022-W1) situated on a nucleotide internal to (e.g., proximal to the 5’ end) the second strand or on a terminal nucleotide (e.g., at the 5’ end) of the second strand. In some embodiments, the second click handle is situated at the 5’ most nucleotide of the second strand, or within 1, 2, 3, 4, or 5 nucleotides of the 5’ end of the second strand. In some embodiments, the second strand comprises one or more backbone modifications, e.g., phosphorothioate modifications. In some embodiments, the second strand comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, or at least 12 phosphorothioate modifications. In some embodiments, the one or more backbone modifications are situated between the 2, 3, 4, 5, or 6 nucleotides adjacent to the 5’ end of the second strand, and / or the one or more backbone modifications are situated between the 2, 3, 4, 5, or 6 nucleotides adjacent to the 3’ end of the second strand.

[0469] In some embodiments, a method described herein comprises producing circular dsDNA comprising a functional group, e.g., a click handle, wherein producing the circular dsDNA comprises one or more of (e.g., 2, 3, 4, or all of): (i) providing a nucleic acid (e.g., a plasmid) optionally comprising an effector sequence; (ii) performing PCR to amplify a region of the nucleic acid (e.g., plasmid) that comprises the effector sequence, wherein performing PCR comprises contacting the nucleic acid with a first primer, e.g., a forward primer, and a second primer, e.g., a reverse primer, wherein optionally the first primer and the second primer are positioned at locations on the nucleic acid suitable to amplify the effector sequence (and optionally, not amplify backbone of the nucleic acid), and contacting the nucleic acid with a DNA-dependent DNA polymerase (e.g., a high fidelity polymerase, e.g., Q5), and applying thermal cycling conditions sufficient to amplify the region of the nucleic acid that comprises the effector sequence, thereby producing a linear dsDNA; (iii) digesting the linear dsDNA with an endonuclease (e.g., Bsal, Kpnl, Nhel, or EcoRI) that cleaves the endonuclease recognition sites, thereby producing a digested linear DNA, (iv) circularizing the digested linear dsDNA (e.g., by contacting the digested linear dsDNA with a ligase, e.g., T3 ligase or T4 ligase); and (v) digesting residual linear DNA by contacting a composition comprising the digested linear dsDNA with an exonuclease (e.g., T5 exonuclease). In some embodiments, the first primer, e.g., a forward primer, comprises a first endonuclease recognition site and the second primer, e.g., a reverse primer, comprises a second endonuclease recognition site and optionally a nicking recognition site. In some embodiments, the region of the nucleic acid (e.g., plasmid) that

[0470] 1601851989.1 77 Atorney Docket No.: F2128-7023WO(VL87022-W1) comprises the effector sequence also comprises an endonuclease recognition site, e.g., two endonuclease recognition sites and a nicking recognition site. In some embodiments, the second primer, e.g., reverse primer, comprises a nucleotide covalently linked to the functional group, e.g., click handle, e.g., azide moiety.

[0471] In some aspects, the disclosure provides a method of making a cssDNA comprising a functional group, e.g., a click handle, the method comprising: a) providing (e.g., producing or obtaining) a circular dsDNA, wherein the circular dsDNA: i) lacks a plasmid backbone; ii) lacks a bacterial origin of replication; iii) lacks a selectable marker, e.g., an antibiotic resistance marker; and / or iv) comprises a chemical modification, e.g., a chemical modification to a sugar, a chemical modification to a base, or a chemical modification to a nucleic acid backbone, e.g., a click handle; b) introducing a discontinuity into one strand of the circular dsDNA (e.g., contacting the circular dsDNA with a nicking endonuclease (e.g., Nb.BssSI, Nb.BsrDI, Nb.BpulOI, or Nt.BspQI) that recognizes a nicking recognition site in the dsDNA under conditions that allow the nicking endonuclease to nick the site in the dsDNA) thereby producing a dsDNA having a discontinuity; c) contacting the dsDNA having the discontinuity with an exonuclease (e g., T7 exonuclease, Exonuclease III, or X exonuclease, or a combination of T7 and X exonucleases) under conditions that allow for degradation (e.g., complete degradation) of the nicked strand, thereby making the circular, ssDNA. In some embodiments, step b) comprises contacting the circular dsDNA with the nicking endonuclease for 30-90 minutes, e.g., for about 60 minutes, e.g., at about 37C. In some embodiments, step b) comprises contacting the circular dsDNA with the nicking endonuclease for 4-8 hours, e.g., 5-6 hours, e.g., at about 40C. In some embodiments, the method further comprises after step c), a step of d) contacting the DNA of step c) with a double-stranded DNA-specific endonuclease, e.g., Avril, BssSI, PstI, or XmnI, or a combination thereof, e.g., at about 40C, e.g., for 0.5-3 hours, e.g., for 1-2 hours. In some embodiments, the method further comprises after step d), a step of e) contacting the DNA of step d) with an exonuclease, e.g., T7 exonuclease, Exonuclease III, or exonuclease, optionally in combination with exonuclease I (NEB M0293), e.g., for 30-90 minutes, e.g., for about 60 minutes, e.g., at about 37C. In some embodiments, the method further comprises after step e), a step of f) removing the exonuclease, e.g., through heat inactivation (e.g., at 70°C-80°C, e.g., 75°C, e.g., for about 10 minutes) or performing enrichment of the cssDNA using a column. In some embodiments, the method comprises after step d), a step of f) performing enrichment using

[0472] 1601851989.1 78 Atorney Docket No.: F2128-7023WO(VL87022-W1) a column. In some embodiments, the steps of d), e), and / or f) decreases the amount of dsDNA and enriches for cssDNA.

[0473] In some embodiments, the circular dsDNA or the circular ssDNA comprises e.g., a click handle and: i) lacks a plasmid backbone; ii) lacks a bacterial origin of replication; iii) lacks a selectable marker, e.g., an antibiotic resistance marker; and / or iv) comprises a chemical modification, e.g., a chemical modification to a sugar, a chemical modification to a base, or a chemical modification to a nucleic acid backbone.

[0474] In some embodiments, the method comprises contacting the circular dsDNA comprising a functional group, e.g., a click handle, with a nicking endonuclease chosen from Nb.BssSI, Nb.BsrDI, or Nt.BspQI that recognizes a nicking recognition site in the dsDNA under conditions that allow the nicking endonuclease to nick the site in the dsDNA, thereby producing a nicked dsDNA. In some embodiments, the method comprises contacting the nicked dsDNA with an exonuclease, e.g., T7 exonuclease, Exonuclease III, or exonuclease, under conditions that allow for degradation (e.g., complete degradation) of the nicked strand. In some embodiments, the method comprises performing gel or column enrichment on the circular ssDNA.

[0475] In some embodiments, the method comprises one or more enrichment steps, e.g., gel enrichment or use of a DNA enrichment column. In some embodiments, the enrichment step is performed on: the linear dsDNA; the digested linear dsDNA; the circular dsDNA; or the circular ssDNA. In some embodiments, the method does not comprise an organic extraction step (e.g., a phenol-chloroform extraction step).

[0476] In some embodiments, the method comprises contacting the nicked dsDNA with the exonuclease (e.g., the T7 exonuclease, Exonuclease III, or X exonuclease) for 15-120 minutes, e.g., 20-60 minutes, e.g., about 30 min, or overnight. In some embodiments, introducing a discontinuity into one strand of the circular dsDNA comprises introducing a nick between two adjacent nucleotides. In some embodiments, introducing a discontinuity into one strand of the circular dsDNA comprises removing a nucleotide, e.g., wherein the nucleotide is a uracil.

[0477] In some embodiment, a first strand of the DNA molecule described herein, e g., a circular ssDNA, are produced from a nucleic acid (e.g., a plasmid) assembled to contain the desired elements described herein. The plasmid template can be assembled using Golden Gate cloning for assembly of multiple DNA fragments in a defined linear order in a recipient vector using a one-pot assembly procedure. Golden Gate cloning is described in Marillonnet & Griitzner, 2020,

[0478] 1601851989.1 79 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0479] Synthetic DNA assembly using golden gate cloning and the hierarchical modular cloning pipeline, Current Protocols in Molecular Biology, 130:el 15. The template is then used to make a single stranded DNA using Methanol Responsive (MeRPy) PCR, e.g., as described in Minev et al., 2019, Rapid in vitro production of single-stranded DNA, Nucleic Acids Research, Volume 47, Issue 22: 11956-11962. For embodiments in which the ssDNA is circular, the resulting ssDNA can be circularized, e.g., using a DNA ligase. A schematic diagram of an exemplary production process is shown in Figure 2 of WO / 2023 / 069948, incorporated herein by reference in its entirety.

[0480] In some embodiments, a method or composition described herein involves a nicking endonuclease. In some embodiments, the endonuclease is naturally occurring. In some embodiments, the endonuclease is mutated or engineered, e.g., derived from an enzyme that causes double-stranded breaks.

[0481] In some embodiments, a method described herein comprises the use of, or a composition described herein comprises, Nb.BsrDI. In some embodiments, the Nb.BsrDI comprises the large subunit of the BsrDI restriction gene from Bacillus stearothermophilus D70, or an amino acid sequence with at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity thereto. In some embodiments, the Nb.BsrDI comprises an amino acid sequence according to Genbank accession number ABDI 5132.1 (herein incorporated by reference in its entirety), or an amino acid sequence with at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity thereto. In some embodiments, the Nb.BsrDI cleaves at the site indicated in the following sequence:

[0482] In some embodiments, a digestion reaction utilizing Nb.BsrDI is performed in rCutSmart™ Buffer (NEB). In some embodiments, the digestion reaction is performed in a buffer comprising one or more of (e.g., all of) Potassium Acetate (e.g., at 50mM), Tris-acetate (e.g., 20 mM), Magnesium Acetate (e.g., 10 mM), or Recombinant Albumin (e.g., 100 pg / ml), wherein optionally, the buffer has a pH of 7.9 when measured at 25°C. In some embodiments, the digestion reaction is performed at 30°C to 70°C (e.g., about 37°C or about 65°C). In some embodiments, the digestion reaction is performed for 10 minutes to 3 hours (e.g., about 30 minutes or about 1 hour).

[0483] 1601851989.1 80 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0484] In some embodiments, a method described herein comprises the use of, or a composition described herein comprises, Nb.BpulOI. In some embodiments, the Nb.BpulOI comprises an amino acid sequence encoded by wild type bpulOIRa or a mutagenized bpulOIRP gene from Bacillus pumilus RFL10, or an amino acid sequence with at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity thereto. In some embodiments, the Nb.BpulOI cleaves at the site indicated in the following sequence:

[0485] 5’ C C T N A G C 3'

[0486] 3' G G A hi T ? C G 5;

[0487] In some embodiments, a digestion reaction utilizing Nb.BpulOI is performed in R Buffer (ThermoFisher Scientific). In some embodiments, the digestion reaction is performed in a buffer comprising one or more of (e.g., all of) Tris-HCl (e.g., 10 mM), MgCh (e.g., 10 mM), KC1 (e.g.,

[0488] 100 mM), and BSA (e.g., 0.1 mg / mL). In some embodiments, the digestion reaction is performed at 30°C to 50°C (e.g., about 37°C). In some embodiments, the digestion reaction is performed for 30 minutes to 3 hours (e.g., about 1 hour).

[0489] In some embodiments, a method described herein comprises the use of, or a composition described herein comprises, Nt.BspQI. In some embodiments, the Nt.BspQI comprises an engineered BspQI variant from BspQI restriction enzyme, or an amino acid sequence with at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity thereto. In some embodiments, the Nt.BspQI cleaves at the site indicated in the following sequence: 5'. . . G C T C T T C NT. . 3' 3'. . CG A G A AG N . . . 5'

[0490] In some embodiments, a digestion reaction utilizing Nt.BspQI is performed in NEBuffer™ r3.1 (NEB). In some embodiments, the digestion reaction is performed in a buffer comprising one or more of (e.g., all of) NaCl (e.g., 100 mM), Tris-HCl (e.g., 50mM), MgCh (e.g., 10 mM), Recombinant Albumin (e.g., 100 pg / mL), wherein optionally, the buffer has a pH of 7.9 when measured at 25°C. In some embodiments, the digestion reaction is performed at 40°C to 60°C (e g., about 50°C). In some embodiments, the digestion reaction is performed for 30 minutes to 3 hours (e.g., about 1 hour).

[0491] In some embodiments, a method described herein comprises the use of, or a composition described herein comprises, T7 exonuclease. In some embodiments, a digestion reaction utilizing T7 exonuclease is performed in NEBuffer™ 4 (NEB). In some embodiments, the

[0492] 1601851989.1 81 Atorney Docket No.: F2128-7023WO(VL87022-W1) digestion reaction is performed in a buffer comprising one or more of (e.g., all of) Potassium Acetate (e.g., at 50mM), Tris-acetate (e.g., 20 mM), Magnesium Acetate (e.g., 10 mM), or DTT (e.g., 1 mM), wherein optionally, the buffer has a pH of 7.9 when measured at 25°C. In some embodiments, the digestion reaction is performed at 20°C to 50°C (e.g., about 25°C or about 37°C). In some embodiments, the digestion reaction is performed for 15-120 minutes, e.g., 20-60 minutes, e.g., about 30 min.

[0493] In some embodiments, a method described herein comprises the use of, or a composition described herein comprises, T5 exonuclease. In some embodiments, a digestion reaction utilizing T5 exonuclease is performed in NEBuffer™ 4 (NEB). In some embodiments, the digestion reaction is performed in a buffer comprising one or more of (e.g., all of) Potassium Acetate (e.g., at 50mM), Tris-acetate (e.g., 20 mM), Magnesium Acetate (e.g., 10 mM), or DTT (e.g., 1 mM), wherein optionally, the buffer has a pH of 7.9 when measured at 25°C. In some embodiments, the digestion reaction is performed at 30°C to 50°C (e.g., about 37°C). In some embodiments, the digestion reaction is performed for 10 minutes to 3 hours (e.g., about 30 minutes).

[0494] In some embodiments, a method described herein comprises the use of, or a composition described herein comprises, Exonuclease III. In some embodiments, a digestion reaction utilizing Exonuclease III is performed in NEBuffer™ 1 (NEB). In some embodiments, the digestion reaction is performed in a buffer comprising one or more of (e.g., all of), Bis-Tris- Propane-HCl (e.g., 10 mM), MgCh (e.g., 10 mM), or DTT (e.g., 1 mM), wherein optionally, the buffer has a pH of 7 when measured at 25°C. In some embodiments, the digestion reaction is performed at 30°C to 50°C (e.g., about 37°C). In some embodiments, the digestion reaction is performed for 10 minutes to 3 hours (e.g., about 30 minutes).

[0495] In some embodiments, a method described herein comprises the use of, or a composition described herein comprises, a high-fidelity DNA polymerase, e.g., a Q5 High-Fidelity DNA Polymerase (M0491L, New England Biolabs). In some embodiments, a polymerase chain reaction is performed using a high-fidelity DNA polymerase. In some embodiments, the polymerase chain reaction utilizing the Q5 High-Fidelity DNA Polymerase is performed using Q5 Reaction Buffer (NEB).

[0496] In some embodiments, a method described herein comprises the use of, or a composition described herein comprises, Exonuclease I. In some embodiments, the Exonuclease I comprises the amino acid sequence of Exo I gene from E. coli NM554, or an amino acid sequence with at

[0497] 1601851989.1 82 Atorney Docket No.: F2128-7023WO(VL87022-W1) least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity thereto. In some embodiments, the Exonuclease I catalyzes the removal of nucleotides from linear singlestranded DNA (e.g., in the 3' to 5' direction). In some embodiments, a digestion reaction utilizing Exonuclease I is performed in Exonuclease I Reaction Buffer (NEB). In some embodiments, the digestion reaction is performed in a buffer comprising one or more of (e.g., all of) Glycine-KOH (e.g., at 67 mM), or MgCh (e.g., at 6.7 mM), -ME (e.g., at lOmM), wherein optionally, the buffer has a pH of 9.5 when measured at 25°C. In some embodiments, the digestion reaction is performed at 30°C to 50°C (e.g., about 37°C). In some embodiments, the digestion reaction is performed for 10 minutes to 3 hours (e.g., about 30 minutes). In some embodiments, the circular ssDNA is resistant to degradation by Exonuclease I.

[0498] In some embodiments, the circularization efficiency of the circularization methods provided herein is at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or more.

[0499] The ssDNA or circular, e.g., covalently closed, ssDNA may be enriched from impurities or byproducts selected from the group consisting of: endotoxin, mononucleotides, modified mononucleotides, double stranded DNA, linear DNA (for circular products), proteins (e.g., enzymes, e g., ligases, restriction enzymes), DNA fragments or truncations. In some embodiments, the enriched ssDNA is substantially free of process byproducts and impurities, e.g., process byproducts or impurities described herein.

[0500] The ssDNA or circular, e.g., covalently closed, ssDNA may be sequenced to confirm the desired, designed sequence. In embodiments, other structural analysis of the ssDNA (e.g., restriction enzyme analysis) may be performed to confirm or verify its sequence.

[0501] In some embodiments, the method comprises making or manufacturing a DNA molecule, the method comprising (a) providing a DNA molecule described herein, and (b) determining whether the structure of the DNA molecule matches a reference structure, thereby making or manufacturing the DNA molecule. In some embodiments, the determining of (b) comprises sequencing the DNA molecule (e.g., sequencing all of or a part of the DNA molecule). In some embodiments, the determining of (b) comprises digesting the DNA molecule with a restriction enzyme. In some embodiments, the structure of the DNA molecule that matches the reference

[0502] 1601851989.1 83 Atorney Docket No.: F2128-7023WO(VL87022-W1) structure is identical to the reference structure. In some embodiments, the structure of the DNA molecule that matches the reference structure has the same sequence as the reference structure. In some embodiments, the structure of the DNA molecule that matches the reference structure has the same length as the reference structure.

[0503] The DNA molecule may be enriched from impurities or byproducts selected from the group consisting of endotoxin, mononucleotides, chemically modified mononucleotides, single stranded DNA, circular DNA, proteins (e.g., enzymes, e.g., ligases, restriction enzymes), DNA fragments or truncations. In some embodiments, the enriched DNA molecule is substantially free of process byproducts and impurities, e.g., process byproducts or impurities described herein.

[0504] In some embodiments, a DNA molecule described herein is formulated with a lipid based carrier, e.g., a lipid nanoparticle (LNP).

[0505] The DNA molecule may be sequenced to confirm the desired, designed sequence. In embodiments, other structural analysis of the DNA molecule (e.g., restriction enzyme analysis) may be performed to confirm or verify its sequence.

[0506] Enrichment

[0507] A composition described herein is typically enriched to remove process impurities and / or contaminants. In some embodiments, a composition comprising a DNA molecule described herein is enriched. For instance, in some embodiments, at least 60%, at least 65%, at least 70%, at least 75%, or at least 80% by mass of total DNA in the composition may be the DNA molecule. As an example, the composition may also comprise other forms of DNA, e.g., as a process impurity, for instance host cell DNA. As an example, the composition may comprise a contaminant, such as bacterial or viral or fungal agents.

[0508] In some embodiments, a composition comprising a DNA molecule as described herein, or a first strand of a DNA molecule as described herein, e.g., a ssDNA described herein, has a certain level of enrichment. For instance, in some embodiments, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% by mass of total DNA in the composition may be the covalently closed ssDNA. As an example, the composition may also comprise linear DNA or circular dsDNA, e.g., as a contaminant.

[0509] 1601851989.1 84 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0510] In some embodiments, a composition described herein (e.g., a composition comprising a DNA molecule as described herein, or a first strand of a DNA molecule as described herein, e.g., a circular ssDNA, e.g., a pharmaceutical composition comprising a DNA molecule as described herein, or a first strand of a DNA molecule as described herein, e.g., a circular ssDNA, or a manufacturing intermediate comprising a DNA molecule as described herein, or a first strand of a DNA molecule as described herein, e.g., a circular ssDNA) is free of or is substantially free of one or more contaminant, e.g., as described in this section. In some embodiments, a method described herein (e.g., a method of making circular ssDNA) results in a composition that is free of or is substantially free of one or more contaminant, e.g., as described in this section. In some embodiments, a method described herein (e.g., a method of making circular ssDNA) comprises a step of assaying for one or more contaminant, e.g., as described in this section.

[0511] In some embodiments, the method comprises approving or releasing a batch if the batch is free of or substantially free of the process impurity or contaminant or meets a release criterion for that process impurity or contaminant.

[0512] In some embodiments, the process impurity comprises a nonhuman animal serum (e.g., fetal bovine serum); an enzyme, e.g., a ligase, a polymerase, or a digestive enzyme (e.g., a trypsin, a collagenase, a DNase, a RNase, an exonuclease, or an endonuclease, e.g., a restriction endonuclease); a growth factor; a cytokine; an antibody (e.g., a monoclonal antibody); a bead (e g., an antibody-coated bead); an antibiotic; a cell culture medium; a component of a cell culture medium; a detergent; a protein, e.g., a host cell protein; an extraneous nucleic acid sequence (e.g., a mononucleotide (e.g., a modified mononucleotide), or a DNA fragment or truncation; helper virus contaminant (e.g., infectious virus, viral DNA, or viral proteins); or a solvent; a cellular debris; a cell; a pyrogen; a fungus; or any combination thereof, or a portion of any of the foregoing. In some embodiments, the contaminant was a component introduced during a manufacturing process. In some embodiments, the contaminant comprises a viral protein.

[0513] In some embodiments, the contaminant comprises an agent for transmissible spongiform encephalopathy (TSE). In some embodiments, a test for this contaminant is performed on a composition for which a bovine material was used in manufacturing.

[0514] In some embodiments, the contaminant comprises a zoonotic virus, a porcine circovirus 1, a porcine circovirus 2, or a porcine parvovirus; or any combination thereof, or a portion of any

[0515] 1601851989.1 85 Atorney Docket No.: F2128-7023WO(VL87022-W1) of the foregoing. In some embodiments, a test for this contaminant is performed on a composition for which non-human animal material, e.g., a porcine material, was used in manufacturing.

[0516] In some embodiments, the contaminant comprises a virus or portion thereof, e.g., a human virus; human immunodeficiency virus (HIV); HIV-1; HIV-2; hepatitis B virus (HBV); hepatitis C virus (HCV); human TSE, including Creutzfeldt-Jakob disease (CJD); variant CJD (vCID); Treponema pallidum (syphilis); human T-lymphotropic virus (HTLV), HTLV-1, HTLV-2; or cytomegalovirus, human herpesvirus (e.g., human herpesvirus -6, -7 or -8 (HHV-6, - 7, or -8)), JC virus, BK virus, Epstein-Barr virus (EBV), human parvovirus Bl 9, human papillomavirus (HPV); an adenovirus, e.g., adenovirus El; SV40 Large T antigen sequence; HPV E6 or E7 DNA; or any combination thereof, or a portion of any of the foregoing. In some embodiments, a test for this contaminant is performed on a composition for which human donor cells (e.g., leukocyte-rich cells) were used in manufacturing. In some embodiments, a test for this contaminant is performed on a cell bank.

[0517] In some embodiments, the contaminant comprises a microbe or a portion thereof; a bacterium (e.g., a Gram-negative bacterium); mycoplasma; spiroplasma (e.g., when insect cells are used); bacterial toxin (e.g., endotoxin); or an adventitious agent, e.g., an adventitious viral agent or a non-viral adventitious agent, or any combination thereof, or a portion of any of the foregoing. In some embodiments, the contaminant comprises a simian virus, e.g., simian polyomavirus SV40 or simian retrovirus, or any combination thereof, or a portion of any of the foregoing. In some embodiments, the contaminant comprises an arbovirus. In some embodiments, the contaminant comprises a bacteriophage. In some embodiments, a test for this contaminant is performed on a cell bank, e.g., a cell bank of bacterial cells.

[0518] In some embodiments, the contaminant or process impurity comprises DNA from a host cell, e.g., wherein the host cell is a non-tumorigenic cell. In some embodiments, the DNA is present at a level of less than 10 ng / dose. In some embodiments, the DNA size is below about 200 nucleotides in length.

[0519] In some embodiments, the contaminant is an endotoxin. In some embodiments, a level of the endotoxin is less than 5 Endotoxin Unit (EU) / kg body weight / hour, e.g., wherein the composition is formulated for parenteral administration. In some embodiments, a level of the endotoxin is less than 0.2 EU / kg body weight / hour, e.g., wherein the composition is formulated

[0520] 1601851989.1 86 Atorney Docket No.: F2128-7023WO(VL87022-W1) for intrathecal administration. In some embodiments, a level of the endotoxin is not more than 2.0 EU / dose / eye, e.g., wherein the composition is formulated for injection or implantation into the eye, or not more than 0.5 EU / mL, e.g., wherein the composition is formulated for intraocular administration.

[0521] In some embodiments, a process impurity comprises an organic solvent, e.g., an aromatic organic solvent, e.g., phenol or chloroform.

[0522] In some embodiments, the contaminant or process impurity is described in Chemistry, Manufacturing, and Control (CMC) Information for Human Gene Therapy Investigational New Drug Applications (INDs) - Guidance for Industry (U.S. Department of Health and Human Services, Food and Drug Administration, Center for Biologies Evaluation and Research, January 2020), which is herein incorporated by reference in its entirety.

[0523] In some embodiments, the composition is substantially free of (e.g., is free of) a polymerase. In some embodiments, the composition is substantially free (e.g., is free of) lipids, e.g., LNPs. In some embodiments, the composition is substantially free (e.g., is free of) nanoparticles.

[0524] In some embodiments, the composition is substantially free of (e.g., is free of) agarose. In some embodiments, the composition is substantially free of (e.g., is free of) acrylamide. In some embodiments, the composition is substantially free of (e.g., is free of) polypeptides.

[0525] Pharmaceutical compositions

[0526] In some aspects, the present disclosure includes a DNA molecule and related compositions in combination with one or more pharmaceutically acceptable excipients and / or carriers.

[0527] Pharmaceutical compositions may optionally comprise one or more additional active substances, e.g., therapeutically and / or prophylactically active substances. Pharmaceutical compositions of the present invention are generally sterile and / or pyrogen-free.

[0528] A DNA molecule described herein may be formulated without a carrier, e.g., the DNA molecule described herein may be administered to a host cell, tissue or subject “naked”. A naked formulation may include pharmaceutical excipients or diluents but lacks a carrier.

[0529] Pharmaceutically acceptable excipients or diluents may comprise an inactive substance that serves as a vehicle or medium for the compositions described herein, such as any one of the

[0530] 1601851989.1 87 Atorney Docket No.: F2128-7023WO(VL87022-W1) inactive ingredients approved by the United States Food and Drug Administration (FDA) and listed in the Inactive Ingredient Database, which is incorporated by reference herein. Nonlimiting examples of pharmaceutically acceptable excipients or diluents include solvents, aqueous solvents, non-aqueous solvents, tonicity agents, dispersion media, cryoprotectants, diluents, suspension aids, surface active agents, isotonic agents, thickening agents, emulsifying agents, preservatives, hyaluronidases, dispersing agents, preservatives, lubricants, granulating agents, disintegrating agents, binding agents, antioxidants, buffering agents (e.g., phosphate buffered saline (PBS)), lubricating agents, oils, and mixtures thereof.

[0531] General considerations in the formulation and / or manufacture of pharmaceutical agents may be found, for example, in Remington: The Science and Practice of Pharmacy 21st ed., Lippincot Williams & Wilkins, 2005 (incorporated herein by reference).

[0532] Carriers

[0533] A DNA molecule described herein may also be formulated, or included, with a carrier. General considerations of carriers and delivery of pharmaceutical agents may be found, for example, in “Delivery Technologies for Biopharmaceuticals: Peptides, Proteins, Nucleic Acids and Vaccines” (Lene Jorgensen and Hanne Morck Nielson, Eds.) Wiley; 1st edition (December 21, 2009); and Vargason et al. 2021. Nat Biomed Eng 5, 951-967.

[0534] Non-limiting examples of carriers include carbohydrate carriers (e.g., an anhydride- modified phytoglycogen or glycogen-type material, GalNAc), nanoparticles (e.g., a nanoparticle that encapsulates or is covalently linked to the DNA molecule, gold nanoparticles, silica nanoparticles), lipid particles (e.g., liposomes, lipid nanoparticles), cationic carriers (e.g., a cationic lipopolymer or transfection reagent), fusosomes, non-nucleated cells (e.g., ex vivo differentiated reticulocytes), nucleated cells, exosomes, protein carriers (e.g., a protein covalently linked to the DNA molecule), peptides (e g., cell-penetrating peptides), materials (e.g., graphene oxide), single pure lipids (e.g., cholesterol), DNA origami (e.g., DNA tetrahedron).

[0535] In one embodiment, the DNA molecules, compositions, constructs and systems described herein can be formulated in liposomes or other similar vesicles. Liposomes are spherical vesicle structures composed of a uni- or multilamellar lipid bilayer surrounding internal aqueous compartments and a relatively impermeable outer lipophilic phospholipid bilayer. Liposomes may be anionic, neutral or cationic. Liposomes are biocompatible, nontoxic, can deliver both

[0536] 1601851989.1 88 Atorney Docket No.: F2128-7023WO(VL87022-W1) hydrophilic and lipophilic drug molecules, protect their cargo from degradation by plasma enzymes, and transport their load across biological membranes and the blood brain barrier (BBB) (see, e.g., Spuch and Navarro, Journal of Drug Delivery, vol. 2011, Article ID 469679, 12 pages, 2011. doi: 10.1155 / 2011 / 469679 for review).

[0537] Vesicles can be made from several different types of lipids; however, phospholipids are most commonly used to generate liposomes as drug carriers. Methods for preparation of multilamellar vesicle lipids are known in the art (see for example U.S. Pat. No. 6,693,086, the teachings of which relating to multilamellar vesicle lipid preparation are incorporated herein by reference). Although vesicle formation can be spontaneous when a lipid film is mixed with an aqueous solution, it can also be expedited by applying force in the form of shaking by using a homogenizer, sonicator, or an extrusion apparatus (see, e.g., Spuch and Navarro, Journal of Drug Delivery, vol. 2011, Article ID 469679, 12 pages, 2011. doi: 10.1155 / 2011 / 469679 for review). Extruded lipids can be prepared by extruding through filters of decreasing size, as described in Templeton et al., Nature Biotech, 15:647-652, 1997, the teachings of which relating to extruded lipid preparation are incorporated herein by reference.

[0538] Exosomes can also be used as drug delivery vehicles for the compositions and systems described herein. For a review, see Ha et al. July 2016. Acta Pharmaceutica Sinica B. Volume 6, Issue 4, Pages 287-296; www.doi.org / 10.1016 / j.apsb.2016.02.001.

[0539] Ex vivo differentiated red blood cells can also be used as a carrier for an agent (e.g., a DNA molecule) described herein. See, e.g, WO2015073587; WO2017123646; WO2017123644; W02018102740; WO2016183482; W02015153102; WO2018151829; W02018009838; Shi et al. 2014. Proc Natl Acad Sci USA. 111(28): 10131-10136; US Patent 9,644,180; Huang et al. 2017. Nature Communications 8: 423; Shi et al. 2014. Proc Natl Acad Sci USA. 111(28): 10131-10136.

[0540] Fusosome compositions, e.g., as described in WO2018208728, can also be used as carriers to deliver the DNA molecules described herein.

[0541] Lipid Nanoformiilalious Lipid-based carriers

[0542] In some embodiments, compounds, e.g., DNA molecules, described herein are formulated into a lipid-based carrier (or lipid nanoformulation). In some embodiments, the lipid- based carrier (or lipid nanoformulation) is a liposome or a lipid nanoparticle (LNP). In one

[0543] 1601851989.1 89 Atorney Docket No.: F2128-7023WO(VL87022-W1) embodiment, the lipid-based carrier is an I.NP.

[0544] In some embodiments, the lipid-based carrier (or lipid nanoformulation) comprises a cationic lipid (e.g., an ionizable lipid), a non-cationic lipid (e.g., phospholipid), a structural lipid (e.g., cholesterol), and a PEG-modified lipid. In some embodiments, the lipid-based carrier (or lipid nanoformulation) contains one or more compounds described herein, or a pharmaceutically acceptable salt thereof.

[0545] As described herein, suitable compounds to be used in the lipid-based carrier (or lipid nanoformulation) include all the isomers and isotopes of the compounds described above, as well as all the pharmaceutically acceptable salts, solvates, or hydrates thereof, and all crystal forms, crystal form mixtures, and anhydrides or hydrates.

[0546] In addition to one or more compounds described herein, the lipid-based carrier (or lipid nanoformulation) may further include a second lipid. In some embodiments, the second lipid is a cationic lipid, a non-cationic (e.g., neutral, anionic, or zwitterionic) lipid, or an ionizable lipid.

[0547] One or more naturally occurring and / or synthetic lipid compounds may be used in the preparation of the lipid-based carrier (or lipid nanoformulation).

[0548] The lipid-based carrier (or lipid nanoformulation) may contain positively charged (cationic) lipids, neutral lipids, negatively charged (anionic) lipids, or a combination thereof.

[0549] Cationic Lipids (Positively Charged) and Ionizable Lipids

[0550] In some embodiments, the lipid-based carrier (or lipid nanoformulation) comprises one or more cationic lipids, e.g., a cationic lipid that can exist in a positively charged or neutral form depending on pH, or an amine-containing lipid that can be readily protonated. In some embodiments, the cationic lipid is a lipid capable of being positively charged, e.g., under physiological conditions.

[0551] Exemplary cationic lipids include one or more amine group(s) which bear the positive charge. Examples of positively charged (cationic) lipids include, but are not limited to, N,N'- dimethyl-N,N'-dioctacyl ammonium bromide (DDAB) and chloride DDAC), N-(l-(2,3- dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA), 3 -[N-(N',N'- dimethylaminoethyl)carbamoyl) cholesterol (DC-chol), l,2-dioleoyloxy-3-[trimethylammonio]- propane (DOTAP), l,2-dioctadecyloxy-3-[trimethylammonio]-propane (DSTAP), and 1,2- dioleoyloxypropyl-3-dimethyl-hydroxy ethyl ammonium chloride (DORI), N,N-dioleyl-N,N-

[0552] 1601851989.1 90 Atorney Docket No.: F2128-7023WO(VL87022-W1) dimethylammonium chloride (DODAC), N,N-dimethyl-2,3-dioleyloxy)propylamine (DODMA), l,2-Dioleoyl-3-Dimethylammonium-propane (DODAP), l,2-Dioleoylcarbamyl-3- Dimethylammonium-propane (DOCDAP), l,2-Dilineoyl-3-Dimethylammonium-propane (DLINDAP), 3-Dimethylamino-2-(Cholest-5-en-3-beta-oxybutan-4-oxy)-l-(cis,cis-9,12- octadecadienoxy)propane (CLinDMA), 2-[5'-(cholest-5-en-3-beta-oxy)-3'-oxapentoxy)-3- dimethyl-l-(cis, cis-9',12'-octadecadienoxy)propane (CpLin DMA), N,N-Dimethyl-3,4- dioleyloxybenzylamine (DMOBA), and the cationic lipids described in e.g. Martin et al., Current Pharmaceutical Design, pages 1-394, which is herein incorporated by reference in its entirety. In some embodiments, the lipid-based carrier (or lipid nanoformulation) comprises more than one cationic lipid.

[0553] In some embodiments, the lipid-based carrier (or lipid nanoformulation) comprises a cationic lipid having an effective pKa over 6.0. In some embodiments, the lipid-based carrier (or lipid nanoformulation) further comprises a second cationic lipid having a different effective pKa (e.g., greater than the first effective pKa) than the first cationic lipid.

[0554] In some embodiments, cationic lipids that can be used in the lipid-based carrier (or lipid nanoformulation) include, for example those described in Table 4 of WO 2019 / 217941, which is incorporated by reference.

[0555] In some embodiments, the cationic lipid is an ionizable lipid (e.g., a lipid that is protonated at low pH, but that remains neutral at physiological pH). In some embodiments, the lipid-based carrier (or lipid nanoformulation) may comprise one or more additional ionizable lipids, different than the ionizable lipids described herein. Exemplary ionizable lipids include, but are not limited to,

[0556] 1601851989.1 91 Attorney Docket No.: F2128-7023WO(VL87022-W1)

[0557] (see WO 2017 / 004143A1, which is incorporated herein by reference in its entirety).

[0558] 1601851989.1 92 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0559] In some embodiments, the lipid-based carrier (or lipid nanoformulation) further comprises one or more compounds described by WO 2021 / 113777 (e.g., a lipid of Formula (3) such as a lipid of Table 3 of WO 2021 / 113777), which is incorporated herein by reference in its entirety.

[0560] In one embodiment, the ionizable lipid is a lipid disclosed in Hou, X., et al. Nat Rev Mater 6, 1078-1094 (2021). www.doi.org / 10.1038 / s41578-021-00358-0 (e. ., L319, C12-200, and DLin-MC3-DMA), (which is incorporated by reference herein in its entirety).

[0561] Examples of other ionizable lipids that can be used in lipid-based carrier (or lipid nanoformulation) include, without limitation, one or more of the following formulas: X of US 2016 / 0311759; I of US 20150376115 or in US 2016 / 0376224; Compound 5 or Compound 6 in US 2016 / 0376224; I, IA, or II of US 9,867,888; I, II or III of US 2016 / 0151284; I, IA, II, or IIA of US 2017 / 0210967; I-c of US 2015 / 0140070; A of US 2013 / 0178541; I of US 2013 / 0303587 or US 2013 / 0123338; I of US 2015 / 0141678; II, III, IV, or V of US 2015 / 0239926; I of US 2017 / 0119904; I or II of WO 2017 / 117528; A of US 2012 / 0149894; A of US 2015 / 0057373; A of WO 2013 / 116126; A of US 2013 / 0090372; A of US 2013 / 0274523; A of US 2013 / 0274504; A of US 2013 / 0053572; A of WO 2013 / 016058; A of WO 2012 / 162210; I of US 2008 / 042973; I, II, III, or IV of US 2012 / 01287670; I or II of US 2014 / 0200257; I, II, or III of US 2015 / 0203446; I or III of US 2015 / 0005363; I, IA, IB, IC, ID, II, IIA, IIB, IIC, IID, or III-XXIV of US 2014 / 0308304; of US 2013 / 0338210; I, II, III, or IV of WO 2009 / 132131; A of US 2012 / 01011478; I or XXXV of US 2012 / 0027796; XIV or XVII of US 2012 / 0058144; of US 2013 / 0323269; I of US 2011 / 0117125; I, II, or III of US 2011 / 0256175; I, II, III, IV, V, VI, VII, VIII, IX, X, XI, XII of US 2012 / 0202871; I, II, III, IV, V, VI, VII, VIII, X, XII, XIII, XIV, XV, or XVI of US 2011 / 0076335; I or II of US 2006 / 008378; I of WO2015 / 074085 (e.g., ATX-002); I of US 2013 / 0123338; I or X-A-Y-Z of US 2015 / 0064242; XVI, XVII, or XVIII of US 2013 / 0022649; I, II, or III of US 2013 / 0116307; I, II, or III of US 2013 / 0116307; I or II of US 2010 / 0062967; I-X of US 2013 / 0189351; I of US 2014 / 0039032; V of US 2018 / 0028664; I of US 2016 / 0317458; I of US 2013 / 0195920; 5, 6, or 10 of US 10,221,127; III-3 of WO 2018 / 081480; 1-5 or 1-8 of WO 2020 / 081938; I of WO 2015 / 199952 (e.g, compound 6 or 22) and Table 1 therein; 18 or 25 of US 9,867,888; A of US 2019 / 0136231; II of WO 2020 / 219876; 1 of US 2012 / 0027803; OF-02 of US 2019 / 0240349; 23 of US 10,086,013; CKK-E12 / A6 of Miao et al (2020); C12-200 of WO 2010 / 053572; 7C1 of Dahlman et al (2017); 304-013 or 503-

[0562] 1601851989.1 93 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0563] 013 of Whitehead et al; TS-P4C2 of U S9, 708, 628; I of WO 2020 / 106946; I of WO 2020 / 106946; (1), (2), (3), or (4) of WO 2021 / 113777; and any one of Tables 1-16 of WO 2021 / 113777, all of which are incorporated herein by reference in their entirety.

[0564] In some embodiments, the lipid-based carrier (or lipid nanoformulation) further includes biodegradable ionizable lipids, for instance, (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3- (diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also called 3- ((4,4- bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z,12Z)-octadeca-9,12-dienoate). See, e.g., lipids of WO 2019 / 067992, WO 2017 / 173054, WO 2015 / 095340, and WO 2014 / 136086, which are incorporated herein by reference in their entirety.

[0565] Non-Cationic Lipids (e.g., Phospholipids)

[0566] In some embodiments, the lipid-based carrier (or lipid nanoformulation) further comprises one or more non-cationic lipids. In some embodiments, the non-cationic lipid is a phospholipid. In some embodiments, the non-cationic lipid is a phospholipid substitute or replacement. In some embodiments, the non-cationic lipid is a negatively charged (anionic) lipid.

[0567] Exemplary non-cationic lipids include, but are not limited to, distearoyl-sn-glycero- phosphoethanolamine, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), di oleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE), di oleoyl-phosphatidyl ethanolamine 4-(N-maleimidomethyl)-cyclohexane-l -carboxylate (DOPE- mal), dipalmitoyl phosphatidyl ethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidyl-ethanolamine (DSPE), monomethyl-phosphatidylethanolamine (such as 16-O-monomethyl PE), dimethyl- phosphatidylethanolamine (such as 16-O-dimethyl PE), 18-1-trans PE, l-stearoyl-2-oleoyl-phosphatidyethanolamine (SOPE), hydrogenated soy phosphatidylcholine (HSPC), egg phosphatidylcholine (EPC), dioleoylphosphatidyl serine (DOPS), sphingomyelin (SM), dimyristoyl phosphatidylcholine (DMPC), dimyristoyl phosphatidylglycerol (DMPG), di stearoylphosphatidylglycerol (DSPG), dierucoylphosphatidylcholine (DEPC), palmitoyloleyolphosphatidylglycerol (POPG), dielaidoyl-

[0568] 1601851989.1 94 Atorney Docket No.: F2128-7023WO(VL87022-W1) phosphatidylethanolamine (DEPE), 1,2-dilauroyl- sn-glycero-3-phosphocholine (DLPC), Sodium 1,2- ditetradecanoyl-sn-glycero-3 -phosphate (DMPA), phosphatidylcholine (lecithin), phosphatidylethanolamine, lysolecithin, lysophosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, sphingomyelin, egg sphingomyelin (ESM), phosphatidylethanolamine (cephalin), cardiolipin, phosphatidic acid, cerebrosides, dicetylphosphate, lysophosphatidylcholine, dilinoleoylphosphatidylcholine, or mixtures thereof. It is understood that other diacylphosphatidylcholine and diacylphosphatidylethanolamine phospholipids can also be used. The acyl groups in these lipids are preferably acyl groups derived from faty acids having C10-C24 carbon chains, e.g., lauroyl, myristoyl, paimitoyl, stearoyl, or oleoyl. Additional exemplary lipids, in certain embodiments, include, without limitation, those described in Kim et al. (2020) dx.doi.org / 10.1021 / acs.nanolett.0c01386, which is incorporated herein by reference. Such lipids include, in some embodiments, plant lipids found to improve liver transfection with mRNA (e.g., DGTS).

[0569] In some embodiments, the lipid-based carrier (or lipid nanoformulation) may comprise a combination of distearoylphosphatidylcholine / cholesterol, dipalmitoylphosphatidylcholine / cholesterol, dimyrystoylphosphatidylcholine / cholesterol, 1,2- Dioleoyl-sn-glycero-3-phosphocholine (DOPC) / cholesterol, or egg sphingomyelin / cholesterol.

[0570] Other examples of suitable non-cationic lipids include, without limitation, nonphosphorous lipids such as, e.g., stearylamine, dodecylamine, hexadecylamine, acetyl palmitate, glycerol ricinoleate, hexadecyl stearate, isopropyl myristate, amphoteric acrylic polymers, triethanolamine-lauryl sulfate, alkyl-aryl sulfate polyethyloxylated fatty acid amides, dioctadecyl dimethyl ammonium bromide, ceramide, sphingomyelin, and the like. Other noncationic lipids are described in WO 2017 / 099823 or US 2018 / 0028664, which are incorporated herein by reference in their entirety.

[0571] In one embodiment, the lipid-based carrier (or lipid nanoformulation) further comprises one or more non-cationic lipid that is oleic acid or a compound of Formula I, II, or IV of US 2018 / 0028664, which is incorporated herein by reference in its entirety.

[0572] The non-cationic lipid content can be, for example, 0-30% (mol) of the total lipid components present. In some embodiments, the non-cationic lipid content is 5-20% (mol) or 10- 15% (mol) of the total lipid components present.

[0573] In some embodiments, the lipid-based carrier (or lipid nanoformulation) further

[0574] 1601851989.1 95 Atorney Docket No.: F2128-7023WO(VL87022-W1) comprises a neutral lipid, and the molar ratio of an ionizable lipid to a neutral lipid ranges from about 2: 1 to about 8:1 (e.g., about 2: 1, about 3: 1, about 4: 1, about 5: 1, about 6:1, about 7: 1, or about 8: 1).

[0575] In some embodiments, the lipid-based carrier (or lipid nanoformulation) does not include any phospholipids.

[0576] In some embodiments, the lipid-based carrier (or lipid nanoformulation) can further include one or more phospholipids, and optionally one or more additional molecules of similar molecular shape and dimensions having both a hydrophobic moiety and a hydrophilic moiety (e.g., cholesterol).

[0577] Structural Lipids

[0578] The lipid-based carrier (or lipid nanoformulation) described herein may further comprise one or more structural lipids. As used herein, the term “structural lipid” refers to sterols (e.g., cholesterol) and also to lipids containing sterol moi eties.

[0579] Incorporation of structural lipids in the lipid nanoparticle may help mitigate aggregation of other lipids in the particle. Structural lipids can be selected from the group including but not limited to, cholesterol or cholesterol derivative, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, tomatine, ursolic acid, alpha-tocopherol, hopanoids, phytosterols, steroids, and mixtures thereof. In some embodiments, the structural lipid is a sterol. In certain embodiments, the structural lipid is a steroid. In certain embodiments, the structural lipid is cholesterol. In certain embodiments, the structural lipid is an analog of cholesterol. In certain embodiments, the structural lipid is alpha-tocopherol.

[0580] In some embodiments, structural lipids may be incorporated into the lipid-based carrier at molar ratios ranging from about 0.1 to 1.0 (cholesterol phospholipid).

[0581] In some embodiments, sterols, when present, can include one or more of cholesterol or cholesterol derivatives, such as those described in WO 2009 / 127060 or US 2010 / 0130588, which are incorporated herein by reference in their entirety. Additional exemplary sterols include phytosterols, including those described in Eygeris et al. (2020), Nano Lett. 2020;20(6):4543- 4549, incorporated herein by reference.

[0582] In some embodiments, the structural lipid is a cholesterol derivative. Non-limiting examples of cholesterol derivatives include polar analogues such as 5a-cholestanol, 53-

[0583] 1601851989.1 96 Atorney Docket No.: F2128-7023WO(VL87022-W1) coprostanol, cholesteryl-(2’-hydroxy)-ethyl ether, cholesteryl-(4'- hydroxy)-butyl ether, and 6- ketocholestanol; non-polar analogues such as 5a-cholestane, cholestenone, 5a-cholestanone, 5p- cholestanone, and cholesteryl decanoate; and mixtures thereof. In some embodiments, the cholesterol derivative is a polar analogue, e.g., cholesteryl-(4'-hydroxy)-butyl ether. Exemplary cholesterol derivatives are described in WO 2009 / 127060 and US 2010 / 0130588, each of which is incorporated herein by reference in its entirety.

[0584] In some embodiments, the lipid-based carrier (or lipid nanoformulation) further comprises sterol in an amount of 0-50 mol% (e.g., 0-10 mol %, 10-20 mol %, 20-50 mol%, 20- 30 mol %, 30-40 mol %, or 40-50 mol %) of the total lipid components.

[0585] Polymers and Polyethylene Glycol (PEG) - Lipids

[0586] In some embodiments, the lipid-based carrier (or lipid nanoformulation) may include one or more polymers or co-polymers, e.g., poly(lactic-co-gly colic acid) (PF AG) nanoparticles.

[0587] In some embodiments, the lipid-based carrier (or lipid nanoformulation) may include one or more polyethylene glycol (PEG) lipid. Examples of useful PEG-lipids include, but are not limited to, l,2-Diacyl-sn-Glycero-3- Phosphoethanolamine-N-[Methoxy(Poly ethylene glycol)- 350] (mPEG 350 PE); 1,2-Diacyl-sn- Glycero-3-Phosphoethanolamine-N- [Methoxy(Polyethylene glycol)-550] (mPEG 550 PE); 1,2- Diacyl-sn-Glycero-3- Phosphoethanolamine-N-[Methoxy(Polyethylene glycol)-750] (mPEG 750 PE); 1,2-Diacyl-sn- Glycero-3-Phosphoethanolamine-N-[Methoxy(Polyethylene glycol)-1000] (mPEG 1000 PE); l,2-Diacyl-sn-Glycero-3-Phosphoethanolamine-N-[Methoxy(Polyethylene glycol)-2000] (mPEG 2000 PE); l,2-Diacyl-sn-Glycero-3-Phosphoethanolamine-N- [Methoxy(Poly ethylene glycol)- 3000] (mPEG 3000 PE); l,2-Diacyl-sn-Glycero-3- Phosphoethanolamine-N- [Methoxy(Polyethylene glycol)-5000] (mPEG 5000 PE); N-Acyl- Sphingosine- 1- [Succinyl(Methoxy Polyethylene Glycol) 750] (mPEG 750 Ceramide); N-Acyl- Sphingosine- 1- [Succinyl(Methoxy Polyethylene Glycol) 2000] (mPEG 2000 Ceramide); and N- Acyl- Sphingosine-l-[Succinyl(Methoxy Polyethylene Glycol) 5000] (mPEG 5000 Ceramide). In some embodiments, the PEG lipid is a polyethyleneglycol-diacylglycerol (i.e., polyethyleneglycol diacylglycerol (PEG-DAG), PEG-cholesterol, or PEG-DMB) conjugate.

[0588] In some embodiments, the lipid-based carrier (or nanoformulation) includes one or more conjugated lipids (such as PEG-conjugated lipids or lipids conjugated to polymers described in

[0589] 1601851989.1 97 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0590] Table 5 of WO 2019 / 217941, which is incorporated herein by reference in its entirety). In some embodiments, the one or more conjugated lipids is formulated with one or more ionic lipids (e.g., non-cationic lipid such as a neutral or anionic, or zwitterionic lipid); and one or more sterols (e.g., cholesterol).

[0591] The PEG conjugate can comprise a PEG-dilaurylglycerol (Cl 2), a PEG- dimyristylglycerol (C14), a PEG-dipalmitoylglycerol (C16), a PEG-disterylglycerol (C18), PEG- dilaurylglycamide (C 12), PEG-dimyristylglycamide (C 14), PEG-dipalmitoylglycamide (C 16), and PEG-disterylglycamide (Cl 8).

[0592] In some embodiments, conjugated lipids, when present, can include one or more of PEG- diacylglycerol (DAG) (such as l-(monomethoxy-polyethyleneglycol)-2,3- dimyristoylglycerol (PEG-DMG)), PEG-dialkyloxypropyl (DAA), PEG-phospholipid, PEG- ceramide (Cer), a pegylated phosphatidylethanoloamine (PEG-PE), PEG succinate diacylglycerol (PEGS-DAG) (such as 4-0-(2',3'-di(tetradecanoyloxy)propyl-l-0-(w- methoxy(polyethoxy)ethyl) butanedioate (PEG-S-DMG)), PEG dialkoxypropylcarbam, N- (carbonyl-methoxypolyethylene glycol 2000)- 1 ,2-distearoyl-sn-glycero-3-phosphoethanolamine sodium salt, and those described in Table 2 of WO 2019 / 051289 (which is herein incorporated by reference in its entirety), and combinations of the foregoing.

[0593] Additional exemplary PEG-lipid conjugates are described, for example, in US 5,885,613, US 6,287,591, US 2003 / 0077829, US 2003 / 0077829, US 2005 / 0175682, US 2008 / 0020058, US 2011 / 0117125, US 2010 / 0130588, US 2016 / 0376224, US 2017 / 0119904, US 2018 / 0028664, and WO 2017 / 099823, all of which are incorporated herein by reference in their entirety.

[0594] In some embodiments, the PEG-lipid is a compound of Formula III, III-a-I, III-a-2, Ill-b- 1, III-b-2, or V of US 2018 / 0028664, which is incorporated herein by reference in its entirety. In some embodiments, the PEG-lipid is of Formula II of US 2015 / 0376115 or US 2016 / 0376224, both of which are incorporated herein by reference in their entirety. In some embodiments, the PEG-DAA conjugate can be, for example, PEG-dilauryloxypropyl, PEG- dimyristyl oxy propyl, PEG-dipalmityloxypropyl, or PEG-distearyloxypropyl. In some embodiments, the PEG-lipid includes one of the following:

[0595] 1601851989.1 98 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0596] In some embodiments, lipids conjugated with a molecule other than a PEG can also be used in place of PEG-lipid. For example, polyoxazoline (POZ)-lipid conjugates, polyamide-lipid conjugates (such as ATTA-lipid conjugates), and cationic-polymer lipid (GPL) conjugates can be used in place of or in addition to the PEG-lipid.

[0597] Exemplary conjugated lipids, e.g., PEG-lipids, (POZ)-lipid conjugates, ATTA-lipid conjugates and cationic polymer-lipids, include those described in Table 2 of WO 2019 / 051289A9, which is incorporated herein by reference in its entirety.

[0598] In some embodiments, the conjugated lipid e.g., the PEGylated lipid) can be present in an amount of 0-20 mol% of the total lipid components present in the lipid-based carrier (or lipid nanoformulation). In some embodiments, the conjugated lipid (e.g., the PEGylated lipid) content is 0.5-10 mol% or 2-5 mol% of the total lipid components.

[0599] When needed, the lipid-based carrier (or lipid nanoformulation) described herein may be coated with a polymer layer to enhance stability in vivo (e.g., sterically stabilized LNPs).

[0600] Examples of suitable polymers include, but are not limited to, poly(ethylene glycol), which may form a hydrophilic surface layer that improves the circulation half-life of liposomes and enhances the amount of lipid nanoformulations (e.g., liposomes or LNPs) that reach therapeutic targets. See, e.g., Working et al. J Pharmacol Exp Ther, 289: 1128-1133 (1999); Gabizon et al., J Controlled Release 53: 275-279 (1998); Adlakha Hutcheon et al., Nat Biotechnol 17: 775-779 (1999); and Koning et al., Biochim Biophys Acta 1420: 153-167 (1999), which are incorporated herein by reference in their entirety.

[0601] 1601851989.1 99 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0602] Percentages of Lipid Nanoformulation Components

[0603] In some embodiments, the lipid-based carrier (or lipid nanoformulation) comprises one of more of the compounds described herein, optionally a non-cationic lipid (e.g., a phospholipid), a sterol, a neutral lipid, and optionally conjugated lipid (e.g., a PEGylated lipid) that inhibits aggregation of particles. In some embodiments, the lipid-based carrier (or lipid nanoformulation) further comprises a payload (e.g., a DNA molecule described herein). The amounts of these components can be varied independently and to achieve desired properties. For example, in some embodiments, the ionizable lipid including the lipid compounds described herein is present in an amount from about 20 mol% to about 100 mol% (e.g., 20-90 mol%, 20-80 mol%, 20-70 mol%, 25-100 mol%, 30-70 mol%, 30-60 mol%, 30-40 mol%, 40-50 mol%, or 50- 90 mol%) of the total lipid components; a non-cationic lipid (e.g., phospholipid) is present in an amount from about 0 mol% to about 50 mol% (e.g., 0-40 mol%, 0-30 mol%, 5-50 mol%, 5-40 mol%, 5-30 mol%, or 5-10 mol%) of the total lipid components, a conjugated lipid (e.g., a PEGylated lipid) in an amount from about 0.5 mol% to about 20 mol% (e.g., 1-10 mol% or 5- 10%) of the total lipid components, and a sterol in an amount from about 0 mol % to about 60 mol% (e.g., 0-50 mol%, 10-60 mol%, 10-50 mol%, 15-60 mol%, 15-50 mol%, 20-50 mol%, 20- 40 mol%) of the total lipid components, provided that the total mol% of the lipid component does not exceed 100%.

[0604] In some embodiments, the lipid-based carrier (or lipid nanoformulation) comprises about 25-100 mol% of the ionizable lipid including the lipid compounds described herein, about 0-50 mol% phospholipid, about 0-50 mol% sterol, and about 0-10 mol% PEGylated lipid.

[0605] In some embodiments, the lipid-based carrier comprises a payload (e.g., a DNA molecule described herein, etc.) that is formulated in a lipid nanoparticle, wherein the lipid nanoparticle comprises about 25-100 mol% of the ionizable lipid including the lipid compounds described herein, about 0-50 mol% phospholipid, about 0-50 mol% sterol, and about 0-10 mol% PEGylated lipid. In some embodiments, the encapsulation efficiency of the payload may be at least 70%.

[0606] In one embodiment, the lipid-based carrier (or lipid nanoformulation) comprises about 25-100 mol% of the ionizable lipid including the lipid compounds described herein; about 0-40 mol% phospholipid (e.g., DSPC), about 0-50 mol% sterol (e.g., cholesterol), and about 0-10 mol% PEGylated lipid.

[0607] 1601851989.1 100 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0608] In some embodiments, the lipid-based carrier comprises a payload (e.g., a DNA molecule described herein) that is formulated in a lipid nanoparticle, wherein the lipid nanoparticle comprises about 25-100 mol% of the ionizable lipid including the lipid compounds described herein; about 0-40 mol% phospholipid e.g., DSPC), about 0-50 mol% sterol (e.g., cholesterol), and about 0-10 mol% PEGylated lipid. In some embodiments, the encapsulation efficiency of the payload may be at least 70%.

[0609] In some embodiments, the lipid-based carrier (or lipid nanoformulation) comprises about 30-60 mol% (e.g., about 35-55 mol%, or about 40-50 mol%) of the ionizable lipid including the lipid compounds described herein, about 0-30 mol% (e.g., 5-25 mol%, or 10-20 mol%) phospholipid, about 15-50 mol% (e.g., 18.5-48.5 mol%, or 30-40 mol%) sterol, and about 0-10 mol% (e.g., 1-5 mol%, or 1.5-2.5 mol%) PEGylated lipid.

[0610] In some embodiments, the lipid-based carrier comprises a payload (e.g., a DNA molecule described herein) that is formulated in a lipid nanoparticle, wherein the lipid nanoparticle comprises about 30-60 mol% (e.g., about 35-55 mol%, or about 40-50 mol%) of the ionizable lipid including the lipid compounds described herein, about 0-30 mol% (e.g., 5-25 mol%, or 10- 20 mol%) phospholipid, about 15-50 mol% (e.g, 18.5-48.5 mol%, or 30-40 mol%) sterol, and about 0-10 mol% (e.g, 1-5 mol%, or 1.5-2.5 mol%) PEGylated lipid. In some embodiments, the encapsulation efficiency of the payload may be at least 70%.

[0611] In some embodiments, molar ratios of ionizable lipid / sterol / phospholipid (or another structural lipid) / PEG-lipid / additional components is varied in the following ranges: ionizable lipid (25-100%); phospholipid (DSPC) (0-40%); sterol (0-50%); and PEG lipid (0-5%).

[0612] In some embodiments, the lipid-based carrier comprises a payload (e.g., a DNA molecule described herein) that is formulated in a lipid nanoparticle, wherein the lipid nanoparticle comprises molar ratios of ionizable lipid / sterol / phospholipid (or another structural lipid) / PEG- lipid / additional components in the following ranges: ionizable lipid (25-100%); phospholipid (DSPC) (0-40%); sterol (0-50%); and PEG lipid (0-5%). In some embodiments, the encapsulation efficiency of the payload may be at least 70%.

[0613] In some embodiments, the lipid-based carrier (or lipid nanoformulation) comprises, by mol% or wt% of the total lipid components, 50-75% ionizable lipid (including the lipid compound as described herein), 20-40% sterol (e.g, cholesterol or derivative), 0 to 10% non- cationic-lipid, and 1-10% conjugated lipid (e.g., the PEGylated lipid).

[0614] 1601851989.1 101 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0615] In some embodiments, the lipid-based carrier comprises a payload (e.g., a DNA molecule described herein) that is formulated in a lipid nanoparticle, wherein the lipid nanoparticle comprises, by mol% or wt% of the total lipid components, 50-75% ionizable lipid (including the lipid compound as described herein), 20-40% sterol (e.g., cholesterol or derivative), 0 to 10% non-cationic-lipid, and 1-10% conjugated lipid (e.g., the PEGylated lipid). In some embodiments, the encapsulation efficiency of the payload may be at least 70%.

[0616] In some embodiments, the lipid-based carrier (or lipid nanoformulation) comprises (i) a DNA molecule; (ii) a cationic lipid comprising from 50 mol% to 65 mol% of the total lipid present in the lipid-based carrier; (iii) a non-cationic lipid comprising a mixture of a phospholipid and a cholesterol derivative thereof, wherein the phospholipid comprises from 3 mol% to 15 mol% of the total lipid present in the lipid-based carrier and the cholesterol or derivative thereof comprises from 30 mol% to 40 mol% of the total lipid present in the lipid- based carrier; and (iv) a conjugated lipid comprising 0.5 mol% to 2 mol% of the total lipid present in the particle.

[0617] In some embodiments, the lipid-based carrier (or lipid nanoformulation) comprises (i) a DNA molecule; (ii) a cationic lipid comprising from 50 mol % to 85 mol % of the total lipid present in the lipid-based carrier; (iii) a non-cationic lipid comprising from 13 mol % to 49.5 mol % of the total lipid present in the lipid-based carrier; and (d) a conjugated lipid comprising from 0.5 mol % to 2 mol % of the total lipid present in the lipid-based carrier.

[0618] In some embodiments, the phospholipid component in the mixture may be present from 2 mol% to 20 mol%, from 2 mol% to 15 mol%, from 2 mol% to 12 mol%, from 4 mol% to 15 mol%, from 4 mol% to 10 mol%, from 5 mol% to 10 mol%, (or any fraction of these ranges) of the total lipid components. In some embodiments, the lipid-based carrier (or lipid nanoformulation) is phospholipid-free.

[0619] In some embodiments, the sterol component (e.g. cholesterol or derivative) in the mixture may comprise from 25 mol% to 45 mol%, from 25 mol% to 40 mol%, from 25 mol% to 35 mol%, from 25 mol% to 30 mol%, from 30 mol% to 45 mol%, from 30 mol% to 40 mol%, from 30 mol% to 35 mol%, from 35 mol% to 40 mol%, from 27 mol% to 37 mol%, or from 27 mol% to 35 mol% (or any fraction of these ranges) of the total lipid components.

[0620] In some embodiments, the non-ionizable lipid components in the lipid-based carrier (or lipid nanoformulation) may be present from 5 mol% to 90 mol%, from 10 mol% to 85 mol%, or

[0621] 1601851989.1 102 Atorney Docket No.: F2128-7023WO(VL87022-W1) from 20 mol% to 80 mol% (or any fraction of these ranges) of the total lipid components.

[0622] The ratio of total lipid components to the payload (e.g., an encapsulated therapeutic agent such as a DNA molecule) can be varied as desired. For example, the total lipid components to the payload (mass or weight) ratio can be from about 10: 1 to about 30: 1. In some embodiments, the total lipid components to the payload ratio (mass / mass ratio; w / w ratio) can be in the range of from about 1 : 1 to about 25: 1, from about 10: 1 to about 14: 1, from about 3: 1 to about 15: 1, from about 4: 1 to about 10: 1, from about 5: 1 to about 9: 1, or about 6: 1 to about 9: 1. The amounts of total lipid components and the payload can be adjusted to provide a desired N / P ratio, for example, N / P ratio of 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or higher. Generally, the lipid-based carrier’s (or lipid nanoformulation’s) overall lipid content can range from about 5 mg / ml to about 30 mg / mL. Nitrogen: phosphate ratios (N:P ratio) is evaluated at values between 0.1 and 100.

[0623] The efficiency of encapsulation of a payload such as a DNA molecule, describes the amount of the DNA molecule that is encapsulated or otherwise associated with a lipid nanoformulation (e.g., liposome or LNP) after preparation, relative to the initial amount provided. The encapsulation efficiency is desirably high (e.g., at least 70%, at least 80%, at least 90%, at least 95%, or close to 100%). The encapsulation efficiency may be measured, for example, by comparing the amount of DNA molecule in a solution containing the liposome or LNP before and after breaking up the liposome or LNP with one or more organic solvents or detergents. An anion exchange resin may be used to measure the amount of DNA molecule in a solution. Fluorescence may be used to measure the amount of DNA molecule in a solution. For the lipid-based carrier (or lipid nanoformulation) described herein, the encapsulation efficiency of a DNA molecule may be at least 50%, for example 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the encapsulation efficiency may be at least 70%. In some embodiments, the encapsulation efficiency may be at least 80%. In some embodiments, the encapsulation efficiency may be at least 90%. In some embodiments, the encapsulation efficiency may be at least 95%.

[0624] Route of administration

[0625] A DNA molecule described herein may be introduced into a cell, tissue or subject by any suitable route.

[0626] 1601851989.1 103 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0627] Administration to a target cell or tissue (e.g., ex vivo) may be by methods known in the art such as transfection, e.g., transient or stable transfection using reagents (e.g., liposomal, calcium phosphate) or physical means (e.g., electroporation, gene gun, microinjection, microfluidic fluid shear, cell squeezing). Other methods are described, e.g., in Rad et al. 2021. Adv. Mater. 33:2005363, which is incorporated herein by reference.

[0628] Administration to a subject, e.g., a mammal, e.g., a human subject, may be by parenteral (e.g., intravenous, intramuscular, intraperitoneal, subcutaneous, or intracranial) route; by topical administration, transdermal administration or transcutaneous administration. Other suitable routes include oral, rectal, transmucosal, intranasal, inhalation (e.g., via an aerosol), buccal (e.g., sublingual), vaginal, intrathecal, intraocular, transdermal, intraendothelial, in utero (or in ovo), intrapleural, intracerebral, intraarticular, topical, or intralymphatic. Also included is direct tissue or organ injection (e.g., to liver, eye, skeletal muscle, cardiac muscle, diaphragm, muscle or brain).

[0629] Ultrasound

[0630] In some aspects, the present disclosure provides a method of performing ultrasound (e.g., focused ultrasound (FUS)), e.g., for delivery of a DNA molecule described herein. Without wishing to be bound by theory, ultrasound is typically performed as a non-invasive technique that comprises administering ultrasound waves (e.g., sound waves with frequencies greater than 20 kHz) to a subject or a tissue of interest. In some embodiments, the ultrasound that is performed is focused ultrasound (FUS). In some embodiments, the ultrasound that is performed is unfocused ultrasound. In some embodiments, performing ultrasound comprises performing FUS to focus the ultrasound waves to target a precise area. In some embodiments, when combined with the use of bubbles (e.g., microbubbles or nanobubbles), ultrasound allows for delivery of a DNA molecule into a target cell of a tissue, e.g., through enhanced tissue permeabilization. Without wishing to be bound by theory, performing ultrasound on the tissue may induce oscillations of the bubbles, which may result in disruptions to the tight junctions of cells. In some embodiments, the tight junctions of capillary epithelial cells may be disrupted, which may allow for increased delivery of the DNA molecule across an endothelial barrier. In some embodiments, ultrasound is used to permeabilize a nuclear membrane of a target cell. In some embodiments, ultrasound is used to deliver a DNA molecule described herein to a liver

[0631] 1601851989.1 104 Atorney Docket No.: F2128-7023WO(VL87022-W1) tissue, spleen tissue, brain tissue, pancreatic tissue, heart tissue, skeletal muscle tissue, kidney tissue, or tumor tissue. In some embodiments, ultrasound and bubbles may be used to disrupt a blood-brain barrier to deliver the DNA molecule to brain tissue. In some embodiments, ultrasound is used to deliver a DNA molecule described herein to central nervous system (CNS) tissue, spinal cord tissue, dorsal root ganglia, trigeminal ganglia, or lymphatic vessels (e.g., meningeal lymphatic vessels). In some embodiments, ultrasound is used to deliver a DNA molecule described herein to a vascular endothelium. In some embodiments, ultrasound is performed concurrently with, before, or after an imaging step. In some embodiments, ultrasound is performed concurrently with the imaging step. The imaging step may comprise, e.g., magnetic resonance imaging (MRI) or ultrasound (e.g., medical or diagnostic ultrasound).

[0632] Devices for ultrasound

[0633] In some embodiments, a device for performing ultrasound (e.g., FUS) comprises an ultrasound transducer (e.g., a piezoelectric ultrasound transducer). The ultrasound transducer may be used to deliver the ultrasound waves to a tissue. In some embodiments, the ultrasound transducer is a concave focusing transducer. The concave focusing transducer may comprise a fixed aperture and focal length. In some embodiments, the ultrasound transducer is a phase array transducer. In embodiments, the phase array transducer comprises one or more piston transducers that are arranged on a truncated surface of a spherical bowl. In some embodiments, the ultrasound transducer is a flat transducer, otherwise known as a fully populated phase array. In some embodiments, a device for performing ultrasound comprises an acoustic lens. While not wishing to be bound by theory, it is believed that the acoustic lens concentrates multiple ultrasound waves to a targeted area. In some embodiments, a device for administering ultrasound comprises one or more of (e.g., all of) a transducer (e.g., an ultrasound transducer, e.g., a piezoelectric ultrasound transducer), a crystal, an array, an electrode, a control, a power generator, a probe, a sensor, a Piezo ceramic, an amplifiers (e.g., a power amplifier), a transformer, a cable, a coupler, a filter, an accessory, a hydrophone, a phantom, or an acoustic intensity measurement system. In some embodiments, a device for performing ultrasound comprises a single-element transducer, e.g., a single-element FUS transducer. In some embodiments, a device for performing ultrasound comprises an image guidance system. In some embodiments, the image guidance system is used to perform magnetic resonance interference

[0634] 1601851989.1 105 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0635] (MRI). In some embodiments, the image guidance system is used to perform ultrasound (e.g., medical or diagnostic ultrasound). In some embodiments, ultrasound is performed in a water tank (e.g., a degassed water tank). In some embodiments, one or more components in the device for performing ultrasound (e.g., a transducer) is placed inside a water tank (e.g., a degassed water tank).

[0636] Bubbles

[0637] In some aspects, a method described herein, e.g., a method of delivering a DNA molecule described herein, comprises administering a plurality of bubbles and performing ultrasound (e.g., FUS) on a tissue. In some embodiments, the bubbles have an average diameter less than 10 pm. In some embodiments, the bubbles have an average diameter of 50 nm to 10 pm. In some embodiments, the bubbles have an average diameter of 50 nm to 100 nm. In some embodiments, the bubbles have an average diameter of 1 pm to 10 pm.

[0638] In some embodiments, the bubbles comprise a gas comprising octafluoroprane, also known as perflutren. In some embodiments, the bubbles comprise a gas comprising sulfur hexafluoride. In some embodiments, the bubbles comprise a gas comprising perfluorobutane, also known as perflubutane. In some embodiments, the bubbles comprise a gas comprising perfluopentane, also known as perflenapent. In some embodiments, the bubbles comprise a gas comprising perfluorohexane, also known as perflexane. In some embodiments, the bubbles comprise an inert gas. In some embodiments, the bubbles comprise a noble gas, e.g., Xe gas, He gas, or Ar gas. In some embodiments, the bubbles comprise a gas comprising one or more of (e.g., all of) air, nitrogen gas, sulfur hexafluoride gas, perfluorocarbon gas, or fluorocarbon gases.

[0639] In some embodiments, the bubbles comprise an exterior layer, also known as a shell. In some embodiments, the exterior layer of the bubbles comprises one or more of, e g., all of, lipids, proteins, surfactants, or polymers. In some embodiments, the bubbles comprise albumin (e.g., human serum albumin, bovine serum albumin), lysozyme, avidin, or casein. In some embodiments, the proteins comprised in the exterior layer of the bubbles are denatured, e.g., denatured via heating or denatured via sonication, prior to assembly of the bubbles. In some embodiments, the bubbles comprise an exterior layer comprising a phospholipid. In some embodiments, the bubbles comprise an exterior layer comprising distearoylphosphatidylcholine

[0640] 1601851989.1 106 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0641] (DSPC), dipalmitoylphosphatidylcholine (DPPC), l,2-distearoyl-sn-glycero-3-phosphoglycerol (DSPG), distearoylphosphatidylethanolamine (DSPE), distearoylphosphatidylethanolamine-polyethyleneglycol molecular weight 2000 (DSPE- PEG2000), or polyethyleneglycol (PEG). In some embodiments, the exterior layer of the bubbles comprise polylactide-derived or cyanoacrylate polymers. In some embodiments, the bubbles comprise a monolayer lipid shell. In some embodiments, the monolayer lipid shell comprises lipids wherein the hydrophobic tails face toward the gas phase of the bubbles.

[0642] Tissues and Cells for Targeting

[0643] In some aspects, a method described herein comprising performing ultrasound (e.g., FUS) to deliver a DNA molecule described herein into a target cell of a tissue of interest. In some embodiments, ultrasound is used to deliver the DNA molecule into non-dividing cells or dividing cells. In some embodiments, ultrasound is used to deliver the DNA molecule into a hepatocyte, immune cell, neuron, glial cell, ependymal cell, pancreatic islet cell (e.g., alpha, beta, or delta cell), cardiomyocyte, skeletal myocyte, skeletal satellite cell, podocyte, tubular epithelial cell, endothelial cell, or fibroblast. In some embodiments, ultrasound is used to deliver the DNA molecule into the nucleus of a cell. In some embodiments, ultrasound is used to permeabilize a nuclear membrane of a target cell. In some embodiments, ultrasound is used to temporarily permeabilize the blood vessel wall of a capillary (e.g., a capillary of a subject, e g., a human subject). In some embodiments, performing ultrasound enlarges an extracellular space or a perivascular space of a tissue. In some embodiments, performing ultrasound enhances interstitial flow in a brain or a tumor. In some embodiments, ultrasound is used to deliver the DNA molecule to brain tissue. In some embodiments, ultrasound is used to deliver the DNA molecule into a central nervous system (CNS) cell. In some embodiments, ultrasound is used to mediate delivery of a DNA molecule into a tumor. In some embodiments, the tumor comprises a hepatocellular carcinoma, brain tumor, pancreatic cancer, sarcoma, renal cancer, breast cancer, or skin cancer (e.g., a melanoma). In some embodiments, ultrasound is used to mediate delivery of a DNA molecule into a liver tissue, a spleen tissue, a brain tissue, a pancreas tissue, a heart tissue, a skeletal muscle tissue, kidney tissue, tumor tissue, breast tissue, or skin tissue. In some embodiments, ultrasound is performed on a volume of about 1mm3to about 50 cm3.

[0644] 1601851989.1 107 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0645] Administration

[0646] In some embodiments, a device used for performing ultrasound (e.g., FUS) may be used concurrently with a device used to perform MRI (e.g., an MRI scanner). In some embodiments, a device used to perform ultrasound can also perform MRI. In some embodiments, a plurality of bubbles or a DNA molecule (e.g., a DNA molecule described herein) is administered to a subject (e.g., a human subject) intravenously. In some embodiments, the plurality of bubbles or the DNA molecule is administered via intravenous (IV) infusion or IV bolus. In some embodiments, the DNA molecule is injected intravenously such that the DNA molecule reaches a tissue (e.g., the tissue that is targeted by ultrasound). In some embodiments, the plurality of bubbles or the DNA molecule is administered by injection (e.g., direct injection into the tissue of interest). In some embodiments, the plurality of bubbles and the DNA molecule are administered via different modes of administration. In some embodiments, the plurality of bubbles is administered intravenously, and the DNA molecule is administered to the tissue of interest by injection into the tissue. In some embodiments, the DNA molecule is administered intramuscularly or intratum orally.

[0647] In some embodiments, the DNA molecule is formulated, or included, with a carrier. In some embodiments, the DNA molecule is comprised in a nanoparticle (e.g., a nanoparticle that encapsulates or is covalently linked to the DNA molecule, gold nanoparticles, silica nanoparticles). In some embodiments, the DNA molecule is comprised in a lipid nanoparticle (LNP). In some embodiments, the DNA molecule is not comprised in an LNP. In some embodiments, the DNA molecule is comprised in a polymer nanoparticle. In some embodiments, the DNA molecule is comprised in a lipid particle. In some embodiments, the DNA molecule is comprised in a liposome. In some embodiments, the carrier is a cationic carrier (e.g., a cationic lipopolymer or transfection reagent), a fusosome, a non-nucleated cell (e.g., an ex vivo differentiated reticulocyte), a nucleated cell, an exosome, a protein carrier (e.g., a protein covalently linked to the DNA molecule), a peptide (e.g., a cell -penetrating peptide), a material (e.g., graphene oxide), a single pure lipid (e.g., cholesterol), or a DNA origami (e.g., DNA tetrahedron).

[0648] In some embodiments, the plurality of bubbles is administered to the subject at a concentration of 107bubbles / mL solvent to 1010bubbles / mL solvent, e.g., about 109bubbles / mL solvent. In some embodiments, the solvent comprises a biocompatible solvent. In some

[0649] 1601851989.1 108 Atorney Docket No.: F2128-7023WO(VL87022-W1) embodiments, a subject is administered DEFINITY® perflutren lipid microsphere solution. In some embodiments, the plurality of bubbles is administered to a subject at a final concentration of 1 x 104bubbles / g to 1 x 107bubbles / g. In some embodiments, the DNA molecule and the bubbles are administered to the subject at a ratio of 105: 1 to 1010: 1 DNA molecules:microbubbles . In some embodiments, ultrasound is performed at a frequency of 0.2 - 3 MHz (e.g., 0.2-0.5 MHz, 0.5-1.0 MHz, 1.0-1.5 MHz, 1.5-2 MHz, 2-2.5 MHz, or 2.5-3 MHz). In some embodiments, ultrasound is performed at a frequency of about 2 MHz to about 40 MHz (e.g., about 20 MHz). In some embodiments, ultrasound is performed with an ultrasound transducer, e.g., an ultrasound transducer as described herein, e.g., a focused ultrasound transducer. In some embodiments, ultrasound is performed at 5 ps to 0.5 s bursts, e.g., at 5 ms to 20 ms, e.g., at 10 ms bursts. In some embodiments, ultrasound is performed at a pulse repetition frequency of 0.1 to 10 Hz, e.g., about 0.5 Hz. In some embodiments, ultrasound is performed at a peak negative pressure of 0.1 to 2.0 (e.g., 0.1-0.5 MPa, 0.5-1.0 MPa, 1.0 to 1.5 MPa, or 1.5 to 2.0 MPa). In some embodiments, ultrasound is performed for a duration of 1 minute to 10 minutes, e.g., 1 minute to 5 minutes, 1 minute to 3 minutes, 3 minutes to 5 minutes, or 5 minutes to 10 minutes, e.g., about 2 minutes.

[0650] In some embodiments, a method described herein comprises administering a plurality of bubbles, administering a DNA molecule (e.g., an DNA molecule described herein), and performing ultrasound. In some embodiments, the plurality of bubbles is administered after the DNA molecule is administered, and ultrasound is performed after the plurality of bubbles is administered. In some embodiments, the DNA molecule is administered after the plurality of bubbles is administered, and ultrasound is performed after the DNA molecule is administered. In some embodiments, the plurality of bubbles is administered concurrently (e.g., simultaneously) with the DNA molecule. In some embodiments, the plurality of bubbles and the DNA molecule are administered concurrently (e.g., simultaneously) with ultrasound being performed.

[0651] In some embodiments, the plurality of bubbles is administered concurrently (e.g., simultaneously) with ultrasound being performed. In some embodiments, the DNA molecule is administered first, and then the plurality of bubbles is administered concurrently (e.g., simultaneously) with ultrasound being performed. In some embodiments, the DNA molecule is administered concurrently (e.g., simultaneously) with ultrasound being performed. In some

[0652] 1601851989.1 109 Atorney Docket No.: F2128-7023WO(VL87022-W1) embodiments, the plurality of bubbles is administered first, and then the DNA molecule is administered concurrently (e.g., simultaneously) with ultrasound being performed.

[0653] In some embodiments, ultrasound is initiated less than 70 minutes (e.g., less than 1 second, less than 5 seconds, less than 10 seconds, less than 20 seconds, less than 30 seconds, less than 1 minute, less than 2 minutes, less than 3 minutes, less than 4 minutes, less than 5 minutes, less than 6 minutes, less than 7 minutes, less than 8 minutes, less than 9 minutes, less than 10 minutes, less than 15 minutes, less than 20 minutes, less than 25 minutes, less than 30 minutes, less than 35 minutes, less than 40 minutes, less than 45 minutes, less than 50 minutes, less than 55 minutes, less than 60 minutes, or less than 65 minutes) after the administration of the plurality of bubbles is initiated. In some embodiments, ultrasound is initiated less than 70 minutes (e.g., less than 1 second, less than 5 seconds, less than 10 seconds, less than 20 seconds, less than 30 seconds, less than 1 minute, less than 2 minutes, less than 3 minutes, less than 4 minutes, less than 5 minutes, less than 6 minutes, less than 7 minutes, less than 8 minutes, less than 9 minutes, less than 10 minutes, less than 15 minutes, less than 20 minutes, less than 25 minutes, less than 30 minutes, less than 35 minutes, less than 40 minutes, less than 45 minutes, less than 50 minutes, less than 55 minutes, less than 60 minutes, or less than 65 minutes) after administration of the DNA molecule is initiated.

[0654] In some embodiments, administration of a plurality of bubbles is initiated less than 85 minutes (e.g., less than 1 second, less than 5 seconds, less than 10 seconds, less than 20 seconds, less than 30 seconds, less than 1 minute, less than 2 minutes, less than 3 minutes, less than 4 minutes, less than 5 minutes, less than 6 minutes, less than 7 minutes, less than 8 minutes, less than 9 minutes, less than 10 minutes, less than 15 minutes, less than 20 minutes, less than 25 minutes, less than 30 minutes, less than 35 minutes, less than 40 minutes, less than 45 minutes, less than 50 minutes, less than 55 minutes, less than 60 minutes, less than 65 minutes, less than 70 minutes, less than 75 minutes, or less than 80 minutes) after administration of the DNA molecule is initiated. In some embodiments, administration of the DNA molecule is initiated less than 85 minutes (e.g., less than 1 second, less than 5 seconds, less than 10 seconds, less than 20 seconds, less than 30 seconds, less than 1 minute, less than 2 minutes, less than 3 minutes, less than 4 minutes, less than 5 minutes, less than 6 minutes, less than 7 minutes, less than 8 minutes, less than 9 minutes, less than 10 minutes, less than 15 minutes, less than 20 minutes, less than 25 minutes, less than 30 minutes, less than 35 minutes, less than 40 minutes, less than 45 minutes,

[0655] 1601851989.1 110 Atorney Docket No.: F2128-7023WO(VL87022-W1) less than 50 minutes, less than 55 minutes, less than 60 minutes, less than 65 minutes, less than 70 minutes, less than 75 minutes, or less than 80 minutes) after administration of the plurality of bubbles is initiated.

[0656] In some embodiments, a method described herein comprises a first step (e.g., administration of a composition or performing ultrasound) and a second step (e.g., administration of a second composition or performing ultrasound) wherein the first step is begun, then the second step is begun such that there is overlap in time of the first step and second step. In some embodiments, the first step may end before the second step ends. In some embodiments, the second step may end before the first step ends. In some embodiments, the first step and the second step end at the same time. In some embodiments, the first step and the second step begin at the same time, but end at different times. In some embodiments, the first step and the second step begin at different times and end at the same time. In some embodiments, the first step and the second step begin at different times and end at different times.

[0657] In some embodiments, the method comprises two or more steps, wherein the two or more steps are being performed at the same time, and wherein the start and end of each step are not necessarily at the same time. In some embodiments, the method comprises a first step, a second step, and a third step, such that there is overlap in time of all of the first step, second step, and third step. In some embodiments, the start and end of each step are at the same time. In some embodiments, the start and end of each step are at different times. In some embodiments, there is a period of time of at least 3 seconds (e.g., at least 5 seconds, at least 10 seconds, at least 30 seconds, at least 1 minute, at least 5 minutes, at least 10 minutes, at least 30 minutes, at least 60 minutes) where two or more of the steps overlap.

[0658] In some embodiments, when a first step and second step are being performed concurrently, the first step starts at least 3 seconds (e.g., at least 5 seconds, at least 10 seconds, at least 30 seconds, at least 1 minute, at least 5 minutes, at least 10 minutes, at least 30 minutes, at least 60 minutes) before the second step starts. In some embodiments, when a first step and second step are being performed concurrently, the first step starts at least 3 seconds (e g., at least 5 seconds, at least 10 seconds, at least 30 seconds, at least 1 minute, at least 5 minutes, at least 10 minutes, at least 30 minutes, at least 60 minutes) after the second step starts. In some embodiments, when a first step and second step are being performed concurrently, the first step ends at least 3 seconds (e.g., at least 5 seconds, at least 10 seconds, at least 30 seconds, at least 1

[0659] 1601851989.1 111 Atorney Docket No.: F2128-7023WO(VL87022-W1) minute, at least 5 minutes, at least 10 minutes, at least 30 minutes, at least 60 minutes) before the second step ends. In some embodiments, when a first step and second step are being performed concurrently, the first step ends at least 3 seconds (e.g., at least 5 seconds, at least 10 seconds, at least 30 seconds, at least 1 minute, at least 5 minutes, at least 10 minutes, at least 30 minutes, at least 60 minutes) after the second step ends.

[0660] In some embodiments, a method described herein comprises a first step (e.g., administration of a composition or performing ultrasound) and a second step (e.g., administration of a second composition or performing ultrasound), wherein the first step and second step are simultaneous. In some embodiments, the first step and the second step start at the same time and end at the same time. In some embodiments, the method comprises two or more steps, wherein the two or more steps start at the same time and end at the same time. In some embodiments, the method comprises a first step, a second step, and a third step, wherein the first step, second step, and third step all start at the same time and end at the same time.

[0661] Applications

[0662] The DNA molecule described herein can be used in therapeutic or health applications for a subject, e.g., a human or non-human animal. Although the descriptions of pharmaceutical compositions provided herein are principally directed to pharmaceutical compositions which are suitable for administration to humans, it will be understood by the skilled artisan that such compositions are generally suitable for administration to any other animal. The subject can be any animal, e.g., a mammal, e.g., a human or non-human mammal. In embodiments, the subject is a vertebrate animal (e.g., mammal, bird, fish, reptile, or amphibian). In embodiments, the subject is a human. In embodiments, the method subject is a non-human mammal. In embodiments, the subject is a non-human mammal is such as a non-human primate (e.g., monkeys, apes), ungulate (e.g., cattle, buffalo, sheep, goat, pig, camel, llama, alpaca, deer, horses, donkeys), carnivore (e.g., dog, cat), rodent (e.g., rat, mouse), or lagomorph (e.g., rabbit). In embodiments, the subject is a bird, such as a member of the avian taxa Galliformes (e.g., chickens, turkeys, pheasants, quail), Anseriformes (e.g., ducks, geese), Paleaognathae (e.g., ostriches, emus), Columbiformes (e.g., pigeons, doves), or Psittaciformes (e.g., parrots). In embodiments, the subject is an invertebrate such as an arthropod (e.g., insects, arachnids, crustaceans), a nematode, an annelid, a helminth, or a mollusk.

[0663] 1601851989.1 112 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0664] In some embodiments, a DNA molecule described herein is provided at a dose of about 0.1-100 mg / kg ofDNA.

[0665] In some embodiments, a DNA molecule described herein imparts a biological effect of the effector, e.g., expression of a therapeutic polypeptide, on a host cell, tissue or subject over a time period of at least 2, at least 3, at least 4, at least 5, at least 6 days or a week; at least 8, at least 9, at least 10, at least 12, at least 14 days or two weeks; at least 16, at least 18, at least 20 days or 3 weeks; at least 22, at least 24, at least 25, at least 27, at least 28 days or a month; at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months or more; between one week and 6 months, between 1 month to 6 months, between 3 months to 6 months.

[0666] In some embodiments, a DNA molecule described herein imparts a biological effect of the effector, e.g., expression of a therapeutic polypeptide, on a host cell, tissue or subject over a time period of at least 1 cell divisions of the host cell.

[0667] In embodiments, a DNA molecule described herein can be used to deliver an effector, e.g., an effector described herein, to a cell, tissue or subject. In some embodiments, the cell is an animal cell, e.g., a mammalian cell, e.g., a human cell. In some embodiments, the cell is a hepatocyte.

[0668] In embodiments, a DNA molecule described herein can be used to modulate (e.g., increase or decrease) a biological parameter in a cell, tissue or subject. The biological parameter may be an increase or decrease in gene expression of a subject gene in a target cell, tissue or subject. In some embodiments, a DNA molecule described herein increases or decreases a biological activity in a target cell, wherein the biological activity comprises cell growth, cell metabolism, cell signaling, cell movement, specialization, interactions, division, transport, homeostasis, osmosis, or diffusion. In some embodiments, the cell is an animal cell, e.g., a mammalian cell, e g., a human cell.

[0669] In embodiments, a DNA molecule described herein can be used to treat a cell, tissue or subject in need thereof by administering the DNA molecule described herein to such cell, tissue or subject.

[0670] In embodiments, the DNA molecule delivers an effector to a cell.

[0671] In some embodiments, a user chooses a target cell and then delivers DNA to that cell using a method of delivery described herein. In other embodiments, a user delivers DNA to a target cell in a tissue without specifically choosing the target cell beforehand. For example, if a

[0672] 1601851989.1 113 Atorney Docket No.: F2128-7023WO(VL87022-W1) user delivers DNA to a target tissue, and 10 cells in the target tissue take up the DNA, those 10 cells are target cells even if the user did not specifically choose those 10 cells over other cells in the tissue. A target cell may come into contact with or receive a DNA molecule described herein. A target cell may be a cell of a type to which it is desired to receive one or all of a DNA molecule as described herein, a plurality of bubbles, or ultrasound. The combination of administering a DNA molecule, administering a plurality of bubbles, and performing ultrasound may lead to preferential delivery of the DNA molecule to a target cell compared to a non-target cell. In some embodiments, a cell of the same type of the target cell or in the same tissue as the target cell does not receive one or all of a DNA molecule as described herein, a plurality of bubbles, or ultrasound.

[0673] EXAMPLES

[0674] Example 1 : Synthesis of a circular single stranded DNA containing a clickable functional group This example describes the production of the first strand of DNA as described herein. In this example, the first strand of DNA is a circular single stranded DNA (cssDNA) containing a functional group, e.g., a click handle.

[0675] To produce the first strand of DNA, a region of interest, e.g., a region that comprises the sequence of the first strand of DNA, in a template DNA, e.g., a plasmid or another DNA form, is amplified by PCR using two primers: a forward, unmodified primer, and a reverse primer containing a conjugation handle, such as a deoxyribonucleotide containing an azido group. Sequences recognized by a specific restriction enzyme, e.g., Bsal enzyme, is located within the nucleic acid sequences recognized by the forward primer and the reverse primer and amplified by PCR. For example, the sequence recognized by Bsal is GGTCTCAAGAAG_C (SEQ ID NO: 1), wherein the “A” symbol indicates the region where Bsal cuts a first strand of the PCR product comprising the exact nucleotide sequence of SEQ ID NO: 1, and the symbol indicates the region where Bsal cuts a second strand of the PCR product comprising the complementary nucleotide sequence of SEQ ID NO: 1.

[0676] Alternatively, if the sequence recognized by the specific restriction enzyme is not present in the template DNA, the forward primer and the reverse primer are designed to comprise the sequence recognized by the specific restriction enzyme. For instance, a forward primer

[0677] 1601851989.1 114 Atorney Docket No.: F2128-7023WO(VL87022-W1) comprises the nucleic acid sequence of GCGCGGTCCTTCGGTCTCAGAAGCATTGCGCTGCTTCGCGATGTACGGGCCAG (SEQ ID NO: 2), and a reverse primer comprises the nucleic acid sequence of CACACGTCCCGAGGTCTCACTTCGC / iAzideN / ATAGAGCCCACCGCATCCCCAG (SEQ ID NO: 3). As another example, both the forward and the reverse primers may comprise the nucleic acid sequence of G / AATTC, which can be recognized and cleaved by restriction enzyme EcoRI, wherein the “ / ” symbol indicates the region where the nickase is introduced.

[0678] The PCR product is then incubated with a buffer, DNA, and the restriction enzyme to produce compatible overhangs at the 5’ and 3’ end of the PCR product.

[0679] The PCR products comprising the compatible overhangs are then circularized to produce a dsDNA product. For example, the PCR products (16 ng / pl) are incubated with T3 DNA ligase (NEB M0317, 300 units / pg of DNA) in lx T4 DNA ligase buffer at 23°C for one hour or overnight. Alternatively, the PCR products are circularized by incubating with a dsDNA ligase, e.g., T4 DNA ligase (NEB#M0202), and an appropriate buffer. Residual, non-circular dsDNA can be removed by T5 exonuclease (NEB, M0663) digestion.

[0680] A cssDNA is then produced from the dsDNA product by inducing a nick in a strand, e.g., in the sense strand, using a nickase, e.g., Nb.BsrDI (NEB, R0648). The DNA sequence recognized by the nickase is present in the template DNA. For example, Nb.BsrDI recognizes the sequence 5’-GCAATG-3’, and it nicks the other strand after the last G in the 3’ end. If the DNA sequence recognized by the nickase is not present in the template DNA, the DNA sequence recognized by the nickase is added to one of the PCR primers. For example, the forward primer of SEQ ID NO: 2 comprises the DNA sequence recognized by Nb.BsrDI sequence that can induce a nick in the sense strand of the PCR product. The below sequence is that of SEQ ID NO: 2 except that the underlined sequences is the Nb.BsrDI recognizing sequence, and the “A” symbol indicates the region where the nick is introduced: GCGCGGTCCTTCGGTCTCAGAAGACATTGCGCTGCTTCGCGATGTACGGGCCAG (SEQ ID NO: 6).

[0681] The dsDNA product is incubated with the nickase enzyme in rCutSmart buffer for 1 hr for the nicking reaction. The nicked DNA strand of the dsDNA product is then removed by incubation with an exonuclease, e.g., Exonuclease III (NEB, M0206), T7 exonuclease (NEB, M0263), X, exonucleases (NEB M0262), or a combination of T7 and X exonucleases, in NEB

[0682] 1601851989.1 115 Atorney Docket No.: F2128-7023WO(VL87022-W1) rCutSmart Buffer (NEB#B6004) at 37°C for overnight. The product of this reaction is cssDNA containing the reactive handle (e.g., click handle).

[0683] A double-stranded DNA-specific restriction enzyme and an exonuclease is then used to remove residual dsDNA and enrich the cssDNA. For example, double-stranded DNA is digested with Avril (NEB#R0174), BssSI (NEB#R0680), PstI (NEB#R0140), or XmnI (NEB#R0194) or in combination, at 37°C for 1 hr following the exonuclease (which is, e.g., the same exonuclease used to remove the nicked strand or in combination with Exonuclease I (NEB#M0293) treatment at 37°C for 1 hr. The exonuclease is then removed either by heat inactivation (75°C for 10 min) or by DNA enrichment (Zymo#D4004). CssDNA is then measured for enrichment via the 4200 Tapestation (G2991BA, Agilent).

[0684] Example 2: Production of primed cssDNA (primeCS)

[0685] This example describes the addition of the second strand of DNA as described herein. In this example, the second strand of DNA is a priming oligonucleotide that comprises a reactive handle, e.g., a click handle, that is capable of reacting with the first strand of DNA, e.g., the cssDNA produced in Example, 1 to form a covalent bond.

[0686] The cssDNA is incubated with an oligonucleotide comprising a region complementary to a portion of the cssDNA and a complementary conjugation handle, e.g., DBCO, Alkyne dUTP (CLK-T05), TCO-PEG-dUTP (CLK-035), or DBCO-PEG-dUTP (CLK-060), at the 5’ end of the oligonucleotide.

[0687] A covalent bond is created between the cssDNA and the oligonucleotide through a covalent conjugation reaction, e.g., click chemistry. The cssDNA (concentration between 100- 400ng / uL) is incubated in a ratio of 1 :20 with the oligonucleotide, e.g., comprising DBCO, in 20mM HEPES buffer (Thermo, 15630080) in a sterile PCR tube strip. The mixture is incubated at 37°C for 3 hours. This results in the production of a DNA molecule described herein, more specifically a cssDNA molecule comprising an oligonucleotide complementary to a portion of the cssDNA that is covalently linked to the cssDNA.

[0688] Unligated oligonucleotides are removed by incubating with a single-stranded DNA- specific exonuclease, e.g., Exonuclease I (NEB, M0293) in lx CutSmart buffer (NEB, B6004S) for 30 min at 37°C, followed by enrichment using a column (Monarch 50ug RNA cleanup kit, cat# T2040L) to remove the digested products and residual exonuclease.

[0689] 1601851989.1 116 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0690] Example 3: Delivery of Naked DNA molecules

[0691] This example describes focused ultrasound (FUS) delivery of an unencapsulated “naked” DNA molecule encoding an exogenous effector to the liver or spleen in mice.

[0692] Unencapsulated DNA molecules described herein are prepared in sterile saline and are dosed via bolus (5 mL / kg) intravenous administration to a final dose of between 0.1 and 2 mg / kg into mice. Immediately following, microbubbles (Definity) are administered via IV bolus to a final concentration of 0.5e5 - le7 microbubbles / g body weight. A focused ultrasound transducer with a center frequency of 0.5 - 2 MHz is positioned such that the ultrasound focus is aligned with the targeted spleen or liver. Ultrasound application begins within 30 seconds after administration of the DNA molecule and microbubbles. The transducer is operated in 10 ms bursts, 0.5 Hz pulse repetition frequency, 0.1 - 2 MPa peak negative pressure for a total two minute duration.

[0693] For DNA molecules that encode luciferase, the successful delivery of DNA molecules can be verified via bioluminescence. Seven days after dosing and FUS application, mice receive an intraperitoneal dose of luciferin (150 mg / kg). Bioluminescence is captured by an In Vivo Imaging System (IVIS) and is quantified using proprietary software.

[0694] Example 4: Production of Lipid Nanoparticle-encapsulated DNA molecules

[0695] This example describes the encapsulation of DNA molecules encoding an exogenous effector into lipid nanoparticles (LNPs) prior to dosing into mice.

[0696] LNPs are formulated encapsulating DNA molecules described herein encoding an exogenous effector using standard formulation methods. In brief, the DNA molecules are diluted into citrate buffer (pH 4.0), and a lipid mixture (50% ionizable lipid, 10% DSPC, 38.5% cholesterol and 1.5% DMG-PEG2000 by mole) is dissolved into ethanol. The two solutions are mixed rapidly at a ratio of 3: 1 DNAdipid solution (vokvol). LNPs are washed and concentrated using Amicon centrifugal filter units (100 kDa, UFC8100, Millipore) before characterization.

[0697] Example 5: Delivery of Lipid Nanoparticle-encapsulated DNA molecules

[0698] This example describes FUS delivery of DNA molecules that are encapsulated in LNPs, as prepared in Example 4, to the liver or spleen in mice.

[0699] 1601851989.1 117 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0700] LNPs encapsulating DNA molecules described herein are prepared in sterile saline and dosed via bolus (5 mL / kg) intravenous administration to a final dose of between 0.1 and 2 mg DNA / kg into mice. Immediately following, microbubbles (Definity) are administered via IV bolus to a final concentration of 0.5e5 - le7 microbubbles / g body weight. A focused ultrasound transducer with a center frequency of 0.5 - 2 MHz is positioned such that the ultrasound focus is aligned with the targeted spleen or liver. Ultrasound application begins within 30 seconds after administration of DNA molecule and microbubbles. The transducer is operated in 10 ms bursts, 0.5 Hz pulse repetition frequency, 0.1 - 2 MPa peak negative pressure for a total two minute duration.

[0701] For LNPs comprising DNA molecules that encode luciferase, the successful delivery of the DNA molecules can be verified via bioluminescence. Seven days after dosing and FUS application, mice receive an intraperitoneal dose of luciferin (150 mg / kg). Bioluminescence is captured by an In Vivo Imaging System (IVIS) and quantified using proprietary software.

[0702] Example 6: Synthesis of a circular single stranded DNA containing a clickable functional group

[0703] This example demonstrates production of a circular single stranded DNA (cssDNA) containing a functional group.

[0704] A region of interest in a plasmid DNA was amplified by PCR using two primers: a forward unmodified primer (Primer A), and a reverse unmodified primer (Primer B) or a reverse modified primer containing a conjugation handle, such as deoxyribonucleotide containing an azido group ( / iAzideN / , which is a nucleotide comprising a thymine nucleobase and an azido group, in Primer C). Primers A and B were used to produce cssDNA that lacks a conjugation handle, while Primers A and C were used to produce cssDNA comprising a conjugation handle. Sequences recognized by the restriction enzyme Bsal were included in the nucleic acid sequences of the forward primer and the reverse primer, such that the sequences recognized by Bsal were amplified by PCR and included in the PCR product. Alternatively, if the sequences recognized by the restriction enzyme are present in the template DNA, primers can be designed to amplify that region.

[0705] An example for a sequence recognized by Bsal-HF V2 (NEB, R3733) to generate compatible overhangs is GGTCTCAAGAAG_C (SEQ ID NO: 1), wherein the “A” symbol indicates the region where Bsal-HF V2 cuts a first strand of the PCR product comprising the

[0706] 1601851989.1 118 Atorney Docket No.: F2128-7023WO(VL87022-W1) exact nucleotide sequence of SEQ ID NO: 1, and the symbol indicates the region where Bsal-HF V2 cuts a second strand of the PCR product comprising the complementary nucleotide sequence of SEQ ID NO: 1.

[0707] Another example of a sequence to include in the primers (both forward and reverse) is G / AATTC which can be cleaved by restriction enzyme EcoRI-HF (NEB, R3101) to create compatible overhangs, wherein the symbol indicates the region where the enzyme cuts.

[0708] Primers

[0709] Unmodified Forward (PrimerA): GCGCGGTCCTTCGGTCTCAGAAGGCTGCTTCGCGATGTACGGGCCAG (SEQ ID NO: 7) Unmodified Reverse (Primer B): CACACGTCCCGAGGTCTCACTTCGCCATAGAGCCCACCGCATCCCCAG (SEQ ID NO: 8)

[0710] Modified Reverse (PrimerC): CACACGTCCCGAGGTCTCACTTCGC / iAzideN / ATAGAGCCCACCGCATCCCCAG (SEQ ID NO: 3)

[0711] Overhangs in the PCR product were created by incubating the DNA in a restriction enzyme digestion reaction that included a buffer, DNA, and the restriction enzyme. PCR products containing the overhangs were circularized in a reaction containing DNA (16 ng / pl), T3 DNA ligase (300 units / pg of DNA; New England Biolabs, NEB#M0317) in lx T4 DNA ligase buffer, and the reactions were incubated at 23 °C for one hour or overnight. T4 DNA ligase (New England Biolabs, NEB#M0202) may also be used. Residual, non-circular dsDNA were removed by T5 exonuclease (New England Biolabs, NEB, M0663) digestion. cssDNA were produced from these dsDNA products by inducing a nick in the sense strand of the dsDNA using the nickase Nb.BssSI (New England Biolabs, NEB# R0681). Other nickases that induce a break in only one strand of a dsDNA may be used. The DNA sequence recognized by the nickase can be included in the DNA template in the desired orientation either in the sense or antisense strand. For instance, Nb.BssSI recognizes the sequence 5’-CACGAG- 3’, and it nicks the opposite strand after the last C in the 3’ end. If none is present, the nickase sequence can be added to one of the PCR primers.

[0712] 1601851989.1 119 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0713] The nicking reaction was performed by treating the dsDNA template with the nickase enzyme in rCutSmart buffer for 5-6 hrs at 40C. The nicked DNA strand was removed by incubation with T7 exonuclease (NEB M0263) in NEB rCutSmart Buffer (NEB#B7204) at 40C for overnight. Other exonucleases that may be used include Exonuclease III (NEB, M0206) or A exonucleases (NEB#M0262), or a combination of T7 exonuclease and A exonuclease.

[0714] The product of this reaction was cssDNA containing the conjugation handle, as shown in the left panel of Fig. 2A.

[0715] To enrich for the cssDNA, residual dsDNA was removed from the sample by incubation with XmnI (NEB#R0194), a double-stranded DNA-specific restriction enzyme, at 40C for 1-2 hours, then enriched by columns.

[0716] As shown in Fig. 2B, cssDNA that comprise a conjugation handle was successfully enriched, as analyzed using 4200 Tapestation (G2991BA, Agilent).

[0717] Example 7: Production of primed cssDNA (primeCS)

[0718] This example demonstrates the addition of a priming oligonucleotide that contains a functional group that reacts with the cssDNA precursor made in Example 6 to form a covalent bond.

[0719] The cssDNA produced as described in Example 6 was incubated with an oligonucleotide with a region complementary to a portion of the cssDNA and comprising iAmMC6T, (which can be activated to DBCO) at the 5’ end for terminal (PrimerD) or proximal to the 5’ end for internal modification (Primer E) of the oligonucleotide.

[0720] Sequences of the primers for conjugation:

[0721] Oligos with terminal modification (PrimerD): / 5Phos / / iAmMC6T / *A*G*C*G*AAGGCTGCTTCGCGATGTACGGGCCAGATATACG*C*G* T*T*G (SEQ ID NO: 40)

[0722] Oligos with internal modification (PrimerE):

[0723] / 5Phos / T*C*T*A* / iAmMC6T / *AGCGAAGGCTGCTTCGCGATGTACGGGCCAGATATACG

[0724] *C*G*T*T*G (SEQ ID NO: 9)

[0725] 1601851989.1 120 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0726] The modified oligos were end-protected by phosphorothioate modification (denoted by *as shown in the PrimerD and PrimerE oligos above), rendering them resistant to nuclease degradation.

[0727] Modified oligos (containing iAmMC6T functional group, PrimerD and PrimerE) were activated using lOOx molar excess of 20mM DBCO-NHS ester (Broad Pharm, BP-22231) for 45 min at 25C and enriched by NAP-10 columns (Cytiva, 17085401), thereby producing oligonucleotides comprising a DBCO click handle. Percent modification was analyzed by HPLC and the oligonucleotides were further enriched by precipitation with 1 / 10 volume of 5M NaCl (Invitrogen, AM9760G) and 3x volume of cold ethanol (Fisher, BP2818_500). iAmMC6T (Int Amino Modifier C6 dT) is available from Integrated DNA Technologies.

[0728] A covalent bond was created between the cssDNA and the oligonucleotide (comprising the DBCO click handle) through a click reaction to generate a PrimeCS molecule. cssDNA at a concentration between 100-400ng / uL was incubated in 20mM HEPES buffer pH7.3 (Thermo, 15630080) with the oligonucleotides comprising a DBCO click handle at 1: 100 molar ratio in a sterile PCR tube strip. The mixture was allowed to react to 37C for 3hrs. This resulted in PrimeCS-A comprising PrimerE (where the linkage is situated on a nucleotide internal to the oligonucleotide), or PrimeCS-B comprising PrimerD (where the linkage is situated at the 5’ most nucleotide of the oligonucleotide), as shown in Fig. 2A.

[0729] Unligated oligonucleotides were removed from the PrimeCS preparation by SEC-HPLC fractionation followed by enrichment using a column (Monarch, T2040). As shown in Figs. 2C- 2D, PrimeCS-A (Fig. 2C) and PrimeCS-B (Fig. 2D) were successfully enriched, as analyzed by 4200 Tapestation.

[0730] Example 8: Assessment of reporter gene expression of PrimeCS molecules in vitro

[0731] This example demonstrates detection and quantification of gene expression using PrimeCS molecules.

[0732] Fa2N cells were cultured in William’s E medium (Thermo# A12176-01) supplemented with Dexamethasone (Thermo# Al 3449), Primary hepatocyte maintenance cocktail (Thermo# A13448), ROCK inhibitor y-27632 (Stem cell#129830-38-2) and FBS (Thermo# A5670401). Cells were plated at a density of 20,000 cells / well of a 96 well plate on the day before transfection. 100 ng of PrimeCS-A or PrimeCS-B encoding the fluorescent reporter eGFP,

[0733] 1601851989.1 121 Atorney Docket No.: F2128-7023WO(VL87022-W1) prepared as described in Examples 6 and 7, and controls, such as cssDNA that comprises a clickable functional group but is not covalently linked to a second strand of DNA (produced as described in Example 6), were administered via lipid transfection using Lipofectamine 3000 transfection reagent (Thermo#L3000150) and optiMEM (Thermo#31985062) in a total volume of 4uL into the cells to determine expression of eGFP. eGFP expression was analyzed 48 hours post transfection by FACS (fluorescence activated cell sorter, Attune, Thermo Fisher) analysis.

[0734] Fig- 3 shows that PrimeCS molecules were functional with detectable expression of the reporter protein eGFP.

[0735] Example 9: Assessment of innate immune response of PrimeCS molecules in cells in vitro

[0736] This example demonstrates the effect of PrimeCS molecules on the immune response of cultured cells.

[0737] PrimeCS-A or PrimeCS-B molecules, prepared as described in Examples 6 and 7, and controls, such as cssDNAthat comprises a clickable functional group but is not covalently linked to a second strand of DNA (produced as described in Example 6) and circular double-stranded DNA that lacks chemically modified nucleotides, were administered to fibroblasts, HDF-alpha (ThermoFisher, Cat#C0135C) cells cultured in MesenCult MSC Basal medium (Human) (StemCell, Cat# 05401) with MesenCult MSC Stimulatory Supplement (Human) (StemCell, Cat# 05402) to assess the immune response. Cells were seeded a day prior to transfection at a density of 15,000 cell / well on a Collagen I-coated 96 well flat bottom plate (StemCell, Cat# 100- 03666), at lOOuL of final volume per well. Delivery of DNA to HDF-alpha cells was mediated by Lipofection with Lipofectamine Stem reagent (ThermoFisher, Cat# STEM00015) a day after seeding. 100 ng of the DNA molecules were delivered with a corresponding amount of 0.6 uL of LipoStem per well. Liposome formation with DNA was carried out in OPTI-MEM medium (Gibco, Cat# 31985-062). 5 uL of OPTI-MEM were mixed with the 0.6 uL of LipoStem, and the remaining OPTI-MEM was mixed with the DNA to result in a final amount of 10 uL per well. After spinning, the cells were incubated at 37C, 5% CO2, for 6 hours for cGAMP detection, and 24 hours for detection of cytokines. 6 hours post transfection, supernatants were collected. cGAMP detection was performed using the 2’3’-CyclicGAMP competitive ELISA kit (ThermoFisher, Cat# EIAGAMP). Cytokine detection was performed with LEGENDplex Human Anti-virus response panel 1 (13-plex) (Biolegend, Cat# 741270).

[0738] 1601851989.1 122 Atorney Docket No.: F2128-7023WO(VL87022-W1)

[0739] Fig. 4A shows the levels of cGAMP in cells treated with the PrimeCS molecules, cssDNA comprising a clickable functional group, or circular double-stranded DNAthat lacks chemically modified nucleotides. cGAMP levels were lower in cells transfected with the PrimeCS molecules (PrimeCS-A or PrimeCS-B) as compared to cells transfected with circular double-stranded DNA at the same molar amount as the PrimeCS molecules.

[0740] Fig. 4B shows the expression levels of cytokines in cells treated with the PrimeCS molecules, cssDNA comprising a clickable functional group, or circular double-stranded DNA that lacks chemically modified nucleotides. The levels of several cytokines, such as IFN-a2, IFN-P, IFN-X1, IP-10, and IL-ip, were lower for cells transfected with PrimeCS molecules as compared to cells transfected with circular double-stranded DNA.

[0741] For all patents, applications, or other reference cited herein, such as non-patent literature and reference sequence information, it should be understood that they are incorporated by reference in their entirety for all purposes as well as for the proposition that is recited. Where any conflict exists between a document incorporated by reference and the present application, this application will control. All information associated with reference gene sequences disclosed in this application, such as GenelDs or accession numbers (typically referencing NCBI accession numbers), including, for example, genomic loci, genomic sequences, functional annotations, allelic variants, and reference mRNA (including, e g., exon boundaries or response elements) and protein sequences (such as conserved domain structures), as well as chemical references (e.g., PubChem compound, PubChem substance, or PubChem Bioassay entries, including the annotations therein, such as structures and assays, et cetera), are hereby incorporated by reference in their entirety.

[0742] Headings used in this application are for convenience only and do not affect the interpretation of this application.

[0743] 1601851989.1 123

Claims

Attorney Docket No.: F2128-7023WO(VL87022-W1)CLAIMS1. A DNA molecule comprising: a first strand of DNA, wherein the first strand is circular and is single stranded over at least 90% of its length; and a second strand of DNA, wherein the second strand is linear, has a length of less than 200 nucleotides, and at least a portion of the second strand is complementary to a contiguous portion of the first strand; wherein the second strand is covalently linked to the first strand.

2. The DNA molecule of claim 1, wherein the second strand is covalently linked to the first strand via a reactive linker, e.g., a click linker.

3. The DNA molecule of claim 2, wherein the reactive linker, e.g., click linker, is situated between a first nucleotide in the first strand and a second nucleotide in the second strand.

4. The DNA molecule of claim 2 or 3, wherein the click linker was formed by reaction of azide with DBCO.

5. The DNA molecule of any of claims 1-4, wherein at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of nucleotides of the second strand are paired with complementary nucleotides of the first strand.

6. The DNA molecule of any of claims 1-5, wherein the second strand has a length of at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 120, at least 140, at least 160, or at least 180 nucleotides.

7. The DNA molecule of any of claims 1-6, wherein the first strand is covalently closed.

8. The DNA molecule of any of claims 1-7, wherein the first strand is single stranded over at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of its length.1601851989.1 124Attorney Docket No.: F2128-7023WO(VL87022-W1)9. The DNA molecule of any of claims 1-8, wherein the first strand has a length of at least 200, at least 300, at least 400, at least 500, at least 1000, at least 1500, at least 2000, at least 3000, at least 4000, at least 5000, at least 6000, at least 7000, at least 8000, at least 9000, at least 10000, at least 11000, or at least 12000 nucleotides.

10. The DNA molecule of any of claims 1-9, wherein the first strand comprises a promoter sequence and an effector sequence that encodes an effector (e.g., a therapeutic effector).

11. The DNA molecule of claim 10, wherein the effector comprises a polypeptide (e.g., a DNA binding protein; an epigenetic modifying factor; an antigen; a hormone; an enzyme; a nuclease element of a CRISPR system; a mobile genetic element protein; a gene writer; an antibody; a signaling peptide; a receptor ligand; a receptor; or a clotting factor).

12. The DNA molecule of any of claims 1-11, wherein when the DNA molecule is introduced to a cell, the cell exhibits a lower interferon beta mRNA level compared to a control cell of the same type that was contacted with a fully double stranded DNA having the same sequence as the DNA molecule at the same molar amount as the DNA molecule.

13. The DNA molecule of any of claims 1-12, which is converted to circular double stranded DNA when the DNA molecule is introduced into a target cell.

14. The DNA molecule of any of claims 1-13, which comprises a second nucleotide having a chemically modified nucleobase, wherein the chemically modified nucleobase is situated in the first strand or the second strand.

15. A pharmaceutical composition comprising the DNA molecule of any of claims 1-14.

16. The pharmaceutical composition of claim 15, wherein the DNA molecule is comprised in a lipid nanoparticle (LNP).1601851989.1 125Attorney Docket No.: F2128-7023WO(VL87022-W1)17. The pharmaceutical composition of claim 15, which is substantially free of (e.g., is free of) LNPs.

18. A method of making a DNA molecule, the method comprising: providing a first strand of DNA, wherein the first strand is circular and is single stranded over at least 90% of its length; contacting the first strand with a second strand of DNA, wherein the second strand is linear, has a length of less than 200 nucleotides, and at least a portion of the second strand base pairs with a contiguous portion of the first strand; and covalently linking the first strand to the second strand, thereby making the DNA molecule.

19. A DNA molecule produced by the method of claim 19.

20. A method of modulating (e.g., increasing or decreasing) a biological activity in a target cell, the method comprising:(i) contacting a target cell with the DNA molecule of any of claims 1-14 or 19, or pharmaceutical composition of any of claims 15-17, wherein the first strand comprises an effector sequence that encodes an effector, and wherein the effector modulates a biological activity in the target cell; and(ii) maintaining (e.g., incubating) the cell under conditions suitable for expressing the effector from the DNA molecule; thereby modulating the biological activity in the target cell.

21. A method of treating a cell, tissue, or subject in need thereof, the method comprising: administering to the cell, tissue, or subject the DNA molecule of any of claims 1-14 or19, or the pharmaceutical composition of any of claims 15-17; thereby treating the cell, tissue, or subject.

22. A method of delivering a DNA molecule to a target cell, the method comprising:1601851989.1 126Attorney Docket No.: F2128-7023WO(VL87022-W1) contacting a target cell with the DNA molecule of any of claims 1-14 or 19, or the pharmaceutical composition of any of claims 15-17; thereby delivering the DNA molecule to the target cell.

23. A method of delivering a DNA molecule into a target cell of a tissue in a subject, the method comprising, in combination: a) administering to the subject a DNA molecule, wherein the DNA molecule comprises: a first strand of DNA, wherein the first strand is circular and is single stranded over at least 90% of its length; and b) administering to the subject a plurality of bubbles having an average diameter less than 10 pm; and c) performing ultrasound, e g., focused ultrasound (FUS), on the tissue; thereby delivering the DNA molecule into the target cell.

24. A composition comprising: a) a DNA molecule, wherein the DNA molecule comprises: a first strand of DNA, wherein the first strand is circular and is single stranded over at least 90% of its length; and b) a plurality of bubbles having an average diameter of 10 pm or less.

25. A kit comprising: a) a DNA molecule, wherein the DNA molecule comprises: a first strand of DNA, wherein the first strand is circular and is single stranded over at least 90% of its length; and b) a plurality of bubbles having an average diameter of 10 pm or less.

26. The method of claim 23, composition of claim 24, or kit of claim 25, wherein the DNA molecule further comprises: a second strand of DNA, wherein the second strand is linear, has a length of less than 200 nucleotides, and at least a portion of the second strand is complementary to a contiguous portion of the first strand; wherein the second strand is covalently linked to the first strand.1601851989.1 127

Citation Information

Patent Citations

  • Amino acid-, peptide- and polypeptide-lipids, isomers, compositions, and uses thereof

    US10086013B2

  • Lipids and lipid nanoparticle formulations for delivery of nucleic acids

    US10221127B2

  • Lipid-based formulations

    US20030077829A1

  • Polyethyleneglycol-modified lipid compounds and uses thereof

    US20050175682A1

  • Sterilization method

    US20060008378A1

Cited By

  • Therapeutic circular DNA forms

    US12685745B2